KR101916677B1 - PCR kit for quantifying Alaska pollock in seafood products and method for quantifying using the same - Google Patents

Abstract

The present invention provides a PCR kit for detection or quantification of pollack in a mixed fish meat which can quickly and accurately determine a content of pollack contained in the mixed fish meat, and a quantifying method using the same. According to one aspect of the present invention, provided is the PCR kit for quantification of Pollack in the mixed fish meat, comprising: a forward primer; a reverse primer; universal species probes; and polymorphism-specific probes.

Description

[0001] The present invention relates to a PCR kit for quantifying poliovirus in a mixed fish meat, and a method for detecting or quantifying the same.

More particularly, the present invention relates to a PCR kit for quantitative determination of pollinosis in a mixed fish meat, and a method of quantitatively using the same.

Identification of species and estimation of content are the most important factors in food safety assessment. In recent years, as the market for processed seafood has gradually expanded, it has been increasingly used for the production of Economically Motivated Adulteration (EMA), which mixes or replaces expensive raw materials intentionally with low-cost raw materials, And sales are surging. In the case of processed fish products of aquatic products, since various fish are crushed and mixed, there arises a problem that it becomes difficult for consumers to check and evaluate the ratio of the raw materials. In addition, the European Union Summit (EC) Regulation No. 104/2000 (Dec. 17, 1999) states that aquatic products can not be sold for retail purposes unless the name, production method, and place of origin are marked. Therefore, in order to ensure the safety of mixed processed foods, it is urgent to develop a reliable qualitative and quantitative detection method that requires a quality inspection system.

On the other hand, species-specific PCR primers are used to quickly and accurately identify target species in food, and quantitative real-time PCR (qRT-PCR) is used to confirm the relationship between cycle threshold and initial DNA template concentration, Is confirmed in real time. However, qRT-PCR is expensive and time-consuming to produce reference DNA for the production of standard curves for quantitative analysis, and has limited accuracy and reproducibility by indirect quantification using cycle thresholds. In addition, PCR inhibitors present in the extracted DNA have a problem that they affect the amplification efficiency and cause bias (Dingle et al., Clinical Chemistry, 59, 1670-1672 (2013)). Therefore, there is a need for an analytical method that can accurately quantify the content of target species from food.

However, in the case of the prior art described above, there is a problem in that identification and identification are expensive and time consuming, accuracy and reproducibility are reduced.

It is an object of the present invention to provide a quantitative analysis method capable of accurately and quickly detecting the content of pollack in a mixed fish meat to solve various problems including the above problems. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a nucleic acid comprising a forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1; A reverse primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2; A universal species probe comprising a nucleic acid sequence represented by SEQ ID NO: 3; And a polynucleotide-specific probe consisting of a nucleic acid sequence represented by SEQ ID NO: 4, is provided.

According to another aspect of the present invention, there is provided a method of extracting genomic DNA, comprising: a genomic DNA extraction step of extracting genomic DNA from a mixed fish; A DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1; A DNA copy number analysis step of counting the amplified DNA product; And a quantitative analysis step for estimating quantitatively a pollen from the DNA copy number is provided.

According to the embodiment of the present invention as described above, the PCR kit of the present invention is capable of quickly and accurately detecting and quantifying the content of polished rice contained in the mixed fish meat, unlike the prior art, Can be implemented. Of course, the scope of the present invention is not limited by these effects.

FIG. 1 is a diagram showing DNA sequences of 12 species for designing primers and probes. FIG.
FIG. 2 is a graph showing the correlation coefficient by analyzing the linear relationship between DNA concentration and weight of Alaska pollock and Cutlassfish.
FIG. 3 is a graph showing the correlation coefficient and the linear relationship between the target DNA copy number and DNA concentration of Alaska pollock and Cutlassfish.

