KR101840949B1 - A pharmaceutical composition for preventing or treating liver disease comprising Guaijaverin - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating liver diseases containing guaijaverin. The composition of the present invention does not affect feed absorption rate, body weight, and weight of organs, is not toxic, and prevents accumulation of neutral fat in liver and blood due to alcohol, thereby being useful for pharmaceutical compositions for preventing and treating liver diseases such as fatty liver, inflammation in liver, hepatic fibrosis, and liver cirrhosis as well as functional health foods for preventing or ameliorating liver diseases such as fatty liver, inflammation in liver, hepatic fibrosis, and liver cirrhosis.

Description

TECHNICAL FIELD The present invention relates to a pharmaceutical composition for preventing or treating liver disease, which comprises Guaijaverin,

The present invention relates to a pharmaceutical composition for the prevention or treatment of liver diseases including courazabelin, and more particularly to a pharmaceutical composition for preventing or treating hepatic inflammation, liver fibrosis or liver cirrhosis, A health functional food for preventing or ameliorating liver disease, and a method for preventing or treating liver disease, which comprises administering to a subject a zeaxanthin.

The liver plays a central role in nutritional metabolism. When liver dysfunction is caused, problems occur in the metabolism of nutrients in vivo. If the liver damage is mild, the liver cell can be restored through rest, but in a busy modern society, there is no room for rest and the liver disease is also increased. Although current treatments for liver disease, such as exercise, diet, and dieting, are combined with drug therapy, it is difficult to completely heal. Therefore, there is a continuing need for effective and improved treatments for liver disease or hepatoprotectants.

Obesity, and type 2 diabetes, metabolic syndrome is becoming common, and liver disease due to fatty liver formation is increasing. Fatty liver, especially fatty liver, is caused by accumulation of liver fat due to excessive fat or alcohol consumption, increase of liver fat synthesis, decrease of triglyceride and decrease of burning, Or more. Steatosis and steatohepatitis are considered as subtypes of chronic liver disease and can lead to liver cirrhosis and, worse, hepatocellular carcinoma (HCC). Most of the fat accumulated in the fatty liver is triglyceride. In particular, alcoholic fatty liver is caused by excessive intake of alcohol and promotion of liver lipid synthesis and normal energy metabolism, and pathophysiologically, Cell death, cell necrosis and necrotizing inflammation are found. The liver is the main organ for metabolizing, digesting, and deciphering the ethanol consumed, because most of the ethanol metabolism occurs in the liver. In some cases, fatty liver is thought to be merely accumulation of liver fat. However, fatty liver disease is called silent disease, which is accompanied by liver damage, inflammation and fat accumulation but is not clinically clinically symptomatic. Considering that 50% of the identified patients develop cirrhosis, fatty liver should be considered one of the most serious liver diseases.

However, no therapeutic agent has been developed to prevent progression to liver cirrhosis in the liver. Although there is an effort to develop a therapeutic agent for an associated disease such as metabolic syndrome, hypertension, cardiovascular disease, and type 2 diabetes as an alternative treatment, side effects have been found, and exercise and diet therapy are recommended. The treatment efficiency of fatty liver is very low and development of effective therapeutic agent is required. Although it has been reported that fatty liver is related to insulin resistance of cells observed in diabetic and obese states, some hypoglycemic agents such as metformin have been reported to be effective in the treatment of fatty liver. However, these drugs have side effects such as hepatotoxicity or lactic acidosis . ≪ / RTI > In addition, pioglitazone and thiazolidinedione, a drug for the treatment of insulin resistance and oxidative stress, and adiponectin-promoting diabetes mellitus, have been shown to inhibit hepatic tissue damage in patients with fatty liver disease and to improve liver insulin sensitivity There has been a report that there is potential for the development of therapeutic agents, but severe adverse effecr (SAE) has emerged that can affect the patient's mortality at the appropriate efficacy concentrations. In addition, betaine, glucuronate, methionine, choline and lipotrophic preparations are supplemented as an alternative drug adjuvant therapy, Is not fully proven. Therefore, there is an urgent need to develop a safe therapeutic agent for fatty liver, which is superior in efficacy but does not cause side effects as a natural product.

Hepatitis in liver disease is an inflammation of hepatocyte and liver tissue, and the main cause is excessive alcohol consumption. Alcoholic hepatitis is a type of acute hepatitis caused by short-term drinking of alcohol in excess of the usual amount of alcohol, and it is known that the intestinal mucosal permeability increases when bingeing occurs. In this case, intestinal bacteria permeate the intestine and enter the portal bloodstream . The endotoxin (lipopolysaccharide, LPS) secreted by intestinal bacteria enters the liver and binds to the Toll-like receptor 4 on the surface of the Kupffer cell. Then, cytokines such as TNF-a are secreted by intracellular signal transduction pathways, causing apoptosis, necrosis, and inflammation of hepatocytes.

