KR101811048B1 - Composition comprising extract of Gynostemma longipes VK1 or longipenoside A compound isolated from thereof for preventing or treating of cognitive dysfunction - Google Patents

Abstract

The present invention relates to a composition for preventing or treating a cognitive function disorder, containing a gynostemma longipes VK1 extract or longipenoside A compound separated therefrom. The gynostemma longipes VK1 extract or longipenoside A compound separated therefrom is injected into an animal model with hypomnesia and a cognitive disorder, and thus, a cognitive function and memory are confirmed to be improved.

Description

A composition for preventing or treating cognitive dysfunction, which comprises as an active ingredient a Zynosthomonas ficus VK1 extract or a ronigphenoside A compound isolated therefrom (Composition comprising extract of Gynostemma longipes VK1 or longipenoside A compound isolated from the compound for treating or treating of cognitive dysfunction}

The present invention relates to a composition for preventing or treating cognitive dysfunction, which comprises as an active ingredient an extract of Gynostemma longipes VK1 or a longpenoside A compound isolated therefrom.

Population aging is one of the most important social issues in the world. In the United States and Japan, the elderly population aged 65 and older is now expected to reach 13% and 16%, respectively, and 24% and 32%, respectively, after 25 years. In Japan, the current longevity-related industry in Japan is 39 trillion yen, which is expected to grow to 155 trillion yen in 20 years. (In 2000, the Ministry of Commerce Industry Restructuring Review Committee, "21st Century Economic Policy Vision Report" , 2000). In Korea, the elderly population, which is 11.0% of the total population as of 2010, is expected to reach 24.3% by 2030. Therefore, urgent measures are needed.

Along with the rapid increase in the elderly population, geriatric diseases are also rapidly increasing, and this has become an essential social problem that needs to be solved for the increase in medical expenses (FED, 2009). In particular, dementia disease is rapidly increasing with the aging population, and it has become a social phenomenon not only in Korea but also in the whole world. According to the WHO report, the global dementia population is estimated to reach 131.1 million in 2015, tripling from 46.8 million in 2050. The population of the elderly with dementia in Korea is also rapidly increasing from about 540,000 in 2012 to 1.27 million in 2030 and 2.71 million in 2050, about twice every 20 years.

Socio-economic costs associated with global dementia are estimated at $ 604 billion in 2010 (1% of global GDP) and will reach $ 1 trillion by 2030. The social and economic costs associated with domestic dementia are estimated to rise to 11.7 trillion won by 2013 and to 43.2 trillion won by 2050. The social cost of dementia treatment is significantly higher than that of general chronic diseases. In the UK, the social cost of dementia is 23 billion pounds, which is significantly higher than cancer (12 billion pounds) and heart disease (8 billion pounds). In particular, dementia is a disease that loses human self, It is the disease most dreaded by the population, and it also relates to efforts to defend human intrinsic value.

Dementia is a generic term that refers to a condition in which the brain can not maintain the previous level of daily life due to various cognitive disturbances such as memory due to various causes of brain damage (Jeong, Yeojo, et al., 2000). Alzheimer's disease, vascular dementia, dementia with Lewy body and frontotemporal dementia are classified according to the cause of dementia (Kim, Sang-yoon, 2006). Alzheimer's dementia is a disease characterized by progressive memory impairment and amyloid plaque and nerve fiber entanglement, which accounts for 50-75% of patients with dementia. Vascular dementia is a progressive cerebrovascular disease with fewer memory impairments and lowered concentration, and is characterized by proliferation of major infarcts or multiple infarcts. Among domestic dementia patients, Alzheimer's dementia accounts for 71.3%, vascular dementia accounts for 16.9%, and other dementia accounts for 11.8%, indicating that Alzheimer's disease and vascular dementia account for most of dementia patients. Among the symptoms of the disease, the most probable dementia was 17.4%, mild dementia 41.4%, moderate dementia 25.7% and severe dementia 15.5%.

Alzheimer's disease, which predominantly occurs in the elderly population, is characterized by the accumulation of β-amyloid (Aβ) protein in the brain lesion of the patient. The beta-amyloid protein is known to accumulate in the brain about 10 to 15 years before the clinical dementia symptom, memory impairment and impaired ability to perform daily activities. Accumulated beta-amyloid protein causes various neurotoxicity, It is known to cause neurodegenerative disease in addition to hyperphosphorylated tau protein. The beta-amyloid accumulation in the brain acts in a way that inhibits synaptic plasticity, a neuronal mechanism.

The neuropathologic features of Alzheimer's disease are loss or loss of synapses, loss of metabolic function of neurons, and damage of various neurotransmitter systems. Amyloid plaques due to the accumulation of beta-amyloid are observed in the brain region of patients with Alzheimer's disease. The beta-amyloid protein is produced by degradation of the amyloid precursor protein by the two enzymes of? -Secretase and? -Secretase, And beta-amyloid produced or produced are not normally degraded, beta-amyloid aggregates and accumulates in the brain, leading to nerve inflammation and nerve cell death.

In addition, neurofibrillary tangles (NFT) are observed in Alzheimer's disease patients. Tau, one of the microtubule associated proteins, is a major component of nerve fiber bundles and is responsible for the neuronal intracranial axonal transport and microtubule stabilization by repeating phosphorylation and dephosphorylation. However, when the balance is broken by the hyperphosphorylation of tau, aggregation of tau and bundles of nerve fibers are produced, accumulating in the brain and inducing neuronal cell death. Therefore, the anti-tau mechanism can protect neurons by preventing tau aggregation and nerve fiber bundle formation through inhibition of hyperphosphorylation of tau.

In conclusion, glia cells that are abnormally agitated and activated by accumulation of beta-amyloid or phosphorylated tau (p-tau) may become inflammatory, such as NO (nitric oxide) or PGE2 (prostaglandin E2) Not only promotes the expression of mediators but also promotes the secretion of inflammatory cytokines such as IL-1β (interleukin-1β) and TNF-α (tumor necrosis factor-α) .

Currently used drugs for treating Alzheimer's disease include acetylcholinesterase inhibitor drugs such as donepezil, rivastigmine, galanthamine and NMDA receptor antagonists (N-methyl-D- aspartate receptor antagonist, and memantine. The acetylcholinesterase inhibitor is known to be a pharmacological mechanism that enhances memory by inhibiting acetylcholine degradation by acetylcholinesterase in the brain of Alzheimer's patients. However, it inhibits the progress of Alzheimer's disease Or can not be treated. Donepezil, the most commonly known drug for treating dementia, is a drug widely used for Alzheimer's disease, but also for vomeric dementia and rubiocellular dementia. About 10% of the patients have gastrointestinal disorders, headache and dizziness. In addition, tachrine, which was first approved as a treatment for Alzheimer's disease, was withdrawn from the market due to severe hepatotoxicity. Monoclonal antibody vaccines have recently been developed and are currently in clinical phase 2 and phase 3. However, these drugs do not have the ability to treat Alzheimer's disease itself or restore symptoms. Therefore, it is necessary to develop new therapeutic agents for dementia with few side effects.

Gynostemma longipes CYWu is a perennial vine plant belonging to the genus Cucurbitaceae and is native to southern Vietnam and China. Gynostemma longipes CYWu is similar to Gynostemma pentaphyllum , which grows in Korea, Ulleungdo and southern provinces, Vietnam, Japan and China. Other than stone, it is a vine plant. Its stem is wrapped around another object with a tendril, it grows by tangling up and down, and it is used as "stone outside" to dry the leaf. The rhizome or outpaths of the stones are called 七葉 膽, and they have traditionally been used for respiratory or circulatory diseases such as germane, bronchitis, flea, poisoning, poisoning, and seawater. Leaves other than stones are alive, with multicellular white hairs on both sides, but soon disappear. Lobules are usually five, but some are 3-7. Gynostemma longipes CYWu is characterized by a relatively large number of leaves (7 ~ 9) in comparison with stones. It is relatively difficult to distinguish between leaves and leaves in Vietnam. Has been used. However, Gynostemma longipes CYWu) is characterized by having more leaves than stones, pubescent in the stems, and a bitter taste than stones. Studies on Gynostemma longipes CYWu have not been conducted much recently. Recently, research on chemical composition has been attempted, and Vietnamese researchers have been studying Gynostemma longipes CYWu from Gynostemma longipes CYWu -III (gylongiposide II-III) and gypentoside A (Anh PT, et al., 2015).