Definition of Terms:

As used herein, the term "droplet digital PCR (ddPCR)" is a new concept of PCR technique in which 20 μl of PCR reaction is split into 20,000 droplets and then the target DNA is counted. And the negative is used to calculate the copy number of the target DNA through the poisson distribution. Therefore, unlike the conventional quantitative PCR, absolute quantitation is possible without a standard curve. In addition, it splits into 20,000 droplets and conducts PCR reaction. It shows sensitivity and accuracy about 1,000 times higher than conventional qPCR. It is not affected by PCR efficiency and always guarantees a constant result. The PCR proceeds in each droplet, and the amplification is confirmed using a fluorescent hydrolysis probe specific for the target species. The total number of fluorescent positive (1) or negative (0) individual droplets can be counted by the droplet reader and the absolute number of target DNA molecules can be calculated using the Poisson distribution. In addition, ddPCR is based on absolute quantification and is not influenced by amplification efficiency bias. Therefore, it is more accurate and reproducible than qRT-PCR, and accurate results can be obtained even in low concentration samples.

As used in this document, "Surimi" means that when the fish meat is roasted by adding an appropriate amount of salt (2 ~ 3%) to the fish meat, the salty proteins myosin and actomyosin proteins are eluted It is also called as a meat paste, and it is used as a raw material for fish paste.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention, there is provided a nucleic acid comprising a forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1; A reverse primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2; A universal species probe comprising a nucleic acid sequence represented by SEQ ID NO: 3; The SEQ ID NO: Pollock specific probe mix in fish roe content quantitative PCR kit for the comprising a nucleic acid sequence which is composed of a base material by 4 are provided.

According to another aspect of the present invention, there is provided a method of extracting genomic DNA, comprising: a genomic DNA extraction step of extracting genomic DNA from a mixed fish; A DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1; A DNA copy number analysis step of counting the amplified DNA product; And a quantitative analysis step for estimating quantitatively a pollen from the DNA copy number is provided.

In the quantitative method, a method for quantifying a pollen in a mixed fish meat is provided, wherein the step of analyzing the number of copies is carried out using the following equation:

DNA concentration = 36.14 x sample weight - 30.85 (Equation 1)

DNA copy number = 0.237 x DNA concentration + 3.34 (formula 2)

(수식 3)Pollack content =

(Equation 3)

In the above quantitative method, genomic DNA can be amplified by droplet digital PCR.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Sample preparation

We purchased the full range of Alaska pollock (pollack), cutlassfish (grits) and 15 commercially available fish paste products in the local market. Each sample was minced into small pieces and dried in a 65 ° C dryer for 24 hours Lt; / RTI > The dried sample was evenly pulverized using liquid nitrogen and mortar and pestle. The Alaska pollock and cutlassfish were then blended with a known composition (8: 2, 6: 1) to verify the accuracy and sensitivity of the method. : 4, 4: 6, 2: 8). Information on the purchased fish paste is shown in Table 1 below.

Sample Suri Country of Origin Water content Species marked on the product A Imported - - B Imported - - C America 82.76% Alaska pollock D America 71.56% Alaska pollock E Imported 70.67% - F Imported 64.62% White flesh fish G Imported 54.89% Croaker H Imported - - I Vietnam 57.67% White flesh fish J Imported 61.13% Golden-thread, cutlassfish and croaker K America 30.70% - L America - Alaska pollock M Korea - - N Imported - - O Imported 68.97% -

Example 2: Preparation of primers and probes

For design of primers and probes, the mitochondrial 16S rRNA region was selected as the target detection sequence and Oligomers was selected based on the alignment of the 16S rRNA sequence in the NCBI database (http://www.ncbi.nlm.nih.gov) Were designed from a conserved sequence. The main raw material species of the surimi product Genomic sequences G. chalcogrammus (NC004449), Larimichthys polyactis (GU586227), Trichiurus lepturus (NC018791), T. japonicus (EU339148), Nemipterus japonicus (NC023972), N. virgatus (KU933270), N . bathybius (NC029938), Decapterus macarellus (NC026718), D. maruadsi (NC024556), D. macrosoma (NC023458), trachurus trachurus (AB108498), and T. japonicus of the present invention has attained the (AP003092) from NCBI database primers and (Fig. 1).

