KR101882740B1 - Modified microorganism for high efficient production of lactic acid - Google Patents

Abstract

Disclosed is a modified microorganism for high-yield production of lactic acid, an expression vector for producing the modified microorganism, and a method for producing lactic acid using the modified microorganism. The modified microorganism can produce lactic acid with high efficiency even under acidic conditions.

Description

MODIFIED MICROORGANISM FOR HIGH EFFICIENT PRODUCTION OF LACTIC ACID [0002]

A modified microorganism for producing high-efficiency lactic acid, an expression vector for producing the modified microorganism, and a method for producing lactic acid using the modified microorganism.

Lactic acid is generally used as a food additive such as a food preservative, a flavoring agent or an acidifier, and is an important organic acid widely used in industry such as cosmetics, chemicals, metals, electronics, textiles, dyeing and pharmaceuticals. In addition, lactic acid is also used as a raw material for polylactic acid (PLA), which is a type of biodegradable plastics. In recent years, lactic acid has been used as a raw material for environmental pollution caused by oil price rise, crude oil depletion, The demand for lactic acid has been greatly increased due to the increasing interest in environmentally friendly alternative polymer materials of refractory plastics due to the increase of the amount of lactic acid.

Particularly, lactic acid is a highly reactive organic acid having a hydroxyl group and a carboxyl group, and is not only a polylactic acid, but also acetaldehyde, polypropylene glycol, acrylic acid, 2,3-pentadione (2, 3-pentathione) and other chemical raw materials. Lactic acid is also used in the manufacture of ethyl lactate, a biodegradable and non-toxic solvent, which is used in electronics manufacturing, paint and textiles, detergents, adhesives and printed materials.

Recently, Kluyveromyces strain has attracted attention as an alternative to Saccharomyces strains. K. Marchenus ( Kluyveromyces marxianus and Kluyveromyces lactis are classified as Generally Recognized As Save (GRAS) cells, which are recognized by the US FDA as a human body, as well as Saccharomyces.

K. marxianus is able to grow at temperatures of 47, 49, and even 52 캜. It is highly acid resistant and has recently attracted attention as a producer of organic acids and platform compounds.

According to one aspect,

At least one lactate dehydrogenase (LDH) activity selected from the group consisting of Pelodiscus sinensis japonicus, Ornithorhynchus anatinus, Tursiops truncatus and Norwegian rats (Rattus norvegicus) Lt; RTI ID = 0.0 > lactic < / RTI > acid.

According to another aspect,

Cloning start point; Promoter; A polynucleotide encoding at least one LDH activity selected from the group consisting of Japanese zoets, platypus, bottlenose dolphins and Norwegian rats; And an expression vector comprising a terminator.

According to another aspect,

Culturing the modified microorganism into which the expression vector has been introduced in a glucose-containing medium; And recovering the lactic acid produced by the culture.

The modified microorganism can produce lactic acid in high yield. Also, lactic acid can be produced at a high yield under acidic conditions.

Figure 1 shows the expression vector pJSKM316-GPD according to Example 1.

Unless otherwise defined, can be performed by molecular biology, microbiology, protein purification, protein engineering, and DNA sequencing and routine techniques commonly used in the art of recombinant DNA within the skill of those skilled in the art. These techniques are known to those skilled in the art and are described in many standardized textbooks and references.

Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Various scientific dictionaries, including the terms contained herein, are well known and available in the art. Although any methods and materials similar or equivalent to those described herein are found to be used in the practice or testing of the present application, some methods and materials have been described. Should not be construed as limiting the invention to the particular methodology, protocols and reagents, as they may be used in various ways in accordance with the context in which those skilled in the art use them.

As used herein, the singular forms include plural objects unless the context clearly dictates otherwise. Also, unless otherwise indicated, nucleic acids are written from left to right, 5 'to 3', amino acid sequences from left to right, amino to carboxyl.

The numerical range includes numerical values defined in the above range. All maximum numerical limitations given throughout this specification include all lower numerical limitations as well as the lower numerical limitations being explicitly stated. All minimum numerical limitations given throughout this specification include all higher numerical limitations as the higher numerical limitations are explicitly stated. All numerical limitations given throughout this specification will include all better resin ranges within a broader numerical range, as narrower numerical limitations are explicitly stated.

The subject matter provided herein should not be construed as limiting the following embodiments in various aspects or as a reference throughout the specification.

And to provide a modified microorganism for the high-efficiency production of lactic acid.

Organic acids such as lactic acid are produced by industrial fermentation methods. Fermentation is carried out by a variety of bacterial species that consume sugars and convert the sugar to the desired acid.

Development of a yeast or a fungal biocatalyst for producing an organic acid from the saccharide material has been conducted for the following reasons. Many bacteria can not synthesize some of the amino acids or proteins they need to grow and efficiently metabolize sugars. As a result, bacteria often have to be supplied with some complex nutrients. This results in an increase in the direct costs required to carry out the fermentation. As the complexity of the medium increases, it becomes more difficult to recover the fermentation products in a reasonably pure state, so that additional work and costs are incurred to recover the products. On the other hand, many yeast species can synthesize the amino acid or protein they need from inorganic nitrogen compounds. They often grow well and ferment in so-called "defined" media, which are usually less expensive and less laborious to recover the product.

Another reason why yeast is of interest as a biocatalyst for the production of organic acids is related to the properties of the product itself. In order to have an economically feasible method, a high concentration of organic acid products must be accumulated in the fermentation medium. Besides the concern that the fermentation product may be toxic to the biocatalyst when present in high concentrations, there is an additional concern about acidity when the fermentation product is acid. The medium will become more and more acidic as more organic acids are produced. Most bacteria that produce these organic acids are not active in strong acid environments and produce products that are not viable or economically ineffective under these conditions.

Thus, commercial acid fermentation methods are buffered by the addition of materials that neutralize the acid when the acid is formed. This keeps the medium at neutral pH, allowing the bacteria to grow efficiently and produce organic acids. However, it converts the acid to a salt, which must then be separated in order to obtain the product in the desired acid form.

Conventional buffers are calcium compounds that neutralize organic acids to form corresponding calcium salts. After the calcium salt is recovered from the fermentation medium, it is separated by the addition of mineral acid, typically sulfuric acid, to regenerate the organic acid and form an insoluble calcium salt of mineral acid. Therefore, the method also incurs the cost of treating and disposing undesired calcium salt byproducts as well as direct costs for buffering and mineral acids. If the biocatalyst can efficiently grow and produce organic acids under lower pH conditions, the cost may be reduced or eliminated.

According to one embodiment, a modified microorganism comprising an exogenous lactate dehydrogenase (LDH) activity is provided.

The term "metabolically engineered" or "metabolic engineering ", as used herein, refers to a biosynthetic gene, a gene associated with an operon, It involves rational path design and assembly of the control elements of the sequence. "Metabolism manipulated" refers to a metabolic flux that is controlled and optimized by transcription, translation, protein stability and protein functionality using genetic manipulation and appropriate culture conditions. And may further include optimization. A biosynthetic gene may be heterologous to a host (e. G., A microorganism) by being foreign to the host or modified by mutagenesis, recombination or association with a heterologous expression control sequence in an endogenous host cell. Suitable culture conditions include conditions such as culture medium pH, ionic strength, nutrient content, temperature, oxygen, carbon dioxide, nitrogen content, humidity, and other culture conditions that allow the production of compounds by the metabolic metabolism of the microorganisms . Culture conditions suitable for microorganisms capable of functioning as host cells are well known.

Thus, metabolic "engineered " or" modified "microorganisms are produced by introducing a genetic material into a selected host or parent microorganism to alter or alter the cellular physiology and biochemistry of the microorganism. Through the introduction of genetic material, parental microorganisms acquire new properties, such as the ability to produce new intracellular metabolites or larger amounts of intracellular metabolites.

