KR101864928B1 - Biomarker composition for diagnosing butyrate resistant colon cancer comprising CPT1 - Google Patents

Abstract

The present invention relates to a biomarker composition for the diagnosis of butyrate resistant colorectal cancer, which comprises carnitine palmitoyltransferase 1 (CPT1) as an active ingredient, wherein the expression of CPT1 is compared with a control (HCT116 / BR), which is expected to be utilized as a diagnostic target for bacterias resistant colon cancer.

Description

[0001] The present invention relates to bioterrorism resistant colon cancer comprising CPT1 as an active ingredient,

The present invention relates to a biomarker composition for diagnosing butyrate resistant colorectal cancer comprising carnitine palmitoyltransferase 1 (CPT1) as an active ingredient.

Colorectal cancer is one of the most common cancers, and the onset of colorectal cancer is progressively increasing due to changes in lifestyle. Many epidemiological studies have sought to determine the link between dietary fiber and the incidence and progression of colorectal cancer. Butyrate is a short-chain fatty acid that is naturally produced by intestinal microorganisms during dietary fiber fermentation process. It inhibits cell proliferation of colon cancer cells and induces apoptosis. Therefore, it is presented as a target of colon cancer treatment have. Butyrate is cyclin D1, and retinoblastoma; known to inhibit cell proliferation by causing cell cycle arrest in G ₁ and G ₂ phase (phase) which is involved in (retinoblastoma Rb) signaling. It is also well known that histone deacetylases (HDAC) inhibitors such as trichostatin A (TSA) and butyrate promote the improvement of gene expression, which is known as Bak, Bad and Bim Increases pro-apoptotic protein expression and reduces anti-apoptotic protein expression, such as Bcl-2 and Bcl-xL, leading to apoptosis.

On the other hand, butyrate plays an important role as a main energy source in normal colon cells and promotes the proliferation of normal colon cells. However, most cancer cells prefer to use glucose as an energy source even under abundant oxygen conditions, and the colorectal cancer cells do not use the beautilate well, so the anti-cancer effect of the beautilate is increased.

Recently, studies have been reported that colon cancer cells can trigger tolerance to butyrate. As mentioned above, the butyrate is a natural product by dietary fiber fermentation, and the colon cells can be resistant to the butyrate by continuous exposure to the butyrate. Acquisition of tolerance to butyrate may affect drug sensitivity to cell proliferation, cell cycle and invasiveness of colon cancer cells. However, the mechanism for the tolerance of butyrate is not well known. Drug efflux pumps such as P-glycoprotein (P-gp), breast cancer resistant protein (BCRP) and multidrug resistance associated protein 1 (MRP1) May be associated with acquisition of resistance to the rate. These proteins have been reported to affect drug absorption, bioavailability and drug resistance. It may also be related to fatty acid metabolism in terms of the removal of the beautiorate. In previous studies, butyrate-resistant HCT 15 cells were found to prefer the butyrate metabolism more than glucose as an energy source, and the? -Oxidation such as short-chain acyl-CoA dehydrogenase (SCAD) (Luciferase) activity of the acyl-CoA dehydrogenase, an enzyme involved in the production of the enzyme, is increased.

U.S. Published Patent Application No. 2002-0115716 (published on Aug. 22, 2002)

The present invention relates to a biomarker composition for the diagnosis of butyrate resistant colorectal cancer comprising carnitine palmitoyltransferase 1 (CPT1) as an active ingredient, a preparation capable of measuring the expression level of CPT1 as an active ingredient And a screening method for treating a bacterium-resistant colorectal cancer by measuring an expression level of CPT1.

In order to solve the above problems, the present invention provides a biomarker composition for diagnosing butyrate resistant colorectal cancer comprising carnitine palmitoyltransferase 1 (CPT1) as an active ingredient.