Thus, in the course of studying the extract of Agenzinthomonrhia ficus, the present invention, a new variety, Zynostemonga fescue VK1 ( Gynostemma longipes VK1). The inventors of the present invention were able to complete the present invention by confirming that Zincothermone pest VK1 extract or a compound isolated therefrom has an effect of treating memory decline and cognitive disorders.

Korean Patent No. 0945382 discloses a therapeutic and prophylactic use of Gynostemma pentaphyllum extract as a prior art for the treatment of neurodegenerative diseases. However, in the case of Zynostemma pace VK1 ( Gynostemma longipes VK1) extract or the lon- giophenoside A compound isolated therefrom is not described, and thus the composition of the present invention is different from that of the present invention. Chinese Patent Laid-Open No. 104721413 discloses Gynostemma pentaphylla extract, but it is a plant heterologous to the Zynoththermophagus fus VK1 of the present invention and shows the effect of preventing and treating liver disease, This is different from the configuration of the present invention, which discloses an enhancing effect. In addition, Chinese Patent No. 103238741 discloses Gynostemma longipes , but differs from the present invention in that it does not disclose the effect of enhancing memory effect with the compound of the present invention.

Korean Patent No. 0945382, Pharmaceutical composition for the treatment and prevention of neurodegenerative diseases containing an extract of Vinegar as an active ingredient, 2010. 02. 24. Registered. Chinese Patent Laid-Open No. 104721413, Traditional Chinese medicine vinegar for treating fatty liver, Chinese Registration No. 103238741, Nutritious animal food for improving pork quality, 2014. 05. 14. Registration.

In 2000, the Japan Industrial Restructuring Review Committee, "Report on the 21st Century Economic and Industrial Policy Vision Report, 2000. Kim, Sang Yoon, Clinical diagnosis and differential diagnosis of dementia, Hanyang medical review, 26 (1), 14-25, 2006. Chung, YJ, et al., Prevention and management of dementia, Inje medical Journal, 21 (1), 11-19, 2000. Prevalence rate and risk factors of elderly people with dementia in Korea, Health and Welfare Forum, 156, 43-48, 2009. Anh P.T., et al., Damarane-type Saponins from Gynostemma longipes and their Cytotoxicity Activity, Nat. Prod. Commun., 10 (8), 1351-1352, 2015.

It is an object of the present invention to provide a composition for preventing or treating cognitive dysfunction which comprises as an active ingredient an extract of Gynostemma longipes VK1 or a longpenoside A compound isolated therefrom.

The present invention relates to a pharmaceutical composition for preventing or treating cognitive dysfunction, which comprises an extract obtained from Gynostemma longipes VK1.

The present invention also relates to a pharmaceutical composition for preventing or treating cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermophys felis VK1 comprising a compound of longpenoside A having the following formula (1).

[Chemical Formula 1]

The Zynoththermophagus VK1 extract may be an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate.

The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by adding one or more organic solvents selected from the group consisting of hexane, ethyl acetate and butanol to the diluent, or a fraction obtained by passing the diluent through an ion exchange resin.

The cognitive dysfunction may be selected from the group consisting of dementia, learning disorder, agnosia, amnesia, aphasia, apraxia or delirium, mild cognitive impairment ), And Binswangers disease.

The dementia may be AIDS (Acquired Immune Deficiency Syndrome) induced dementia, Alzheimer's dementia, vascular dementia, rheisome dementia, frontal dementia, semantic dementia, and multiple infarct dementia (MID).

The present invention also relates to a pharmaceutical composition for preventing or treating cognitive dysfunction, which comprises a longpenoside A compound represented by the following formula (1) as an active ingredient.

[Chemical Formula 1]

Further, the present invention relates to a health functional food for improving cognitive dysfunction comprising an extract extracted from Zynostemma longipes VK1.

The present invention also relates to a health functional food for improving cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermone females VK1 comprising a compound of longpenoside A having the following formula (1).

[Chemical Formula 1]

The Zynoththermophagus VK1 extract may be an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate.

The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by adding one or more organic solvents selected from the group consisting of hexane, ethyl acetate and butanol to the diluent, or a fraction obtained by passing the diluent through an ion exchange resin.

The present invention also relates to a health functional food for improving cognitive dysfunction, which comprises a longpenoside A compound of formula (1) as an active ingredient.

[Chemical Formula 1]

The present invention also relates to an animal drug for preventing or treating cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermone females VK1 comprising a longpenoside A compound of the following formula (1).

[Chemical Formula 1]

The Zynoththermophagus VK1 extract may be an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate.

The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by adding one or more organic solvents selected from the group consisting of hexane, ethyl acetate and butanol to the diluent, or a fraction obtained by passing the diluent through an ion exchange resin.

The present invention also relates to an animal drug for preventing or treating cognitive dysfunction, which comprises a longpenoside A compound represented by the following general formula (1) as an active ingredient.

[Chemical Formula 1]

The present invention also relates to an animal feed additive for improving cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermophys felis VK1 comprising a longpenoside A compound of the following formula (1).

[Chemical Formula 1]

The Zynoththermophagus VK1 extract may be an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate.

The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by adding one or more organic solvents selected from the group consisting of hexane, ethyl acetate and butanol to the diluent, or a fraction obtained by passing the diluent through an ion exchange resin.

The present invention also relates to an animal feed additive for improving cognitive dysfunction, which comprises a longpenoside A compound of formula (1) as an active ingredient.

[Chemical Formula 1]

The present invention also relates to a novel compound longpenoside A having the following chemical structure.

The present invention also relates to a method for producing Zynoththermoscopic femur VK1, which comprises using Zynoththermoscopic feline VK1 as a solvent, at least one selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate as a solvent, step; A second step of diluting the Zynoththermophagus VK1 extract to prepare a diluted solution; A third step of passing the diluted solution through an ion exchange resin to obtain fractions; A fourth step of concentrating the fraction to prepare a concentrate or applying the concentrate to chromatography to obtain a fraction; And a fifth step of crystallizing the concentrate or the small fraction with water, C1 to C4 lower alcohol, acetone, acetonitrile or a mixed solvent thereof.

Hereinafter, the present invention will be described in detail.

The Gynostemma longipes VK1 is a plant belonging to the genus Gynostemma spp., Gynostemma longipes . It is a plant belonging to the genus Gynostemma longipes , It is a plant of a new breed distinguished from Zynos theme longevity species.

The Zynoththermophagus VK1 extract may be an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone, ethyl acetate, hexane and chloroform. Preferably water, C1 to C4 lower alcohols, acetone, ethyl acetate and hexane. Most preferably water, C1 to C4 lower alcohols, acetone and ethyl acetate.

An extract of Zynoththermophys felis VK1 containing the above-mentioned lonergic phenoxide A compound is obtained by extracting Zynoththermophysi fus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate Methanol, ethanol, propanol, isopropanol, butanol, etc. may be used as the C1 to C4 lower alcohols. Preferably water, ethanol, methanol, butanol and ethyl acetate, most preferably methanol and ethanol.

The solvent may be added at a weight of 2 to 500 times the weight of Zynothhemoron pace VK1.

Also, the Zynoththermophagus VK1 extract is obtained by concentrating an extract obtained by extracting Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by fractionating the diluted solution with one or more organic solvents selected from the group consisting of hexane, ethyl acetate and butanol, or a fraction obtained by passing the diluted solution through an ion exchange resin.

The diluent may be prepared by adding water or ethanol to a concentrate of a Zynoththermophagus VK1 extract. When the concentrate is 0.0001 g to 10 g, 1 to 10 L may be added.

The organic solvent is preferably butanol.

The organic solvent may be added at a weight of 0.5 to 4 times the weight of the diluted solution obtained by concentrating and diluting the Zynoth's theme VK1 extract.

The ion exchange resin may be selected from Diaion HP-20 (Diaion HP-20), SP825, AXT204, XAD1600T, MN200, SP70, SP710 and the like. Preferably SP70 and SP710, and most preferably SP70.

The cognitive dysfunction refers to a state in which memory, attention, language ability, time-space ability and judgment ability are degraded.

The cognitive dysfunction may be selected from the group consisting of dementia, learning disorder, agnosia, amnesia, aphasia, apraxia or delirium, mild cognitive impairment ), And Binswangers disease.

