KR101856477B1 - Composition comprising complex of ginsenodise as an effective ingredient for preventing or treating of bone disease - Google Patents

Abstract

The present invention relates to a composition for preventing or treating bone diseases comprising a ginsenoside complex as an active ingredient. More specifically, the present invention relates to a composition for preventing, treating or alleviating bone diseases, which comprises, as an active ingredient, a ginsenoside complex composed of ginsenoside Rd and ginsenoside Re, wherein a weight ratio of the Rd to the Re ranges from 2:1 to 2:3. The composition according to the present invention has desirable effects of promoting proliferation and differentiation of osteoblasts and formation of bone calcification, and thus can be beneficially used in the prevention or treatment of bone diseases such as osteoporosis and the like.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for preventing or treating bone diseases, which comprises a compound ginsenoside as an active ingredient. BACKGROUND OF THE INVENTION [0002]

The present invention relates to a composition for preventing or treating bone diseases, which comprises a complex ginsenoside as an active ingredient.

Bone tissue is a dynamic tissue that is constantly absorbed and formed to maintain bone mass and skeletal homeostasis. Bone remodeling involves two types of cells that function in a specific way. While osteoclasts absorb bone, osteoblasts play a role in synthesizing and filling bone matrix. Therefore, bone mass depends on the relative function of these cells. In normal adults, there is always a balance between the amount of bone resorption and the amount of bone formation. The bone remodeling takes place over a period of time and occurs locally in a narrow region, so that the structure of the skeletal system is maintained. The structure and function of the skeletal system is controlled by the complex interactions between systemic hormones and local factors. The imbalance between osteoblast and osteoclast activity is due to skeletal abnormalities due to osteoporosis or osteosclerosis. There are various theories and arguments as to whether this imbalance of bone metabolism is caused by a decrease in function of osteoblast cells or an increase in osteoclast activity or an increase in osteoclast activity. The factors of osteoporosis include age, Deficiency, lack of exercise, lack of calcium intake, genetic factors, drug use, and hormonal effects.

Osteoporosis, which is a major problem in the aged society, is a disease that can cause bone fracture in a slight impact due to a decrease in the bone mass in the unit volume without a significant change in the chemical composition of the bone. It is known that the elderly, especially postmenopausal women, are most likely to have a high incidence of estrogen secretion. However, even in men, bone mass tends to decrease with aging, and the fracture rate of elementary and middle school students has more than doubled in recent 20 years. In terms of prevention or treatment of bone disease due to bone metabolic imbalance, it is important to raise bone mass from a young age, and thus maintaining bone health is an important issue regardless of gender or age.

Korean Patent Publication No. 10-2014-0111097 (2014.09.18)

The present invention includes a compound ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3. Pharmaceutical compositions and the like.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention includes a compound ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3. To provide a pharmaceutical composition.

The total concentration of the complex ginsenosides may be between 10 [mu] M and 50 [mu] M.

The complex ginsenosides may be those having osteoblast proliferation and differentiation promotion or bone calcification formation ability.

The complex ginsenoside is selected from the group consisting of alkaline phosphatase (ALP), osteopontin (OPN), type I collagen (ColI), RUNX2 (RUNX2) and bone morphogenetic protein- May be to increase one or more bone-associated factor activities.

The above-mentioned bone diseases include, but are not limited to, osteoporosis, Paget's bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatic or degenerative bone disease, bone metastatic lesion, primary bone- Inflammatory alveolar bone disorder disease and inflammatory bone resorption disease.

In one embodiment of the present invention, the complex ginsenoside consisting of ginsenoside Rd and ginsenoside Re is contained as an active ingredient, and the weight ratio of Rd and Re is 2: 1 to 2: 3. A health functional food for preventing or improving disease.

