KR101837975B1 - Composition for treating of pulmonary disease comprising spheroid adipose-derived mesenchymal stem cells - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of pulmonary disease, comprising a steroid-derived fat-derived stem cell cultured in the form of a sprooid, and a cell therapy composition comprising the same. The speroid-type fat-derived stem cells of the present invention are remarkably superior in alveolar regeneration ability as compared with fat-derived stem cells cultured in the general form, and thus can be useful for the treatment of various pulmonary diseases including emphysema have.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention [0001] The present invention relates to a composition for treating pulmonary diseases, including spheroid-shaped fat-derived stem cells,

The present invention relates to a pharmaceutical composition for the prevention or treatment of pulmonary disease, comprising a steroid-derived fat-derived stem cell cultured in the form of a sprooid, and a cell therapy composition comprising the same.

Many of the acute or chronic respiratory diseases such as bronchial asthma, COPD, and pulmonary embolism (interstitial pneumonia) represent conditions accompanied by airway inflammation. As a general inflammatory condition, first, the information carrier molecules called free chemotactic factors liberated in the early stage promote localization of inflammatory cells such as neutrophils, basophils, eosinophils and macrophages, The enzymes and radicals of the cell are inhibited and the cytokine and the like are released, resulting in better mobilization and activation of inflammatory cells. When such inflammation develops in the airways, infiltrating inflammatory cells interfere with the tissues of the bronchi and lungs, and eventually cause respiratory disturbances such as respiratory flow or oxygen exchange capacity characteristic of each disease. Therefore, it is known that medicines having an anti-inflammatory effect are applied for the treatment of inflammatory respiratory diseases and adrenocortical steroids are already effective for mild to moderate bronchial asthma. Adrenocortical steroids have also been reported to prevent the deterioration of COPD. The effect of COPD on the condition is limited, and the effectiveness of corticosteroids in pulmonary fibrosis has not been clearly demonstrated. On the other hand, it is known that adrenocortical steroid not only suppresses immune function nonspecifically, but also causes various side effects such as electrolyte abnormality, peptic ulcer, muscle disease, behavioral abnormality, cataract, osteoporosis, osteonecrosis, and developmental inhibition. In the treatment of bronchial asthma, the number of first aid outpatients and hospitalized patients due to seizures is reduced due to infiltration of treatment using a main ingredient of inhaled steroid, and the number of patients who can control the outpatient is increasing. Even in such a situation, the number of patients is not lowered, and still there is still asthma due to lethal seizure. Therefore, combination therapy of asthma treatment mainly with current inhaled steroids does not reach sufficient treatment, And the development of new therapeutic agents with reduced side effects is desired.

Emphysema also refers to an abnormal and permanent peripheral airway and alveolar expansion due to the destruction of the distal bronchiole distal airspace. A long-term illness causes considerable damage to the alveoli and capillaries, small alveoli that exchange oxygen and carbon dioxide in the lungs, which causes pulmonary hypertension, especially secondary pulmonary hypertension. Although some substances are known for the prevention and treatment of these emphysema and pulmonary hypertension, their kinds and effects are insufficient and research for developing more effective medicines is required. Emphysema has been associated with elastase in recent studies. Neutrophil elastase (or white blood cell elastase) is a serine protease belonging to the family, such as chymotrypsin, and exhibits various substrate specificities. We have a charge transport system consisting of a catalytic triad consisting of histidine, aspartate and serine residues along with other serine proteases, which are histidine, aspartate and serine residues In the primary sequence of the polypeptide, they are dispersed to each other, but they are gathered in the proteins folded in the tertiary structure. Neutrogin elastase is a strong nonspecific serine protease that acts as a germicide in the form of collagen and degrades elastin, which represents the physical properties of the connective tissue. , Emphysema and chronic obstructive diseases. The developmental causes of emphysema, known to date, include a combination of inflammation, elastase, matrix metalloprotease imbalance, auto-apoptosis, and oxidative stress. Especially when the lung is exposed to pig pancreatic elastase, Neutrophils and macrophages have been shown to induce acute pulmonary inflammatory responses, and neutrophil elastase induces the production of reactive oxygen species (ROS). Studies have shown that the increase in MUC5AC messenger RNA levels in neutrophil elastase is dependent on the production of intracellular oxidants or changes in the state of cellular redox, suggesting that ROS plays a role in elastase-induced inflammation it means. Nitric oxide also plays a major role in elastase mediated diseases.