The dementia may be AIDS (Acquired Immune Deficiency Syndrome) induced dementia, Alzheimer's dementia, vascular dementia, rheisome dementia, frontal dementia, semantic dementia, and multiple infarct dementia (MID).

The longpenoside A compound of formula 1 may be a novel compound.

The Ronigi phenocide A compound can be isolated from the Zynoththermophagus VK1 extract. Also, it can be synthesized according to a conventional method in the art, and can be prepared as a pharmaceutically acceptable salt.

The present invention relates to a method for separating Ronphenoside A compound represented by Formula 1, wherein Zinoththermophagus ficus VK1 is at least one selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A first step of preparing an extract of Nomotoronji pest VK1; A second step of diluting the Zynoththermophagus VK1 extract to prepare a diluted solution; A third step of passing the diluted solution through an ion exchange resin to obtain fractions; A fourth step of concentrating the fraction to prepare a concentrate or applying the concentrate to chromatography to obtain a fraction; And a fifth step of crystallizing the concentrate or the small fraction with water, C1 to C4 lower alcohol, acetone, acetonitrile or a mixed solvent thereof.

The dilution solution of the second step may be prepared by diluting a Zynoththermophagus VK1 extract with water or ethanol. When the Zynoththermophagus VK1 extract is 0.0001 g to 10 g, the dilution may be diluted by adding 1 to 10 L .

The fourth step chromatography can be carried out by silica gel column chromatography, LH-20 column chromatography, ion exchange resin chromatography, thin layer chromatography Thin layer chromatography and high performance liquid chromatography may be used.

The crystallization in the fifth step means that a liquid or an amorphous solid forms crystals. Specifically, a solvent may be added to the concentrate or the small fraction of the fourth step to crystallize the rorphenic acid A compound present in the concentrate or the small fraction.

The solvent may be water, C1 to C4 lower alcohols, acetone, acetonitrile or a mixture thereof. The C1 to C4 lower alcohols may be methanol, ethanol, propanol, isopropanol, butanol, and the like.

The pharmaceutical composition comprising the Zynoththermoscopic feline VK1 extract or the lonlyphenoside A compound isolated therefrom can be administered orally or rectally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, And may be formulated in the form of a tablet, an external preparation, a suppository, and a sterile injection solution. Examples of carriers, excipients and diluents that can be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like. Such solid preparations can be prepared by mixing at least one or more of the Zincothermone fes VK1 extract of the present invention or the lonophenoxide A compound separated therefrom Excipients such as starch, calcium carbonate, sucrose or lactose, and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.

The dosage of the pharmaceutical composition will depend on the age, sex, body weight of the subject to be treated, the particular disease or condition to be treated, the severity of the disease or condition, the route of administration and the judgment of the prescriber. Dosage determinations based on these factors are within the level of ordinary skill in the art and generally the dosage ranges from 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferable dosage is 0.1 mg / kg / day to 500 mg / kg / day. The administration may be carried out once a day or several times. The dose is not intended to limit the scope of the invention in any way.

The pharmaceutical composition may be administered to mammals such as rats, livestock, humans, and the like in various routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine mucosal or intracerebral injection. The Zincothermone pace VK1 extract of the present invention or the Ronigiphenoside A compound isolated therefrom has little toxicity and side effects, and thus can be safely used for long-term use even for prophylactic purposes.

In addition, the present invention provides a health functional food comprising a food-acceptable food supplement containing an extract of Zynoththermophagus VK1 or a lon- giophenoside A compound isolated therefrom. The health functional food of the present invention includes forms such as tablets, capsules, pills, and liquids, and as a food to which the extract of Zincothermone pace VK1 of the present invention or the lonlyphenoside A compound isolated therefrom can be added , For example, various foods, beverages, gums, tea, vitamin complexes, and health functional foods. In particular, the present invention relates to a method for improving memory and learning ability or cognitive dysfunction, comprising a food-acceptable food supplementary additive containing a Zynoththermophagus VK1 extract or a lonophenide A compound isolated therefrom It provides health functional foods.

The animal feed additive may be used as an additive for animal feed, and the Zynoththermophysi feline VK1 extract of the present invention or the lone polyphenoid A compound isolated therefrom is added to the animal feed in an amount of 0.001 to 30 wt% By weight, preferably 0.001% by weight to 10% by weight, and most preferably 0.001% by weight to 5% by weight.

The present invention relates to a composition for preventing or treating cognitive dysfunction, which comprises, as an active ingredient, an extract of Gynostemma longipes VK1 or a longpenoside A compound isolated therefrom, The results of the administration of the Lonerpepes VK1 extract or the loniphenoside A compound isolated therefrom to the animal models of memory loss and cognitive impairment showed that the cognitive ability and memory enhancing effect were obtained.

Thus, the present inventive extract of Gynostemma longipes VK1 or the longpenoside A compound isolated therefrom can be used as a medicament for the prevention or treatment of cognitive dysfunction or in the development of a health functional food for memory enhancement It is expected that it will be usefully used in the future.

Figure 1 shows the external morphological differences of the plants of the genus Gynostemma spp. (A) is G. laxum , (B) is G. burmanicum , (C) is G. pentaphyllum , (D) is (G. longipes ), (E) shows the external shape of the Zyunoththermongi pes VK1 (G. longipes VK1).
FIG. 2 is a graph showing the relationship between rDNA-ITS (nucleotide ribosomal DNA gene region) (A), matK (mutase K gene region) (B) and ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit gene (C) and rsbA-trnH (rpl20-rps120 intergenic spacer region gene region) (D), showing similarity with the previously identified zynothorhermophagus gene.
Figure 3 shows a systematic classification of Zynos theme species using DNA barcoding for the identification of Zynosthomonrhoeferis VK1.
Fig. 4 is a graph showing the results of discrimination of Z. nymothermophthus VK1 plants. In order to distinguish Z. nymothermophycephaly VK1 plants, Z. nothermontis females ( Z. G. burmanicum , G. pentaphyllum , and G. longipes ).
Fig. 5 shows the results of HMBC of the novel compound, lunophenoside A, isolated from Zynoththermophys fus VK1.
FIG. 6 shows the results of confirming the memory improvement and the cognitive enhancing effect of the Zynoththermophagus VK1 extract. The cognitive impairment mouse model of scopolamine administration was obtained by administering a 70% ethanol extract of Zincothermonipes VK1 to a new animal.
FIG. 7 shows the results of confirming the effect of preventing or treating cognitive dysfunction and memory decline due to senescence of Zynosthomonrhia fescue VK1 extract. A 22-month-old aged mouse was administered a Zinoththermophagus VK1 70% ethanol extract to perform a new object recognition experiment, which resulted in a decline in memory by a search time (A) for a new object and a search frequency (B) for a new object And cognitive disorders.
Fig. 8 shows the results of confirming the effect of improving the memory and cognitive function of the compound of the lon- giophenoside A isolated from the Zynoththermophagus VK1 extract. Cognition disturbance by administration of scopolamine The compound of lonifenoside A was administered to the animal model at a concentration (5 mg / kg, 20 mg / kg, 50 mg / kg) to determine the degree of recognition of a new object.
Fig. 9 shows the tau phosphorylation inhibitory activity of the lonergic phenoside A compound isolated from the Zynoththermophagus VK1 extract. (A) shows the results of western blotting of the expression level (pTau) of hyperphosphorylated tau after treating the HT22 cell line with the concentrations of 1, 5 and 10 μM of lonergic phenoid A compound, (B) Tau) expressing the phosphorylated tau (pTau) as a relative quantitative value.

Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein but may be embodied in other forms. Rather, the intention is to provide an exhaustive, complete, and complete disclosure of the principles of the invention to those skilled in the art.

≪ Example 1 > Differentiation of Zynoththermoscopic femur VK1 >

Example 1-1. Differentiation of Zynoth's theme longevity by morphological characteristics

Gynostemma spp. Plants were collected in various regions of Vietnam in order to distinguish the morphological differences of the plants of the present invention VK1 ( Gynostemma longipes VK1). Identification of the plant by external morphological features was carried out by Professor Tran Van On and Pharm Ha Than Tung, professor of botany at Hanoi Pharmacy College, Vietnam.