For example, the introduction of genetic material into parent microbes results in new or altered ability to produce chemicals. The genetic material introduced into the parent microorganism comprises a gene or a portion of a gene encoding one or more enzymes involved in the biosynthetic pathway for chemical production and further components for modulation of the expression or expression of these genes, Promoter sequence.

As used herein, the term "exogenous" means that the genetic material considered is not native to the host strain. The term "native" means a genetic material found in the genome of a wild-type cell of a host cell.

The term "activity ", " enzyme activity ", used interchangeably herein, means any functional activity normally attributable to a selected polypeptide when produced under advantageous conditions. Typically, The activity of the selected polypeptide includes the total enzymatic activity associated with the produced polypeptide. The polypeptide produced by the host cell and having the enzymatic activity may be located in the intracellular space of the cell, bound to the cell, Can be secreted.

As used herein, the term "Lactate dehydrogenase (LDH)" refers to the ability to convert from pyruvate to lactate. The lactate dehydrogenase enzyme is a cytokine c-dependent D-lactate dehydrogenase (EC 1.1.2.4) or L-lactate dehydrogenase (EC 1.1.2.3), and NAD (P) L-lactate dehydrogenase (EC 1.1.1.28) or L-lactate dehydrogenase (EC 1.1.1.27), but the embodiment is not limited to the NAD (P) -dependent L-lactate dehydrogenase It is about.

As used herein, the term "derived from" means separating the genetic material in whole or in part from the indicated source or purifying the genetic material from the indicated source.

The reaction formula of the lactate dehydrogenase is as follows:

[Reaction Scheme 1]

In such embodiments, the LDH activity may include those derived from bacterial, fungal, yeast, mammalian or reptile sources. In this embodiment, high efficiency LDH activity was found through a database search. For example, the L-LDH gene was sequenced from the database, and representative genes were selected by enzyme homology and phylogenetic analysis.

In one embodiment, LDH activity from Pelodiscus sinensis japonicus, Ornithorhynchus anatinus, Tursiops truncatus and Norwegian rats (Rattus norvegicus) was used.

The introduction of the LDH activity into the microorganism can be carried out by a known conventional method. For example, a method comprising preparing a vector containing the polynucleotide having the above activity, and transforming the microorganism with the expression vector can be used.

According to another embodiment, an expression vector for producing the modified microorganism is provided. Wherein said expression vector comprises a cloning start point; Promoter; Polynucleotides encoding Lactate dehydrogenase (LDH) activity; And a terminator.

As used herein, the term "replication origin" refers to a nucleotide sequence that directs replication or amplification of a plasmid in a host cell.

As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA within an appropriate host microorganism. The vector may be a plasmid, phage particle, or simply a potential genomic insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or may be integrated into the genome itself. As used herein, "plasmid" and "vector" are used interchangeably, since plasmids are commonly used as current vectors.

However, other forms of vectors having equivalent functions to those known or known in the art are also included. For example, the vector may comprise a replicating vector, an expression vector, a shuttle vector, a plasmid, a phage or viral particle, a DNA construct, and a cassette. The term "plasmid" refers to a circular double-stranded DNA rescue used as a cloning vector and forms a non-chromosomal self-replicating genetic element in many bacteria and some eukaryotes. The plasmid may comprise a plurality of copy plasmids that can be integrated into the genome of the host cell by homologous recombination.

As is well known in the art, in order to increase the level of expression of a gene introduced in a host cell, the gene must be operably linked to transcriptional and detoxification control sequences that function in a selected expression host. For example, an expression control sequence and the gene are contained within an expression vector containing a selectable marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further include a useful expression marker in the eukaryotic expression host.

As used herein, the term "operably linked" means that the polynucleotide promoter sequence affects the transcription of the polynucleotide sequence encoding the polypeptide, if it affects the transcription of the gene. Operably linked "may mean that the linked polynucleotide sequence is contiguous. The connection can be carried out by being tied to a convenient limit position. If such sites do not exist, a synthetic oligonucleotide adapter or linker may be used.

As used herein, the term "promoter" refers to a nucleic acid sequence that functions to effect transcription of a downstream gene or to effect it. The promoter may be any promoter that results in the expression of the protein of interest and may be any nucleic acid sequence that shows transcriptional activity in the selected host cell and includes mutations, truncated and hybridized promoters, Or from genes encoding heterologous extracellular or intracellular polypeptides. The promoter may be native or heterologous to the host cell.

As used herein, the term "gene" refers to the 5 'untranslated (5' UTR) or the 5 'untranslated region (intron) as well as the preceding and succeeding coding regions, Quot; means a polynucleotide sequence that may or may not include a leader sequence and a 3 'untranslated (3' UTR) or trailer sequence.

As used herein interchangeably, the terms "polynucleotide" and "nucleic acid" refer to a polymeric form of a nucleotide of any length. This includes, but is not limited to, single-stranded DNA, double helix DNA, genomic DNA, cDNA, or polypeptides including purine and pyrimidine bases or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases It is not. Non-limiting examples of polynucleotides include, but are not limited to, genes, gene fragments, chromosomal fragments, ESTs, exons, introns, mRNAs, tRNAs, rRNAs, ribozymes, cDNAs, recombinant polynucleotides, branched polynucleotides, plasmids, DNA, any sequence of isolated RNA, nucleic acid probes, and primers. As a result of degradation of the genetic code, it will be understood that many nucleotide sequences encoding a given protein can be generated.

As used herein, the term "terminator" means a nucleic acid sequence which serves to bring about the end of transcription or to effect it.

In this embodiment, the origin of replication may comprise an autonomous replication sequence (ARS) and the ARS may be stabilized by a centromeric sequence (CEN).

In one embodiment, the ARS / CEN of Cluveromyces marcianus was used.

Wherein the ARS / CEN replication origin is at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 92, at least about 95, , At least about 97%, at least about 98%, or at least about 99% sequence homology.

SEQ ID NO: 1:

gagctccttt catttctgat aaaagtaaga ttactccatt tatcttttca ccaacatat tcatagttga aagttatcct tctaagtacg tatacaatat taattaaacg taaaaacaaa actgactgta aaaatgtgta aaaaaaaaat atcaaattc atagcagttt caaggaatga aaactattat gatctggtca cgtgtatata aattattaat tttaaaccca tataatttat tattttttta ttctaaagt ttaaagtaat tttagtagt attttatatt ttgaataaat atactttaaa tttttatttt tatattttat tacttttaaa aataatgttt ttatttaaaa caaaattata agttaaaaag ttgttccgaa agtaaaatat attttatagt ttttacaaaa ataaattatt tttaacgtat tttttttaat tatatttttg tatgtgatta tatccacagg tattatgctg aatttagctg tttcagttta ccagtgtgat agtatgattt tttttgcctct caaaagctatt tttttagaag cttcgtctta gaaataggtg gtgtataaat tgcggttgac ttttaactat atatcatttt cgatttattt attacataga gaggtgcttt taatttttta atttttattt tcaataattt taaaagtggg tacttttaaa ttggaacaaa gtgaaaaata tctgttatac gtgcaactga attttactga ccttaaagga ctatctcaat cctggttcag aaatccttgaa atgattgata tgttggtgg attttctctg attttcaaac aagaggtat tttatttcat atttattata ttttttacat ttattttata tttttttatt gtttggaagg gaaagcgaca at caaattca aaatatatta attaaactgt aatacttaat aagagacaaa taacagccaa gaatcaaat actgggtttt taatcaaaag atctctctac atgcacccaa attcattatt taaatttact atactacaga cagaatatac gaacccagat taagtagtca gacgcttttc cgctttattg agtatatagc cttacatatt ttctgcccat aatttctgga tttaaaataa acaaaaatgg ttactttgta gttatgaaaa aaggcttttc caaaatgcga aatacgtgtt atttaaggtt aatcaacaaa acgcatatcc atatgggtag ttggacaaaa cttcaatcga t

In this embodiment, the promoter is selected from the group consisting of CYC (cytochrome c oxidase), TEF (translation elongation factor 1α, glyceraldehyde-3-phosphate dehydrogenase), ADH (alcohol dehydrogenase), PHO5, TRP1, GAL1, GAL10, hexokinase, pyruvate decarboxylase but are not limited to, phosphofructokinase, triose phosphate isomerase, phosphoglucose isomerase, glucokinase, α-mating factor pheromone, GUT2, nmt, fbp1, AOX1, AOX2, MOX1, FMD1 and PGK1. , The promoter may be selected from the group consisting of CYC promoter, TEF promoter, GPD promoter and ADH promoter.

