KR101886788B1 - Method for screening Duchenne Muscular Dystrophy agents comprising detecting interactions of MG53 and Orai1 - Google Patents

Abstract

The present invention relates to a method for screening a substance which inhibits binding between Orai1 and MG53. According to the method of the present invention, it is possible to screen out the substance inhibiting the binding between Orai1 and MG53, and the screened candidate substance suppresses activities of store-operated calcium influx by Orai1, thereby enabling establishment of a screening system to find out therapeutic agents for various muscle disorders including Duchenne muscular dystrophy which is associated with weakening or a decrease in an amount of skeletal muscles due to the excessive store-operated calcium influx. Thus, the method can be widely applied to pharmaceutical industries.

Description

[0001] The present invention relates to a method for screening for a therapeutic agent for a dysgenetic skeletal muscle atrophy using MG53 and Orai1,

The present invention relates to a method of screening for a therapeutic agent for Duchenne skeletal muscle atrophy, comprising determining whether binding of MG53 and Orai1 is inhibited.

Duchenne Muscular Dystrophy is a common genetic neuromuscular disease associated with deterioration of muscle function progression, first described by the French neurologist Duchenne de Boulogne about 150 years ago, It is named after his name. Duchenne skeletal muscle atrophy is characterized by an X-linked febrile disorder that affects one out of 3,500 men, caused by a mutation in the dystrophin gene. This gene is the largest of the human genome, containing 2.6 million base pairs of DNA and containing 79 exons. About 60% of dystrophin mutations are large insertions or deletions resulting in frame shift error downstream, and about 40% are point mutations or small frame shift rearrangements. In the case of skeletal muscle cells derived from Duchenne skeletal muscle atrophy patients, the store-operated Ca ²⁺ -entry (SOCE) is greatly increased, and this excessive store-working calcium influx is associated with recurrent skeletal muscle It is well known as another cause of abnormal skeletal muscle contraction in patients.

Many of the patients with Duchenne skeletal muscle atrophy are deficient in dystrophin protein. Becker muscular dystrophy is a milder form of duchenne skeletal muscle atrophy, caused by a decrease in the amount of dystrophin protein or a change in size. Because of the high incidence of duodenal skeletal muscle atrophy (1 per 10,000 sperm or oocytes), genetic screening will never eliminate this disease, and effective treatment is highly desired.

On the other hand, Mitsugumin 53 (MG53) is a specific protein expressed only in the skeletal muscle, heart, lung and kidney. It has a tripartite motif (TRIM) domain, Domain, and SPRY domain. At present, it is known that intracellular function of MG53 participates in membrane repair system during cell membrane injury. When cell membrane damage occurs, the cytoplasmic vesicles move to the damaged site and resealing the damaged cell membrane quickly, restoring the membrane damage site. In this process, the MG53-coated vesicles are attached to the vesicular membrane and the disulfide bond between the MG53s that bind to the cystic membrane during the migration of the capsules to the cell membrane- It plays an important role. Proteins such as dysferrin, polymerase I and transcript release factor, and non-muscle myosin type IIA interact with MG53 in these membrane repair mechanisms .

However, although MG53 is well known to be abundantly expressed in skeletal muscle, the influence of MG53 on shrinkage and relaxation, which is a unique function of skeletal muscle, has not been clearly elucidated. In particular, MG53 and Orai1 Is not known at all.

Accordingly, the present inventors confirmed that MG53 binds to Orai1 and activates a storage-working calcium inflow through Orai1, while performing the influence of MG53 on skeletal muscle inherent functions. Therefore, excessive storage-working calcium influx through Orai1 is caused by the combination of MG53 and Orai1. By confirming a method for screening a therapeutic agent for Duchenne skeletal muscle atrophy using the combination of MG53 and Orai1, Completed.

Korean Patent Publication No. 10-2015-0109386 Korean Patent Publication No. 10-2010-0075777

It is an object of the present invention to provide a method of treating MG53 (mitsugumin 53) and Orai1 by administering a candidate compound to cells and determining whether the binding of MG53 and Orai1 is inhibited in the cell, Dystrophy) therapeutic agent.

The present inventors confirmed that MG53 binds to Orai1 and excessively activates the reservoir-working calcium influx while performing the effect of MG53 on skeletal muscle-specific function. Therefore, by using the combination of MG53 and Orai1, the possibility of screening for a therapeutic agent for muscular diseases including dysthymia skeletal muscle atrophy associated with skeletal muscle weakening or reduction, which inhibits storage-working calcium inflow through Orai1, .