Alcoholic hepatitis is the primary cause of the immune response. In mild cases, alcoholic hepatitis can be recovered only this week. In severe alcoholic hepatitis, about 40-50% of cases are fatal diseases without treatment. These severe alcoholic hepatitis require treatment to block the immune response, and currently recognized treatments include steroids that inhibit the immune response and pentoxifylline, a TNF-α blocker. In particular, steroid agents used for the treatment of alcoholic hepatitis have many side effects and contraindications, and pentoxifylline is currently used, but the therapeutic effect of pentoxifylline is not satisfactory.

On the other hand, hepatic fibrosis in liver disease means a disease in which fibrosis occurs in the liver. After hepatic tissue damage by various stresses in the human body, hepatic stellate cells are activated by various cytokines including TGF-beta (secretion from transformed growth factor beta) secreted from Kupffer cells. TGF-β promotes collagen synthesis and accumulates extracellular matrix, resulting in liver fibrosis. In particular, progression from simple fatty liver to fibrosis involves not only liver damage but also immunological and genetic factors. The pathway of the immunological pathogenesis is the hedgehog (HH) pathway. Hedgehog-related protein is a signaling substance that induces the immune response in the hepatocyte. The hallguration of hedgehog induces natural killer cells and the increase of inflammatory cytokine To promote liver fibrosis.

Liver cirrhosis occurs when persistent liver fibrosis persists. Continuous or repeated diffuse hepatic cirrhosis, which consists of hepatic nodules or nodules regenerated by hepatic cell regeneration, increased fibrosis, and necrosis, inflammation (necrosis inflammation and fibrosis. Patients with cirrhosis develop clinical symptoms such as fluid retention, muscle wasting, intestinal bleeding, and liver failure. And ultimately leads to diseases such as cirrhosis complications and liver cancer, leading to death.

Since there is no awareness at first, it is not until it has progressed considerably. Therefore, studies are being actively carried out to develop a method of rapidly diagnosing and treating liver fibrosis and cirrhosis. For example, Korean Patent No. 1086040 discloses a therapeutic agent for hepatic fibrosis and cirrhosis which comprises an aspartic acid derivative, a pharmaceutically acceptable salt thereof or an ester thereof, and Korean Patent No. 1135574 discloses a therapeutic agent for hepatic fibrosis and cirrhosis, Discloses a technique for preventing and treating liver fibrosis and cirrhosis by using 2-disubstituted-2H-chromen-6-yl) thiourea derivatives. However, The development of a substance having a therapeutic effect is insufficient.

Under these circumstances, the present inventors have made intensive efforts to solve the above-mentioned problems. As a result, the present inventors have found that zeolite zeolin, which can be extracted and isolated from a mountain elk, does not affect the feed intake, body weight, or organ weight, , And the effect of inhibiting the accumulation of triglyceride and triglyceride in blood due to alcohol and the like and confirming the prevention and treatment effect on liver diseases such as fatty liver, liver inflammation, liver fibrosis or liver cirrhosis. Completed.

 G.R. Prabu et al., Guaijaverin-a plant flavonoid as potent antiplaque agent against Streptococcus mutans, The Society for Applied Microbiology, Journal of Applied Microbiology 101 (2006) 487-495

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating liver disease, which comprises courazoline.

Specifically, one object of the present invention is to provide a pharmaceutical composition for prevention or treatment of fatty liver, liver inflammation, liver fibrosis or cirrhosis, which comprises courazoline.

It is still another object of the present invention to provide a health functional food for preventing or ameliorating liver disease, which comprises courazoline.

It is still another object of the present invention to provide a method for preventing or treating liver disease, which comprises administering to a subject a loveseedrine.

This will be described in detail as follows. On the other hand, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present invention fall within the scope of the present invention. Further, the scope of the present invention is not limited by the detailed description described below.

One aspect of the present invention for achieving the above object is to provide a pharmaceutical composition for preventing or treating liver disease, which comprises a zeaxanthin.

In the present invention, "Guaijaverin" is a compound represented by the following formula (1), and has a molecular weight of 434,353, a formula of C ₂₀ H ₁₈ O ₁₁ . It can be extracted from mountain elk, etc. It is known to be dissolved in a solvent such as pyrimidine and methanol. Urease inhibitor, and inhibitory activity against Streptococcus mutans. However, the preventive or therapeutic effect of liver disease is not known.