In addition, the present invention provides a composition for diagnosing butyrate resistant colorectal cancer comprising, as an active ingredient, a preparation capable of measuring the expression level of CPT1.

In addition, the present invention provides a method for providing information necessary for the diagnosis of butyrate-resistant colorectal cancer by measuring the expression level of CPT1.

In addition, the present invention provides a method for screening for the treatment of bacterium-resistant colon cancer by measuring the expression level of CPT1.

The present invention relates to a biomarker composition for the diagnosis of butyrate resistant colorectal cancer comprising CPT1 as an active ingredient. More particularly, the present invention relates to a biomarker composition for HCT116 / HCT116 / PT (HCT116 / PT) (HCT116 / BR) to study the increase in the virulence resistance of the colon cancer cell line HCT116. As a result, it was confirmed that energy metabolism was changed when colon cancer cells were chronically exposed to butyrate, and that the related mechanism had an effect on the increase of tolerance to butyrate and other anti-cancer drugs of colon cancer cells, In particular, it was confirmed that the expression of carnitine palmitoyltransferase 1 (CPT1) was significantly increased in butyrate-resistant cells (HCT116 / BR) and could be used as a diagnostic target for bacterias resistant colon cancer .

Figure 1 shows a micrograph of HCT116 parent cells (HCT116 / PT) (left) and butyrate resistant HCT116 (HCT116 / BR) cells (right). The morphology of each cell was observed through an optical microscope. The magnification is × 200. Arrows indicate vacuole.
2 shows the results of cell proliferation measured by MTT assay. (HCT116 / PT, < / RTI &gt; and HCT116) cells. The dose-response curves are shown in Table 1. The dose-response curves are shown as A, paclitaxel, fluorouracil (5-FU) (C), doxorubicin (D), and trichostatin A ) (E) Processing results are shown. Results were expressed as mean ± SD. The experiment was repeated three times, three times.
Figure 3 shows the protein expression results of the drug efflux pump. P-glycoprotein (P-gp), breast cancer resistant protein (BCRP) and multidrug resistance-associated protein 1 (HCT116 / and multidrug resistance associated protein 1 (MRP1). beta -actin was used as a loading control. Band density was measured with Image J software.
Figure 4 shows the results of relative DNA content analysis in the cell cycle. Cell cycle progression was analyzed by flow cytometry analysis with propidium iodide staining. HCT116 / HCT116 / PT, 6.4 mM butyrate were incubated for 24 h with single-handled HCT116 / PT (HCT116 / AT_6. 4) and butyrate resistant HCT116 (HCT116 / BR) cells. (A) The histogram was obtained by flow cytometry. (B) The bar graph represents the relative percentage distribution of the cell cycle in each sample. Results were expressed as mean ± SD. The experiment was repeated three times, three times. *, P &lt;0.05; **, P &lt;0.01; ***, P < 0.001.
5 shows the results of protein expression in the cell cycle. Proteins associated with the cell cycle were analyzed by immunoblot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Band density was measured with Image J software.
6 shows the results of protein expression for apoptosis. Phosphorylated extracellular signal-regulated kinase 1/2 (p-Erk1 / 2) and Bcl-2 family members were detected by immunoassay. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. Band density was measured with Image J software.
Figure 7 shows the results of gelatin zymography analysis of matrix metalloproteinases-9 (MMP-9). (A) Results of MMP-9 expression after 72 hours of reaction, (B) Results of quantitative analysis of band density using Image J software. Results were expressed as mean ± SD. The experiment was repeated three times, three times. *, P &lt;0.05; **, P < 0.01.
Figure 8 shows the effect of the beating rate on wound healing. Wound healing analysis for butyrate (2 mM), paclitaxel (100 nM), doxorubicin (10 μM) and TSA (300 nM) in HCT116 parental (HCT116 / PT) and butyrate resistant HCT116 Respectively. (A) Photographs after 12 hours of drug treatment. (B) Percentage of wound area after 12 hours of treatment compared to 0 hours. Results were expressed as mean ± SD. The experiment was repeated three times, three times. *, P &lt; 0.05.
FIG. 9 shows mRNA expression results of enzymes related to glucose and fatty acid metabolism. (A) hexokinase 2 (HK2), short-chain acyl-CoA dehydrogenase (SCAD) and long-chain acyl-CoA dehydrogenase ), (B) qRT-PCR was performed to quantify mRNA expression of carnitine palmitoyltransferase 1A, 1B and 1C (carnitine palmitoyltransferase 1A, 1B and 1C; CPT1A, CPT1B and CPT1C). HCT116 / PT. &Lt; / RTI &gt; Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control. The experiment was repeated three times, three times. ***, P &lt; 0.001.