However, despite the above results, there is a need for a new therapeutic agent for treating various pulmonary diseases including emphysema with excellent efficiency.

The inventors of the present invention have been studying to develop a substance having few side effects and having excellent effects for the prevention and treatment of a variety of pulmonary diseases including emphysema. In particular, it has been reported that adipose-derived stem cells cultured in the form of a sprooid induce the regeneration of alveoli And thus it is effective in the treatment of various lung diseases. Thus, the present invention has been completed.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for prevention or treatment of pulmonary disease comprising adipose-derived mesenchymal stem cells (ASC) and a cell therapy agent containing the same.

In order to accomplish the above object, the present invention provides a pharmaceutical composition for prevention or treatment of pulmonary disease comprising adipose-derived mesenchymal stem cells (ASC).

The present invention also provides a cell therapeutic composition comprising adipose-derived mesenchymal stem cells (ASC) in the form of a sphere.

The speroid-type fat-derived stem cells of the present invention are remarkably superior in alveolar regeneration ability as compared with fat-derived stem cells cultured in the general form, and thus can be useful for the treatment of various pulmonary diseases including emphysema have.

FIG. 1 is a view showing a result of confirming the formation process of speroid-type fat-derived stem cells using culture using cone cave micro-wells.
FIG. 2 is a graph showing the results of confirming changes in the expression levels of BAX and Bcl-2 by dissociated ASC and spolide ASC cultured by a general culture method.
FIG. 3 is a graph showing changes in the expression levels of FGF2, HGF, and VEGF by dissociated ASC and speroid ASC cultured by a general culture method through changes in mRNA expression level (A) and protein expression level (B) to be.
4A schematically shows an experimental protocol using an emphysema mouse model, and B to E show the degree of alveolar destruction by the elastase treatment in the untreated group (B), the elastase alone treated group (C) Elastase + Dissociated ASC treatment group (D), Elastase + SPEROID ASC treatment group (E). F in FIG. 4 is a graph showing the result of confirming MLI (mean linear intercept).
FIG. 5 is a graph showing changes in the expression levels of FGF-2, HGF, and VEGF in the damaged lung tissue by treatment with SPECT.
FIGS. 6A to 6C are graphs showing the results of confirming the tissue regeneration effect of sprouted ASC transplantation through reduction of expression of MMP-2, MMP-9, and MMP-12. FIG.
FIG. 6D shows the results of confirming the expression changes of TIMP-1 and SLPI according to the sprouted ASC transplantation.

The present invention relates to a pharmaceutical composition and a cell treatment agent for preventing or treating pulmonary disease, comprising adipose-derived mesenchymal stem cells (ASC).

The speroid-type fat-derived stem cells of the present invention can more effectively induce the alveolar regeneration in injured lung tissue as compared with the dissociated form of stem cells cultured through the general culture method, Of the present invention.

Hereinafter, the present invention will be described in detail.

In the present invention, the steroid-derived fat-derived stem cell (hereinafter, referred to as SPEROID ASC) refers to a form of a three-dimensional cell tissue, and refers to a cell in which the cells are not disassociated but aggregated. Spheroid ASC is a self-assembled form of cells.

The SPAROID ASC of the present invention can be obtained through a culture method for known conventional spoloid formation, and can be obtained, for example, by a conventional method of forming a cell spoloid, such as a Spinner Flask, a conventional Petri-dish method, Can be obtained through a cone-microwell culture method. Preferably, when obtained via a cone-microwell culture method, the cone-microwell may be a PDMS cone-microwell (poly-di-methyl siloxane concave microwell).

The spleen ASCs can induce the alveolar regeneration very efficiently. Regeneration of such alveoli is caused by the expression of at least one growth factor selected from the group consisting of FGF2, HGF and VEGF in the stem cells, Can be accomplished by significantly higher expression than the dissociated ASC treatment obtained by the culturing method.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating pulmonary disease, characterized in that said spolded ASC induces alveolar regeneration and increases the expression of at least one growth factor selected from the group consisting of FGF2, HGF and VEGF Lt; / RTI >

In the present invention, it is preferable that the speroid ASC is obtained by culturing adult stem cells, and the adult stem cells may be those separated from commercially available stem cells or living tissues.