In one embodiment of the present invention, it was confirmed that the guazeaberin did not affect the feed intakes, body weight and organ weight changes as a result of administration of the guazeabine, and thus it was confirmed that the compound was a natural-derived compound that could be safely used without cytotoxicity (Figs. 1 to 4).

In the present invention, "liver disease" means that one or more functions among the various functions performed by the subject are problematic and thus metabolism can not be normally performed.

When CYP2E1 is increased due to alcohol and the like, oxidative stress is induced, and the tumor necrosis factor-alpha (TNF-α) induced thereby damages the hepatocytes. Damaged hepatocytes cause increased plasma concentrations of aminotransferases alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Therefore, by measuring blood concentrations of ALT and AST, prevention and treatment effects of liver disease and liver protection effect can be confirmed.

In one embodiment of the present invention, ALT and AST levels in liver and liver tissues, which are indicators of hepatocyte injury, were measured. As a result, the ALT and AST levels in the group administered with zeaxanthin were lower than those in the control group (Fig. 10), confirming the liver protective effect of zeae zaverin.

In the present invention, liver disease can be included without limitation as long as it can be treated using a composition comprising zeaxanthin, for example, liver inflammation, hepatotoxicity, cholestasis, fatty liver, liver fibrosis, liver cirrhosis, liver ischemia, Liver disease, liver abscess, hepatic coma, liver atrophy and liver cancer. More specifically, it may be fatty liver, liver inflammation, liver fibrosis or cirrhosis.

In the present invention, the term 'fatty liver' refers to a case where liver fat accumulates due to excessive fat or alcohol consumption, increase in liver fat synthesis, triglyceride release and reduction of combustion, etc. Generally, It is defined as fatty liver. Specifically, 'alcoholic fatty liver', which is caused by excessive alcohol consumption, is caused by excessive consumption of alcohol, which promotes liver lipid synthesis and does not allow normal energy metabolism.

In one embodiment of the present invention, it was confirmed visually that the amount of lipid accumulated in the liver was significantly reduced as a result of administering the guazeabine to the mouse (Fig. 5) (Fig. 6). It was confirmed that the concentration of neutral fat in the blood and liver was decreased (Fig. 7), and it was confirmed that the hepatospermine had the preventive and therapeutic effect of fatty liver.

In the present invention, the 'liver inflammation' is inflammation of hepatocytes and liver tissues, and death of hepatocytes due to excessive alcohol consumption, necrosis, and inflammation reaction occurs. In the liver, alcohol is firstly oxidized to acetaldehyde by about 90% by alcohol dehydrogenase (ADH), which promotes alcohol oxidation. However, when chronic alcohol is consumed, cytochrome P-450 2E1 (CYP2E1) , Resulting in increased GSH, GGT inflammation and damage to the hepatocytes. More specifically, CYP2E1 is the central enzyme of MEOS (microsomal ethanol oxidizing system), which promotes ethanol oxidation and damages the liver more severely than the catalase and ADH pathway, leading to liver inflammation. Therefore, it is known that alcohol ingestion in mice without CYP2E1 can prevent alcohol liver damage.

In one embodiment of the present invention, the administration of guazeaberin to the mouse to confirm the expression level of the CYP2E1 enzyme showed that the amount of CYP2E1 expression was further reduced in the group administered with goethiverbine compared to the control group 8), confirming that the zeolite has an effect of preventing and treating liver inflammation.

The 'liver fibrosis' is a fibrotic disease caused by damage to various tissues of liver by various stresses, and it can develop into liver cirrhosis if it occurs continuously. It is known that the liver fibrosis progresses by increasing the level of the protein fiber of liver tissue composed of collagenic fiber, reticular fiber and elastic fiber by alcohol.

The term 'liver cirrhosis' means that the normal liver tissue is replaced with a fibrotic tissue such as regenerative nodules due to chronic inflammation, thereby lowering liver function. It is known to occur especially when the liver fibrosis persists, and it may progress to diseases such as liver complications and liver cancer.

In one embodiment of the present invention, the extent of hepatic fibrosis of the reticular fibers was examined by tissue staining using a Gomori Reticulum. As a result, (FIG. 9), confirming that Goethezaverine has preventive and therapeutic effects on liver fibrosis and cirrhosis.