In the present invention, co-immunoprecipitation was performed using anti-MG53 or anti-Orai1 in a triad sample obtained from rabbit skeletal muscle, and the amount of MG53 protein precipitated with Orai1 was significantly increased when Orai1 antibody was present Respectively. In addition, it was confirmed that the amount of Orai1 protein precipitated with MG53 was significantly increased when MG53 antibody was present. Therefore, it was confirmed that Oari1 binds to MG53.

Accordingly, the present invention relates to a method of treating a candidate compound in a cell expressing MG53 (mitsugumin 53) and Orai1, and determining whether or not the binding of MG53 and Orai1 is inhibited in the cell, wherein Duchenne Muscular Dystrophy ) ≪ / RTI >

In a preferred embodiment for this, the present invention comprises (a) treating a cell expressing MG53 (mitsugumin 53) and Orai1 with a candidate compound, and (b) determining whether the binding of MG53 and Orai1 is inhibited in the cell (Duchenne Muscular Dystrophy), which comprises administering a therapeutically effective amount of a Duchenne Muscular Dystrophy.

In yet another preferred embodiment, the present invention provides a method of treating a candidate compound, comprising: (a ') treating a candidate compound to a mixture of isolated MG53 and isolated Orai1; and (b') determining whether binding of MG53 and Orai1 is inhibited. The present invention relates to a method for screening a drug for treating skeletal muscle atrophy.

Hereinafter, the configuration of the present invention will be described in detail.

In the present invention, the term " MG53 (mitsugumin 53) " is a protein expressed in the skeletal muscle and the myocardium, and consists of the TRIM domain, the PRY domain and the SPRY domain. The TRIM domain is again composed of the Ring domain, the B-box, and the coil-coil domain. The nucleotide sequence of the mouse MG53 gene and the amino acid sequence of the protein can be obtained from NCBI Registration Nos. NM_001079932 (NM_001079932.3) and NP_001073401 (NP_001073401.1), and the amino acid sequence of the MG53 protein of the mouse is shown in SEQ ID NO: 1. The nucleotide sequence of the human MG53 gene and the amino acid sequence of the protein can be obtained from NCBI Registration Nos. NM_001008274 (NM_001008274.3) and NP_001008275 (NP_001008275.2), and the amino acid sequence of the human MG53 protein is represented by SEQ ID NO: 2. However, the above sequence is only a representative example. The MG53 protein referred to in the present invention is not limited to the protein of the above sequence, but subtypes, analogues, variants or fragments having an activity equivalent to MG53 are included in the scope of the present invention. may be included in the scope of the present invention regardless of species.

The term in the invention, "Orai1" storage is a more selective ion channels for calcium and plasma membrane protein of approximately 33kDa - a key protein of operation calcium influx ^{(store-operated Ca 2 + -entry} , SOCE). The gene and protein information is registered in the National Center for Biotechnology Information (NCBI) (NM_032790.3, NP_116179.2).

Orai1 is a kind of calcium channel present in the cell membrane. When the amount of calcium stored in the sarcoplasmic reticulum is reduced by various cell phenomena, the STIM1 (stromal interation molecule 1, steam) protein This is detected. As a result, STIM1 binds to Orai1 in cell membranes near myocytes and activates Orai1. Finally, calcium present outside the cell is introduced into the cell through Orai1.

As used herein, the term "store-operated calcium influx ^{(store-operated Ca 2 + -entry} ) or" SOCE "is intracellular stores, i.e., near the cytoplasmic reticulum (sarcoplasmic reticulum) or cytosolic calcium ions from the reticulum (endoplasmic reticulum) The release of calcium into the cytoplasm and the depletion of calcium in the cytoplasmic reticulum or cytoplasmic reticulum is a signal that the external calcium ions flow into the cytoplasm across the plasma membrane. The decrease in calcium concentration in the intracellular calcium reservoir, such as cytoplasmic reticulum, provides a signal for calcium to flow from the outside of the cell into the cell body (i. E., Cytoplasm), where Stim1 protein acts as a calcium sensor in the reservoir, The calcium channel, which acts as a pathway for external calcium in the membrane, is known as Orai1. The interaction of Orai1 calcium channels and Stim1 is known to be essential for the reservoir-working calcium influx. In conventional studies, Orai1 significantly reduced intracellular store-working calcium influx when Orai1 alone was overexpressed, (Soboloff et al., J. Biol. Chem. Vol. 281, no. 30, 20661-20665, 2006). It has also been reported that Orai1 does not affect intracellular store-working calcium influx if Orai1 is overexpressed alone (Liao et al., PNAS, Vol. 104, no. 11, 4682-4687, 2007). Calcium introduced into cells from outside the cell via store-operated calcium infiltration is known to participate in the contraction of the skeletal muscle (control of the strength of contraction) and not at the onset of skeletal muscle contraction.