In one embodiment, a GPD promoter was used.

Wherein the CYC promoter comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95% , 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 2:

atttggcgag cgttggttgg tggatcaagc ccacgcgtag gcaatcctc gagcagatcc gccaggcgtg tatatatagc gtggatggcc aggcaacttt agtgctgaca catacaggca tatatatatg tgtgcgacga cacatgatc atatggcatg catgtgctc tgtatgtata taaaactctt gttttcttct tttctctaaa tattctttcc ttatacatta ggacctttg cagcataaat tactatactt ctatagacac gcaaacacaa atacacacac taa

Wherein the TEF promoter comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95% , 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 3:

atagcttcaa aatgtttcta ctcctttttt actcttccag attttctcgg actccgcgca tcgccgtacc acttcaaaac acccaagcac agcatactaa atttcccctc tttcttcctc tagggtgt cgttaattac ccgtactaaa ggtttggaaa agaaaaaaga gaccgcctcg tttctttttc ttcgtcgaaa aaggcaataa aaatttttat cacgtttctt tttcttgaaa attttttttt tgattttttt ctctttcgat gacctcccat tgatatttaa gttaataaac ggtcttcaat ttctcaagtt tcagtttcat ttttcttgtt ctattacaac tttttttact tcttgctcat tagaaagaaa gcatagcaat ctaatctaag ttt

Wherein the GPD promoter comprises at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95% , 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 4:

agtttatcattatcaatactcgccatttcaaagaatacgtaaataattaatagtagtgattttcctaactttatttagtcaaaaaattagccttttaattctgctgtaacccgtacatgcccaaaatagggggcgggttacacagaatatataacatcgtaggtgtctgggtgaacagtttattcctggcatccactaaatataatggagcccgctttttaagctggcatccagaaaaaaaaagaatcccagcaccaaaatattgttttcttcaccaaccatcagttcataggtccattctcttagcgcaactacagagaacaggggcacaaacaggcaaaaaacgggcacaacctcaatggagtgatgcaacctgcctggagtaaatgatgacacaaggcaattgacccacgcatgtatctatctcattttcttacaccttctattaccttctgctctctctgatttggaaaaagctgaaaaaaaaggttgaaaccagttccctgaaattattcccctacttgactaataagtatataaagacggtaggtattgattgtaattctgtaaatctatttcttaaacttcttaaattctacttttatagttagtcttttttttagttttaaaacaccagaacttagtttcgacggat

The ADH promoter is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95% , 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 5:

gccgggatcg aagaaatgat ggtaaatgaa ataggaaatc aaggagcatg aaggcaaaa gacaaatata agggtcgaac gaaaaataaa gtgaaaagtg ttgatatgat gtatttggct ttgcggcgcc gaaaaaacga gtttacgcaa ttgcacaatc atgctgactc tgtggcggac ccgcgctctt gccggcccgg cgataacgct gggcgtgagg ctgtgcccgg cggagttttt tgcgcctgca ttttccaagg tttaccctgc gctaaggggc gagattggag aagcaataag aatgccggtt ggggttgcga tgatgacgac cacgacaact ggtgtcatta tttaagttgc cgaaagaacc tgagtgcatt tgcaacatga gtatactagaa gaatgagcca agacttgcga gacgcgagtt tgccggtggt gcgaacaata gagcgaccat gaccttgaag gtgagacgcg cataaccgct agagtacttt gaagaggaaa cagcaatagg gttgctacca gtataaatag acaggtacat acaacactgg aaatggttgt ctgtttgagt acgctttcaa ttcatttggg tgtgcacttt attatgttac aatatggaag ggaactttac acttctcctat gcacatatat taattaaagt ccaatgctag tagagaaggg gggtaacacc cctccgcgct cttttccgat ttttttctaa accgtggaat atttcggatat ccttttgttg tttccgggtg tacaatatgg acttcctctt ttctggcaac caaacccata catcgggatt cctataatac cttcgttggt ctccctaaca tgtaggtggc ggaggggaga tatacaatag aacagatacc agacaagaca taatgggc ta aacaagacta caccaattac actgcctcat tgatggtggt acataacgaa ctaatactgt agccctaga cttgatagc catcatcat atcgaagttt cactaccctt tttccatttg ccatctattg aagtaataat aggcgcatgc aacttctttt cttttttttt cttttctctc tcccccgttg ttgtctcacca tatccgcaat gacaaaaaaa tgatggaagaca ctaaaggaaa aaattaacga caaagacagc accaacagat gtcgttgttc cagagctgat gaggggtatc tcgaagcaca cgaaactttt tccttccttc attcacgcaca ctactctcta atgagcaacg gtatacggcc ttccttccag ttacttgaat ttgaaataaa aaaaagtttg ctgtcttgct atcaagtataa atagacctgc aattattaat cttttgtttc ctcgtcattgt tctcgttccc tttcttcctt gtttcttttt ctgcacaata tttcaagcta taccaagcat acaatcaact ccaagctggc cgc

The polynucleotide encoding the LDH activity is at least about 70%, at least about 75%, at least about 80%, at least about 85% of SEQ ID NO: 6 (Accession Number: Q98SL0) , About 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 6:

MSVKELLIQN VHKEEHSHAH NKITVVGVGA VGMACAISIL MKDLADELAL VDVIEDKLRG

EMLDLQHGSL FLRTPKIVSG KDYSVTAHSK LVIITAGARQ QEGESRLNLV QRNVNIFKFI

IPNVVKYSPD CMLLVVSNPV DILTYVAWKI SGFPKHRVIG SGCNLDSARF RYLMGEKLGI

HSLSCHGWII GEHGDSSVPV WSGVNVAGVS LKALYPDLGT DADKEHWKEV HKQVVDSAYE

VIKLKGYTSW AIGLSVADLA ETVMKNLRRV HPISTMVKGM YGVSSDVFLS VPCVLGYAGI

TDVVKMTLKS EEEEKLRKSA DTLWGIQKEL QF

The polynucleotide encoding the LDH activity may be at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 85%, at least about 80% About 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 7:

MAGVKEQLIQ NLLKEEYAPQ NKITVVGVGA VGMACAISIL MKDLADELAL VDVIEDKLKG

EMMDLQHGSL FLRTPKIVSG KDYSVTANSK LVIITAGARQ QEGESRLNLV QRNVNIFKFI

IPNVVKYSPN CKLLVVSNPV DILTYVAWKI SGFPKNRVIG SGCNLDSARF RYLMGERLGI

HSTSCHGWVI GEHGDSSVPV WSGVNVAGVS LKNLHPDLGT DADKEQWKDV HKQVVDSAYE

VIKLKGYTSW AIGLSVADLA ESIVKNLRRV HPISTMIKGL YGIKDEVFLS VPCVLGQNGI

SDVVKITLKS EEEAHLKKSA DTLWGIQKEL QF

The polynucleotide encoding the LDH activity is at least about 70%, at least about 75%, at least about 80%, at least about 85% of SEQ ID NO: 8 (Accession Number: C6L2F0) , About 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 8:

MATVKDQLIQ NLLKEEHVPQ NKITVVGVGA VGMACAISIL MKDLADELAL VDVIEDKLKG

EMMDLQHGSL FLRTPKIVSG KDYSVTANSK LVIITAGARQ QEGESRLNLV QRNVNIFKFI

VPNIVKYSPH CKLLVVSNPV DILTYVAWKI SGFPKNRVIG SGCNLDSARF RYLMGERLGV

HPLSCHGWIL GEHGDSSVPV WSGVNVAGVS LKNLHPELGT DADKEHWKAI HKQVVDSAYE

VIKLKGYTSW AVGLSVADLA ESIMKNLRRV HPISTMIKGL YGIKEDVFLS VPCILGQNGI

SDVVKVTLTP EEQACLKKSA DTLWGIQKEL QF

The polynucleotide encoding the LDH activity may be at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 80%, at least about 85% , At least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98%, or at least about 99% sequence homology.

SEQ ID NO: 9:

MAALKDQLIV NLLKEEQVPQ NKITVVGVGA VGMACAISIL MKDLADELAL VDVIEDKLKG

EMMDLQHGSL FLKTPKIVSS KDYSVTANSK LVIITAGARQ QEGESRLNLV QRNVNIFKFI

IPNVVKYSPQ CKLLIVSNPV DILTYVAWKI SGFPKNRVIG SGCNLDSARF RYLMGERLGV

HPLSCHGWVL GEHGDSSVPV WSGVNVAGVS LKSLNPQLGT DADKEQWKDV HKQVVDSAYE

VIKLKGYTSW AIGLSVADLA ESIMKNLRRV HPISTMIKGL YGIKEDVFLS VPCILGQNGI

SDVVKVTLTP DEEARLKKSA DTLWGIQKEL QF

The terminator may include, but is not limited to, those selected from the group consisting of PGK1 (phosphoglycerate kinase 1), CYC1 (cytochrome c transcription), and GAL1.

In one embodiment, a CYC1 terminator was used.

The CYC1 terminator is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95% , 97% or more, about 98% or more, or about 99% or more.

SEQ ID NO: 10:

tcatgtaatt agttatgtca cgcttacatt cacgccctcc ccccacatcc gctctaacc gaaaaggaag gagttagaca acctgaagtc taggtcccta tttatttttt tatagttatg ttagtattaa gaacgttatt tatatttca aatttttct tttttttctg tacagacgc gtgtacgca tgtaacattat actgaaaacc ttgcttgaga aggttttggg acgctcgaag gctttaattt gcggcc

As used herein, the term "homology" means sequence similarity or sequence identity. Such homology can be determined using standard techniques known in the art (see, for example, Smith and Waterman, Adv. Appl. Math., 2: 482 [1981]; Needleman and Wunsch, J. Mol. Biol., 48: 443 [1970]; Programs such as GAP, BESTFIT, FASTA, and TFASTA of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI), and programs such as Devereux et al , Nucl. Acid Res., 12: 387-395 [1984]).

The expression vector may further comprise a selection marker.

As used herein, the term "selectable marker" refers to a nucleotide sequence that is expressible in a host cell, and the expression of the selectable marker is determined by the presence of a corresponding selector for the cell containing the expressed gene, Gives the ability to grow on deficits. The selectable marker may be an antibiotic marker such as ampicillin, kannamycin, erythromycin, actinomycin, chloramphenicol and tetracyclin, and URA3 (uracil nutrient requirement ), LEU2 (leucine auxotrophy), TRP1 (tryptophan auxotrophy), and HIS3 (histidine auxotrophy). That is, the selectable marker is a gene that allows endogenous antibiotics and nutritional requirements to be given in host cells so that cells containing foreign DNA can be distinguished from cells that do not undergo any exogenous sequence during transformation.

In one embodiment, a URA3 auxotrophic selection marker was used.

The expression vector may be introduced into a microbial host cell by a conventional method.

As used herein, the term "host cell" means a suitable cell from a cell that performs as a host for the expression vector. Suitable host cells can be naturally occurring or wild-type host cells, or can be transformed host cells. A "wide-type host cell" is a host cell that has not been genetically altered through recombinant methods.

As used herein, the term "altered host cell" refers to a genetically engineered host cell in which the desired protein is produced at a level of expression or is produced at a level greater than that of expression or is essentially the same Is expressed at a level of expression that is greater than the level of expression of the protein of interest in unmodified or wild-type host cells growing under growth conditions. "Modified host cell" means a wild-type or modified host cell that is genetically engineered to overexpress a gene encoding the protein of interest. Modified host cells can express lactic acid at a higher level than wild-type or altered parental cells.

The host cell may be a yeast or a bacterium, but is not limited thereto and includes all cells suitable for introducing the expression vector. The yeast or bacteria Xi thigh eggplant (Zymomonas), Escherichia (Escherichia), Pseudomonas (Pseudomonas), Alcaligenes (Alcaligenes), Salmonella (Salmonella), Shh Gela (Shigella), Burke holde Liao (Burkholderia), oligo Trojan wave (Oligotropha), keulrep when Ella (Klebsiella), blood teeth (Pichia), Candida (Candida), Hanse Cronulla (Hansenula), Saccharomyces in MRS (Saccharomyces), Cluj Vero My process (Kluyveromyces), coma Pseudomonas (Comamonas) , Corynebacterium (Corynebacterium), Breda thinning teryum (Brevibacterium), also co kusu (Rhodococcus), azo Sat bakteo (Azotobacter), bakteo (Citrobacter), Enterobacter bakteo (Enterobacter), Clostridium (Clostridium) into a sheet, Lactobacillus bacteria (Lactobacillus), Aspergillus (Aspergillus), two flying it Ella My process (Zygosaccharomyces), with Xi Kosaka (Dunaliella), Deva Rio MRS (Debaryomyces), non-cor (Mucor), Sat rulrop sheath (Torulopsis), but not including, bacteria (Methylobacteria), Bacillus (Bacillus), separation tank emptying (Rhizobium), Streptomyces (Streptomyces) methyl limited.

In this embodiment, the host cell used was, but not limited to, Kluyveromyces or Escherichia . For example, my process genus Cluj Cluj Vero Vero My process Marcia Taunus (K. marxianus), Cluj Vero My process infrastructure Gillis (K. fragilis), Cluj Vero My process lactis (K. lactis), Cluj Vero My process K. bulgaricus , and K. thermotolerans. ≪ RTI ID = 0.0 >

In one embodiment, Clube Veromyces marcianus and Escherichia coli were used.

As used herein, the term "introduced " means any suitable method of transferring a nucleic acid sequence into the host cell. Methods of introduction can include, but are not limited to, plasmid fusion, transfection, transformation, conjugation, transduction (see, for example, Ferrari et al., "Genetics," in Hardwood et al, (eds.), (Bacillus), Plenum Publishing Corp., pages 57-72, [1989]).

As used herein, the terms "tramsformed" and "stably transformed" refer to non-native heterologous polynucleotide sequences incorporated into the genome or episomes maintained for two or more generations Quot; means a cell comprising a heterologous polynucleotide sequence present in a plasmid.

Introduction of a polynucleotide encoding the LDH activity into a host cell can be carried out by isolating the plasmid from E. coli and transforming it into a host cell. However, it is not essential to use a coagulant microorganism such as E. coli, and the vector may be directly introduced into the host cell. Such transformation methods may include, but are not limited to, electroporation, microinjection, biolistics (or particle bombardment mediated delivery), or Agrobacterium mediated transformation, no.