In the present invention, the prevention or treatment of the liver disease can be achieved by inhibiting lipid accumulation in the liver and inhibiting the expression of genes related to lipid metabolism in the liver.

Regarding the suppression of lipid accumulation in the liver, in one embodiment of the present invention, it was confirmed visually that the amount of lipid accumulated in the liver was considerably reduced as a result of administration of Geazolaxarin to the mouse (FIG. 5) (Fig. 6), it was confirmed that the concentration of the triglyceride in the liver was decreased (Fig. 7), and the hepatic fat accumulation was inhibited by the hepatic heparin , Liver inflammation, liver fibrosis, or liver cirrhosis.

In the present invention, 'gene in liver lipid metabolism-related gene' refers to a gene involved in synthesis or accumulation of a lipid component in liver cells, and may be Fas , ApoB , Cd36 or Fabp , but is not limited thereto . Morocco The gene is a gene involved in FAS (Fatty acid synthase) synthesis, and ApoB The gene is involved in the synthesis of Apolipoprotein B (ApoB). Cd36 The gene is a gene involved in the synthesis of CD36 (Cluster of differentiation 36) also known as FAT, and Fabp Genes are genes involved in fatty acid-binding protein (FABP) synthesis. Since the in vivo protein involved in the synthesis of the gene is involved in lipid synthesis and lipid accumulation in cells or tissues, inhibition of the gene in the hepatocyte can inhibit lipid accumulation in the liver.

In one embodiment of the present invention, the mRNA expression of hepatic lipid metabolism-related genes was measured and compared after administration of guazeabine to mice. As a result, it was found that the hepatic metabolism-related genes Fas , ApoB , Cd36 , Fabp gene expression was inhibited (Fig. 11), positively affecting liver lipid metabolism and mitochondrial function, and consequently proved to have preventive and therapeutic effects on fatty liver, liver inflammation, liver fibrosis, and liver cirrhosis.

The gouachezine of the present invention may be derived from a mountain elk. Acer tegmentosum Maxim. Is a deciduous broad-leaved arboreous tree with a dicotyledonous plant leaf, and is also called a spermatozoa.

The term "prophylactic" in the present invention refers to any action that inhibits or delays liver diseases such as fatty liver, liver inflammation, liver fibrosis, and liver cirrhosis by administration of a composition comprising Courazine verin of the present invention. The term "treatment" as used in the present invention means all the actions for improving or alleviating symptoms of liver disease by administration of the composition comprising the above-mentioned clauses.

The composition comprising the clauzaverine of the present invention may further contain one or more active ingredients which exhibit the same or similar functions in addition to the above components.

The pharmaceutical composition of the present invention may be formulated in the form of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, aerosols and sterilized injection solutions according to a conventional method for preventing and treating liver diseases It is possible to get angry.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations are prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose, lactose, . In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, Can be used.

Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, suppositories, and the like. Examples of the non-aqueous solvent and the suspending agent include vegetable oils such as propylene glycol, polyethylene glycol and olive oil, injectable esters such as ethyl oleate, and the like.

In addition, the pharmaceutical composition of the present invention may further comprise a carrier, an excipient or a diluent. Examples of the carrier, excipient or diluent include lactose, textol, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Mineral oil such as propyl methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and silicon dioxide can be used have.

The specific dosage of the pharmaceutical composition according to the present invention may vary depending on factors such as the formulation method, the patient's condition and body weight, the patient's sex, age, degree of disease, drug form, administration route and period, excretion rate, And the dosage and the number of times do not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention can be administered through various routes to mammals such as rats, mice, livestock, humans, and the like. All modes of administration may be expected and may be administered, for example, by oral, intravenous, intramuscular or subcutaneous injection.

Another aspect of the present invention for achieving the above object is to provide a health functional food for preventing or ameliorating liver diseases including zeaxanthin.

As described above, the hepatopancrein, liver disease, and prevention are as described above.

The term " improvement " of the present invention means any action in which administration of the composition of the present invention improves or alleviates liver disease.

In the present invention, the term "health functional food" refers to a food prepared and processed in the form of tablets, capsules, powders, granules, liquids and rings using raw materials and components having useful functions in the human body. The term "functional" as used herein means that the structure and function of the human body have a beneficial effect on health uses such as controlling nutrients or physiological actions. The health functional food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients that are conventionally added in the art. In addition, the formulations of the above health functional foods may also be manufactured without limitations as long as they are acceptable as health functional foods.