In order to distinguish the exact morphological characteristics of the plant, Gynostemma spp., The G. pentaphyllum belonging to the genus Zothos theme which can be sampled in Vietnam with similar external form, G. laxum , G. longipes , and G. burmanicum were collected and compared with each other to determine the difference in the shape of leaf, stem and petiole of each plant. And the results are shown in Fig.

As shown in Fig. 1, Zyunothhemia ischemia (A) has three small leaves, the surface of the leaves is smooth and fragrant, and has no hair. Zincotherm bombardini (B) was composed of three to five small leaves, with overall fine keratin and sweet taste. Zinoth Theme Pentaphyllum (C) has thin, grooved, rounded, reckless or coarse nipples with stems and branches, the leaves usually have five leaves in the shape of a bird's eye, some with seven small nanny or reckless It has leaves. The leaves are oblong-ovate or lanceolate and consist of middle lobes of 3 ~ 12 × 1.5 ~ 4㎝ in size and smaller lateral lobes. Sometimes the rough leaf surface is visible. The lateral artery was 6 to 9 pairs and showed features of stabbing-like leaflets, acute or short acuminate, 1 to 5 mm of leaflets, thread-shaped vines, and 2-mast (fid). Zynos theme The common feature of the pentapyllum is that it has five small leaves and it has a bitter taste. Zinoth theme longevity (D) is characterized by leaves consisting of seven to nine small leaves with nipple stems and lanceolate. The petiole is 4 ~ 8㎝ long. The leaf shape is elliptical-rhomboid or Doran-lanceolate. It has middle leaf of 5 ~ 12 × 2 ~ 4.5㎝, uneven irregularly shaped leaflet, and short pointed peak. The zinoththymonophagus fecal VK1 (E) of the present invention has a lateral leaflet smaller than the mid lobe, a dull leaf tip, a rough hair of a hypocotyl on a leaf vein, a penile nanny of a hypocotyl, a small leaflet of about 1 cm and a thin vine, ). In addition, the genus thomharyngeus fescue VK1 of the present invention is distinguished from other genus motifs in general by having seven small leaves, a rough nanny and a stem having five busbars and five angles.

As a result, it was found that the Zynoth's theme longevity pest VK1 of the present invention is the same as the Zynoth's theme longevity pest of Gynostemma spp., And the plant sample of Zynoth's theme longevity pest VK1 is the plant of Hanoi Pharmacy University of Vietnam It was kept in the sampler as resource number HNIP.18500 / 16.

Examples 1-2. Identification of new varieties Zinostha longong fescue VK1 through DNA differentiation

In order to distinguish the DNA of Zincothermonfexus VK1 of the present invention, GeneBank, a DNA barcode gene bank, and GenBank, which is a commonly used DNA barcode region registered in the BOLD (Barcode of Life Data) system, The rDNA-ITS of the nuclear ribosomal DNA gene (nrDNA) and the matK (maturase K) of the chloroplast genome, ribulose-1,5-bisphosphate carboxylase / oxygenase large subunit (rbcL) and psbA-trnH (rpl20-rps120 intergenic spacer region) were selected and their DNA sequences were analyzed by DNA sequencing.

DNA was extracted from the collected plants for DNA discrimination. 200 mg of the collected plants were used for DNA extraction with the Dneasy Plant Mini Kit of QIAGEN (Germany). Amplified DNA was amplified and sequenced and analyzed for amplified DNA in Macrogen. The primers used for discriminating the genus thomhronophagus females VK1 of the present invention are shown in Table 1.

Gene site Name of the primer Primer base sequence The amplified length (bp) rDNA-ITS ITS1F TCCGTAGGTGAACCTGCGG 658 ITS4R TCCTCCGCTTATTGATATGC matK MATK8F AAATCCTTCGCTCCTGGGTG 658 MATK710R GAATCGATCCAGGCCGTCTT rbcL RBCL134F GGACAACTGTGTGGACCGAT 430 RBCL590R AAACGGTCTCTCCAACGCAT psbA-trnH RP143F ACCTTCCCGACCACGATTTC 516 RP686R CGGAACAACCCCGTTCACTA

Amplified DNA sequencing was performed using genetic DNA sequencing software (version 8.1.8, Biomatters Ltd. New Zealand). Using the various DNA barcode information registered in the gene bank, we compared and analyzed DNA nucleotide sequences in Zynosome genomes that were previously registered in order to accurately distinguish genomes from genus Zymospora. The VK1 nucleotide sequence of Genomese longevirus was compared with the gene of Genomus longomy fesus registered using the BLAST (Basic Local Alignment Search Tool) of the gene bank, and the result is shown in Fig.

As shown in FIG. 2, the nucleotide sequence analysis of rDNA-ITS (A), matK (B), rbcL (C) and rsbA-trnH (D) of Zynoth's theme rongefex VK1 revealed that each gene- And 99.5% or more of the genome gene of the genus Zymospora.

In addition, the interspecific relationships between the Zynoththermophagus pest VK1 of the present invention and the four species of Zynothhemaceae plants collected in Vietnam of Example 1-1 were confirmed. Each of the plants belonging to Genus theme of Example 1-1 was amplified by using the nucleotide sequence information of the gene region registered in GeneBank, and then the gene sequence was established. At this time, the gene of the genbank used was KF269131 for Zynoth's theme pitfilium, KF269126 for Zynos theme rock, KF269109 for Zynos theme bombardy, KF269108 and KF261571 for Zynos theme longevity, The results are shown in Fig.

As shown in FIG. 3, it was confirmed that the species could be discriminated through the difference between the genome thomson females VK1 of the present invention and other genus theme species and the amplified gene region. However, differences in gene amplification sites have been found among plants distinguished by external morphology as zynothhemorrhoids. That is, gene regions using KF269108 and KF261571, registered as genus theme longeviruses in the genbank, are located in Tam Dao, TD, Quan Bao, QB and Dong Van, DV regions It was similar to the collected Zynoth Theme longevity. However, in the Dong Van region of the present invention, the Z. nymothelioma females VK1 have single nucleotide polymorphism (SNP) in two genes different from Z. nothermongifera collected in other regions Was identified, which distinguished it from other Zynothermonian fes.

Accordingly, a new varietal strain of the present invention, which has been collected in the Dong Van region of the present invention through a joint study between Korea and Vietnam and confirmed to have single nucleotide polymorphism (SNP) The North theme longevity festival was named as Gynostemma longipes VK1. In addition, the gene region of Zynoth's theme longevity ficivirus VK1 amplified by the primer shown in Table 1 was received at GeneBank and recorded in the JinBank Data Bank after examination. The official registration numbers for each site for the Northothermalongi fes VK1 deposited at the National Center for Biotechnology Information (NCBI) are KX619478 (rDNA-ITS site), KX619479 (matK site), KX619480 (rbcL site) KX619481 (psbA-trnH site).

Examples 1-3. Differentiation of Zyunoththermophagus femur VK1 by chemical composition components

Four kinds of Gynostemma spp. Plants collected in Vietnam of Example 1-1 were classified according to their constituents. In particular, Zynos theme longevity collected plants by collection sites and further examined the composition of the constituent compounds.

The plants were collected and dried. To 1 g of each dry plant, 50 ml of 70% methanol was added and the plant components were extracted using an ultrasonic wave extractor. At this time, the extraction process was repeated three times under the same conditions. The extracted extract was collected, filtered, and dissolved in methanol to a concentration of 2 mg / ml in a 50 ml flask to prepare a sample for analysis of chemical components through thin layer chromatography.

The prepared sample was spotted on RP-18 plate and developed with 80% methanol as a solvent. After oxidation using 10% sulfuric acid, the color of the compound shown on the thin layer chromatography and the moving distance of the compound were measured and divided into three groups. The results are shown in FIG.

As shown in FIG. 4, it was confirmed that, in contrast to other Zinoth theme species, Zinoth theme rock contained a large amount of flavonoid compounds, and the thin layer chromatography shape of the Zinothhemburomani hidden compound was purple It has been found that a large amount of triterpenoid compound appears. Unusual was found to have a composition of trityterpenoid compounds similar to Zynostomiburnumi chome in some of the plant specimens identified as Zynoth's theme longevity in external morphological differentiation and DNA differentiation. Zynos Theme The pentapyllum contains some flavonoids and has been found to be composed mainly of triterpenoids, similar to Zynoth's theme longevity. Zincothermongeus ficus VK1 of the present invention was confirmed to be a specific yellow terpenoid compound as a main component. Subsequently, in order to standardize the Zinoth theme Longevity VK1 plant, a sample of the plant sample was collected under the cooperation of the DK-Pharma Company in the Quan Ba district of Ha Giang Province, Vietnam. Changes in the composition and content of the compounds were monitored from the cultivation to the harvesting time. According to the result of the compound analysis, the time of collecting Zynoththermophagus VK1 was finally determined for standardization of the compound by observing that the Zynoththermophysi females VK1 showed a partial increase of the Gypentoside A compound at the time of flowering .