According to another embodiment, a method of producing lactic acid using the modified microorganism is provided. The method comprises culturing the modified microorganism in a glucose-containing medium; And recovering the lactic acid produced by the culture.

The method may further comprise the step of producing a lactide from the recovered lactic acid. The method may further comprise the step of polymerizing the lactide to form a polylactide polymer.

The step of culturing the modified microorganism may be carried out under fermentation conditions.

The medium used for cell culture may be any conventional medium suitable for the growth of host cells, such as minimal or complex medium containing appropriate supplements. Suitable media are available from commercial vendors or may be prepared according to known methods of manufacture (e. G., The catalog of the American Type Culture Collection).

In this embodiment, the medium may be a fermentation medium containing a sugar which can be fermented by a modified microorganism. Sugars may be hexasaccharides such as glucose, glycans or other polymers of glucose, glucose oligomers such as maltose, maltotriose and isomaltotriose, paranose, fructose and fructose oligomers . The fermentation medium may also contain a source of nitrogen such as ammonia, ammonium sulfate, ammonium chloride, ammonium nitrate and urea; Inorganic salts such as potassium hydrogen phosphate, potassium dihydrogen phosphate and magnesium sulfate; And nutrients including various vitamins such as peptone, meat extract, yeast extract, corn steep liquor, casamino acid, biotin, and thiamine, if necessary.

The modified microorganism can be cultured under batch, feed-batch or continuous fermentation conditions. The classic batch fermentation method uses a closed system, wherein the culture medium is made before fermentation is carried out, the organism is inoculated into the medium, and fermentation takes place without any addition of ingredients to the medium. In certain cases, the pH and oxygen content, not the carbon source content of the growth medium, are varied during the batch process. The metabolites and cellular biomass of the batch system are constantly changing until fermentation is stopped. In a batch system, the cells progress over the high growth log phase on stationary retardation, and finally the growth rate is reduced or stopped. If not, the stationary cells eventually die. In a typical period, the cells on the log make up most of the protein.

A variation of the standard batch system is the "feed-batch fermentation" system. In such a system, nutrients (e.g., carbon source, nitrogen source, O ₂ , and typically other nutrients) are added when the concentration of their culture drops below a threshold. A supply-and-batch system is useful when inhibition of catabolite production is desired to inhibit cell metabolism and to have a limited amount of nutrients in the medium in the medium. Measurement of the actual nutrient concentration in the feed-batch system can be accomplished using pH, dissolved oxygen And the partial pressure of the waste gas, such as CO ₂ . Batch and feed-batch fermentations are common and are known in the art.

Continuous fermentation is an open system in which a defined culture medium is continuously added to the bioreactor and the same amount of conditioned media is removed simultaneously during the process. Continuous fermentation usually maintains a constant high density culture in which the cells are initially in log phase growth. Continuous fermentation allows manipulation of one or any number of factors that affect cell growth or final product concentration. For example, nutrients such as carbon sources or nitrogen sources are kept at a fixed rate and all other parameters are maintained as appropriate. In other systems, the factors that affect many growths continue to change, while the cell concentration measured by the medium turbidity remains constant. Continuous systems try to maintain constant growth conditions. Thus, cell loss due to media excretion can be balanced against cell growth rate in fermentation. Methods for maintaining nutrients and growth factors during the continuous fermentation process as well as techniques for maximizing the rate of product formation are known in the art.

During the culture, the medium may be buffered to maintain the pH in the range of about 5.0 to about 9.0, or about 5.5 to about 7.0. Suitable buffers are basic substances that can neutralize lactic acid when formed, for example, potassium hydroxide, calcium carbonate, sodium hydroxide, potassium hydroxide, potassium carbonate, sodium carbonate, ammonium carbonate, ammonia, ammonium hydroxide, But is not limited thereto.

The culture may be carried out so that the pH of the medium at the end of the fermentation is not more than the pKa of the lactic acid. For example, the final pH may range from about 1.5 to about 4.5, or from about 2.0 to about 3.5, or from about 2.5 to 3.0. The microorganisms according to this embodiment can also grow lactic acid in an acidic fermentation medium having a pH of less than about 3.5, less than about 3.3, and even less than about 3.1.

The step of recovering the lactic acid produced by the culture may be performed by any method used in the bioprocess. For example, separation, purification, or collection methods can be used, including salting out, recrystallization, organic solvent extraction, esterification distillation, chromatography, and electrodialysis.

According to this embodiment, the modified microorganism can produce lactic acid in high yield.

In one embodiment, the modified microorganism showed a yield of at least 34.50%. Even the modified microorganisms showed a yield of at least 12.20% even under the condition of about pH 3.0.

Hereinafter, various embodiments are provided to facilitate understanding of the present invention. The following examples are provided to facilitate understanding of the invention and are not intended to limit the scope of the invention.

* Strain and plasmid

As a host for the multiplication and mass-extraction of the plasmid, E. coli TOP10 F-mcrA? (Mrr-hsdRMS-mcrBC)? 80lacZ? M15? LacX74 nupG recA1 araD139? Ara-leu 7697 galE15 galK16 rpsL (StrR) (LacZ) M15] hsdR17 (rK-mK +) (Invitrogen, Calif.) Was used as a yeast strain for producing lactic acid. As a cell, Kluyveromyces marxianus strain, for example, KM07 (ATCC 36907) was used. PRS306 (ATCC 77141) was used as a recombinant plasmid.

Medium and culture method

E. coli was inoculated into LB (1% bacto-tryptone, 0.5% bacto-enzyme extract, 1% NaCl) medium containing ampicillin or kanamycin and cultured at 37 ° C. Yeast host cells and recombinant yeast were cultured for 2 days at 37 ° C in YPD (1% bacto-yeast extract, 2% bacto-peptone, 2% dextrose) medium. The minimum medium consisted of 0.17% yeast nitrogen base, 0.5% ammonium sulfate, 2% glucose or glycerol, 38.4 mg / l arginine, 57.6 mg / l isoleucine, 48 mg / l phenylalanine, 57.6 mg / l valine, 6 mg / l threonine , 50 mg / l inositol, 40 mg / l tryptophan, 15 mg / l tyrosine, 60 mg / l leucine and 4 mg / l histidine.

Example  1: Production of expression vector for high-efficiency production of lactic acid

A. pKM316 Production

The ARS / CEN cloning start point of K. marxianus was amplified by PCR under TaOpt (optimal annealing temperature) of 53.2 ° C. At this time, the primers used were as follows:

Forward primer 5'-TTCAGACGTCGAGCTCCTTTCATTTCTGAT-3 '

Reverse primer 5'-TTCAGACGTCATCGATTGAAGTTTTGTCCA-3 '

Then, the cloning start point was cleaved with restriction enzyme AatII, and introduced into a plasmid pRS306 (ATCC 77141) digested in the same manner to prepare a K. marxianus - E. coli shuttle vector. This was named pKM316.

B. pJSKM316 - GPD Production

The GPD promoter of S. cerevisiae and the CYC terminator of K. marxianus were amplified by PCR under TaOpt at 57.5 ° C. Here, the primers used are as follows:

Forward primer 5'-TTCAGGTACCGGCCGCAAATTAAAGCCTTC-3 '

Reverse primer 5'-TTCAGCGGCCGCAGTTTATCATTATCAATACT-3 '

Forward primer 5'-TTCAGGTACCTCATGTAATTAGTTATGTCAC-3 '

Reverse primer 5'-TTCAGCGGCCGCGGCCGCAAATTAAAGCCT-3 '

Then, the promoter and terminator were digested with restriction enzymes NotI and KpnI, and introduced into pKM316 digested by the same method to prepare pJSKM316-GPD.