The measurement of the storage-working calcium influx in the present invention can be carried out through various methods known in the art, for example, by measurement of the ionic current or by fluorescence image analysis.

The method of measuring the storage-working calcium influx through fluorescence image analysis is a method of injecting a calcium detection reagent into a cell, treating the calcium removal reagent so that the calcium level in the intracellular calcium reservoir (myocyte reticulum or cytoplasmic reticulum) is reduced, And to analyze the degree of intracellular inflow of calcium by fluorescence image by treating calcium ion externally. The calcium detection reagent may include a calcium removal reagent in the reservoir and calcium. Examples of the calcium detection reagent include calcium fluorochromes which bind to calcium at a different wavelength than that before binding calcium. Examples of the calcium fluorochrome dye include fura-2, indo-1, fulo-4, calcein, rhod- rhod-4 and derivatives thereof, but are not limited thereto. The calcium-scavenging reagent in the reservoir can be, but is not limited to, thapsigargin, cyclopiazonic acid, ryanodine (high concentration), and the like.

In order to investigate the effect of MG53 on the intrinsic function of skeletal muscle, the present inventors prepared and purified GST-binding protein for each domain of MG53 in E. coli (GST-TRIM, GST-PRY, GST (Triad sample containing Orai1), which specifies proteins involved in the contraction and relaxation of skeletal muscle, such as -SPRY, GST-PRY-SPRY, GST-MG53 The MGRY domain binding to Orai1 was found by performing immunoadhesion using Orai1 antibody and GST antibody. The PRY domain, the SPRY domain except the TRIM domain, the full-length MG53 Considering that all bind to Orai1, it was confirmed that the PRY-SPRY domain of MG53 binds to Orai1.

The present inventors have found that MG53 is based on the results combined with Orai1, store, due to the MG53-Orai1 combined - to ensure that changes in calcium influx operation ^{(store-operated Ca 2 + -entry} , SOCE), Battlefield MG53 or PRY- Expression of full-length MG53 or PRY-SPRY domain was confirmed by immunocytochemistry in SPRY domain-expressing myotube cells (myotube). As a result, it was confirmed that the storage-working calcium influx was increased in the differentiated skeletal muscle cells expressing the PRY-SPRY domain of MG53, which functions as a binding site for Orai1 as well as full-length MG53, compared with the control. These results indicate that MG53 binds to Orai1 via PRY-SPRY and increases the activity of Orai1, which means that the store-working calcium influx is increased excessively.

Therefore, the possibility of screening for a therapeutic agent for Duchenne Muscular Dystrophy associated with weakening or reducing skeletal muscle using the combination of MG53 and Orai1 was confirmed.

Accordingly, the present invention provides a method of screening for a therapeutic agent for Duchenne Muscular Dystrophy associated with an increase in excessive reservoir-working calcium influx, comprising determining a substance that inhibits the binding of MG53 and Orai1.

For example, the screening method

(a) treating candidate compounds with cells expressing MG53 (mitsugumin 53) and Orai1,

(b) determining whether the binding of MG53 and Orai1 in said cells is inhibited. < Desc / Clms Page number 3 >

In another example, the screening method

(a ') treating the candidate compound with a mixture of isolated MG53 and isolated Orai1,

(b ') determining whether binding of MG53 and Orai1 is inhibited. < Desc / Clms Page number 3 >

The screening method of the present invention comprises treating a candidate compound with MG53 and Orai1 wherein the candidate compound is treated with a cell expressing MG53 and Orai1 or a candidate compound is administered directly to a mixture of isolated MG53 and isolated Orai1 Can be processed.

The term " candidate compound " in the present invention means a candidate substance expected to inhibit the binding of MG53 and Orai1. Such candidate substances may include not only a single compound such as an organic or inorganic compound but also a complex of a protein, a carbohydrate, a nucleic acid molecule (RNA, DNA, etc.) and a polymer compound such as lipid and a plurality of compounds.