Accordingly, the present inventors constructed a butyrate-resistant colon cancer cell line and studied the effect on the resistance to butyrate in colorectal cancer cells, in particular, sensitivity to chemotherapeutic drugs, cell cycle, invasiveness and energy metabolism characteristics Respectively. As a result, the present inventors confirmed that carnitine palmitoyltransferase 1 (CPT1), which is an enzyme that transports a long chain fatty acid from cytoplasm to mitochondria for? -Oxidation, may be related to butyrate resistance, .

The present invention provides a biomarker composition for diagnosing butyrate resistant colorectal cancer comprising carnitine palmitoyltransferase 1 (CPT1) as an active ingredient.

In detail, the CPT1 may be any one or more selected from the group consisting of CPT1A, CPT1B, and CPT1C, but is not limited thereto.

Preferably, the CPT1 may be all eukaryotic genes or proteins having CPT1 including mammals such as human, bovine, goat, sheep, pig, mouse, rabbit and the like. (NCBI accession No. NM_001876, NP_001867), CPT1B gene or protein (NCBI accession No. NM_004377, NP_004368), CPT1C gene or protein (NCBI accession No. NM_001136052, NP_001129524) were used as targets.

The term &quot; diagnosing &quot; herein is used to determine the susceptibility of an object to a particular disease or disorder, to determine whether an object currently has a particular disease or disorder, Determining the prognosis of the object, or therametrics (e.g., monitoring the status of the object to provide information about the therapeutic efficacy).

In addition, the present invention provides a composition for diagnosing butyrate resistant colorectal cancer comprising, as an active ingredient, a preparation capable of measuring the expression level of CPT1.

In detail, the agent capable of measuring the expression level of CPT1 may be a primer or a probe specifically binding to the CPT1 gene, an antibody, a peptide, an aptamer or a compound specifically binding to the CPT1 protein, But is not limited thereto.

In detail, the CPT1 may be any one or more selected from the group consisting of CPT1A, CPT1B, and CPT1C, but is not limited thereto.

The present invention also provides a kit for the diagnosis of a butyrate resistant colorectal cancer comprising the above composition.

As used herein, the term "primer" refers to a nucleic acid sequence capable of forming base pairs with a complementary template with a short free 3 'hydroxyl group and having a short Refers to a nucleic acid sequence. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. The PCR conditions, the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

As used herein, the term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides that can specifically bind to an mRNA. The presence or absence of a specific mRNA, You can check the amount. The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.

As used herein, the term "antibody" means a specific immunoglobulin as indicated in the art and directed against an antigenic site. An antibody in the present invention refers to an antibody that specifically binds to CPT1 of the present invention, and an antibody can be produced according to a conventional method in the art. The forms of the antibodies include polyclonal or monoclonal antibodies, including all immunoglobulin antibodies. The antibody refers to a complete form having two full-length light chains and two full-length heavy chains. The antibody also includes a special antibody such as a humanized antibody.

In addition, the kit of the present invention comprises an antibody specifically binding to a marker component, a secondary antibody conjugate conjugated with a label that develops upon reaction with the substrate, a coloring substrate solution to be colored with the label, A reaction stop solution, and the like, and may be manufactured from a number of separate packaging or compartments including the reagent components used.