Since the SPECTOR ASC of the present invention has a very excellent effect on the alveolar regeneration, it can be effectively used for the prevention or treatment of various lung diseases related to lung injury. In the present invention, lung disease is preferably at least one selected from the group consisting of emphysema, chronic bronchitis, pneumonia, pulmonary hypertension, chronic obstructive pulmonary disease and asthma.

When the pulmonary disease is emphysema, the emphysema may be at least one selected from the group consisting of Crohn's lobulated emphysema, central lobulated emphysema, interstitial emphysema, and emphysema.

The pharmaceutical composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the aforementioned components for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. These formulations may be prepared by conventional methods used in the art for formulation, or by methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA, and may be formulated into a variety of formulations, .

The pharmaceutical composition of the present invention can be administered through any conventional route of administration as long as it can reach the target tissue. That is, the pharmaceutical composition of the present invention can be administered orally, intraperitoneally, intravenously, intramuscularly, subcutaneously, Intrathecal, intrapulmonary, intrathecal, intrathecal, or thoracic, and is preferably, but not exclusively, administered intravenously or intrathecally for the treatment of pulmonary disease.

Since the SPECTOR ASC of the present invention exhibits a very excellent therapeutic effect as compared with the dissociated form of ASC and does not require treatment of a separate chemical substance in ASC and can be obtained through a simple culture method, And it can be used as a cell therapy agent because it has an advantage of solving the problem of treatment efficiency which is pointed out as a disadvantage in dissociated type ASC treatment.

Accordingly, the present invention relates to a cell therapeutic composition comprising adipose-derived mesenchymal stem cells (ASC).

The composition or the cell therapeutic agent may be directly applied to an animal including a human to exhibit a therapeutic activity for pulmonary disease. The animal is a group of organisms corresponding to a plant, such as birds including poultry such as pheasant or chicken, , Chlorine, and the like.

The composition or the cell therapy agent may further include any one selected from the group consisting of carbohydrates, proteins, lipids, vitamins, minerals, and combinations thereof, in addition to the active ingredients.

The saccharide may be appropriately selected according to the purpose and use of the saccharide. Examples of the saccharide include honey, dextrin, sucrose, palatinose, glucose, fructose, starch syrup, sugar alcohol, sorbitol, xylitol, But is not limited thereto. The protein may be selected depending on the purpose and use of the protein. Examples of the protein include milk-derived proteins such as casein and whey protein, soybean proteins, animal-derived enzymes such as trypsin and pepsin And hydrolysates by neutrase and alkylase, but are not particularly limited thereto. The lipid may be selected depending on the purpose and use of the lipid. For example, the first lipid may be selected from saturated fatty acids, sunflower oil containing polyunsaturated fatty acids, rapeseed oil, olive oil, safflower oil, corn oil , A variety of plant-derived fats such as soybean oil, palm oil and palm oil, middle-chain fatty acid, EPA, DHA, soybean-derived phospholipids and milk-derived phospholipids. The above-mentioned vitamins are not particularly limited, and the minerals may be appropriately selected depending on the purpose and use of the minerals. Examples thereof include potassium phosphate, potassium carbonate, potassium chloride, sodium chloride, calcium lactate, calcium gluconate, calcium pantothenate, , Magnesium chloride, ferrous sulfate, sodium hydrogencarbonate, but is not particularly limited thereto.

The cell therapeutic agent may be an agent having a formulation suitable for the purpose according to a conventional method in the pharmaceutical field. In addition, the composition may be formulated into a unit dosage form suitable for administration to a patient in the body according to a conventional method in the pharmaceutical field.

The formulation includes an effective dose capable of exhibiting the therapeutic effect of pulmonary disease by one or several doses. In addition to the above-mentioned active ingredients, the pharmaceutical preparations may contain one or more pharmaceutically acceptable conventional inert carriers, for example, a preservative, an anhydrous agent, a solubilizing agent or a stabilizer in the case of an injection, Base, excipient, lubricant or preservative, and the like.

The thus-prepared composition or pharmaceutical preparation of the present invention can be administered in the form of a mixture with other stem cells used for transplantation and other uses, or a mixture thereof with such stem cells, using the administration methods commonly used in the art . In addition, the above-mentioned administration is both non-surgical administration using a catheter and surgical administration such as implantation or transplantation after chest incision, but a non-surgical administration method using a catheter is more preferable.