In the present invention, the term " treatment " refers not only to a candidate compound directly contacting one or more of MG53 and Orai1, but also to the fact that a substance affects the cell membrane and a signal generated from the cell membrane contacts one or more of MG53 and Orai1 Or even if it affects them. Thus, in the present invention, the candidate compound includes not only substances that are permeable to cell membranes but also substances that are impermeable to cell membranes. At this time, the candidate compound is treated within an effective amount range. The term " effective amount " means an amount sufficient to induce the reaction. Since the accurate result can not be obtained at an effective amount or less, it is preferable to measure the inhibitory ability within an effective amount range.

When the candidate compound is treated to cells expressing MG53 and Orai1, the present invention relates to a method of treating a cell expressing MG53 and Orai1, wherein the candidate compound is treated with (b) whether the binding of MG53 and Orai1 is inhibited in the cell And a method of screening for a therapeutic agent for Duchenne skeletal muscle atrophy, comprising

The cells expressing MG53 and Orai1 are originally cells containing MG53 or intentionally contained different promoters for MG53 and Orai1 in one vector for the case of expressing MG53 and Orai1, Or may be prepared by co-transfecting a vector expressing MG53 and a vector expressing Orai1.

The cells include all cells of animal origin such as human or cattle, goats, pigs, rats, rabbits, hamsters, stomachs, guinea pigs, etc. Primary cells, secondary cells, immortalized cells and the like can be used. Alternatively, cells can be used to stably or transiently overexpress MG53 and / or Orai1 in a cell using a recombinant vector comprising MG53 and / or Orai1 gene.

Further, the detection of the substance which inhibits the binding of MG53 and Orai1 can be carried out in vivo using laboratory animals such as mice, rabbits, hamsters, stomachs, guinea pigs as well as cell levels.

In the above (b) of the present invention, whether or not the binding of MG53 and Orai1 is inhibited can be confirmed by applying techniques commonly used in the art in order to confirm whether there is a reaction between protein-protein or protein-compound. For example, immunological assays, fluorescence assays, yeast two-hybrid, high throughput screening (HTS) using natural and chemical libraries, detection of phage display peptide clones binding to MG53 or Orai1, And a screening method using a drug-hitting HTS or cell-based screening, but the present invention is not limited thereto.

In one preferred embodiment, an antibody specific for MG53 or Orai1 can be used to detect whether the binding of MG53 and Orai1 is inhibited. For example, the amount of the formed antigen-antibody complex formed can be compared with the amount of the antigen-antibody complex formed in the control group not treated with the candidate substance to determine the inhibition. Absolute or relative differences in the amount of antigen-antibody complex formation can be ascertained by molecular biology or histological analysis including, but not limited to, immunostaining, immunoprecipitation and immunostaining.

In the detection method using the antigen-antibody reaction, the formation amount of the antigen-antibody complex can be quantitatively measured through the signal label of the detection label. In the present invention, the term "detection label" is to be detected by means of spectroscopic, photochemical, biochemical, immunochemical, chemical or other physicochemical means ≪ / RTI > Such detection labels include, but are not limited to, enzymes, minerals, ligands, luminescent materials, microparticles, redox molecules, and radioactive isotopes.

In another preferred embodiment, it is possible to detect whether the binding of MG53 and Orai1 is inhibited by the signal magnitude of the reporter protein after ligating the MG53 or Orai1 with the respective reporter protein, respectively.

The reporter protein may be a luciferase, a chloramphenicol acetyltransferase, a beta-glucuronidase, a beta-galactosidase, an alkaline phosphatase, or a fluorescent protein, wherein the fluorescent protein is a green fluorescent a fluorescent protein, a red fluorescent protein, a blue fluorescent protein, a yellow fluorescent protein, a cyan fluorescent protein, an enhanced green fluorescent protein, , An enhanced red fluorescent protein, an enhanced blue fluorescent protein, an enhanced yellow fluorescent protein, or an enhanced blue fluorescent protein.

In order to express the reporter protein in a form associated with MG53 and Orai1, a gene encoding MG53 and an expression vector in which a reporter gene is operably linked, and a gene encoding Orai1 and an expression vector in which a reporter gene is operably linked, Lt; / RTI >

When the reporter protein is a fluorescent protein, it can be confirmed whether the binding of MG53 and Orai1 is inhibited by measuring the fluorescence intensity of the reporter protein using a fluorescence microscope. In the case of using a luminescence enzyme such as luciferase as a reporter protein, It is possible to confirm whether the binding of MG53 and Orai1 is inhibited by the lager activity assay or luciferase luminescence. In addition, an enzyme capable of converting a substrate into a coloring product capable of emitting detectable light such as chloramphenicol acetyltransferase, beta-glucuronidase, beta-galactosidase, alkaline phosphatase and the like is used as the reporter protein It is possible to confirm whether the binding of MG53 and Orai1 is inhibited by an optical signal obtained by an enzyme reaction using a chromogenic substrate.