The present invention relates to a method for preventing, treating, or ameliorating bone diseases, which comprises a complex ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: The present invention relates to a composition for improving osteoblast, and more particularly, to a composition for improving osteoblast proliferation and differentiation promoting activity and a composition for enhancing bone calcification when Re selected from among protopanaxadiol-based ginsenosides and Re selected from protopanaxadiol-based ginsenosides are combined at specific weight ratios And can be usefully used for preventing or treating bone diseases such as osteodystrophy.

FIG. 1 is a graph comparing cell survival rates to osteoblast cell lines as a result of treating compositions according to Examples 1 to 4 and compositions according to Comparative Examples 1 to 10. FIG.
Fig. 2 is a photograph comparing the ability of the composition according to Example 1 and the composition according to Comparative Examples 1 and 2 to form calcification. Fig.
FIGS. 3 (a) to 3 (e) are graphs comparing the bone-related factor activity of the composition according to Examples 1, 3 and 4 and the composition according to Comparative Examples 1 to 2 and 6 to 10.

The inventors of the present invention found that when performing a study on the efficacy of ginsenoside-related bone disease, when Re selected from among protopanaxadiol-based ginsenosides and Re selected from protopanaxadiol-based ginsenosides are combined at a specific weight ratio, Confirming that it has the cell proliferation and differentiation promoting effect and the ability to form bone calcification, thereby completing the present invention.

Hereinafter, the present invention will be described in detail.

Pharmaceutical composition for preventing or treating bone diseases

The present invention includes a compound ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3. To provide a pharmaceutical composition.

The pharmaceutical composition for preventing or treating bone diseases according to the present invention comprises a compound ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3 .

Specifically, the complex ginsenoside is composed of ginsenoside Rd and ginsenoside Re, and the weight ratio of Rd and Re is 2: 1 to 2: 3.

First, the ginsenoside Rd is selected from protopanaxadiol-based ginsenosides and is represented by the following formula 1:

[Chemical Formula 1]

.

.

The ginsenoside Rd is preferably extracted from ginseng, red ginseng, wild ginseng or wild ginseng culture root, but is not limited thereto. Ginsenoside is also referred to as saponin when extracted from rice, bellflower, roots, beans and the like, and this saponin is included in the definition of ginsenoside in the present invention in the same concept as ginsenoside.

In addition to the ginsenosides Rd, ginsenosides Rb1, Rb2, Rc, and the like are also classified as protopanaxadiol-based ginsenoside, but these ginsenosides Rb1, Rb2, Rc, It is preferable to exclude it from the components of the composition for treating or preventing osteogenesis, but the present invention is not limited thereto. Particularly, since ginsenosides Rb1, Rb2, and Rc decrease BMP-2 activity corresponding to ALP and osteogenic factors, which are associated with osseointegration-related factors, have.

Next, the ginsenoside Re is selected from protopanaxyl triol ginsenosides and is represented by the following formula (2): < EMI ID =

(2)

.

.

The ginsenoside Re is also preferably extracted from ginseng, red ginseng, wild ginseng or wild ginseng culture root, but is not limited thereto.

In addition to the above ginsenosides Re, ginsenosides Rg1 and Rg2 are also classified as protoplast tridentate ginsenosides, but these ginsenosides Rg1 and Rg2 do not have excellent osteoblast proliferation and differentiation promoting activity and ability to form bone calcification It is preferable to exclude it from the components of the composition for treating or preventing osteogenesis, but the present invention is not limited thereto. Particularly, ginsenosides Rg1, Rg2, and the like have a problem of reducing ALP corresponding to a bone-related molecule-promoting factor and BMP-2 activity corresponding to a bone formation-related factor and thus preventing or treating bone diseases.

More preferably, the weight ratio of Rd and Re is 2: 1 to 2: 3, and the weight ratio of Rd and Re is preferably 2: 2 to 2: 3. 2: 2.5 to 2: 3, but is not limited thereto. At this time, when the weight ratio of Rd and Re is out of the above range, the effect of promoting osteoblast proliferation and differentiation is reduced, so that there is a problem that the bone disease treatment or prevention effect can not be effectively exerted.