The form of the health functional food of the present invention is not limited, and may include all foods in the conventional meaning, and may be used in combination with terms known in the art such as functional foods. In addition, the health functional food of the present invention can be prepared by mixing other suitable auxiliary ingredients, which may be included in food, according to the selection of a person skilled in the art, and known additives. Examples of foods that can be added include dairy products, such as meat, sausage, bread, chocolates, candies, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Vitamins, and the like, and foods used as feed for animals.

In the examples of the present invention, mice treated with guazeabine did not show cytotoxicity without affecting the feed intakes, body weight and organ weight changes (Figs. 1 to 4), and lipid and neutral (FIG. 8), and inhibited the progression of hepatic fibrosis of the senescent fibers (FIG. 9), and decreased serum levels of AST and ALT (Fig. 10), and inhibited the expression of the gene related to lipid metabolism in the liver (Fig. 11), it was confirmed that the composition containing Gezae zaverin could be used as a health functional food for prevention or improvement of liver disease .

Another aspect of the present invention for achieving the above object is to provide a method for preventing or treating liver disease, which comprises administering a zeaxanthin to an individual.

The gastroenterology and liver disease, prevention, and treatment are as described above.

As used herein, the term "individual" may refer to any animal, including humans, who have or are at risk of developing liver disease. The animal may be a mammal such as a cow, a horse, a sheep, a pig, a goat, a camel, an antelope, a dog, a cat, etc., which require treatment of humans as well as similar symptoms. It may also refer to animals other than humans, but is not limited thereto.

The term "administering" as used herein means introducing the pharmaceutical composition of the present invention to a patient by any suitable method, and the route of administration of the composition of the present invention is not limited to a variety of oral or parenteral routes Lt; / RTI >

The preventive or therapeutic method of the present invention may specifically include administering the composition in a pharmaceutically effective amount to a subject suffering from or at risk of developing liver disease.

The pharmaceutical dosage form of the composition for the prevention or treatment of liver disease of the present invention may be used in the form of a pharmaceutically acceptable salt thereof and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable combination .

The composition of the present invention may be administered orally or parenterally in accordance with the intended method, and may be administered orally, parenterally or intraperitoneally, rectally, subcutaneously, intravenously, intramuscularly, Can be selected. The dosage may vary depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.

The dosage of the composition of the present invention varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of disease, And may be 0.001 mg / kg to 10 mg / kg, and may be administered once to six times a day, but is not limited thereto.

In the examples of the present invention, mice treated with guazeabine did not show cytotoxicity without affecting the feed intakes, body weight and organ weight changes (Figs. 1 to 4), and lipid and neutral (FIG. 8), and inhibited the progression of hepatic fibrosis of the senescent fibers (FIG. 9), and decreased serum levels of AST and ALT (Fig. 10) and inhibited the expression of genes related to lipid metabolism in the liver (Fig. 11), administration of a composition containing zeaxanthin to an individual may show prevention or therapeutic effects of liver disease Respectively.

The composition of the present invention containing the zeaxanthin inhibits the accumulation of triglyceride and neutral fat in the blood due to alcohol without affecting the feed intake, body weight, or organ weight and without toxicity, , A pharmaceutical composition for prevention and treatment of liver inflammation, liver fibrosis and cirrhosis, or a health functional food for prevention or improvement of fatty liver, liver inflammation, liver fibrosis and cirrhosis.

1 is a graph comparing weight changes of alcoholic fatty liver-induced mice and control mice.
2 is a graph showing changes in food intake of alcoholic fatty liver-induced mice and control mice over time.
FIG. 3 is a graph comparing total food intakes of alcoholic fatty liver-induced mice and control mice.
4 is a graph comparing the weights of extracted organs (liver, spleen, kidney, and epididymal fat) of alcoholic fatty liver-induced mice and control mice.
FIG. 5 is a photograph showing the viscous observation of the degree of liver fat accumulation by dissecting alcoholic fatty liver-induced mice and control mice.
FIG. 6 is a photograph showing the degree of neutral fat accumulation in liver tissues of alcoholic fatty liver-induced mice and control mice by H & E staining and Oil Red O staining method.
FIG. 7 is a graph comparing the concentrations of triglyceride in blood and liver of alcoholic fatty liver-induced mice and control mice.
8 is a photograph showing the expression of cytochrome P-450 2E1 (CYP2E1) enzyme in alcoholic fatty liver-induced mice and control mice by tissue staining.
FIG. 9 is a photograph showing the progress of liver fibrosis in alcoholic fatty liver-induced mice and control mice by tissue staining.
FIG. 10 is a graph showing ALT and AST levels of alcoholic fatty liver-induced mice and control mice by blood biochemical analysis, respectively.
FIG. 11 is a graph comparing the expression levels of genes involved in lipid metabolism in the liver.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  One: Experimental animal  Preparation and Alcoholic Fatty Liver Animal Model ( NIAAA  model)

The animals used for the efficacy evaluation were C57BL / 6N mice at 8 weeks of age and purchased from BioLink, Hongcheon Medical Herb Institute animal room (relative temperature 23 ± 2 ° C, relative humidity 50 ± 5%, 12 h light-dark cycle ), 18 males were selected for which no abnormal findings were observed among the animals subjected to quarantine and purification for 7 days.