≪ Example 2: Preparation of Zynoththermophagus VK1 extract >

10 g of ground Zynothermonia fescue VK1 was added to each of the solvents listed in Table 2 below and ultrasonically extracted for 3 hours. This procedure was repeated three times to prepare an extract. At this time, 300 ml of the solvent was used per one time.

In addition, high performance liquid chromatography (HPLC) was performed to confirm the content of the active ingredient longpenoside A in each extract. HPLC was carried out using an Agilent 1200 HPLC system (Agilent Technologies, Palo Alto, Calif., USA) under the conditions of an acetonitrile concentration gradient (10 → 100% [v / v] Mg / ml, and 10 [mu] l of each solution was injected. The column used was INNO RP-C18 (4.6 × 250 mm, 5 μm particle size, Young Jin Bio Chrom Co., Ltd.) with a flow rate of 0.5 ml / min, UV detection: 205 nm]. In addition, the checklability of the lonlyphenoside A compound was prepared through the same HPLC conditions, and the extraction amount of the Zynoththermophysi fus VK1 extract and the content of the lonlyphenoside A compound in each extract were determined according to the respective solvents, The results are shown in Table 2.

Extraction solvent Of the extract containing the compound < RTI ID = 0.0 >
Extraction (%) Content (%) of lonlyphenoside A compound Distilled water 16.5 1.27 30% ethanol 18.5 6.6 50% ethanol 17.5 12.2 70% ethanol 14.0 16.5 100% ethanol 11.5 10.3 100% methanol 11.5 9.7 n-hexane 8 0 Acetone 4 1.3 Ethyl acetate 8.5 5.9 n-butanol 11.0 3.1

As shown in the above Table 2, it can be seen that the extract of Zincothermonomie pVK1 can be extracted by a polar organic solvent such as water, ethanol and methanol. In addition, it is known that the Ronig phenoxide A compound, which is an active ingredient of Zynoth's theme rongefex VK1, is present in a large amount in ethanol, methanol and ethyl acetate extracts, and in particular, it is found that it is contained in a large amount in the 70% ethanol extract there was.

≪ Example 3: Preparation of Zinc Therapeutic VK1 fraction >

An organic solvent or an adsorbent resin was used to prepare the Zynoththermophagus VK1 fraction containing the longpenoside A compound of the present invention. The adsorbent resin used in the present invention is an ion exchange resin, and more specifically, as a synthetic adsorbent, a standard (CFR173.62, Code of Federal Regulations Title 21) that can be used for foods and medicines by the US FDA among aromatic non- The satisfied resins, SP70 and SP710, were used.

500 ml of 70% ethanol was added to 30 g of dried Zynosthomonas pace VK1, and ultrasonic extraction was repeated three times to obtain an extract. Thereafter, the extract was concentrated with a vacuum concentrator to obtain 5.1 g of a concentrate. 500 ml of 20% ethanol was added to the obtained concentrate to make a 20% ethanol diluent. A 20% ethanol dilution was adsorbed through the SP70 resin and treated with 500 ml of distilled water, 40% ethanol, 60% ethanol, 80% ethanol and 100% ethanol, which corresponded to 100 times the weight of the extracted concentrate, The fraction was eluted by elution, and finally the adsorbed material was eluted using acetone as a solvent.

The content of the Roniginophenoside A compound in the VNO1 70% ethanol extract and ZNOtherma longevity Fragment VN1 obtained by the above procedure was analyzed. At this time, high performance liquid chromatography (HPLC) and quantitative method of Example 2 were used for the analysis, and the results are shown in Table 3.

Fraction Content (%) of lonlyphenoside A compound Configuration Concentration (mg / ml) Amount of injection (μl) 70% ethanol extract One 10 14.0 SP70 resin
(Fraction of distilled water) One 10 0 SP70 resin
(20% ethanol fraction) One 10 0 SP70 resin
(40% ethanol fraction) One 10 1.2 SP70 resin
(60% ethanol fraction) One 10 17.2 SP70 resin
(80% ethanol fraction) One 10 47.7 SP70 resin
(100% ethanol fraction) One 10 8.6

As shown in Table 3, the content of the lon- giophenoside A compound was 12 to 17% in the case of the 70% ethanol extract, and in the fraction eluted with the SP70 resin, the fraction was found to be the most abundant in the fraction eluted with 80% .

When the extract of Zincothermonfexus VK1 was passed through an ion exchange resin and then washed with 40% ethanol and eluted with 80-100% ethanol, the content of the active compound, ronphenoside A compound, was 30-60% , And the fraction of VK1 of Nyunomotoronipesu was obtained.

The 70% ethanol extract was concentrated in order to obtain a Zynoththermophys fleece VK1 fraction containing a compound of Ronigiphenoside A, and the obtained concentrate was diluted with distilled water, and butanol was added to the diluted solution to obtain a butanol fraction. As a result of HPLC analysis to confirm the presence of the lonorphenoside A compound in the obtained butanol fraction, it was confirmed that the lonlyphenoside A compound was also present in the butanol fraction.

≪ Example 4: Isolation of lonlyphenoside A compound >

3 L of 70% ethanol was added to 524 g of the dried Zynosthomonrhia females VK1 outpowder, and the resultant was sonicated at room temperature for 3 times to obtain an extract. The extract was concentrated under reduced pressure to obtain a dried product. A 20% ethanol diluted solution prepared by diluting the dried extract (60.2 g) with 2 L of 20% ethanol was passed through SP70 resin and adsorbed. After 40% ethanol, which is 3-100 times the weight of the dried extract, was used to elute and remove unadsorbed materials, the adsorbed material was eluted with 80% ethanol, which was 3-100 times the weight of the dried extract, . The resulting fraction was concentrated to obtain a concentrated solution. The obtained concentrate (18.5 g) was purified by silica gel column chromatography using ethyl acetate / methanol / distilled water gradient (20: 1: 0.1 → 4: 1: 0.1 [v: v: Nine fractions were obtained by performing silicagel column chromatography (column size: 10 × 50 cm, particle size: 63-200 μm) (GL1 to GL9). From the fraction, GL7 (12 g) was crystallized using water / ethanol / acetone to obtain Compound 1 (5.5 g).

Further, the fraction eluted with the 80% ethanol was concentrated, and the concentrate was crystallized using ethanol / acetone to obtain Compound 1.

Example 5: Identification of the physicochemical structure of the compound 1 >

3β-20 (S) -dihydroxydamar-24-ene-12,23-dione 3-O- [α-L-rhamnopyranosyl (1 → 2)] - [α-L-rhamnopyranosyl 1? 3)] -? - D-glucuronopyranoside;

3β-20 (S) -dihydroxydammar-24-ene-12,23-dione 3-0- [α-L-rhamnopyranosyl (1 → 2)] - [α-L-rhamnopyranosyl D-glucuronopyranoside;

Longipenosidea;

White amorphous powder;

_{[A] D -32.0 (c 0.1} , methanol (MeOH));

UV (methanol)? _Max (log?) 244 (3.0) nm;

IR (KBr) V _max 3404, 2973, 2938, 1697, 1616, 1073, 1055, 1010 cm ^-1 ;

HRESIMS m / z 925.5157 [MH] - (calcd for C 48 H 77 O 17, 925.5166) and ^{971.5213 [M + HCOO] - (} calcd for C 49 H 79 O 19, 971.5221);

¹ H NMR (500 MHz, pyridine (pyridine) - d _5); Sugar portion; (Glucose) 4.80 (1H, d, J = 7.7 Hz, H-1 '), 4.01 (1H, overlap, H-2'), 4.11 , H-4 '), 3.85 (1H, m, H-5'), 4.48 (1H, overlap, H-6a '), 4.33 (1H, overlap, H-6b'); Overlap, H-3 "), 4.26 (1H, overlap, H-2"), 4.66 4 "), 4.61 (1H, overlap, H-5"), 1.64 (3H, d, H-6 "); H-2 '''), 4.53 (1H, overlap, H-3''), 4.87 (1H, dd, J = 7.6, 3.1 Hz, '''), 4.28 (1H, overlap, H-4'''), 4.70 (1H, m, H-5 ''').