On the other hand, the total concentration of the complex ginsenosides is preferably 10 μM to 50 μM, more preferably 10 μM to 25 μM, but is not limited thereto. At this time, by maintaining the total concentration of the complex ginsenoside from 10 μM to 50 μM, it was possible to increase the activity of ALP, OCN and Col I corresponding to bone matrix promoting factors without cytotoxicity, And BMP-2 activity can be significantly increased. As the total concentration of the complex ginsenosides increases, the bone-associated factor activity tends to increase. However, in the case of BMP-2 activity, when the total concentration of the complex ginsenosides is more than 25 μM, Can be rather reduced as compared with the case where the total concentration of the side is 25 [mu] M or less.

The above-mentioned bone disease is caused by a decrease in function of osteoblasts, and includes osteoporosis, Paget's bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatic or degenerative bone disease, bone metastatic lesion, A tumor generated in bone, periodontal disease, inflammatory alveolar bone disease, and inflammatory bone resorption disease, and more preferably osteoporosis, but is not limited thereto.

The pharmaceutical composition for preventing or treating bone diseases according to the present invention may be in the form of oral preparations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations, suppositories and sterilized injection solutions And may contain suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions for formulation.

The carrier or the excipient or diluent includes lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

In the case of formulation, a diluent or excipient such as a commonly used filler, a weight agent, a binder, a wetting agent, a disintegrant or a surfactant may be used.

The solid preparation for oral administration can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin and the like in the complex ginsenoside. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of the liquid preparation for oral administration include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for preventing or treating bone diseases according to the present invention varies depending on the condition of the patient, the body weight, the degree of disease, the drug form, the administration route and the period, but can be appropriately selected by those skilled in the art. However, for a desired effect, the dose may be 0.0001 to 2,000 mg / kg, preferably 0.001 to 2,000 mg / kg per day. The administration may be carried out once a day or divided into several doses. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for preventing or treating bone diseases according to the present invention can be administered to mammals such as rats, mice, livestock, and humans in various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

Health functional foods for preventing or improving bone diseases

The present invention also relates to a method for preventing or treating bone diseases, which comprises the step of mixing a compound ginsenoside comprising ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3. And provides a health functional food for improvement.

The health functional food for preventing or ameliorating bone diseases according to the present invention comprises a complex ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3 , And the compound ginsenoside is as described above.

The above-mentioned bone disease is caused by a decrease in function of osteoblasts, and includes osteoporosis, Paget's bone disease, rickets, osteomalacia, renal osteodystrophy in patients with renal failure, rheumatic or degenerative bone disease, bone metastatic lesion, A tumor generated in bone, periodontal disease, inflammatory alveolar bone disease, and inflammatory bone resorption disease, and more preferably osteoporosis, but is not limited thereto.

In the health functional food for preventing or ameliorating bone diseases according to the present invention, when the complex ginsenoside is used as an additive for a health functional food, it may be added as it is or may be used together with other foods or food ingredients, It can be used appropriately. The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, the compound ginsenoside may be added in an amount of not more than 15 parts by weight, preferably not more than 10 parts by weight, based on 100 parts by weight of the raw material. However, in the case of long-term consumption intended for health or hygiene purposes or for the purpose of controlling health, the amount may be less than the above range. Further, since the present invention uses natural products, there is no problem in terms of safety. Can also be used.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for preventing or ameliorating bone diseases according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, Stabilizers, preservatives, glycerin, alcohols, and carbonating agents used in carbonated beverages. In addition, the composition for improving sleep of the present invention may contain flesh for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Accordingly, the present invention provides a method for preventing and treating bone diseases, comprising administering to a patient in need thereof a compound ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient, wherein the weight ratio of Rd and Re is 2: 1 to 2: The present invention relates to a composition for treating or ameliorating osteogenic cell proliferation and differentiation, and is characterized in that, when a Re selected from protopanaxadiol-based ginsenosides and Re selected from protopanaxadiol-based ginsenosides are combined at specific weight ratios, And can be usefully used for preventing or treating bone diseases such as osteodystrophy.