Alcoholic fatty liver model animals were modeled on alcoholic fatty liver models presented by the National Institute of Alcohol Abuse and Alcoholism (NIAAA) of the National Institutes of Health (NIH).

The Lieber-DeCarli'82 ethanol liquid diet (F1258SP, Bio-serv) was used as a control diet in the Liquid diet feeding tube (9019 , Bio-serv) and replaced with new feeds at fixed times between 3 pm and 5 pm daily.

After a 5-day adaptation period of liquid feed, 1 mg / kg of zeaxanthin (test substance) was orally administered for 10 days, and a 5% alcohol liquid feed was fed. A 45% maltose dextrin solution was orally administered to the non-alcoholic group (Pair-fed group) between 7:00 am and 9:00 am on the 11th day, and a 5% liquid feed group (hereinafter referred to as the EtOH-fed group) And the test substance administration group (hereinafter referred to as " EtOH + A group ") were orally administered with 31.5% ethanol.

Example  2: Analysis indicators and analysis methods

2-1. Weight measurement of mouse and organ harvesting

Alcoholic fatty liver-induced mice were weighed once a day using a weight scale (AND FX-2000i, Korea) to evaluate changes in body weight following administration of the test substance. In addition, the weight of the organs (liver, spleen, kidney, and epididymal fat) extracted according to the description of Example 2-3 described below was measured and then weighed to evaluate the weight change.

2-2. H & E ( Hematoxylin  & Eosin) Dyeing

H & E (Hematoxylin & Eosin) staining was performed to observe the overall shape of the liver tissue and the degree of lipid accumulation in the liver tissue. Specifically, the nuclei were first stained with Harris hematoxylin staining solution for 5 minutes, and then stained with Eosin solution.

2-3. Blood collection of mice, tissue and organ extraction, lipid extraction

After 9 hours from the test substance administration, the blood of the mice was collected under isoflurane inhalation anesthesia and subjected to biochemical analysis. Specifically, hematological analysis of alcoholic fatty liver-induced mice was performed using a biochemical analyzer (Kornelab 20XT, Thermo, USA).

In addition, liver tissue, organs or tissues (epididymal fat, spleen, Kidney) were extracted by isoflurane inhalation anesthesia 9 hours after the test substance administration. Hepatocytes were stained with nuclear and cytoplasm through H & E staining to observe the extent of fat accumulation, and other organs were observed for their weight changes to evaluate toxicity and body fat reduction effects.

2-4. Cytochrome  P450 2E1  Dyeing and Gomori Rediculum  dyeing

The reticulin fibers were stained in the tissue using a plating method in which the oozing material existing outside the sesame fiber was removed, the tissue was sensitized, and the silver solution was penetrated. After immunohistochemical analysis, anti-Cytochrome P450 2E1 (ab28146, Abcam, USA) was used and primary antibody was developed with Rabbit specific HRP / DAB (ABC) Detection IHC Kit (ab64261, Abcam, USA) and stained with hematoxylin.

2-5. Liver tissue  Frozen sections and Oil Red O staining

The isolated liver tissue was fixed with 10% NBF and infiltrated into 30% sucrose solution. After washing with PBS solution, water was removed and frozen tissue blocks were prepared by fixing to free cutting tissue (Optical Cutting Temperature (O.C.T)) compound (SAKURA, U.S.A). The liver tissue was cut into 7 ㎛ thickness using cryostat (Leica) and quickly attached to the slide, and the slide was stored in a -70 deep freezer. 5 g / l Oil-red-O (Sigma, U.S.A) powder was placed in 100% propylene glycol, heated and filtered using a Watman fiter. It was allowed to stand at room temperature for one day and was used for dyeing after filtering. The slides stored in -70 deep freezer were removed just before the experiment and dried at room temperature for about 1 hour. The slides were then rinsed with water and washed with anhydrous propylene glycol for 2 minutes. The slides were placed in filtered Oil-red-O, stained for 1 hour, and then placed in 85% propylene glycol for discoloration for 1 minute. The slide was washed with running water for 5 minutes, stained with hematoxylin (H9627, Sigma, USA) for 10 seconds, and then washed with water again. After staining, they were sealed with Faramount Aqueous Mounting Medium (Dako, S3025, Japan).