¹ H NMR (500 MHz, pyridine (pyridine) - d _5); M, H-1b), 2.10 (1H, m, H-2a), 1.70 M, H-6), 1.39 (1H, m, H-7), 1.25 (1H, m, H-7b ), 1.62 (1H, br d, J = 11.8, H-9), 2.24 (1H, overlap, H-11a), 2.22 (1H, dd, J = 10.5, 3.1 Hz, (1H, m, H-11b), 3.26 (1H, d, J = 9.6 Hz, H-13), 1.84 H-16), 1.91 (1H, m, H-16b), 2.77 3H, s, H-21), 2.90 (1H, overlap, H-22a), 2.72 H-26), 1.70 (3H, br s, H-27), 1.17 (3H, s, H-28), 1.11 (3H, s, H-29), 0.84 (3H, s, H-30).

¹³ C NMR (125 MHz, pyridine (pyridine) - d _5); Sugar portion; (Glucose) 105.3 (C-1 '), 78.3 (C-2'), 87.5 (C-3 '), 70.6 ); Rhamnose 102.0 (C-1 ''), 72.2 (C-2 ''), 72.7 (C-3 ''), 73.9 (C-4 ' 18.9 (C-6 "); Rhamnose 103.9 (C-1 '''), 72.7 (C-2'''), 72.9 (C-3 ''''), 18.9 (C-6''').

¹³ C-NMR (125 Hz, pyridine _{(pyridine) - d 5):} 39.3 (C-1), 26.9 (C-2), 88.5 (C-3), 39.9 (C-4), 56.7 (C-5 ), 18.8 (C-6), 34.8 (C-7), 40.9 (C-8), 54.6 16.2 (C-17), 16.0 (C-18), 16.5 (C-19), 56.2 (C-13), 56.5 (C-20), 27.9 (C-21), 54.8 (C-22), 201.7 (C-23), 126.4 (C-27), 28.1 (C-28), 16.9 (C-29), 17.4 (C-30).

Compound [1] was isolated as white amorphous powder, and the [[alpha]] _D value measured at 25 [deg.] _C was -32.0 (c0.1, methanol (MeOH)) and [MH] ^- m / z in HRESIMS was 925.5157 ) And [M + HCOO] ^- 971.5213 (calcd 971.5221) and the molecular formula was determined as C ₄₈ H ₇₈ O ₁₇ . Compound 1 showed strong IR absorbance at V _max OH (3404 cm ^-1 ), C═C (1616 cm ^-1 ) and C═O (1697 cm ^-1 ).

That is the binding ¹ H NMR analysis of three sugar for compound _{1 δ H 5.92 (1H, br} s, H-1 "), 5.70 (1H, br s, H-1 '''), 4.80 (1H , d, J = 7.7 Hz, H-1 '). From the confirmation of the sugar obtained by hydrolysis, it was confirmed that the attached sugar was two molecules of rhamnose and one molecule of glucose. 1H, d, J = 7.7 Hz , the H-1 ') beta connection from pair erase constant of the anomeric proton of the other coupling saccharide rhamnose, it was confirmed that the alpha connected. Check connection location of each party HSQC and HMBC experimental results in addition to the glucose H-1 '(δ _H 4.80) and the damask is _C-3 (δ C 88.5) with H-1 skeleton''(δ _H 5.92) and _{C-2' (δ C 78.3} ) , And H-1 '''(δ _H 5.70) and C-3' (δ _C 87.5).

The presence of ketone groups and hydroxyl groups at the C-12 (δ _C 211.7) and C-20 (δ _C 74.0) positions of the tamaran skeleton were H-11 (δ _H 2.24 and 2.22), H-13 (δ _H 3.26, d, J = 9.6 Hz), and H-17 (δ _H 2.77) from the _C-12 (δ C carbon connected in proton and _{H-17 (δ H 2.77)} , H-21 (δ H 1.50 to 211.7)) and H -22 (delta _H 2.90, 2.72) to C-20 (delta _C 74.0). Since the presence of two ketone groups was confirmed from the UV, IR and NMR results of the present compound, the structure of the C-23/24/25 site was confirmed using the HMBC experiment to confirm the additional structure. Proton _{H-22 (δ H 2.90,} 2.72) and _H-24 (δ H 6.28) from the carbon _C-23 (δ C 201.7) connected to _{a, H-26 (δ H 2.15} ) and _H-27 (δ H 1.70 ) carbon _C-25 (δ C 154.8) from the from the connection to the carbon _{C-24 (δ C 126.4)} , H-24 (δ H 6.28), H-26 (δ H 2.15) and _H-27 (δ H 1.70) Shows that the ketone group is in the carbon C-23 position (Figure 5).

Crystallization of the resulting compound was determined through HMBC and ROESY experiments. H-3 (δ _H 3.25) and H-5 (δ _H 0.66) were found to have an α configuration by ROESY linkage. These results further indicate that the general chemical shifts of the carbon are [δ _C 26.8 (C-2) and 88.9 (C-3)] when the sugar is substituted in the β-position at position 3 of the damaran backbone. Compound 1? _C 26.9 and 88.5]. Positioning of the H-17 and Me-21 was H-13 (J = 9.6 Hz ) paired Clear constants and H-17 (δ _H 2.77) from the _H-21 (δ H 1.50) and H-30 of the (δ _H 0.84 ) Was confirmed from the observed ROESY experiment results.

Thus, compound 1 is a 3? -20 (S) -dihydroxydamar-24-en-12,23-dione 3-O- [? -L-raminopyranosyl (1? 2)] - [? (1? 3)] -? - D-glucuronopyranoside (3β-20 (S) -dihydroxydammar-24-en-12,23-dione 3-0- [α-L-rhamnopyranosyl 1? 2)] - [? -L-rhamnopyranosyl (1? 3)] -? - D-glucuronopyranoside.

Example 6 Identification of the efficacy of the Zynoththermophagus VK1 extract for declining memory and cognitive impairment

Example 6-1. Decreased memory and impaired cognitive function Animal modeling and drug administration

Male C57BL / 6J mice at 8 weeks of age were used as experimental animals. Mice were fed sterile feed and water ad libitum in a specific pathogen free (SPF) environment maintained at a temperature of 22-24 ° C, and were maintained in a 12-hour day-night cycle.

We used scopolamine, a Muscarinic receptor antagonist, to model memory impairment and cognitive impairment to identify effects on memory loss and cognitive impairment. Scopolamine is a neurotransmitter, a neurotransmitter liberated from synapses, that binds to receptors at postsynapse, which are receptors, to temporarily block the transmission of information in the brain, By impairing memory, an animal model of memory loss is created and is commonly used to verify learning and memory-enhancing effects.

The mice raised above were administered scopolamine at a dose of 1 mg / kg to prepare an animal model of memory loss. At this time, 30 minutes before the administration of scopolamine, a 70% ethanol extract of Zynoththermophagus VK1 was diluted in 0.5% carboxy methylcellulose and then orally administered at a dose of 300 mg / kg. At this time, 0.5% carboxymethylcellulose alone was orally administered as a control group. In addition, normal mice that did not undergo any treatment were used as normal mice. Eight mice per group were used.

Example 6-2. Identification of the efficacy of VK1 extract of Zynoth's theme longevity females for declining memory and cognitive impairment

In order to confirm the cognitive ability and memory enhancing effect of the test group administered with the 70% ethanol extract of Zincothermone pace VK1 of Example 6-1, the control group administered with 0.5% carboxymethyl cellulose alone or the normal group mice, A novel object recognition test (NORT) was performed.

On the first day of training, the mice were placed in a white box of 41.5 cm x 20 cm x 21.5 cm and allowed to move freely for 10 minutes and then returned to the original cage. On the second day, Two blocks were placed on both sides of the box, and the mice were exposed for 10 minutes to be able to navigate them. Twenty-four hours after this, a cylindrical block (a new object) with a square column was put together with the cylindrical block (the familiar object) which was originally seen, and the movement of the mouse was observed. At this time, the sniffing time was measured by touching the block, sniffing or moving toward the block. For the two blocks, the time of interest in the cylindrical block (familiar object) and the search time of interest in the square pillar block (new object) were measured in total measured times, and the search time = - time of interest in a familiar object) / (time of interest in a new object + time of interest in a familiar object), as shown in FIG.