As used herein, the term "peptide" has a high binding capacity to the target material and does not cause denaturation during thermal / chemical treatment. Also, because of its small size, it can be used as a fusion protein by attaching it to other proteins. It can be used as a diagnostic kit and a drug delivery material because it can be specifically attached to a polymer protein chain.

The term "aptamer " as used herein refers to a specific type of single-stranded nucleic acid (DNA, RNA or modified nucleic acid having a stable tertiary structure by itself and having a characteristic capable of binding with high affinity and specificity to a target molecule ). &Lt; / RTI &gt; As described above, since the aptamer is composed of a polynucleotide which is capable of specifically binding to an antigenic substance like the antibody and is more stable than the protein, has a simple structure, and is easy to synthesize, .

(1) measuring the mRNA expression level of CPT1 gene or the expression level of CPT1 protein from a sample isolated from colon cancer patients; (2) comparing the mRNA expression level of the CPT1 gene or the expression level of the CPT1 protein with a control sample; And (3) determining that the CPT1 gene has high mRNA expression level or expression level of the CPT1 protein is higher than that of the control sample, it is determined to be a colorectal cancer resistant to butyrate. &Lt; / RTI &gt;

In detail, the CPT1 may be any one or more selected from the group consisting of CPT1A, CPT1B, and CPT1C, but is not limited thereto.

In detail, the method of measuring the mRNA expression level may be RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay ), Northern blotting and DNA chips, but are not limited thereto.

In detail, the method of measuring the protein expression level may be Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, ouchterlony immunodiffusion, But are not limited to, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assays, complement fixation assays, FACS and protein chips.

As used herein, the term "a sample isolated from a colon cancer patient" refers to a tissue, cell, whole blood, serum, plasma, saliva, or saliva in the expression level of CPT1 gene or CPT1 protein, , Specimens such as sputum, cerebrospinal fluid, or urine.

(1) contacting a test substance to a butyrate resistant colorectal cancer cell; (2) measuring the degree of expression or activity of the CPT1 gene or protein in the butyrate resistant colorectal cancer cells in contact with the test substance; And (3) selecting a test substance having decreased expression or activity level of the CPT1 gene or protein as compared with a control sample.

In detail, the CPT1 may be any one or more selected from the group consisting of CPT1A, CPT1B, and CPT1C, but is not limited thereto.

The term "test substance" used in reference to the screening method of the present invention refers to an unknown candidate substance used in screening in order to examine whether it affects the expression amount of a gene or affects the expression or activity of a protein. do. Such samples include, but are not limited to, chemicals, nucleotides, antisense-RNA, siRNA (small interference RNA) and natural extracts.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Experimental Example >

The following experimental examples are intended to provide experimental examples that are commonly applied to the respective embodiments according to the present invention.

1. Reagents

Sodium butyrate, TSA, mitomycin C, 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium- 5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium-bromide (MTT) and protease inhibitory cocktail were purchased from Sigma-Aldrich (St. Louis, Mo., USA). Fetal bovine serum (FBS), RPMI 1640 medium and Dulbecco's phosphate buffered saline (DPBS) were purchased from Invitrogen (Carlsbad, CA, USA). All secondary antibodies used in the present invention were purchased from Cell Signaling Technology (Beverly, MA, USA) and Santa Cruz Biotechnology (Santa Cruz, CA, USA) . Enhanced chemiluminescence solution (ECL) was purchased from Detroit R & D, Inc. (Detroit, MI, USA). SYBR Select Master Mix was purchased from Applied Biosystems (Foster City, CA, USA) and all primers used in the present invention were synthesized in Bionics (Seoul, Korea). Propidium iodide and RNase A were purchased from Abcam (Cambridge, UK).