The daily dose of the active ingredient of the composition, SPEROID ASC, may be administered in the form of 0.1 to 10 x 10 ⁶ cells per ml of the culture solution, in terms of weight per kilogram. The daily dose may be administered in single or divided doses. In addition, when the administration subject is different, the actual dosage of the active ingredient may be determined in view of various factors such as the disease to be treated, the severity of the disease, the route of administration, the weight of the subject, age and sex.

Hereinafter, the present invention will be described in detail with reference to Examples and Production Examples. However, the following examples and preparations are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples and production examples.

Example  One. Speroid ASC  Formation observation

Human fat-derived stem cells (ASC) were purchased from Invitrogen and used. ASC was cultured in an incubator in a 5% CO ₂ environment at 37 ° C in MesenPRO RSTM supplemented with growth supplement (Invitrogen) and 1% penicillin. In all experiments, ASC was transfected using 5 passages and labeled with Qtracker 800 Cell Labeling Kit (QDs; Invitrogen). Briefly, cells (1x10 ⁶ ) were incubated for 45-60 min at 37 ° C with 10 nM QD solution. After labeling, cells were washed twice with complete growth medium. Monolayers of adipose-derived mesenchymal stem cells (ASC) cultured on T175 culture plates for 3 days were coated with 3% BSA solution and dispensed into PDMS cone-well micro-wells prepared. Cone cave micro-wells with a diameter of 300 mu m were coated with 70% (v / v) ethanol and treated with PBS and 3% (w / v) BSA to prevent cell adhesion. Cells were dispensed on each cone-cup micro-well with 64 wells and after 5 minutes of cell division, the remaining cells were removed using ASC condition medium. Cone ASC is dispensed Cave micro-wells and incubated for 37 ℃, 1 il eseo 5% CO _2. The cells started to form aggregates after 1 hour, and the appearance of the monolayer cells and the cells after 1 hour and 24 hours are shown in FIG.

As shown in Fig. 1, ASC cells first formed a monolayer cell layer (A), and self-assembled self-assembled spoloids over time. After 1 hour, ASC was found to begin to form aggregates in the PDMS cone microwell (B), and after 24 hours a pronounced sprooid-shaped ASC formation was observed (C).

Example 2 . Speroid In ASC  Confirmation of increased expression of factor

ASC, which cultured to form a primary layer on a known cell culture plate, was cultured in a dissociated form rather than a sphere-like form, Hereinafter, the expression of cell survival-associated apoptosis protein and growth factors was first compared for the characterization of dissociated ASCs and spoloidal ASCs (hereinafter, referred to as SPECTOID ASC). The anti-apoptotic protein Bcl-2 is known to inhibit the interaction between the mitochondria and the pro-apoptotic protein, BAX (pro-apoptotic protein). For this evaluation, dissociated ASC and sprouted ASC Respectively. This assay was performed using Western blot on the first day of culture. For western blotting, tissue and cell lysates were separated by centrifugation at 1200 rpm at 4 ° C for 10 minutes. Proteins were quantified using a BCA assay and 30 μg samples were sorted by SDS-polyacrylamide gel electrophoresis (PAGE) using 10-15% gel according to protein size. Protein was transferred to the PVDF membrane and blocked at room temperature for 1 hour using 5% skim milk. The primary and secondary antibodies were incubated with the membranes for 1 hour at room temperature overnight at 4 ° C. The membranes were scanned by LAS using a film for signal detection and the results are shown in FIG.

At the protein level, as shown in Figure 2, the expression of BAX was found to be similar in both speroid and dissociated ASC. However, the expression of Bcl-2 was found to be further increased in the spleen ASC compared to the dissociated ASC.

In order to measure the increase in expression of growth factors that may have an important effect on the remodeling of alveoli destroyed by emphysema in ASC cultured in the form of spleod, The amount of mRNA expression of FGF2, HGF and VEGF was confirmed by real-time PCR using SYBR, and the amount of protein expression was confirmed by Western blotting. The results are shown in Fig.

As shown in FIG. 3, the mRNA expression level of FGF2, HGF, and VEGF was significantly increased in the ASC cultured in the sphere form, and the protein expression level was further increased in the speroid form. Therefore, ASCs cultured in the form of spoloids have the potential to effectively induce the regeneration of alveoli destroyed by emphysema.