In addition, the present invention includes a step of treating osteoblast cells with a complex gynecenose consisting of ginsenoside Rd and ginsenoside Re, wherein the weight ratio of Rd and Re is 2: 1 to 2: 3 To increase the activity of the bone-associated factor.

Wherein said bone-associated factor is selected from the group consisting of alkaline phosphatase (ALP), osteopontin (OPN), RUNX2, type I collagen (ColI) and bone morphogenetic protein- But is not limited thereto.

The treatment concentration is preferably 10 μM to 50 μM, more preferably 10 μM to 25 μM, but is not limited thereto. At this time, by maintaining the treatment concentration of 10 [mu] M to 50 [mu] M, RUNX2 and BMP-2 activity corresponding to bone formation-related factors can be significantly increased while remarkably increasing ALP, OCN and ColI activity corresponding to bone matrix- have. As the treatment concentration increases, the bone-related factor activity tends to increase. However, in the case of the BMP-2 activity, when the treatment concentration is higher than 25 μM, the treatment concentration is lower than 25 μM .

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example  One

A complex ginsenoside having a weight ratio of ginsenoside Rd (Sigmaaldrich) and ginsenoside Re (Sigmaaldrich) of 2: 3 was prepared, and a composition having a complex ginsenoside concentration of 10 μM was prepared.

Example  2

A composition was prepared in the same manner as in Example 1, except that the weight ratio of ginsenoside Rd and ginsenoside Re was changed to 2: 1.

Example  3

The composition was prepared in the same manner as in Example 1, except that the concentration of the prepared complex ginsenosides was 25 μM.

Example  4

The composition was prepared in the same manner as in Example 1, except that the concentration of the prepared complex ginsenosides was 50 μM.

Composition of complex ginsenosides Concentration of complex ginsenoside Example 1 Rd: Re = 2: 3 10 μM Example 2 Rd: Re = 2: 1 10 μM Example 3 Rd: Re = 2: 3 25 μM Example 4 Rd: Re = 2: 3 50 μM Comparative Example 1 Rd alone 10 μM Comparative Example 2 Re alone 10 μM Comparative Example 3 Rd: Re = 1: 2 10 μM Comparative Example 4 Rd: Re = 1: 3 10 μM Comparative Example 5 Rd: Re = 3: 1 10 μM Comparative Example 6 Rb1 alone 50 μM Comparative Example 7 Rg1 alone 50 μM Comparative Example 8 Rb1: Rg1 = 2: 3 10 μM Comparative Example 9 Rb1: Rg1 = 2: 3 25 μM Comparative Example 10 Rb1: Rg1 = 2: 3 50 μM

Experimental Example 1: Determination of cell survival rate on osteoblast cell line

Osteoblast (MC3T3-E1) was stabilized in a 96-well plate (5X103 cells / well) in a medium supplemented with 10% FBS and 1x penicillin-streptomycine. After 24 hours, the composition according to Examples 1 to 4 and the composition according to Comparative Examples 1 to 10 were treated after the medium was replaced with the medium to which no FBS had been added and deficient for more than 14 hours. Thereafter, the cells were cultured for 24 hours. Cell viability of osteoblast was measured using Cell Counting Kit-8 (CCK-8). The results are shown in Table 2 and FIG.