2. Butyrate  Establishing a resistant cell line

HCT116 human colon cancer cell lines is American Type Culture Collection was purchased from (ATCC, Manassas, VA, USA ), 10% FBS and 1% penicillin-streptomycin in 5% CO ₂ incubator using RPMI 1640 medium with added 37 ℃ Lt; / RTI &gt; To establish the butyrate resistant HCT116 colon cancer cell line (HCT116 / BR), HCT116 parental cells (HCT116 / PT) were treated with increasing concentrations of sodium butyrate from low to 1.6 mM for 3 months . Butyrate stocks were prepared by dissolving sodium butyrate in DPBS. The cells were treated overnight after incubation for cell attachment.

3. Cell proliferation assay

HCT116 / PT and HCT116 / BR cells were inoculated into 96-well plates. Cells were treated with various concentrations of butyrate, paclitaxel, 5-fluorouracil (5-FU), doxorubicin and TSA. After culturing for 72 hours, the medium was removed, and 0.5% MTT stock was diluted in the medium at a ratio of 1:10, and 100 쨉 l was added to each well, followed by further incubation at 37 캜 for 2 hours. Next, dimethylsulfoxide (DMSO) was added to dissolve the purple formazan crystals and the absorbance was measured using ELISA (Bio-Tek Instruments Inc., Winooski, VT, USA) at 540 nm.

4. Flow cell  analysis

For clarity on cell cycle progression, HCT116 / PT and HCT116 / BR cells were inoculated into a 60 mm dish. After overnight incubation, HCT116 / PT cells were treated with 6.4 mM butyrate for 24 hours, cells were trypsinized, and centrifuged at 500 g for 5 minutes at 4 [deg.] C. After fixed at 70 ° C in ethanol at 4 ° C, 1 ml propidium iodide staining solution (final concentration 50 μg / ml) containing 200 μg / ml RNase A was treated for 30 minutes under dark conditions . Flow cytometry was analyzed using flow cytometry (Beckman Coulter, Brea, CA, USA).

5. Protein extraction and Immune Blot  analysis

Cells were lysed with cell lysis buffer containing protease inhibition cocktail, and protein concentration was measured using bicinchoninic acid (BCA) assay. Protein samples (20-30 μg per lane) were separated on 7.5-12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to nitrocellulose membranes. For immunodetection, the blots were incubated with 1: 1000 in tris-buffered saline (TBS-T) containing 5% bovine serum albumin (BSA) and 0.1% The diluted primary antibody was reacted by slow shaking at 4 ° C overnight, then reacted with secondary antibody conjugated with horseradish peroxidase at room temperature. Antigen-antibody complexes were detected using an ECL reagent with an ImageQuant LAS-4000 mini (GE Healthcare Life Sciences, Piscataway, NJ, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or? -Actin was used as a loading control.

6. Gelatin Zymography (Gelatin zymography )

Matrix metalloproteinases (MMPs) activity was detected using gelatin zymography. Briefly, cells were cultured in a 60 mm dish, and when the cell density reached 80%, the medium was replaced with serum-free medium to promote MMPs secretion. After 48 hours of incubation, the medium was harvested and concentrated using Speed-vac (Savant / EC Instruments, Niantic, CT, USA). Electrophoresis was performed on 10% SDS-PAGE gel (Wako Pure Chemical Industries, Ltd., Osaka, Japan) containing 0.1% gelatin without reducing agent and boiling process. After electrophoresis, the gel was immersed in the reconstitution buffer (2.5% Triton X-100, v / v) for 1 hour, rinsed 3 times with distilled water and diluted in running buffer (50 mM Tris-base, 150 mM NaCl, 1 μM ZnCl ₂ And 50 mM CaCl ₂ ) at 37 ° C for 72 hours, stained with 0.5% (w / v) Coomassie blue, and stained with de-staining buffer (methanol: acetic acid: water, 10: 5: 85, v / v) Lt; / RTI &gt; Gel images were scanned by Gel-Doc Imaging System (Bio-Rad) and band density was measured using Image J software.