To identify conserved regions, the frequency of nucleotides at each location was measured using a custom script from CLC Genomics Workbench 8.0.1 (CLC bio, Aarhus, Denmark). For the oligomer design, the sequence of the conserved region with 100% sequence identity was used and a forward primer (SEQ ID NO: 1) and a reverse primer (SEQ ID NO: 2) were designed which can specifically bind to all species. In addition, a universal species probe specific for all species (All-P, SEQ ID NO: 3) was specific to the conserved region and Alaska Pollock probe (Gad-P, SEQ ID NO: 4) targeted the species-specific sequence. The universal probes were labeled with 6-carboxyfluorescein (FAM) and black-hole quencher (BHQ1), and Alaska pollock probes were labeled with hexachlor-6-carboxyfluor escein (HEX) and BHQ1.

PCR analysis showed that the primers did not induce nonspecific amplification and that the universal species probes were in perfect agreement with all species. On the other hand, Alaska pollock-specific probes were perfectly matched in G. chalcogrammus and were not consistent with other species. Information on the designed primers and probes is shown in Table 2 below.

Oligo ID Sequences (5 '-> 3') target SEQ ID NO: Forward GTACCTTTTGCATCATGATT 16S rRNA
One Reverse TGGCTGCTTTTARGCCCA 2 All-P FAM-GCAAAAGAGTGGGAAGA-BHQ1 Entire species 3 Gad-P HEX-TCACCCATGCTTACGCTAAA-BHQ1 Alaska pollock 4

Example 3 DNA Extraction and Extraction Efficiency

Genomic DNA was purified from 5 mg powder samples using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. The final volume of the DNA solution was 100 μl.

Example 4: Droplet digital PCR (ddPCR)

Each 20 μl PCR reaction mixture contained 10 μl ddPCR master mix (Bio-Rad, Hercules, CA, USA), 900 nM each primer, 125 nM each probe, 2 μl genomic DNA and distilled water to a volume of 20 μl Alaska pollock samples were 11.3-225.8 ng, and cutlassfish samples were 13.3-72.3 ng). The DNA concentration for analysis was determined by the detection limit of the ddPCR device and the DNA was diluted to 1/100 and used for analysis. The 20 [mu] l PCR mixture was then divided into 15,000 to 20,000 droplets using a Bio-Rad QX100 droplet generator. PCR amplification was denatured at 95 ° C for 10 minutes using a Tetrad thermal cycler (Bio-Rad, Hercules, CA, USA), denatured at 95 ° C for 30 seconds, annealed at 60 ° C for 90 seconds, The enzyme was inactivated for 10 minutes at < RTI ID = 0.0 > 0 C < / RTI > After PCR amplification, TaqMan fluorescence was detected using a droplet reader and each analysis data was obtained three times per sample.

1 to 7 mg of powder samples were weighed using an electronic balance (Sartorius CPA225D, Germany) to verify the correlation between sample and DNA concentrations, and genomic DNA extracted using a NanoVue spectrophotometer (GE Healthcare, Uppsala, Sweden) Respectively. Subsequently, the number of copies of the genomic DNA was analyzed using ddPCR, and the correlation coefficient between the sample weight, DNA concentration and DNA copy number was calculated using Microsoft Excel 2016 (Microsoft Corp., Redmond, WA, USA).

As a result, the extracted concentration showed a linear relationship with the sample weight, correlation coefficients ( R ² ) of Alaska pollock was 0.997, and cutlassfish was 0.998 (FIG. 2). In addition, the correlation coefficient between DNA concentration and Alaska pollock or cutlassfish DNA copy number was 0.998 and 0.997 on the FAM channel and 0.997 and 0 on the HEX channel (Fig. 3). Finally, the measurement of the content (g) of pollack was determined through the formula of polite item below.

DNA concentration = 36.14 x sample weight - 30.85 (Equation 1)

DNA copy number = 0.237 x DNA concentration + 3.34 (formula 2)

(수식 3).Pollack content =

(Equation 3).

The results of the quantitative analysis of the standard sample are shown in Table 3 below.