C. pJSKM316 - GPD LDH CYC

LDH derived from Japanese Zara (SEQ ID NO: 6), Platypus (SEQ ID NO: 7), Bacchus dolphin (SEQ ID NO: 8) and Norwegian rats (SEQ ID NO: 9) was digested with restriction enzymes BamHI and EcoRI, , And four pJSKM316-GPD LDH CYCs were prepared.

As a control, pJSKM316-GPD LDH CYC was prepared by introducing LDH derived from frog (Xenopus laevis) into pJSKM316-GPD in the same manner as above.

Example  2: transformation K. marxianus Of Lactic Acid Production

The five expression vectors prepared in Example 1 were introduced into K. marxianus strain. The five expression vectors pJSKM316-GPD LDH CYC were transformed into KM07 by electroporation and the yield of lactic acid production was measured at pH 5.5. The results are shown in Table 1 below.

Origin of the LDH gene Productivity of lactic acid (g / L / h) yield(%) I'm Japanese. 1.02 35.70 platypus 0.99 34.77 Dolphin 0.98 35.18 Norwegian rats 0.97 36.07 frog 0.76 26.28

As can be seen from the above Table 1, the lactic acid productivity of K. marxianus including LDH derived from Japanese japanese, platypus, bottlenose dolphin and Norwegian rats was 0.959 g / L / h and the yield was 34.77% The lactic acid productivity of K. marxianus including LDH derived from frogs was 0.76 g / L / h, and the yield was 26.28% or less.

Further, in order to examine the lactic acid productivity of K. marxianus according to the above embodiment under acidic conditions, the yield of lactic acid production was measured at pH 3. The results are shown in Table 2 below.

Origin of the LDH gene Productivity of lactic acid (g / L / h) yield(%) I'm Japanese. 0.34 19.20 platypus 0.30 17.10 Dolphin 0.24 15.20 Norwegian rats 0.22 12.20

As can be seen from the above Table 2, the lactic acid productivity of K. marxianus including LDH derived from Japanese japanese, platypus, bottlenose dolphin and Norwegian rats was 0.22 g / L / h or more even under strong acidic conditions of pH 3, 12.20% or higher yield.

Therefore, strains of K. marxianus having an LDH gene derived from Japanese jatropha , platypus, Bacchus dolphin and Norwegian rats produced according to the above embodiments can produce lactic acid at a high yield under acidic conditions, and thus can be used industrially will be.

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific examples are merely examples, and the scope of the present invention is not limited thereby. Accordingly, the actual scope of the present invention should be determined by the technical idea of the claims.