Composition / concentration of complex ginsenoside Cell survival rate for osteoblast cell line Example 1 Rd: Re = 2: 3/10 [mu] M 106.36 ± 1.28 Example 2 Rd: Re = 2: 1/10 [mu] M 105.77 ± 1.34 Example 3 Rd: Re = 2: 3/25 [mu] M 103.4 ± 1.33 Example 4 Rd: Re = 2: 3/50 [mu] M 104.0 + 1.38 Comparative Example 1 Rd alone / 10 μM 101.18 ± 0.35 Comparative Example 2 Re alone / 10 μM 102.20 ± 1.34 Comparative Example 3 Rd: Re = 1: 2/10 [mu] M 102.2 ± 0.66 Comparative Example 4 Rd: Re = 1: 3/10 [mu] M 101.38 + - 0.42 Comparative Example 5 Rd: Re = 3: 1/10 [mu] M 102.88 0.60 Comparative Example 6 Rb1 alone / 50 μM 82.00 Comparative Example 7 Rg1 alone / 50 μM 79.00 Comparative Example 8 Rb1: Rg1 = 2: 3/10 [mu] M 88.40 Comparative Example 9 Rb1: Rg1 = 2: 3/25 [mu] M 85.40 Comparative Example 10 Rb1: Rg1 = 2: 3/50 [mu] M 80.20

As shown in Table 2 and Fig. 1, the composition according to Examples 1 to 4 has a complex ginsenoside composition of Rd: Re = 2: 1 to 2: 3, When the composition was treated with osteoblast, it was confirmed that the cell survival rate was significantly increased. On the other hand, when the composition according to Comparative Examples 1 to 2 contains Rd alone or Re alone instead of the complex ginsenoside and the composition according to Comparative Examples 2 to 5 has a complex ginsenoside composition of Rd: Re = 2: 1 to 2: 3, it is confirmed that the increase in the cell survival rate to the osteoblast cell line is insignificant.

Further, it was confirmed that the cell survival rate for the osteoblast cell line was reduced when the Rb1 alone, Rg1 alone, or Rb1 and Rg1 were contained instead of the complex gensenosides (Rd and Re) as in the compositions according to Comparative Examples 6 to 10 do.

Experimental Example 2: Confirmation of formation ability of bone calcification

To compare the ability of the composition according to Example 1 and the composition according to Comparative Examples 1 and 2 to form bone calcification, MC3T3-E1 cells were adjusted to 1 x 10 ⁴ cells / ml and cultured on a plate. The medium and the composition according to Example 1 or the composition according to Comparative Examples 1 to 2 were added and cultured for 10 days. After incubation, the cells were fixed with 70% EtOH at 4 ° C for 1 hour. The alizarin-red (AR) solution was adjusted to pH 4.2 by adjusting the concentration to 40 mM in 10 ml of distilled water. After fixation, cells were stained with AR solution (2 ml / well) for 10 minutes, washed 2 ~ 3 times with distilled water, and the non-stained sections were washed with PBS. The surface was observed with an inverted microscope (ZEISS, Japan) while wetting with PBS so that the surface did not dry. After confirming the formation of nodules, the absorbance at 550 nm was measured with an ELISA reader by adding 10 mM sodium phosphate (10% cetylpyridinium chloride, pH 7.0) And the results are shown in Fig. As shown in FIG. 2, the composition according to Example 1 was found to have excellent bone calcification forming ability, but the compositions according to Comparative Examples 1 and 2 were found to have insufficient ability to form bone calcification.

Experimental Example  3: confirmation of bone-related factor activity

Examples 1, 3 and 4 The composition of Comparative Example 1-2, in order to ensure that the composition according to the 6-10 increased bone associated factor activity, the MC3T3-E1 cells 3 × 10 ⁵ cells / well density in accordance with the In a 35 mm culture dish. LPS was treated at a concentration of 10 [mu] g / ml and at the same time the composition according to Examples 1, 3 and 4 and the compositions according to Comparative Examples 1 to 2 and 6 to 10 were treated. After 24 hours, the medium was removed and RNA was isolated using Trizol (see manufacturer's instructions). After RNA isolation, it was thoroughly dried and re-dissolved in diethyl pyrocarbonate (DEPC) treated water. CDNA was synthesized using BioRad iScript cDNA Synthesis Kits (Hercules, Calif.). The primers were custom-made at Bioneer (Daejon, Korea) after confirmation at NCBI and are shown in Table 3. Gene amplification was carried out with Taq-polymerase (Geneall, Seoul, Korea), followed by denaturation at 95 ° C and extension at 72 ° C. The product was electrophoresed on 2% agarose gel and stained with EtBr to identify GelDoc (Vilber lourmat, France and Delta2d, Decodon, Germany). The results are shown in Table 4 and FIG.