Liver tissues were observed with an optical microscope (Axiovert40, Zeiss, Germany).

2-6. Liver tissue  Paraffin tissue specimen preparation

Tissue samples were prepared by paraffin infiltration. Specifically, mouse liver was extracted, fixed in 10% NBF for 24 hours, dehydrated with ethanol, and then subjected to a transparent procedure of xylene 3 step. Thereafter, a paraffin block was produced through infiltration and embedding in the liquid paraffin 60. Using a microtome, the tissue block was cut into 5 μm thick slices and dried in a 60-slide drier for 1 hour. Then, the paraffin was removed with xylene and allowed to function through an ethanol step.

2-7. Real Time PCR method  Expression Analysis of Lipid Metabolism Related Gene

About 1 ml of Trizol reagent (Invitrogen, USA) was added to about 50 to 100 mg of the extracted liver and homogenized with a homogenizer and total RNA was extracted. From the RNA, cDNA was synthesized using cDNA reverse transcription kit (QIAGEN, Japan).

Real-time quantitative PCR was performed using SYBR Green (Applied Biosystems, USA) and 7500 Real-time Thermal Cycler (Applied Biosystems, USA) was used to measure gene expression. The nucleotide sequences of PCR primers for each gene and each gene are shown in Table 1 below. For the real-time PCR reaction, 2 μL of cDNA, 10 μL of 2X SYBR mix, and 1 μL of forward and reverse primers were added to a total of 20 μL, respectively, and the rest were filled with H ₂ O.

Gene Primer sequences Morocco F GGAGGTGGTGATAGCCGGTAT R TGGGTAATCCATAGAGCCCAG ApoB F CGTGGGCTCCAGCATTCTA R TCACCAGTCATTTCTGCCTTTG Cd36 F TGGAGCTGTTATTGGTGCAG R TGGGTTTTGCACATCAAAGA Fabp F GCTGCGGCTGCTGTATGA R CACCGGCCTTCTCCATGA β-actin F GGCTGTATTCCCCTCCATCG R CCAGTTGGTAACAATGCCATGT

The following PCR amplification steps were performed, and the amplification cycle was 40 cycles. Denaturation of the amplification step at 95 ° C for 15 seconds, annealing for 30 seconds at 60 ° C, extension for 30 seconds at 72 ° C for 10 minutes at 95 ° C for hot start, , And the values were recorded after each cycle extension.

 After completion of all cycles, melting curve analysis was performed to confirm the specificity of the primers. Analysis of the results was performed with One step system software v2.1 provided by Applied Biosystems.

Example  3: Results and Analysis

3-1. For weight and organ weight Courant of Berin  Effect analysis

The body weights and weights of the mice were measured according to the above Examples 2-1 and 2-2. There was no significant difference in the weight between the groups at the start of rearing, and in all the groups fed with the alcoholic liquid diet, There was no significant difference in body weight change by drug treatment.

Specifically, it was confirmed that weight change was not influenced by addition of alcohol (5%) liquid diet for 10 days after 5 days of adaptation to liquid feed, and zoledronine administration. In the EtOH + A group, the food intake was similar to that of the EtOH-fed and Pair-fed groups, but the weight gain was almost the same as that of the other groups (Fig. 1) And body weight (Figs. 2 and 3).

On the other hand, the weight change of the extracted organs (liver, spleen, kidney, and epididymal fat) was measured as% of body weight, and no significant difference was observed between EtOH + A group and EtOH-fed group (FIG. 4) . Therefore, it can be seen that zeolite is a safe substance derived from natural materials and not showing toxicity to mouse or body organs.

3-2. For alcohol-induced fatty liver Courant of Berin  Effect analysis

To investigate the effects of zafirrin on alcohol - induced fatty liver.

The EtOH-fed group mice showed more liver lipid components than the Pair-fed group mice. In contrast, the EtOH-fed group mice showed more lipid profiles than the Pair-fed group mice (Fig. 5). However, it was confirmed that the EtOH + A group mice to which the lovastatin was administered significantly decreased the amount of accumulated lipids in the liver as compared to the EtOH-fed group (Fig. 5).