Example 3 . Speroid ASC Confirmation of recovery effect in emphysema model of

A 6-week-old 20 g (Sungnam, Korea) mouse, a sterile female C57BL / 6 mouse, was used to confirm the efficacy of the SPECTOR ASC using the emphysema model. Line. C57BL / 6 mice were anesthetized via intraperitoneal injection, and pig pancreatic elastase (50 μl; Sigma Aldrich, St. Louis, Mo.) was intravenously injected intra-tracheally at 0 day Lt; / RTI > Seven days later, mice were injected with dissociated or sprouted ASCs (1 x 10 ⁵ cells) intra-pleural. On day 14, mice were euthanized and lung tissue was collected. The lungs of the elastase treated group, which indicates severe alveolar destruction, were identified by H & E staining. A schematic diagram of the experimental method is shown in FIG. 4A, and the results of the staining and quantification thereof are shown in FIG. 4B to E. The MLI (mean linear intercept) method was used for quantification. More specifically, biopsies of harvested emphysema lung tissue 14 days after treatment were fixed in 3.5% (v / v) formaldehyde and allowed to infiltrate to paraffin. The paraffin block was cut into 5 mm thick sections and stained with H & E to analyze the mean linear intercept (MLI). (N = 12, C), elastase + dissociated ASC (n = 10, D) or elastase + plusolide The experiment was performed using ASC (n = 11, E).

As shown in FIGS. 4B-E, restoration of alveolar damage was observed in mice injected with two types of ASCs, while in the control group it was 50.4 μm (B), while in the group treated with elastase only 109.6 μm, It was confirmed that alveolar damage was effectively induced by starase. There was a decrease in the level of reduced MLI compared to the control (F), which was 97.9 μm in the dissected group (D) and 78.2 μm in the group injected with the steroid ASC (F). In particular, the MLI levels of the group injected with the steroids showed a markedly better MLI level compared with all treated groups, especially the dissociated ASC injected group, And can exert a more excellent effect on alveolar restoration.

Example 4 . Elastase - induced pulmonary emphysema ASC  Check the effect of transplantation

Elastase treatment was used to harvest pulmonary tissue from mice that did not induce or induce emphysema, and ELISA, qPCR, and Western blot analysis were used to determine changes in host cells after transplantation of dissociated ASCs and spleen cultured ASCs Respectively.

More specifically, the method of performing qPCR is as follows. Total RNA from lung tissue and ASC was extracted using an RNeasy mini kit (Qiagen, Duesseldorf, Germany) and quantitated using a spectrophotometer. The mRNA transcripts were then synthesized using cDNA synthesis kit. MMP2 (matrix metalloproteinase-9), MMP12 (matrix metalloproteinase-12) and TIMP-1 (tissue inhibitor of metalloproteinases-1, TIMP-1), SLPI (secretory leukocyte protease inhibitor) and gene expression of genes for FGF-2 (fibroblast growth factor 2), HGF (hepatocyte growth factor) and VEGF (vascular endothelial growth factor) And SYBR Green I Master Mix (che Diagnostics). The primer set used is as follows.

A primer set for the mouse gene gene Forward primer Reverse primer β-actin TGGAATCCTGTGGCATCC TAAAACGCAGCTCAGTAA MMP2 ACAAGTGGTCCGCGTAAA CGGTCATCATCGTAGTTG MMP9 CTCGCGGCAAGTCTTCAGAG AGTTGCTTCTAGCCCAAAGAAC MMP12 TGGTATTCAAGGAGATGC GGTTTGTGCCTTGAAAAC TIMP1 GCAACTCGGACCTGGTCATA CGGCCCGTGATGAGAAACT SLPI GGCCTTTTACCTTTCACGGT TACGGCATTGTGGCTTCTCA Fgf2 GCGACCCACACGTCAAAC TCCCTTGATAGACACAAC Hgf AACAGGGGCTTTACGTTCAC CGTCCCTTTATAGCTGCCTC

Primer sets for human genes gene Forward primer Reverse primer GAPDH ACCACAGTCCATGCCATC TCCACCACCCTGTTGCTG BAX TGGCAGCTGACATGTTTTCTGAC CGTCCCAACCACCCTGGTCT Bcl-2 AGATGTCCAGCCAGCTGCACCTGAC AGATAGGCACCAGGGTGAGCAAGCT FGF2 GGCCACTTCAAGGACCCCAAG TCAGCTCTTAGCAGACA HGF GCTATCGGGGTAAAGACCTA CGTAGCGTACCTCTGGATTG VEGF TCGGGCCTCCGAAACCATGA CCTGGTGAGAGATCTGGTTC

In order to evaluate the protein levels of FGF-2, HGF and VEGF involved in regeneration in injured lung tissue, the protein was evaluated by ELISA. Specifically, a total of 10 μg of mouse protein derived from mouse tissue and 30 μg of 1 × 10 ⁶ ASCs Proteins were measured in accordance with the manufacturer's manual using an ELISA kit. The measured proteins include human and mouse growth factors, FGF-2, HGF and VEGF, and the measurement results are shown in FIG.