Sample
Sample weight (mg)
DNA concentration (ng)
Copy number Alaska pollock Entire species Alaska pollock
( G. chalcogrammus )





  One 11.3 4.1 4.3   2 30.2 11.3 11.7   3 78.2 22.7 22.3   4 118.8 31.5 30.5   5 156.7 42.2 42.1   6 175.0 45.1 45.9   7 225.8 55.2 56.6 Cutlassfish
( T. lepturus )





  One 13.3 0.1 1.9   2 19.5 0.0 4.1   3 26.8 0.0 8.3   4 42.0 0.1 12.8   5 48.7 0.1 17.9   6 62.2 0.0 23.1   7 72.3 0.0 27.8

Example 5: Analysis of mixed samples

To demonstrate the accuracy and applicability of the present invention, the ddPCR method was applied to four mixed samples of known composition. DNA was extracted 3 times from a 5 mg sample using the same method as above.

As a result, as shown in Table 4 below, the concentration of the mixed samples did not differ from the sum of the standard DNA concentrations, and the ratio of the total DNA to the Alaska pollock DNA copy number was similar to the mixing ratio.

Sample
Mixing ratio
DNA concentration (ng)
Copy number
Weighing Deviation
Alaska pollock Cutlassfish Alaska pollock Entire species Alaska pollock One 4 mg 1 mg 143.0 31.0 34.9 4.08 mg 2.0% 2 3 mg 2 mg 102.8 23.5 27.7 3.21 mg 7.0% 3 2 mg 3 mg 57.2 9.6 21.6 1.58 mg -21.0% 4 1 mg 4 mg 52.7 4.4 16.3 0.98 mg 2.0%

Example 6: Commercial fish cake product analysis

Using the ddPCR of the present invention, the Alaska pollock content of 15 commercially available fish paste products was measured. The content of Alaska pollock was determined by comparison with the number of DNA copies containing reference data.

As a result, as shown in Table 5, the Alaska pollock content in 9 samples was 0.79 - 2.87 mg / 5 mg.

Sample
DNA concentration (ng)
Copy number Weighing Alaska pollock Entire species Alaska pollock A 3.5 0.0 0.0 B 9.5 0.7 0.0 C 78.0 20.6 22.0 2.87 mg D 63.2 15.9 14.9 2.32 mg E 35.5 8.5 12.7 1.46 mg F 4.9 0.7 2.9 G 11.2 0.9 2.7 H 12.2 0.5 2.6 I 21.7 0.0 5.4 J 30.0 6.7 11.6 1.25 mg K 16.1 9.1 10.1 1.53 mg L 17.3 5.4 12.5 1.09 mg M 16.6 7.8 10.5 1.37 mg N 24.7 10.4 12.0 1.68 mg O 25.8 2.8 11.6 0.79 mg

As a result, the quantitative analysis method of Alaska pollock contained in the mixed fish meat using the droplet digital PCR of the present invention can accurately and quickly detect the content of pollack contained in the mixed fish meat, And forensic science.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> Republic of Korea represented by National Fisheries Research & Development Institute <120> PCR kit for quantifying Alaska pollock in seafood products and          method for quantifying using the same <130> PD17-5537 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward <400> 1 gtaccttttg catcatgatt 20 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse <400> 2 tggctgcttt targccca 18 <210> 3 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> All-P <400> 3 gcaaaagagt gggaaga 17 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Gad-P <400> 4 tcacccatgc ttacgctaaa 20

Claims (4)

A forward primer consisting of a nucleic acid sequence represented by SEQ ID NO: 1;
A reverse primer consisting of a nucleic acid sequence represented by SEQ ID NO: 2;
A universal species probe comprising a nucleic acid sequence represented by SEQ ID NO: 3; And
A PCR kit for quantifying the content of pollen in a mixed fish meat comprising a pollen-specific probe comprising a nucleic acid sequence represented by SEQ ID NO: 4. A genomic DNA extraction step of extracting genomic DNA from mixed fish;
A DNA amplification step of amplifying the genomic DNA extracted by the PCR kit of claim 1;
A DNA copy number analysis step of counting the number of copies of the amplified DNA product using the following equation;
DNA concentration = 36.14 x sample weight - 30.85 (Equation 1)
DNA copy number = 0.237 x DNA concentration + 3.34 (formula 2)
Pollack content =

(Equation 3)
And
And a quantitative analysis step for estimating the quantity of pollen from the DNA copy number. delete 3. The method of claim 2,
Quantification of the content of pollack in mixed fish meat by amplification of genomic DNA by droplet digital PCR.

Images