As shown in Fig. 6, in the untreated normal group, irrespective of the administration of the 70% ethanol extract of Zynosthomonrhoeferis VK1, it was recognized that both the rectangular block of the new object and the cylindrical block of the familiar object On the other hand, in the case of the control group administered with 0.5% carboxymethyl cellulose only after oral administration of scopolamine, the search time for the new object was remarkably decreased and the distinction between the familiar object and the new object was not good. Zincothermoglypha VK1 After oral administration of 70% ethanol extracts, the experimental group receiving scopolamine was much more interested in new objects and was found to be well distinguished between familiar and new objects .

Thus, by confirming that the 70% ethanol extract of Zinoththymonongeus ficus VK1 of the present invention has the cognitive ability and memory enhancing effect, the Zinoththermophagus VK1 extract has the effect of preventing or treating memory decline and cognitive disorders Could know.

Example 6-3. Zinoth's theme longevity FK VK1 extract aging in other memory decline and efficacy for cognitive disorders

C57BL / 6J female aged mice at 22 months of age were used as experimental animals. The mice were divided into a control group to which 0.5% carboxymethyl cellulose was administered and an experimental group to which 300 mg / kg of Zincothermonfex VK1 70% ethanol extract (diluted with 0.5% carboxymethyl cellulose) was administered. In addition, 2-month-old C57BL / 6J female mice were used as young mouse controls. 0.5% carboxymethyl cellulose and 300 mg / kg of Zinoththermophagus VK1 70% ethanol extract were orally administered daily for 8 weeks, and then, according to the cognitive test method for the new object of Example 6-2, The efficacy against memory decline and cognitive impairment was confirmed, and the results are shown in FIG.

As shown in the results of the search time (A) and the search frequency (B) for the new object in Fig. 7, in the case of the young mouse using C57BL / 6J female mice at 2 months of age, administration of 70% ethanol extract of Zynoth's theme rongefense VK1 Regardless of the new object, square pole blocks and familiar objects, cylindrical blocks, are well recognized, whereas in a 22-month-old aged mouse with 0.5% carboxymethylcellulose, the search time for new objects The number of searches is significantly reduced, and it has been confirmed that they can not distinguish between familiar objects and new objects. On the other hand, in the case of the experimental group administered with a 70% ethanol extract of Zynoth's theme rongefense VK1, the new object search time and search frequency were significantly higher than those of the 0.5% carboxymethyl cellulose-treated control group , It was confirmed that the distinction between the familiar object and the new object was clearly good.

Thus, it can be seen that the 70% ethanol extract of Zincothermongefus VK1 of the present invention has a preventive or therapeutic effect on cognitive disturbance and memory decline due to aging.

≪ Example 7: Determination of efficacy against declining memory and cognitive disorder of < RTI ID = 0.0 >

In order to confirm the efficacy of the Roniginphenoside A compound isolated from the Zynoththermophys felis VK1 extract of the present invention against memory loss and cognitive impairment, a mouse model of memory loss and cognitive impairment was used.

An animal model was prepared in the same manner as in Example 6-1, in the same manner as in the animal model of impaired memory and cognitive impairment, and the drug administration was carried out by oral administration. 30 minutes before the administration of scopolamine, the test group administered with 5 mg / kg, 20 mg / kg, and 50 mg / kg of 0.5% carboxymethylcellulose-diluted Roniginphenoside A compound and 0.5% carboxymethylcellulose Control group, and non-treated normal group.

The confirmation of efficacy against memory decline and cognitive impairment was carried out according to the cognitive test method for the new object of Example 6-2, and the result is shown in FIG.

As shown in Fig. 8, in the case of the normal group treated with no treatment, regardless of administration of the lon- giophenoside A compound, a new object, quadrangular pole block and familiar object cylindrical block, were recognized well, while 0.5% carboxy In the control group treated with methylcellulose and scopolamine, the search time for new objects was significantly reduced, indicating that they could not distinguish between familiar objects and new objects. In the experimental group treated with lonigo phenoside A compound, interest in new objects was much higher, and it was observed to distinguish between familiar objects and new objects. Particularly, when the compound was administered at a dose of 5 mg / kg or 20 mg / kg of the compound, the time required for the investigation of the new substance was increased, and the dose of the compound of the present invention was 50 mg / kg In one case, new object search time was observed to increase statistically significantly.

Thus, it was found that the compound of the present invention of the present invention has the effect of preventing or treating memory loss and cognitive dysfunction.

≪ Example 8: Tau hyperphosphorylation inhibition activity of lonergenone A compound >

In Alzheimer's disease, neurofibrillary tangles (NFT), in which tau proteins are clustered, are observed. Hyperphosphorylation of tau causes coagulation of tau and accumulation of nerve fiber bundles in the brain, accumulation of which leads to brain nerve cell death. Therefore, by confirming the change of hyperphosphorylated tau in neurons following the treatment with the ronigphenoside A compound of the present invention, the tau hyperphosphorylation inhibitory activity of the roncecenoid A compound can be confirmed.

HT2 cells, which are murine hippocampal neuroblastoma cell lines, were used to measure tau hyperphosphorylation inhibition efficacy of ronigphenoside A compounds isolated from Zincothermonfexus VK1 extract, The amount of tau was increased. HT22 cells were plated on 60 mm cell culture plates and stably cultured using DMEM medium containing 10% FBS (fetal bovine serum). A plasmid containing a gene of beta-amyloid _1-42 (A [beta] ₄₂ ) was transfected into HT22 cells using Opti-MEM medium and Lipofectamine 2000, Lt; / RTI > After 13 hours of culture, the cells were treated with DMEM medium supplemented with 5% FBS to treat the rorpenoid A compound of the present invention, and the cells were treated with the rorpenoid A compound at concentrations of 1, 5 and 10 μM And cultured for 48 hours. After culturing, the cells were harvested and the cytoplasm was extracted with a lysis buffer to obtain proteins. Thereafter, 12% SDS-PAGE electrophoresis was performed and the protein was transferred to a PVDF membrane. The membrane was then immersed in 5% skim milk at room temperature for 1 hour and then reacted at 4 ° C for 18 hours or longer using an antibody recognizing phospho-Tau (Ser ²⁶² ) And the amount of expression was confirmed. At this time, since it is known that phosphorylation of tau is increased during the progress of Alzheimer's disease, the expression level of total tau was compared and converted to a relative quantitative value, and the result is shown in FIG.

As shown in Fig. 9, phosphorylation of tau was increased by beta-amyloid (A [beta] ₄₂ ), and the expression level (A) of phosphorylated tau by beta-amyloid according to the treatment concentration of lonergic phenoxide A compound, The relative quantification value (B) of the tau phosphorylation inhibitor was decreased. In particular, when 10 μM of the lonlyphenoside A compound was treated, the most potent tau phosphorylation inhibitory activity was shown.

Thus, it was found that the cognitive dysfunction, such as Alzheimer's disease, can be prevented or treated by inhibiting hyperphosphorylation of tau by the Ronigi phenocide A compound isolated from the Zynoth's theme rongefense VK1 extract of the present invention.

≪ Example 9: Toxicity test &

Example 9-1. Acute toxicity

To investigate the toxicity of an animal body to an animal body in an acute (within 24 hours) when an excessive amount of a 70% ethanol extract of Zincothermone pace VK1 of the present invention or a compound of a lonomiphenoside A in a short period of time was consumed, Experiments were performed. Twenty mice of the general mouse ICR mouse line were assigned to each of the control and experimental groups. In the control group, only 0.5% carboxymethyl cellulose was administered. In the experimental group, a 70% ethanol extract of Zincothermone pace VK1 or a compound of lon- giophenoside A was dissolved in 0.5% carboxymethyl cellulose and administered at a dose of 300 Kg / day corresponding to 6.7-fold of the mean daily dose (mg / kg / day).

After 24 hours of administration, the respective mortality rates were examined. As a result, it was found that the control group administered with 0.5% carboxymethylcellulose and the test group administered with 2.0% g / kg / day of Zincothermonfex VK1 70% ethanol extract or Ronigiphenoside A compound All mice were found to survive.