7. Wound healing analysis

To make a dense monolayer of cells, cells were seeded in 6-well plates and incubated overnight. Mitomycin C (final concentration 25 μg / ml) was treated and removed for 30 minutes. An injury line was made straight in the center of the cell. After washing with DPBS, the cells were treated with a chemotherapeutic drug and incubated for 24 hours or more. The width of the scratched line at appropriate time intervals was measured and compared with each well measured at 0 h.

8. RNA Extraction and cDNA Synthesis

Total RNA was extracted from two cell lines using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and RNA was extracted from the spin column using RNase-free water. RNA concentration was measured at 260 nm absorbance using NanoDrop (Thermo Scientific, Waltham, Mass., USA) and RNA samples were stored at -80 ° C in a cryo freezer (Thermo Scientific). Using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems), 1 μg of total RNA sample was reverse transcribed under the following conditions. 10 minutes at 25 占 폚; 120 minutes at 37 占 폚; After incubation at 85 ° C for 5 minutes, cDNA was synthesized and stored at -20 ° C until quantitative reverse transcriptase polymerase chain reaction (qRT-PCR).

9. qRT - PCR

Hexokinase 2 ( HK2 ), SCAD , long-chain acyl - CoA dehydrogenase ( LCAD ), CPT1A, CPT1B And CPT1C mRNA expression was measured by qRT-PCR using SYBR Select Master Mix with ABI StepOnePlus system (Applied Biosystems). The primer sequences used in qRT-PCR are shown in Table 1. All experimental samples were performed 3 times in triplicate and expression changes were calculated using the 2 ^{- ΔΔCt} method through standardization for GAPDH .

Gene Sequence (5'-3 ') T _a (° C) ^a bp ^b HK2 forward ATTGTCCAGTGCATCGCGGA 52.5 215 reverse AGGTCAAACTCCTCTCGCCG SCAD forward CGGCAGTTACACACCATCTAC 52.5 104 reverse GCAATGGGAAACAACTCCTTCTC LCAD forward TGCAATAGCAATGACAGAGCC 50.0 148 reverse CGCAACTACAATCACAACATCAC CPT1A forward ATCAATCGGACTCTGGAAACGG 52.5 121 reverse TCAGGGAGTAGCGCATGGT CPT1B forward CCTGCTACATGGCAACTGCTA 52.5 128 reverse AGAGGTGCCCAATGATGGGA CPT1C forward GGGCCGCTTTCTTTGTGTC 52.5 150 reverse AGAAGACGATTAGGGTGAAGGAT GAPDH forward CCACCCATGGCAAATTCCCATGGCA 63.0 600 reverse CTGGACGGCAGGTCAGGTCCACC ^a T _a , annealing temperature,
^b bp, base pair

10. Statistical Analysis

Results were expressed as mean ± SD. Statistical analysis was performed using GraphPad Prism 5 software. Results were compared using unpaired two-tailed t- test or Dunnett's post hoc test according to one way analysis of variance (ANOVA). P <0.05 was considered statistically significant.

< Example  1> Butyrate  tolerance HCT116  Establishment of cell line

HCT116 / BR was established by chronic exposure of the butyrate to the HCT116 human colon cancer cell line for 3 months. The HCT116 / BR continued to grow even with continuous exposure of the beautilate. The morphology of the cells changed slightly (Fig. 1). The HCT116 / BR cancer cells are cuboid, sharp and pointed, while the HCT116 / BR has a more rounded, extended shape. In addition, vacuolization was observed in HCT116 / BR cells. Cell growth rates were slightly slower in HCT116 / BR cells.