On the other hand, when the candidate compound is treated to a mixture of isolated MG53 and isolated Orai1, the present invention provides a method of treating a candidate compound in a mixture of (a ') isolated MG53 and isolated Orai1, (b') treating MG53 and Orai1 Lt; RTI ID = 0.0 > Duchenne < / RTI > skeletal muscle atrophy, comprising determining whether binding is inhibited.

In the present invention, the term "isolated" means a protein expressed and isolated in a cell, and is separable by applying common separation techniques known in the art. A method for separating and purifying a protein expressed in a cell is not particularly limited. Isolated MG53 and isolated Orai1 can react directly with the candidate compound in vitro, not in the cell.

The method of confirming whether or not the binding of MG53 and Orai1 is inhibited is as described above.

Agents which inhibit the binding of MG53 and Orai1 obtained by the screening method of the present invention can be used as a therapeutic agent for duchenne skeletal muscle atrophy by reducing the activity of excessive storage-working calcium influx through Orai1.

Advantages and features of the present invention and methods of achieving them will become apparent with reference to the embodiments described in detail below. The present invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of the invention to those skilled in the art. To fully disclose the scope of the invention to a person skilled in the art, and the invention is only defined by the scope of the claims.

According to the method of the present invention, a substance capable of inhibiting the binding of MG53 to Orai1 can be screened, and the screened candidate substance inhibits the activity of excessive storage-working calcium influx through Orai1, The present invention provides a screening system capable of finding a therapeutic agent for various muscular diseases including Duchenne Muscular Dystrophy and thus can be widely applied to the pharmaceutical industry.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a photograph and a graph of a result of co-immunoprecipitation for confirming the binding between MG53 and Orai1. FIG. FIG. 1A is a photograph and a graph showing a result of confirming the co-immunoprecipitation according to the presence or absence of the Orai1 antibody, and FIG. 1B is a photograph and a graph showing a result of confirming co-immunoprecipitation according to the presence or absence of the MG53 antibody (mark in the figure: * - ( P <0.05). Immunostimulation The black stars in the results are of no light scientific significance as the light chain of antibodies recognized by the cross-reactivity of the antibodies.
2A is a schematic for the MG53 and MG53 domains.
Fig. 2b is a photograph showing GST-linked MG53 fragment proteins stained with Coomassie Brilliant Blue expressed in E. coli and separated on a 10% SDS-PAGE gel (marked with white).
FIG. 2c shows the results of a binding assay of GST-linked MG53 scaffold proteins (GST-fused MG53 domains) and a triad sample (Orai1-containing triad sample) in a 10% SDS-PAGE gel The immunoadhesion method using Orai1 antibody and GST antibody was performed to find the MG53 domain binding to Orai1, and the result is indicated by the bar graph on the right side.
FIG. 3A shows the results of immunohistochemical analysis of expression of full-length MG53 or PRY-SPRY domain in differentiation skeletal muscle cells (myotube) expressing full length MG53 or PRY-SPRY domain 50 [mu] m).
Figure 3b shows the results of performing calcium mobilization measurements in a single cell to measure changes in reservoir-working calcium influx (*, normalize the result when only the vector exists and use it as a control) (P <0.05), respectively.

Hereinafter, the present invention will be described in detail with reference to examples. The following examples illustrate the present invention, but the scope of the present invention is not limited to the following examples.

Experimental Method

Example  One. GST - cDNA production and expression in proteins for the bound MG53 proteins

PCR was performed using the mouse primers MG53 cDNA (GenBank accession number: NM_001079932) as a template and the PCR primers shown in Table 1. The obtained PCR product was inserted into pGEX-4T-1 using restriction enzymes Sal and NotI, and the nucleotide sequence was confirmed again by protein digestion. Escherichia coli (E. coli DH5α) GST-PRY, GST-PRRY, GST-PRY-SPRY and GST-MG53 proteins were obtained by purification using GST beads.