<110> SAMSUNG ELECTRONICS CO., LTD. <120> MODIFIED MICROORGANISM FOR HIGH EFFICIENT PRODUCTION OF LACTIC          ACID <130> RG-201109-516-1 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 1267 <212> DNA <213> DNA <400> 1 gagctccttt catttctgat aaaagtaaga ttactccatt tatcttttca ccaacatatt 60 catagttgaa agttatcctt ctaagtacgt atacaatatt aattaaacgt aaaaacaaaa 120 ctgactgtaa aaatgtgtaa aaaaaaaata tcaaattcat agcagtttca aggaatgaaa 180 actattatga tctggtcacg tgtatataaa ttattaattt taaacccata taatttatta 240 tttttttatt ctaaagttta aagtaatttt agtagtattt tatattttga ataaatatac 300 tttaaatttt tatttttata ttttattact tttaaaaata atgtttttat ttaaaacaaa 360 attataagtt aaaaagttgt tccgaaagta aaatatattt tatagttttt acaaaaataa 420 attattttta acgtattttt tttaattata tttttgtatg tgattatatc cacaggtatt 480 atgctgaatt tagctgtttc agtttaccag tgtgatagta tgattttttt tgcctctcaa 540 aagctatttt tttagaagct tcgtcttaga aataggtggt gtataaattg cggttgactt 600 ttaactatat atcattttcg atttatttat tacatagaga ggtgctttta attttttaat 660 ttttattttc aataatttta aaagtgggta cttttaaatt ggaacaaagt gaaaaatatc 720 tgttatacgt gcaactgaat tttactgacc ttaaaggact atctcaatcc tggttcagaa 780 atccttgaaa tgattgatat gttggtggat tttctctgat tttcaaacaa gaggattatttt 840 atttcatatt tattatattt tttacattta ttttatattt ttttattgtt tggaagggaa 900 agcgacaatc aaattcaaaa tatattaatt aaactgtaat acttaataag agacaaataa 960 cagccaagaa tcaaatactg ggtttttaat caaaagatct ctctacatgc acccaaattc 1020 attatttaaa tttactatac tacagacaga atatacgaac ccagattaag tagtcagacg 1080 cttttccgct ttattgagta tatagcctta catattttct gcccataatt tctggattta 1140 aaataaacaa aaatggttac tttgtagtta tgaaaaaagg cttttccaaa atgcgaaata 1200 cgtgttattt aaggttaatc aacaaaacgc atatccatat gggtagttgg acaaaacttc 1260 aatcgat 1267 <210> 2 <211> 289 <212> DNA <213> DNA <400> 2 atttggcgag cgttggttgg tggatcaagc ccacgcgtag gcaatcctcg agcagatccg 60 ccaggcgtgt atatatagcg tggatggcca ggcaacttta gtgctgacac atacaggcat 120 atatatatgt gtgcgacgac acatgatcat atggcatgca tgtgctctgt atgtatataa 180 aactcttgtt ttcttctttt ctctaaatat tctttcctta tacattagga cctttgcagc 240 ataaattact atacttctat agacacgcaa acacaaatac acacactaa 289 <210> 3 <211> 401 <212> DNA <213> DNA <400> 3 atagcttcaa aatgtttcta ctcctttttt actcttccag attttctcgg actccgcgca 60 tcgccgtacc acttcaaaac acccaagcac agcatactaa atttcccctc tttcttcctc 120 tagggtgtcg ttaattaccc gtactaaagg tttggaaaag aaaaaagaga ccgcctcgtt 180 tctttttctt cgtcgaaaaa ggcaataaaa atttttatca cgtttctttt tcttgaaaat 240 tttttttttg atttttttct ctttcgatga cctcccattg atatttaagt taataaacgg 300 tcttcaattt ctcaagtttc agtttcattt ttcttgttct attacaactt tttttacttc 360 ttgctcatta gaaagaaagc atagcaatct aatctaagtt t 401 <210> 4 <211> 655 <212> DNA <213> DNA <400> 4 agtttatcat tatcaatact cgccatttca aagaatacgt aaataattaa tagtagtgat 60 tttcctaact ttatttagtc aaaaaattag ccttttaatt ctgctgtaac ccgtacatgc 120 ccaaaatagg gggcgggtta cacagaatat ataacatcgt aggtgtctgg gtgaacagtt 180 tattcctggc atccactaaa tataatggag cccgcttttt aagctggcat ccagaaaaaa 240 aaagaatccc agcaccaaaa tattgttttc ttcaccaacc atcagttcat aggtccattc 300 tcttagcgca actacagaga acaggggcac aaacaggcaa aaaacgggca caacctcaat 360 ggagtgatgc aacctgcctg gagtaaatga tgacacaagg caattgaccc acgcatgtat 420 ctatctcatt ttcttacacc ttctattacc ttctgctctc tctgatttgg aaaaagctga 480 aaaaaaaggt tgaaaccagt tccctgaaat tattccccta cttgactaat aagtatataa 540 agacggtagg tattgattgt aattctgtaa atctatttct taaacttctt aaattctact 600 tttatagtta gtcttttttt tagttttaaa acaccagaac ttagtttcga cggat 655 <210> 5 <211> 1468 <212> DNA <213> DNA <400> 5 gccgggatcg aagaaatgat ggtaaatgaa ataggaaatc aaggagcatg aaggcaaaag 60 acaaatataa gggtcgaacg aaaaataaag tgaaaagtgt tgatatgatg tatttggctt 120 tgcggcgccg aaaaaacgag tttacgcaat tgcacaatca tgctgactct gtggcggacc 180 cgcgctcttg ccggcccggc gataacgctg ggcgtgaggc tgtgcccggc ggagtttttt 240 gcgcctgcat tttccaaggt ttaccctgcg ctaaggggcg agattggaga agcaataaga 300 atgccggttg gggttgcgat gatgacgacc acgacaactg gtgtcattat ttaagttgcc 360 gaaagaacct gagtgcattt gcaacatgag tatactagaa gaatgagcca agacttgcga 420 gacgcgagtt tgccggtggt gcgaacaata gagcgaccat gaccttgaag gtgagacgcg 480 cataaccgct agagtacttt gaagaggaaa cagcaatagg gttgctacca gtataaatag 540 acaggtacat acaacactgg aaatggttgt ctgtttgagt acgctttcaa ttcatttggg 600 tgtgcacttt attatgttac aatatggaag ggaactttac acttctccta tgcacatata 660 ttaattaaag tccaatgcta gtagagaagg ggggtaacac ccctccgcgc tcttttccga 720 tttttttcta aaccgtggaa tatttcggat atccttttgt tgtttccggg tgtacaatat 780 ggacttcctc ttttctggca accaaaccca tacatcggga ttcctataat accttcgttg 840 gtctccctaa catgtaggtg gcggagggga gatatacaat agaacagata ccagacaaga 900 cataatgggc taaacaagac tacaccaatt acactgcctc attgatggtg gtacataacg 960 aactaatact gtagccctag acttgatagc catcatcata tcgaagtttc actacccttt 1020 ttccatttgc catctattga agtaataata ggcgcatgca acttcttttc tttttttttc 1080 ttttctctct cccccgttgt tgtctcacca tatccgcaat gacaaaaaaa tgatggaaga 1140 cactaaagga aaaaattaac gacaaagaca gcaccaacag atgtcgttgt tccagagctg 1200 atgaggggta tctcgaagca cacgaaactt tttccttcct tcattcacgc acactactct 1260 ctaatgagca acggtatacg gccttccttc cagttacttg aatttgaaat aaaaaaaagt 1320 ttgctgtctt gctatcaagt ataaatagac ctgcaattat taatcttttg tttcctcgtc 1380 attgttctcg ttccctttct tccttgtttc tttttctgca caatatttca agctatacca 1440 agcatacaat caactccaag ctggccgc 1468 <210> 6 <211> 332 <212> PRT <213> Pelodiscus sinensis japonicus <400> 6 Met Ser Val Lys Glu Leu Leu Ile Gln Asn Val His Lys Glu Glu His   1 5 10 15 Ser His Ala His Asn Lys Ile Thr Val Val Gly Val Gly Ala Val Gly              20 25 30 Met Ala Cys Ala Ile Ser Ile Leu Met Lys Asp Leu Ala Asp Glu Leu          35 40 45 Ala Leu Val Asp Val Ile Glu Asp Lys Leu Arg Gly Glu Met Leu Asp      50 55 60 Leu Gln His Gly Ser Leu Phe Leu Arg Thr Pro Lys Ile Val Ser Gly  65 70 75 80 Lys Asp Tyr Ser Val Thr Ala His Ser Lys Leu Val Ile Ile Thr Ala                  85 90 95 Gly Ala Arg Gln Gln Glu Gly Glu Ser Arg Leu Asn Leu Val Gln Arg             100 105 110 Asn Val Asn Ile Phe Lys Phe Ile Ile Pro Asn Val Val Lys Tyr Ser         115 120 125 Pro Asp Cys Met Leu Leu Val Val Ser Asn Pro Val Asp Ile Leu Thr     130 135 140 Tyr Val Ala Trp Lys Ile Ser Gly Phe Pro Lys His Arg Val Ile Gly 145 150 155 160 Ser Gly Cys Asn Leu Asp Ser Ala Arg Phe Arg Tyr Leu Met Gly Glu                 165 170 175 Lys Leu Gly Ile His Ser Leu Ser Cys His Gly Trp Ile Ile Gly Glu             180 185 190 His Gly Asp Ser Ser Val Val Val Trp Ser Gly Val Asn Val Ala Gly         195 200 205 Val Ser Leu Lys Ala Leu Tyr Pro Asp Leu Gly Thr Asp Ala Asp Lys     210 215 220 Glu His Trp Lys Glu Val His Lys Gln Val Val Asp Ser Ala Tyr Glu 225 230 235 240 Val Ile Lys Leu Lys Gly Tyr Thr Ser Trp Ala Ile Gly Leu Ser Val                 245 250 255 Ala Asp Leu Ala Glu Thr Val Met Lys Asn Leu Arg Arg Val His Pro             260 265 270 Ile Ser Thr Met Val Lys Gly Met Tyr Gly Val Ser Ser Asp Val Phe         275 280 285 Leu Ser Val Pro Cys Val Leu Gly Tyr Ala Gly Ile Thr Asp Val Val     290 295 300 Lys Met Thr Leu Lys Ser Glu Glu Glu Glu Lys Leu Arg Lys Ser Ala 305 310 315 320 Asp