< Example  2> HCT116 / BR Chemotaxis in cells

To determine if tolerance to the butyrate is accompanied by tolerance of other chemotherapeutic drugs, the inventors measured the cell viability of the chemotherapeutic drug through MTT assay. HCT116 / PT and HCT116 / BR cells were treated with butyrate, paclitaxel, 5-FU, doxorubicin and TSA and the dose-response curves and inhibitory concentration 50 (IC ₅₀ ) Respectively. The anti - proliferative effect was increased in a concentration - dependent manner in both cells, but HCT116 / BR was most chemically resistant. IC ₅₀ values for butyrate, paclitaxel, 5-FU, doxorubicin and TSA in HCT116 / BR cells were 10.8, 2.42, 2.36, 4.31 and 11.3 times higher than HCT116 / PT, respectively.

Chemotherapeutic drugs HCT116 / PT HCT116 / BR Butyrate (mM) 0.508 5.50 Paclitaxel (nM) 5.89 14.3 5-FU (mM) 7.28 17.1 Doxorubicin (nM) 541 2,330 Trichostatin (nM) 36.3 412 IC _50, 50% inhibition of cell proliferation

< Example  3> Protein expression of drug efflux pump

Drug outflow pumps are known to be associated with drug resistance. One of the possible mechanisms of increased chemical tolerance by the butyrate is that the butyrate may regulate the expression of the drug efflux pump. To confirm the expression of the drug efflux pump, the inventors confirmed protein expression of P-gp, BCRP and MRP1 through immunoblot analysis (FIG. 3). There was no significant difference in expression of P-gp and BCRP between the two cell lines, and MRP1 was not detected in both HCT116 / PT and HCT116 / BR cells. That is, the drug efflux pump did not affect the chemotoxic characteristics of HCT116 / BR cells.

< Example  4> At the rate of  Induced cell cycle arrest

It has been reported that butyrate induces cell cycle arrest and apoptosis in cancer cells, indicating that the HCT116 / BR of the present invention is not affected by this. We performed flow cytometry to determine the effect of the Bileat on the cell cycle progression of HCT116 / BR cells (Figure 4). We also compared HCT116 / PT and HCT116 / BR cells with HCT116 / PT (HCT116 / AT_6.4) treated with 6.4 mM butyrate (4 times 1.6 mM) for 24 hours. Treatment of the 6.4 mM butyrate gave SubG ₁ &lt; RTI ID = 0.0 &gt; _{1 &lt;} / RTI _&gt; (6.69% vs. 0.47%), indicating that apoptosis is triggered. However, HCT116 / BR cells showed similar subG ₁ (0.68%) as HCT116 / PT cells. In the cell cycle, the S group, a DNA replicator, increased 62.0% in HCT116 / BR compared to HCT116 / PT cells. In addition, the G ₂ group increased by two times (51.4% vs. 21.6%) compared to HCT116 / PT cells in HCT116 / AT_6.4, but was similar to that of the control group in HCT116 / BR cells (29.1%).

< Example  5> Protein expression in cell cycle and apoptosis

To confirm that protein expression in HCT116 / PT and HCT116 / BR cells is related to cell cycle and apoptosis, we performed immunoblot analysis. To confirm the effect of acute treatment of the vialate, we treated HCT116 cells with 1.6 and 6.4 mM butyrate (HCT116 / AT_1.6 and HCT116 / AT_6.4, respectively) for 24 hours.

Compared with HCT116 / PT cells, the expression of p21 ^{Waf1 / Cip1} was greatly increased in HCT116 / AT_1.6 and HCT116 / AT_6.4 cells treated with acute butyrate, but slightly increased in HCT116 / BR cells ). Compared to HCT116 / PT cells, HCT116 / BR cells showed increased cyclin D1 expression. Expression of the CDK4 protein was almost unchanged. Rb decreased in HCT116 / BR. Cyclin E is activated by forming the Cyclin E / CDK2 complex. Cyclin E expression was slightly increased by butyrate, but CDK2 was significantly reduced in HCT116 / BR cells.