gene primer PCR conditions GAPDH Fw: AAATGGTGAAGGTCGGTGTG 95 ° C 5s, 62 ° C 15s, 72 ° C 15s, 40cycles Rv: GAATTTGCCGTGAGTGGAGT ALP Fw: TTACCAACTCTTTTGTGCCAG 95 ° C 30s, 62 ° C 30s, 72 ° C 1min 40cycles Rv: ACACAAGTAGGCAGTGGCAGT OPN Fw: TCACCATTCGGATGAGTCTG 95 ° C 30s, 62 ° C 30s, 72 ° C 1min 40cycles Rv: ACTTGTGGCTCTGATGTTCC Col I Fw: TTCCCTGGTGCTGATGGTGTTGCT 95 ° C 5s, 62 ° C 15s, 72 ° C 15s, 40cycles Rv: GCCTTTCCAGGTTCTCCAGCGG RUNX2 Fw: CCGCACGACAACCGCACCAT 95 ° C for 30s, 62 ° C for 30s, 72 ° C for 1min, 40cycles Rv: CGCTCCGGCCCACAAATCTC BMP-2 Fw: AGTTCTGTCCCCAGTGACGAGTTT 95 ° C for 1 min, 63 ° C for 30 s, 72 ° C for 1 min, 40 cycles Rv: GTACAACATGGAGATTGCGCTGAG

In Table 3, GAPDH is a control gene at the time of quantitative analysis, ALP, OCN and Col I are bone morphogenesis-related genes, and RUNX2 and BMP-2 are osteogenic genes.

Composition / concentration of complex ginsenoside ALP
Activity OPN
Activity Col I
Activity
RUNX2
Activity BMP-2
Activity Example 1 Rd: Re = 2: 3/10 [mu] M 1.32 2.19 2.24 2.26 1.26 Example 3 Rd: Re = 2: 3/25 [mu] M 1.66 2.32 2.40 2.40 1.15 Example 4 Rd: Re = 2: 3/50 [mu] M 1.72 2.41 2.43 2.43 1.16 Comparative Example 1 Rd alone / 10 μM 1.156 2.14 2.11 2.10 1.10 Comparative Example 2 Re alone / 10 μM 1.0604 2.02 2.19 2.11 1.04 Comparative Example 6 Rb1 alone / 50 μM 0.82 - - - 0.80 Comparative Example 7 Rg1 alone / 50 μM 0.79 - - - 0.81 Comparative Example 8 Rb1: Rg1 = 2: 3/10 [mu] M 0.88 - - - 0.64 Comparative Example 9 Rb1: Rg1 = 2: 3/25 [mu] M 0.85 - - - 0.59 Comparative Example 10 Rb1: Rg1 = 2: 3/50 [mu] M 0.80 - - - 0.56

As shown in Table 4 and Figs. 3 (a) to 3 (e), the compositions according to Examples 1, 3 and 4 (10 μM, 25 μM and 50 μM) showed ALP, OCN and Significantly increased RUNX2 and BMP-2 activity corresponding to osteogenic factors, while significantly increasing ColI activity. However, it was confirmed that the composition (50 μM) according to Example 4 did not show a large degree of increase in BMP-2 activity as compared with the compositions (10 μM and 25 μM) according to Examples 1 and 2 (see FIG. On the other hand, when the composition according to Comparative Examples 1 and 2 contains Rd alone or Re alone in place of the complex ginsenoside, ALP, OCN, and Col I (particularly ALP and Col I) The level of RUNX2 and BMP-2 (especially BMP-2) activity, which are related to osteogenic factors, is found to be insignificant.