Thr Leu Trp Gly Ile Gln Lys Glu Leu Gln Phe                 325 330 <210> 7 <211> 332 <212> PRT <213> Ornithorhynchus anatinus <400> 7 Met Ala Gly Val Lys Glu Gln Leu Ile Gln Asn Leu Leu Lys Glu Glu   1 5 10 15 Tyr Ala Pro Gln Asn Lys Ile Thr Val Val Gly Val Gly Ala Val Gly              20 25 30 Met Ala Cys Ala Ile Ser Ile Leu Met Lys Asp Leu Ala Asp Glu Leu          35 40 45 Ala Leu Val Asp Val Ile Glu Asp Lys Leu Lys Gly Glu Met Met Asp      50 55 60 Leu Gln His Gly Ser Leu Phe Leu Arg Thr Pro Lys Ile Val Ser Gly  65 70 75 80 Lys Asp Tyr Ser Val Thr Ala Asn Ser Lys Leu Val Ile Ile Thr Ala                  85 90 95 Gly Ala Arg Gln Gln Glu Gly Glu Ser Arg Leu Asn Leu Val Gln Arg             100 105 110 Asn Val Asn Ile Phe Lys Phe Ile Ile Pro Asn Val Val Lys Tyr Ser         115 120 125 Pro Asn Cys Lys Leu Leu Val Val Ser Asn Pro Val Asp Ile Leu Thr     130 135 140 Tyr Val Ala Trp Lys Ile Ser Gly Phe Pro Lys Asn Arg Val Ile Gly 145 150 155 160 Ser Gly Cys Asn Leu Asp Ser Ala Arg Phe Arg Tyr Leu Met Gly Glu                 165 170 175 Arg Leu Gly Ile His Ser Thr Ser Cys His Gly Trp Val Ile Gly Glu             180 185 190 His Gly Asp Ser Ser Val Val Val Trp Ser Gly Val Asn Val Ala Gly         195 200 205 Val Ser Leu Lys Asn Leu His Pro Asp Leu Gly Thr Asp Ala Asp Lys     210 215 220 Glu Gln Trp Lys Asp Val His Lys Gln Val Val Asp Ser Ala Tyr Glu 225 230 235 240 Val Ile Lys Leu Lys Gly Tyr Thr Ser Trp Ala Ile Gly Leu Ser Val                 245 250 255 Ala Asp Leu Ala Glu Ser Ile Val Lys Asn Leu Arg Arg Val His Pro             260 265 270 Ile Ser Thr Met Ile Lys Gly Leu Tyr Gly Ile Lys Asp Glu Val Phe         275 280 285 Leu Ser Val Pro Cys Val Leu Gly Gln Asn Gly Ile Ser Asp Val Val     290 295 300 Lys Ile Thr Leu Lys Ser Glu Glu Glu Ala His Leu Lys Lys Ser Ala 305 310 315 320 Asp Thr Leu Trp Gly Ile Gln Lys Glu Leu Gln Phe                 325 330 <210> 8 <211> 332 <212> PRT <213> Tursiops truncatus <400> 8 Met Ala Thr Val Lys Asp Gln Leu Ile Gln Asn Leu Leu Lys Glu Glu   1 5 10 15 His Val Pro Gln Asn Lys Ile Thr Val Val Gly Val Gly Ala Val Gly              20 25 30 Met Ala Cys Ala Ile Ser Ile Leu Met Lys Asp Leu Ala Asp Glu Leu          35 40 45 Ala Leu Val Asp Val Ile Glu Asp Lys Leu Lys Gly Glu Met Met Asp      50 55 60 Leu Gln His Gly Ser Leu Phe Leu Arg Thr Pro Lys Ile Val Ser Gly  65 70 75 80 Lys Asp Tyr Ser Val Thr Ala Asn Ser Lys Leu Val Ile Ile Thr Ala                  85 90 95 Gly Ala Arg Gln Gln Glu Gly Glu Ser Arg Leu Asn Leu Val Gln Arg             100 105 110 Asn Val Asn Ile Phe Lys Phe Ile Val Pro Asn Ile Val Lys Tyr Ser         115 120 125 Pro His Cys Lys Leu Leu Val Val Ser Asn Pro Val Asp Ile Leu Thr     130 135 140 Tyr Val Ala Trp Lys Ile Ser Gly Phe Pro Lys Asn Arg Val Ile Gly 145 150 155 160 Ser Gly Cys Asn Leu Asp Ser Ala Arg Phe Arg Tyr Leu Met Gly Glu                 165 170 175 Arg Leu Gly Val His Pro Leu Ser Cys His Gly Trp Ile Leu Gly Glu             180 185 190 His Gly Asp Ser Ser Val Val Val Trp Ser Gly Val Asn Val Ala Gly         195 200 205 Val Ser Leu Lys Asn Leu His Pro Glu Leu Gly Thr Asp Ala Asp Lys     210 215 220 Glu His Trp Lys Ala Ile His Lys Gln Val Val Asp Ser Ala Tyr Glu 225 230 235 240 Val Ile Lys Leu Lys Gly Tyr Thr Ser Trp Ala Val Gly Leu Ser Val                 245 250 255 Ala Asp Leu Ala Glu Ser Ile Met Lys Asn Leu Arg Arg Val His Pro             260 265 270 Ile Ser Thr Met Ile Lys Gly Leu Tyr Gly Ile Lys Glu Asp Val Phe         275 280 285 Leu Ser Val Pro Cys Ile Leu Gly Gln Asn Gly Ile Ser Asp Val Val     290 295 300 Lys Val Thr Leu Thr Pro Glu Glu Gln Ala Cys Leu Lys Lys Ser Ala 305 310 315 320 Asp Thr Leu Trp Gly Ile Gln Lys Glu Leu Gln Phe                 325 330 <210> 9 <211> 332 <212> PRT <213> Rattus norvegicus <400> 9 Met Ala Ala Leu Lys Asp Gln Leu Ile Val Asn Leu Leu Lys Glu Glu   1 5 10 15 Gln Val Pro Gln Asn Lys Ile Thr Val Val Gly Val Gly Ala Val Gly              20 25 30 Met Ala Cys Ala Ile Ser Ile Leu Met Lys Asp Leu Ala Asp Glu Leu          35 40 45 Ala Leu Val Asp Val Ile Glu Asp Lys Leu Lys Gly Glu Met Met Asp      50 55 60 Leu Gln His Gly Ser Leu Phe Leu Lys Thr Pro Lys Ile Val Ser Ser  65 70 75 80 Lys Asp Tyr Ser Val Thr Ala Asn Ser Lys Leu Val Ile Ile Thr Ala                  85 90 95 Gly Ala Arg Gln Gln Glu Gly Glu Ser Arg Leu Asn Leu Val Gln Arg             100 105 110 Asn Val Asn Ile Phe Lys Phe Ile Ile Pro Asn Val Val Lys Tyr Ser         115 120 125 Pro Gln Cys Lys Leu Leu Ile Val Ser Asn Pro Val Asp Ile Leu Thr     130 135 140 Tyr Val Ala Trp Lys Ile Ser Gly Phe Pro Lys Asn Arg Val Ile Gly 145 150 155 160 Ser Gly Cys Asn Leu Asp Ser Ala Arg Phe Arg Tyr Leu Met Gly Glu                 165 170 175 Arg Leu Gly Val His Pro Leu Ser Cys His Gly Trp Val Leu Gly Glu             180 185 190 His Gly Asp Ser Ser Val Val Val Trp Ser Gly Val Asn Val Ala Gly         195 200 205 Val Ser Leu Lys Ser Leu Asn Pro Gln Leu Gly Thr Asp Ala Asp Lys     210 215 220 Glu Gln Trp Lys Asp Val His Lys Gln Val Val Asp Ser Ala Tyr Glu 225 230 235 240 Val Ile Lys Leu Lys Gly Tyr Thr Ser Trp Ala Ile Gly Leu Ser Val                 245 250 255 Ala Asp Leu Ala Glu Ser Ile Met Lys Asn Leu Arg Arg Val His Pro             260 265 270 Ile Ser Thr Met Ile Lys Gly Leu Tyr Gly Ile Lys Glu Asp Val Phe         275 280 285 Leu Ser Val Pro Cys Ile Leu Gly Gln Asn Gly Ile Ser Asp Val Val     290 295 300 Lys Val Thr Leu Thr Pro Asp Glu Glu Ala Arg Leu Lys Lys Ser Ala 305 310 315 320 Asp Thr Leu Trp Gly Ile Gln Lys Glu Leu Gln Phe                 325 330 <210> 10 <211> 252 <212> DNA <213> DNA <400> 10 tcatgtaatt agttatgtca cgcttacatt cacgccctcc ccccacatcc gctctaaccg 60 aaaaggaagg agttagacaa cctgaagtct aggtccctat ttattttttt atagttatgt 120 tagtattaag aacgttattt atatttcaaa tttttctttt ttttctgtac agacgcgtgt 180 acgcatgtaa cattatactg aaaaccttgc ttgagaaggt tttgggacgc tcgaaggctt 240 taatttgcgg cc 252

Claims (22)

A strain Kluyveromyces marxianus for the high-throughput production of lactic acid, comprising a nucleic acid sequence encoding the lactate dehydrogenase (LDH) of SEQ ID NO: 6.
delete delete delete The method according to claim 1,
Wherein said modified microorganism produces lactic acid in a yield of at least 34% from glucose.
The method according to claim 1,
Wherein said modified microorganism produces lactic acid in a yield of at least 12.20% from glucose under the condition of pH 3. &lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;
delete delete delete delete delete delete delete delete delete delete delete Culturing the transformed strain of Kluyveromyces marcianus according to any one of claims 1, 5 and 6 in a glucose-containing medium; And
And recovering the lactic acid produced by said culturing.
delete delete 19. The method of claim 18,
&Lt; / RTI &gt; further comprising the step of producing lactide from the recovered lactic acid.
22. The method of claim 21,
&Lt; / RTI &gt; wherein the method further comprises polymerizing the lactide to form a polylactide polymer.

Images