KR101793474B1 - Pharmaceutical composition for preventing or treating inflammatory diseases comprising inositol polyphosphate multikinase inhibitor as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating inflammatory diseases containing inositol polyphosphate multikinase (IPMK) inhibitor as an active ingredient. More specifically, IPMK-removed mice has shown higher viability against blood poisoning compared to a wild type, while an increase in expression rate of protein and mRNA encoding inflammatory cytokines such as interleukin (IL)-1, IL-6, and tumor necrosis factor (TNF)- in tissues is avoided when endotoxemia in induced. Thus, the composition containing IPMK inhibitor can be useful for treating inflammatory diseases.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease containing an inositol polyphosphate multi-kinase inhibitor as an active ingredient. [0002] The present invention relates to a pharmaceutical composition for preventing or treating an inflammatory disease containing an inositol polyphosphate multi-

The present invention relates to a pharmaceutical composition for the prophylaxis or treatment of an inflammatory disease containing an inositol polyphosphate multi-kinase inhibitor as an active ingredient.

Infection with bacteria or the like initiates an immune response that can cause systemic inflammation or Systemic Inflammatory Response Syndrome (SIRS). Excessive immune responses lead to various degrees of fever, hypotoxemia, trachypnea, vomiting, endothelial inflammation, and myocardial dysfunction. Excessive immune responses, especially in the nervous system, Syndrome, coma, and the like. When an infection occurs, macrophages of the infected area are activated to secrete cytokines such as TNF-a and IL-6, thereby increasing the amount of plasma protein released into the tissues and the migration of macrophages and lymphocytes, Adhesion increases. In this way, local blood vessels are occluded and pathogens are concentrated at the site of infection. In particular, sepsis is a systemic infection, involving severe vascular occlusion induced by TNF-a. In addition, systemic release of TNF-α results in loss of plasma volume due to vasodilation and increased permeability of blood vessels, resulting in shock (Schulte W, et al ., Mediators Inflamm, 2013: 165974).

Recently, it has been found that inflammatory reaction is one of the main mechanism causing neurodegeneration. Bovine glial cells, which correspond to the macrophages present in the central nervous system, activate the immune response due to various exogenous and endogenous substances. Activated small glial cells produce and release inflammatory cytokines such as TNF-α and IL-1β. Although the production of these substances causes an immune response in the short term, they can induce functional degeneration by inducing the death of adjacent neuronal cells if they are produced excessively or continuously (von Bernhardi R, et al ., Front Aging Neurosci, 2015 Jul 20; 7: 124).

In this case, antagonistic substances such as TNF-α, IL-1β and IL-6, which are inflammatory cytokines, were tried to be used as inflammatory drugs, but most failed. In addition, administration of activated protein C (C) or treatment with glucocorticoids have been tried, but there are various limitations. Therefore, it is necessary to develop a new therapeutic agent for the treatment of sepsis and related inflammation, which is a congenital immune disease that has not yet developed a clear therapeutic agent even though it has a high mortality rate.

Meanwhile, inositol polyphosphate multiminase (IPMK) is a metabolic enzyme essential for biosynthesis of inositol polyphosphate in a cell, and is a protein involved in cell growth and metabolism (Chakraborty A, et al ., Sci Signal, 2011 Aug 23; 4 (188)). In this regard, it is known that IPMK enzyme proteins activate the expression of genes related to apoptosis and growth by controlling intracellular signaling and metabolism (Xu R et al ., Sci. Signal, 2013 Apr 2; (Kim et al ., Proc Natl Acad Sci USA, Dec 2013, 110 (49): 19938-43).

Accordingly, the inventors of the present invention have found that, when developing a substance for use in the treatment of inflammatory diseases, the mice in which the IPMK gene has been specifically removed from the bone marrow cells have a higher survival rate for sepsis than wild type mice, Lt; RTI ID = 0.0 > IL-6, < / RTI > and TNF-a is suppressed.

It is an object of the present invention to provide a composition containing an IPMK expression or activity inhibitor as an active ingredient and its use.

It is another object of the present invention to provide a method for screening candidate substances for the treatment of inflammatory diseases by measuring the expression or activity of IPMK.

In order to achieve the above object, the present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease containing an IPMK expression or activity inhibitor as an active ingredient.

In addition, the present invention provides a health functional food for the improvement of an inflammatory disease containing an IPMK expression or activity inhibitor as an active ingredient.