As shown in Fig. 5, FGF-2, HGF and VEGF showed a distinct increase compared to the dissociated ASC in the speroid ASC transplantation group. These results suggest that the transplantation of ASCs cultured in the form of spleoids can lead to better alveolar recovery.

Example  5. ASC  By implantation MMP  Check the effect of production

In order to confirm the effect of MMP production on the regeneration effect of spoloid ASC transplantation in the form of sprooid, mRNA transcript levels of MMP2, 9, and 12 were confirmed by qPCR. The results are shown in Fig.

As shown in FIG. 6, the MMP-2 mRNA transcript was lower in the ASC transplantation group compared to the negative control group, and the MMP-12 transcript level was significantly lower in the speroid ASC transplantation group . Levels of protein expression were confirmed by Western blot and zymography. In order to detect MMP activity in the lungs of mice using zymography, these tissues were homogenized in a radioimmunoprecipitation assay (RIPA) buffer without protease inhibitor and the resulting lysates were incubated on ice for 30 min. After centrifugation at 12,000 rpm for 10 minutes at 4 째 C, the supernatant containing whole proteins was collected and quantified using a BCA kit. Samples containing 10 μg protein, 2 × zymogen sample buffer and RIPA buffer were loaded onto 10% SDS-polyacrylamide gel containing 2.65 mg / ml gelatin. Electrophoresis was performed for each gel at 30 mA and 100 V. After 1 hour of electrophoresis, the gel was then washed with distilled water and 50 ml of 2.5% Triton X-100 for 10 minutes and resuspended in 1x of Gram- And cultured at 37 ° C. After incubation, the gels were stained with 0.5% Coomassie blue R-250 in 30% ethanol and 10% acetic acid for 1 hour and then decolorized with 30% ethanol and 10% acetic acid. It was washed with ddH ₂ O.

Expression of MMP-9 at mRNA and protein levels was found to be similar in dissociated ASC and spolide ASC transplant groups. The expression and activity of MMP-2 were decreased in both groups. In addition, in the group to which the speroid ASCs were transplanted, it was confirmed by the analysis by the quantification that a larger decrease in MMP-2 activity was observed as compared with the group to which the dissociated ASCs were transplanted. (TIMP-1) and secretory leukocyte protease (SLPI), which are known to be inhibitory in the inhibition of TIMP-1. Tissue inhibitor mRNA expression of TIMP-1 and SLPI indicates that the ASC transplantation group was increased compared with the elastase alone treatment group (D), respectively. Also, a significant increase was observed in the culture with SPECT ASC.

Claims (8)

The present invention relates to a pharmaceutical composition for prevention or treatment of emphysema, which comprises adipose-derived mesenchymal stem cells (ASC) in the form of spherooids, wherein the steroid-type fat-derived stem cells are for inducing alveolar regeneration Composition.
The pharmaceutical composition for preventing or treating emphysema according to claim 1, wherein the steroid-derived fat-derived stem cells are obtained by culturing in a PDMS cone-microwave microwell.
delete 2. The method according to claim 1, wherein the spleen-shaped fat-derived stem cell comprises at least one growth factor selected from the group consisting of fibroblast growth factor 2 (FGF2), hepatocyte growth factor (HGF) and vascular endothelial growth factor Or a pharmaceutically acceptable salt or solvate thereof.
The pharmaceutical composition for preventing or treating emphysema according to claim 1, wherein the steroid-type fat-derived stem cell is an adult stem cell.
delete The pharmaceutical composition for the prevention or treatment of emphysema according to claim 1, wherein the emphysema is at least one selected from the group consisting of Staphylococcus emphysema, central nodular emphysema, interstitial emphysema, and emphysema.
Derived stem cells (adipose-derived mesenchymal stem cells (ASC)), and said steroid-type fat-derived stem cells are for alveolar regeneration induction. A cell therapy composition for preventing or treating emphysema.

Images