Name Sequence No. PCR  primer GST -TRIM One Forward 5 '- GCGTCGACTCATGTCGGCTGCACCCGG -3' 2 Reverse 5'-TAAAGCGGCCGCTCACAGAGCCCGGAACATC -3 ' GST -PRY
3 Forward 5 '- GCGTCGACCTATGCCAGCGCTGGAGGAAC -3' 4 Reverse 5'-TAAAGCGGCCGCTCACTGTGACAGCAGCTGCTG -3 ' GST -SPRY
5 Forward 5 '- GCGTCGACTCATGGGCGAGCACTATTGGGAG -3' 6 Reverse 5 '- TAAAGCGGCCGCTCAGGCCTGTTCCTGCTCC -3' GST -PRY-SPRY
7 Forward 5 '- GCGTCGACCTATGCCAGCGCTGGAGGAAC -3' 8 Reverse 5 '- TAAAGCGGCCGCTCAGGCCTGTTCCTGCTCC -3' GST -MG53
9 Forward 5 '- GCGTCGACTCATGTCGGCTGCACCCGG -3' 10 Reverse 5 '- TAAAGCGGCCGCTCAGGCCTGTTCCTGCTCC -3'

Example  2. Triad  Sample preparation GST - Binding reaction with bound MG53 proteins

Triad vesicles were obtained from rabbit fast-twitch skeletal muscle (back and leg) and lysates (1% Triton X-100, 10 mM Tris-HCl, 1 mM Na ₃ VO ₄ , 10% glycerol, 150 mM NaCl, 5 mM EDTA, a protease inhibitor cocktail, and pH 7.4) to obtain a triad sample by solubilization at 4 ° C for 4 hours. GST-conjugated MG53 proteins were attached to the GST beads, and then triad samples (150 μg) were mixed and the binding reaction was carried out at 4 ° C for 8 hours. Proteins attached to the beads were separated on an SDS-PAGE gel and subjected to Coomassie Brilliant Blue staining.

Example  3. Isolation of skeletal muscle satellite cells Differentiation skeletal muscle cell  ( myotube ) Judo

Skeletal muscle satellite cells were isolated from mouse skeletal muscle and primary myoblast cells were obtained by primary culture. The cultured cells were treated with F10 Nutrient Mixture (20% FBS, 100 units / ml penicillin, 100 μg / ml streptomycin, 2 mM L-glutamine and 20 nM basic fibroblast growth factor) % CO2 incubator. The culture dishes used were 10-cm or 96-well dishes depending on the application, and all dishes were coated with Matrigel. When the skeletal muscle cells were proliferated to the extent that they accounted for about 70% of the culture dish, they were induced into differentiation skeletal muscle cells (cell differentiation composition: 5% heat-inactivated horse instead of 20% FBS and F-10 Nutrient Mixture in cell culture serum and low-glucose DMEM, bFGF not added, 18% CO2 incubator). Differentiated cells were designated as myotube, and images of differentiated skeletal muscle cells (myotube) were obtained using optical microscope and membrane morphology was compared and observed.

Example  4. Co-immunoprecipitation (Co- immunoprecipitation )

A solubilized triad vesicle sample obtained by dissolving a triad vesicle obtained from a rabbit fast-twitch skeletal muscle (back and leg) and an anti-MG53 or anti-Orai1 antibody (10 (co-immunoprecipitation) was carried out using the anti-MG53, anti-STIM1 or anti-Orai1 immunoblot assay.

Example  5. Immunomodulator test  ( Immunoblot  assay)

Myotubes were lysed in lysis buffer (1% Triton X-100, 10 mM Tris-HCl (pH 7.4), 1 mM Na ₃ VO ₄ , 10% glycerol, 150 mM NaCl, 5 mM EDTA, protease inhibitors (1 μM pepstatin, 1 μM leupeptin, 1 mM phenylmethylsulfonyl fluoride, 20 mg / ml aprotinin, 1 μM trypsin inhibitor) were solubilized at 4 ° C for 24 hours. At this time, in a 10-cm culture dish, 300 μl of the dissolution solution was treated with differentiated skeletal muscle cells (myotube). After dissociating the soluble cell solution into SDS-PAGE gel, the primary antibody (primary antibody: anti-MG53 antibody, anti-Orai1 antibody, anti-STIM1 antibody, anti-GFP antibody, anti-GST antibody) (Secondary antibody: anti-mouse antibody, anti-rabbit antibody) was used for immunoblot assay.

Example  6. Differentiation skeletal muscle cell  ( myotube ) To full-length MG53 or PRY-SPRY domain expression (cDNA transfection  and expression)

CDNA transfection for 4 hours in the skeletal muscle immature myotubes (3 days after the induction of differentiation of cDNA for the full length MG53 or PRY-SPRY domain), each cDNA being in the form of a pGFP vector For example, 30 μl of FuGENE 6, 20 μg of cDNA were treated in the case of cultured cells in a 10-cm culture dish). The cells transfected with the cDNA induce further differentiation for 36 hours, and these cells are myotubes differentiated from each other expressing full-length MG53 or PRY-SPRY domain. It was used in various experiments.