In addition, when the composition according to Comparative Examples 6 to 10 contains Rb1 alone, Rg1 alone, or Rb1 and Rg1 instead of the complex ginsenosides (Rd and Re), ALP and bone formation It was confirmed that the BMP-2 activity corresponding to the association factor was reduced (see Figs. 3 (a) and 3 (e)).

Hereinafter, formulation examples of the composition containing the complex ginsenoside of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically described.

Formulation Example 1: Preparation of powder

Compound ginsenoside 20 mg

Lactose hydrate 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight container to prepare powders.

Formulation Example 2: Preparation of tablets

Compound ginsenoside 10 mg

Corn starch 100 mg

100mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation Example 3: Preparation of capsules

Compound ginsenoside 10 mg

Microcrystalline cellulose 3 mg

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules according to the usual preparation method of capsules.

Formulation Example 4: Preparation of injection

Compound ginsenoside 10 mg

180 mg mannitol

Sterile sterilized water for injection 2974 mg

Sodium dihydrogenphosphate 26 mg

After the above components were mixed, they were prepared with the above ingredient contents per 1 ampoule (2 mL) according to the usual injection preparation method.

Formulation Example 5: Preparation of a liquid preparation

Compound ginsenoside 10 mg

10 g per isomer

5 g mannitol

Purified water quantity

Lemon incense quantity

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

Formulation Example 6: Preparation of Health Functional Foods

Compound ginsenoside 10 mg

Vitamin mixture quantity

70 [mu] g of vitamin A acetate

Vitamin E 1.0 mg

0.13 mg of vitamin B ₁

0.15 mg of vitamin B ₂

0.5 mg of vitamin B ₆

Vitamin B ₁₂ 0.2 g

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 90 mg

100 mg of calcium carbonate

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a component suitable for a health functional food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above components may be mixed And then granules are prepared and used in the manufacture of health functional foods according to conventional methods.

Formulation Example 7: Preparation of health drinks

Compound ginsenoside 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B ₁ 0.25 g

Vitamin B ₂ 0.3 g

Purified water quantitation

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was stirred and heated at 85 ° C for about 1 hour. The resulting solution was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, It is used in the production of the health beverage composition of the invention.

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (7)

A complex ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient,
Wherein the weight ratio of Rd and Re is from 2: 1 to 2: 3.
Osteoporosis, Paget's bone disease, rickets, osteoarthritis, renal osteodystrophy in patients with renal failure, rheumatic or degenerative bone disease, bone metastatic lesion, primary bony tumor, periodontal disease, inflammatory alveolar bone disease And an inflammatory bone resorption disease.
The method according to claim 1,
Wherein the total concentration of the complex ginsenoside is 10 μM to 50 μM.
The method according to claim 1,
Wherein the compound ginsenoside has the ability to promote osteoblast proliferation and differentiation or to form bone calcification.
The method according to claim 1,
The complex ginsenoside is selected from the group consisting of alkaline phosphatase (ALP), osteopontin (OPN), type I collagen (ColI), RUNX2 (RUNX2) and bone morphogenetic protein- A method for preventing or treating bone diseases, comprising administering to a patient a therapeutically effective amount of a compound of formula
delete A complex ginsenoside consisting of ginsenoside Rd and ginsenoside Re as an active ingredient,
Wherein the weight ratio of Rd and Re is from 2: 1 to 2: 3.
Osteoporosis, Paget's bone disease, rickets, osteoarthritis, renal osteodystrophy in patients with renal failure, rheumatic or degenerative bone disease, bone metastatic lesion, primary bony tumor, periodontal disease, inflammatory alveolar bone disease And inflammatory bone resorption diseases. ≪ / RTI >
The method according to claim 6,
Wherein the total concentration of the complex ginsenoside is 10 μM to 50 μM.

Images