Example 9-2. Organ organs toxicity test in experimental group and control group

The long-term toxicity test was carried out on C57BL / 6J mice (10 rats per group), which was used as a model of the present invention of the present invention, in which a 70% ethanol extract of VK1 or a compound of lon- giophenoside A was administered at 300 mg / kg / Respectively. In order to investigate the effects on the organs (tissues) of the animals, the animals were divided into two groups: an experimental group administered with a 70% ethanol extract of Zincothermonfex VK1 or a compound of a lon- giophenoside A compound, and a control group of animals administered with 0.5% carboxymethylcellulose alone Blood samples were taken and blood concentrations of GPT (glutamic-pyruvic transaminase) and BUN (blood urea nitrogen) were measured using Select E (Vital Scientific NV, Netherland).

As a result, GPT, which is known to be related to hepatotoxicity, and BUN, which is known to be related to renal toxicity, showed no significant difference compared to the control group. In addition, liver and kidney were cut from each animal, followed by a general tissue section preparation, histological observation with an optical microscope, and no abnormalities were observed in all tissues.

≪ Formulation Example 1 >

Formulation Example 1-1. Manufacture of tablets

20 g of the Zynosthomonrphaeceus VK1 extract of the present invention or 200 mg of the lonergic phenoxide A compound were mixed with 175.9 g of lactose, 180 g of potato starch and 32 g of colloidal silicic acid. To this mixture was added a 10% gelatin solution, which was pulverized and passed through a 14-mesh sieve. This was dried, and a mixture obtained by adding 160 g of potato starch, 50 g of talc and 5 g of magnesium stearate was made into tablets.

Formulation Example 1-2. Injection preparation

100 mg of the compound of the present invention, 0.6 g of sodium chloride and 0.1 g of ascorbic acid were dissolved in distilled water to make 100 ml. This solution was placed in a bottle and sterilized by heating at 20 DEG C for 30 minutes.

<Formulation Example 2: Food Preparation>

Formulation Example 2-1. Manufacture of cooking seasonings

Each of the Zynosthomonrhia fescue VK1 extract or the Ronigiphenoside A compound of the present invention was added to the cooking sauce in an amount of 1 wt% to prepare a cooking sauce for health promotion.

Formulation Example 2-2. Manufacture of flour food products

The present invention relates to a method for producing health promotion foods by preparing breads, cakes, cookies, crackers and noodles by adding 0.1% by weight of Zincothermone pace VK1 extract or Ronigiphenoside A compound of the present invention to wheat flour respectively Respectively.

Preparation Example 2-3. Manufacture of soups and gravies

Health enhancing soup and juice were prepared by adding Zinothhemoron pace VK1 extract or Ronigiphenoside A compound of the present invention to 0.1% by weight of juice, respectively.

Formulation Example 2-4. Manufacture of dairy products

Each of the Zynoththermone felis VK1 extract of the present invention or the Ronigiphenoside A compound was added to milk in an amount of 0.1% by weight, and various dairy products such as butter and ice cream were prepared using the milk.

Formulation Example 2-5. Vegetable juice manufacturing

Health enhancing vegetable juice was prepared by adding the Zincothermone fescue VK1 extract of the present invention or the Ronigiphenoside A compound to 1,000 ml of tomato juice or carrot juice, respectively.

Formulation Example 2-6. Manufacture of fruit juice

Health enhancing fruit juice was prepared by adding 0.1 g of each of the extracts of the present invention, Nos. &Lt; RTI ID = 0.0 &gt; thymoligus fescue VK1 &lt; / RTI &gt; or the compound of lonlyphenoside A to 1,000 ml of apple juice or grape juice.

Claims (22)

delete A pharmaceutical composition for preventing or treating cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermone phage VK1 comprising a longpenoside A compound represented by the following formula (1).
[Chemical Formula 1]

3. The method of claim 2,
Wherein the Zynoth's theme longevity fungus VK1 extract is an extract obtained by extracting Zynoththermophycephaceae VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate. &Lt; / RTI &gt; 3. The method of claim 2,
The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, Characterized in that the diluent is a fraction obtained by fractionating at least one organic solvent selected from the group consisting of hexane, ethyl acetate and butanol, or a fraction obtained by passing the diluent through an ion exchange resin. A pharmaceutical composition. 3. The method of claim 2,
The cognitive dysfunction may be selected from the group consisting of dementia, learning disorder, agnosia, amnesia, aphasia, apraxia or delirium, mild cognitive impairment ), And Binswangers disease. &Lt; Desc / Clms Page number 15 &gt; 6. The method of claim 5,
Wherein the dementia is characterized by being selected from the group consisting of AIDS (Acquired Immune Deficiency Syndrome) -induced dementia, Alzheimer's dementia, vascular dementia, rheisome dementia, frontal dementia, semantic dementia and multiple infarct dementia A pharmaceutical composition for preventing or treating cognitive dysfunction. A pharmaceutical composition for preventing or treating cognitive dysfunction, comprising a longpenoside A compound of the following formula (1) as an active ingredient.
[Chemical Formula 1]

delete A health functional food for improving cognitive function comprising an extract of Zynoththermophys felis VK1 comprising a longpenoside A compound represented by the following formula (1) as an active ingredient.
[Chemical Formula 1]

10. The method of claim 9,
Wherein the Zynoth's theme longevity fungus VK1 extract is an extract obtained by extracting Zynoththermophycephaceae VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate. Health functional foods for improvement. 10. The method of claim 9,
The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, A fraction obtained by fractionating at least one organic solvent selected from the group consisting of hexane, ethyl acetate and butanol or a fraction obtained by passing the diluted solution through an ion exchange resin, food. A health functional food for cognitive dysfunction improvement comprising the compound of longpenoside A of the following formula (1) as an active ingredient.
[Chemical Formula 1]

An animal drug for preventing or treating cognitive dysfunction comprising, as an active ingredient, an extract of Zynoththermophys felis VK1 comprising a longpenoside A compound of the following formula (1).
[Chemical Formula 1]

14. The method of claim 13,
Wherein the Zynoth's theme longevity fungus VK1 extract is an extract obtained by extracting Zynoththermophycephaceae VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate. Animal drugs for prevention or treatment. 14. The method of claim 13,
The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, Characterized in that the diluent is a fraction obtained by fractionating at least one organic solvent selected from the group consisting of hexane, ethyl acetate and butanol, or a fraction obtained by passing the diluent through an ion exchange resin. Animal drugs. An animal drug for the prevention or treatment of cognitive dysfunction comprising, as an active ingredient, a longpenoside A compound represented by the following formula (1).
[Chemical Formula 1]

An animal feed additive for improving cognitive dysfunction, which comprises as an active ingredient an extract of Zynoththermophys felis VK1 comprising a longpenoside A compound of the following formula (1).
[Chemical Formula 1]

18. The method of claim 17,
Wherein the Zynoth's theme longevity fungus VK1 extract is an extract obtained by extracting Zynoththermophycephaceae VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate. Improved animal feed additives. 18. The method of claim 17,
The above-mentioned Zynoth's theme rongefex VK1 extract is obtained by diluting a concentrate obtained by concentrating Zynoththermophagus VK1 with at least one solvent selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate, An animal feed for cognitive dysfunction improvement, characterized in that it is a fraction obtained by fractionating at least one organic solvent selected from the group consisting of hexane, ethyl acetate and butanol or a fraction obtained by passing the diluted solution through an ion exchange resin additive. An animal feed additive for improving cognitive dysfunction comprising, as an active ingredient, a longpenoside A compound represented by the following formula (1).
[Chemical Formula 1]

Novel compounds having the following chemical structure Ronphenoside A.

A first step of producing a Zynoththermoscopic feline VK1 extract using Zincothermonomice fungus VK1 as a solvent, at least one selected from the group consisting of water, C1 to C4 lower alcohols, acetone and ethyl acetate;
A second step of diluting the Zynoththermophagus VK1 extract to prepare a diluted solution;
A third step of passing the diluted solution through an ion exchange resin to obtain fractions;
A fourth step of concentrating the fraction to prepare a concentrate or applying the concentrate to chromatography to obtain a fraction; And
A fifth step of crystallizing the concentrate or the small fraction with water, C1 to C4 lower alcohol, acetone, acetonitrile or a mixed solvent thereof;
And separating the compound of formula (1).

Images