Example  7. Storage-Operational Calcium Migration Measurements by Calcium Movement Measurements in Single Cells

When combined with calcium before and calcium binding, while maintaining 45 minutes 37 ° C for a by preparing a calcium fluorescent dye that the fluorescence of different wavelengths fluo-4 (5 μM) a (Ca ^{2 +} dye) skeletal muscle cell differentiation And incubated. The differentiated skeletal muscle cells were cultured in imaging solution (125 mM NaCl, 5 mM KCl, 2 mM KH ₂ PO ₄ , 2 mM CaCl ₂ , 25 mM HEPES, 6 mM glucose, 1.2 mM MgSO ₄ , 0.05% BSA 7.4) has been processed. Fluorescence microscopy (Nikon x40 oil-immersion objective, NA 1.30, ECLIPSE Ti, Nikon) was used to measure intracellular calcium mobilization. Fluorescence changes of calcium fluorescent dye were transferred to a computer using a 75-watt Xenon lamp (FSM150Xe, Bentham Instruments, Ltd) connected to a fluorescence microscope and a 12-bit CCD camera (DVC-340M-OO-CL, Digital Video Camera Company) And analyzed using InCyt Im1 image acquisition and analysis software (v5.29, Intracellular Imaging Inc). For storage-working calcium mobilization experiments, the calcium-free imaging solution in the absence of calcium was treated with cyclopiazonic acid (CPA) for 5 minutes before inducing the depletion of calcium in the myoclonical reticulum, The normal imaging solution was then reprocessed into the cells to measure the migration of calcium into the interior from the outside of the cell, i. E., The reservoir-working calcium influx. CPA was dissolved in Me ₂ SO (<0.05%) and manually treated with cells, indicating no change in cellular calcium migration by Me ₂ SO (<0.05%) itself. The results of CPA treatment and storage - working calcium influx measurement, which have relatively long measurement time (more than 20 minutes), were statistically processed.

Example  8. Immunocytochemistry  Way

In order to perform immunocytochemistry, differentiated skeletal muscle cells (myotube) were first fixed with cold methanol for 30 minutes and then incubated with anti-GFP antibody (1: 500) and Cy3-conjugated Secondary antibody (1: 500, Sigma) was used. Images of differentiated skeletal muscle cells and the extent of expressed full-length MG53 or PRY-SPRY domains were determined using optical microscopy and fluorescence microscopy.

Example  9. Statistical analysis

All data are represented as ± SE by combining the data obtained through a number of experiments. The value obtained in the control group was set to 1 and expressed in a normalized ratio manner in which the relative change was expressed. In the case of the resting cytoplasmic calcium concentration, it is expressed as an absolute value. Significant differences were determined using the unpaired t-test (GraphPad InStat, v2.04) and significant differences were marked with an asterisk for P <0.05. Graphing was done using the Origin v7 program.

Experiment result

1. Co-immunoprecipitation (co- immunoprecipitation ) And MG53 Orai1  Confirm binding between

To examine the binding between MG53 and Orai1 using a triad sample from a rabbit skeletal muscle, the co-immunoprecipitation method was performed using an Orai1 antibody or MG53 antibody and the presence or absence of an Orai1 antibody The results are shown in the photographs and the bar graphs.

As a result, it was confirmed that when Orai1 antibody was present, the amount of MG53 protein precipitated together with Orai1 was significantly increased (see FIG. 1A).

Conversely, the results of the presence of MG53 antibody in the course of the co-immunoprecipitation method are shown in the photographs and the bar graphs.

As a result, it was confirmed that the presence of MG53 antibody significantly increased the amount of Orai1 protein precipitated with MG53 (see FIG. 1B).

Therefore, it was confirmed that Orai1 binding to MG53 can be confirmed again. In addition, it can be seen that MG53 is not bound to STIM1 protein which is known to bind to Orai1 and regulate its activity. Overall, these results confirm that the binding between MG53 and Orai1 is an Orai1-specific interaction of MG53.