The Bcl-2 family, including Bcl-xL, Bim and Bax, is involved in the regulation of apoptosis, and the expression of the protein is shown in FIG. Bcl-xL, an important anti-apoptotic protein, was reduced by acute treatment of butyrate, but increased significantly in HCT116 / BR cells. Bim and Bax are referred to as pro-apoptotic proteins, and these have been reduced in both acute and chronic treatments of butyrate. Activation of extracellular signal-regulated kinases (Erk) in HCT116 / BR also decreased Bim expression and increased expression of p-Erk1 / 2.

< Example  6> Invasive  there is Boutilate  effect

To confirm cell invasiveness and metastasis activity, we performed gelatin assays and wound healing assays (FIGS. 7 and 8). Wound healing rates were generally lower in HCT116 / BR than in HCT116 / PT. MMP-9 plays an important role in cancer cell metastasis, with no significant differences between HCT116 / PT and HCT116 / BR cells in gelatin assays (FIG. 7). However, short treatment of the vialate significantly increased MMP-9 in both CT116 / AT_1.6 and HCT116 / AT_6.4 cells. MMP-2 was not detected in both HCT116 / PT and HCT116 / BR cells. Treatment of butyrate, paclitaxel and TSA with HCT116 / PT and HCT116 / BR resulted in no significant difference in wound healing rates between HCT116 / PT and HCT116 / BR, but treatment of doxorubicin significantly inhibited wound healing in both cells .

< Example  7> Changes in energy metabolism

Another possibility of acquiring tolerance to beautylate is a change in energy metabolism. The present inventors have estimated that in order to remove the butyrate, β-oxidation may occur in HCT116 / BR. Thus, the present inventors analyzed mRNA expression of an enzyme involved in fatty acid and glucose metabolism, and the results are shown in FIG. SCAD and LCAD are enzymes involved in? -Oxidation of short chain and long chain fatty acids, respectively. As expected, the expression of SCAD and LCAD increased 3.01 and 5.20 fold in HCT116 / BR, respectively, compared to HCT116 / PT. In addition, CPT1A, CPT1B and CPT1C increased 9.29, 14.3 and 27.1 times in HCT116 / BR, respectively, compared to HCT116 / PT. On the other hand, HK2 , which is involved in glycolysis and is frequently overexpressed in cancer cells, decreased significantly in HCT116 / AT_1.6 (0.256-fold) and HCT116 / AT_6.4 (0.495-fold). In HCT116 / BR cells (0.966-fold), the expression of HK2 was similar to that of HCT116 / PT.

Having described the present invention in detail, it will be apparent to those skilled in the art that this specific description is only a preferred embodiment and that the scope of the present invention is not limited thereby. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (10)

A biomarker composition for the diagnosis of tolerance to butyrate of colon cancer which comprises carnitine palmitoyltransferase 1C (CPT1C) as an active ingredient. delete A composition for diagnosing tolerance to butyrate of colorectal cancer, comprising as an active ingredient, a preparation capable of measuring the expression level of CPT1C. 4. The method according to claim 3, wherein the agent capable of measuring the expression level of CPT1C is a primer or a probe specifically binding to the CPT1C gene, an antibody, a peptide, an aptamer or a compound specifically binding to the CPT1C protein Wherein the composition for diagnosing tolerance to viral diseases is colon cancer. delete A kit for the diagnosis of tolerance to butyrate of colorectal cancer comprising the composition of claim 3 or 4. (1) measuring the mRNA expression level of CPT1C gene or the expression level of CPT1C protein from a sample isolated from colon cancer patients;
(2) comparing the mRNA expression level of the CPT1C gene or the expression level of the CPT1C protein with a control sample; And
(3) If the mRNA expression level of the CPT1C gene or the expression level of the CPT1C protein is higher than that of the control sample, the colon cancer is judged to be resistant to the butyrate. How to. delete delete delete

Images