In addition, according to the results of H & E staining and Oil Red O staining according to the above Examples 2-3 and 2-5, fat accumulation in the tissues was examined. As a result, it was found that the EtOH- Lipid droplet accumulation, whereas in the EtOH + A group, the amount of lipid droplets in the liver tissue was significantly reduced compared to the EtOH-fed group (FIG. 6).

In addition, the concentrations of triglyceride and triglyceride in the blood (mg / dL) were measured and compared with those of the EtOH-fed group, , But the concentration of EtOH + A group administered with zeaxanthin was significantly lower than that of EtOH-fed and Pair-fed group (FIG. 7).

Therefore, it is possible to reduce the concentration of triglyceride in the blood due to alcohol and inhibit the accumulation of triglyceride in the liver without affecting the feed intake and body weight and without toxicity, Prevention or treatment effects.

3-3. Alcohol-induced Liver inflammation , Liver fibrosis  And cirrhosis Courant of Berin  Analysis of liver protection effect

The purpose of this study was to analyze the expression of cytochrome P-450 2E1 (CYP2E1) enzyme, which is known to be the central enzyme of MEOS (microsomal ethanol oxidizing system), which promotes ethanol oxidation and damages the liver by tissue staining.

As a result, compared to the Pair-fed group, the EtOH-fed group treated with ethanol exhibited a significantly higher level of CYP2E1 expression, indicating that liver inflammation occurred. The amount of CYP2E1 expression was further reduced compared to the control group, and liver inflammation was alleviated (FIG. 8).

In the Gomori Reticulum, the degree of liver fibrosis of the reticular fibers was examined by tissue staining. As a result, compared with the Pair-fed group, the EtOH-fed group had more advanced liver fibrosis, An EtOH + A group showed inhibition of the progression of liver fibrosis as compared to the EtOH-fed group (Fig. 9).

On the other hand, ALT and AST levels in the blood and liver tissues, which are indicators of hepatocyte injury, were significantly increased in the EtOH-fed group compared to the Pair-fed group. However, It was confirmed that the levels of ALT and AST were decreased in the EtOH + A group administered together (FIG. 10) compared to the EtOH-fed group.

Therefore, zeolite has prophylactic and therapeutic effects against alcoholic liver inflammation, liver fibrosis, and liver cirrhosis that can be caused by persistent occurrence of liver fibrosis. Overall, it has preventive and therapeutic effects on liver diseases, .

3-4. Lipid metabolism-related genes in liver tissue mRNA  For expression Courant of Berin  effect

The effect of Courbeta berlin on the expression of lipid metabolism related genes was analyzed according to the description of Example 2-7 above.

As a result, when the Pair-fed group was expressed as 100%, the expression level of the EtOH-fed group was increased 1.4-fold in Fas and 1.1-fold in the EtOH + A group. In the case of ApoB , EtOH-fed group showed almost no change at 1.08-fold, but EtOH + A group was 0.8-fold lower than control group. In the case of Cd36 , the EtOH-fed group was almost doubled, and the EtOH + A group was expressed at 0.98-fold in close proximity to the control. Fabp also showed a 1.2-fold increase in the EtOH-fed group and a 0.7-fold decrease in the EtOH + A group compared to EtOH-fed. (Fig. 11).

Thus, it has been shown that zeaxanthin inhibits the expression of Fas , ApoB , Cd36 and Fabp genes , which are genes related to lipid metabolism in liver, positively affecting hepatic lipid metabolism and mitochondrial function and consequently fatty liver, liver inflammation, liver fibrosis and cirrhosis And the like can be exhibited.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

Claims (12)

A pharmaceutical composition for the prevention or treatment of fatty liver, comprising guaijaverin.
delete The composition of claim 1, wherein the fatty liver is an alcoholic fatty liver.
The composition according to claim 1, wherein the prevention or treatment of fatty liver is caused by suppression of lipid accumulation in the liver and inhibition of the expression of genes related to lipid metabolism in the liver.
5. The composition according to claim 4, wherein the intra-hepatic lipid metabolism-related gene is at least one gene selected from the group consisting of Fas , ApoB , Cd36 and Fabp .
2. The composition of claim 1, wherein the zeaxanthin is from a plant selected from the group consisting of plantations.
A health-functional food for preventing or ameliorating fatty liver, including guaijaverin.
delete The health functional food according to claim 7, wherein the fatty liver is an alcoholic fatty liver.
A method for the prevention or treatment of fatty liver, comprising administering to a subject other than human a guaijaverin.
delete 11. The method of claim 10, wherein the fatty liver is an alcoholic fatty liver.

Images