2. GST -Linked MG53 fragment proteins ( GST -fused MG53 proteins) and With Orai1  As a coupling reaction, On Orai1  Found a binding domain of MG53

(GST-TRIM, GST-PRY, GST-SPRY, GST-PRY-SPRY and GST-MG53 (full length; full length) were expressed and purified in E. coli for each domain of MG53. GST-linked MG53 scaffold proteins stained with Coomassie Brilliant Blue were obtained on a 10% SDS-PAGE gel (Fig. 2b). Next, a triad sample Linked MG53 scaffold proteins (GST-fused MG53 domains) and triad samples (triads containing Orai1) to isolate proteins obtained through binding assay with a triad sample containing Orai1 sample was separated from 10% SDS-PAGE gel, immunoadhesion using Orai1 antibody and GST antibody was performed, and the MG53 domain binding to Orai1 was found. As a result, As shown in FIG. 2C, It was confirmed that the PRY-SPRY domain of MG53 binds to Orai1, considering that all the PRY domain, SPRY domain, and full-length MG53 except RIM domain bind to Orai1.

3. Differentiation skeletal muscle cell  ( myotube ) By storage-working calcium influx by full-length MG53 or PRY-SPRY domain expression ( SOCE ) Of excessive increase

Calcium migration measurements were performed in single cells to measure storage-working calcium influx. First, differentiation skeletal muscle cells were transfected with a vector (vector: GFP expression), full-length MG53, or PRY-SPRY domain, and their expression was confirmed by immunocytochemistry (FIG. In the absence of external calcium, cells were depleted of calcium in the sarcoplasmic reticulum through pretreatment with thapsigargin (TG), treated with 2 mM calcium externally to store-operate Calcium influx (SOCE) was measured. (Table 2), an increase of nearly 30% of store-working calcium influx was observed in differentiation skeletal muscle cells expressing full-length MG53 or PRY-SPRY domain, compared to only the vector. The results are shown in the bar graph on the right (Fig. 3B). These results indicate that MG53 increases the activity of Orai1 by binding to Orai1 through PRY-SPRY, resulting in an excessive increase of reservoir-working calcium influx.

Comparison of store-working calcium influx (SOCE) in differentiation skeletal muscle cells (myotube) expressing full-length MG53 or PRY-SPRY domain Vector Full-length MG53 PRY-SPRY Storage - Working Calcium Inflow (SOCE) 1.00 + - 0.11
(87) 1.34 ± 0.09 ^*
(60) 1.27 ± 0.09 ^*
(86)

*, And vector (normalization) as a control group, and the result is significant ( P <0.05). The number in parentheses is the number of experiments used in the analysis.

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Method for screening Duchenne Muscular Dystrophy agents          detecting detecting interactions of MG53 and Orai1 <130> P16U11C2194 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GST-TRIM_F <400> 1 gcgtcgactc atgtcggctg cacccgg 27 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GST-TRIM_R <400> 2 taaagcggcc gctcacagag cccggaacat c 31 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GST-PRY_F <400> 3 gcgtcgacct atgccagcgc tggaggaac 29 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> GST-PRY_R <400> 4 taaagcggcc gctcactgtg acagcagctg ctg 33 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GST-SPRY_F <400> 5 gcgtcgactc atgggcgagc actattggga g 31 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GST-SPRY_R <400> 6 taaagcggcc gctcaggcct gttcctgctc c 31 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> GST-PRY-SPRY_F <400> 7 gcgtcgacct atgccagcgc tggaggaac 29 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GST-PRY-SPRY_R <400> 8 taaagcggcc gctcaggcct gttcctgctc c 31 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> GST-MG53_F <400> 9 gcgtcgactc atgtcggctg cacccgg 27 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GST-MG53_R <400> 10 taaagcggcc gctcaggcct gttcctgctc c 31

Claims (7)

(a) treating candidate compounds with cells expressing MG53 (mitsugumin 53) and Orai1,
(b) determining whether the binding of MG53 and Orai1 is inhibited in said cells. &lt; Desc / Clms Page number 20 &gt; (a ') treating the candidate compound with a mixture of isolated MG53 and isolated Orai1,
(b ') determining whether binding of MG53 and Orai1 is inhibited. 3. The method according to claim 1 or 2,
Wherein the binding of MG53 and Orai1 is detected using an antibody specific for MG53 or Orai1 binding. The method of claim 3,
Wherein the combination of MG53 and Orai1 is detected by immuno-staining, immunoprecipitation or immunostaining. 3. The method according to claim 1 or 2,
Wherein said MG53 and Orai1 are each linked to a reporter protein. 6. The method of claim 5,
Wherein the binding of MG53 and Orai1 is detected by the signal size of the reporter protein. 3. The method according to claim 1 or 2,
Wherein said duchenne skeletal muscle atrophy is associated with skeletal muscle weakening or reduction by store-operated Ca ²⁺ -entry (SOCE).

Images