In addition, the present invention provides a method for preparing an IPMK-expressing cell line, comprising: 1) preparing an IPMK expressing cell line; 2) treating the cell line of step 1) with the test substance; 3) measuring the level of expression or activity of IPMK in the cell line treated with the test substance; And 4) selecting a test substance whose expression or activity level of the IPMK is decreased as compared with a control group in which the test substance is not treated. The present invention also provides a method for screening candidate substances for the treatment of inflammatory diseases.

IPMK gene-deprived mice had a higher survival rate for sepsis than wild-type mice, and an increase in mRNA and protein expression levels of inflammatory cytokines such as IL-1β, IL-6 and TNF- The composition containing the IPMK inhibitor can be usefully used for the treatment of inflammatory diseases.

FIG. 1 is a graph comparing the survival rates of wild-type mice (Ipmk ^{fl / fl} ) and sepsis-specific survival rates in IPMK- ^null mice (Ipmk ^ΔMac ).
FIG. 2 is a graph comparing body temperature changes after inducing endotoxemia with lipopolysaccharide in wild-type mice (Ipmk ^{fl / fl} ) and mice in which IPMK was specifically removed from bone marrow cells (Ipmk ^ΔMac ).
FIG. 3 is a graph comparing weight loss of wild-type mice (control group) and mice in which IPMK was specifically removed from bone marrow cells (experimental group) after 48 hours induction of endotoxemia.
FIG. 4 is a graph comparing ingestion amounts of wild-type mice (controls) and mice in which IPMK was specifically removed from bone marrow cells (experimental group) after 48 hrs induction of endotoxemia.
FIG. 5 shows the results of immunohistochemical ^staining for IL-6 or TNF (anti-inflammatory cytokine), which is an inflammation-inducing cytokine, from spleen tissues of wild-type mice (Ipmk ^{fl / fl} ) and bone marrow cell- -a < / RTI >
FIG. 6 shows the expression of IL-6 or TNF (anti-inflammatory cytokine), which is an inflammation-inducing cytokine, from lung tissues of wild-type mice (Ipmk ^{fl / fl} ) and bone marrow cell- specific ^IPMK- -a < / RTI >
Figure 7 shows IL-6, an inflammation-inducing cytokine, from cerebral cortical tissue of wild-type mice (Ipmk ^{fl / fl} ) and bone marrow cell-specific IPMK- ^nulled mice (Ipmk? ^Macac ) TNF-a < / RTI >
Fig. 8 shows the results of immunohistochemical staining for IL-1β and TNF (anti-inflammatory cytokines), which are inflammation-inducing cytokines, from the cerebral cortex or hypothalamus of wild-type mice (WT) -α or IL-6 mRNA expression levels of the cells.
FIG. 9 shows the results of immunohistochemical ^staining for IL-6 or TNF-alpha, which is an inflammation-inducing cytokine in serum of wild-type mice (Ipmk ^{fl / fl} ) and bone marrow cells (IPMK- alpha of the present invention.
FIG. 10 shows the results of immunohistochemical ^staining of IL-6, an inflammation-inducing cytokine, from cerebral cortical tissues of wild-type mice (Ipmk ^{fl / fl} ) and bone marrow cell-specific ^IPMK- And the amount of protein is compared.
FIG. 11 is a graph showing the ^expression of IL-1β, an inflammation-inducing cytokine in macrophages obtained from bone marrow cells of wild-type mice (Ipmk ^{fl / fl} ) induced endotoxemia and mice immunized with ^IPMK (Ipmk ^ΔMac ) IL-6 or TNF- ?.
Fig. 12 shows the results of immunohistochemical ^staining for IL-1β or IL-1β in macrophages obtained from bone marrow cells of wild-type mice (Ipmk ^{fl / fl} ) inducing endotoxemia and mice in which IPMK was specifically removed from bone marrow cells (Ipmk ^ΔMac ) TNF-a < / RTI >
FIG. 13 is a graph (ScRNA: random siRNA; siRNA: siRNA targeting IPMK) confirming inhibition of IPMK gene expression by treating siRNA targeting IPMK gene in RAW 264.7 cells.
FIG. 14 shows the expression of IL-1β, IL-6 or TNF-α, which is an inflammation-inducing cytokine, by treating siRNA (siRNA) targeting Randomized Sequence RNA (ScRNA) or IPMK gene after inducing endotoxemia in RAW 264.7 cells MRNA expression level of the test compound.
FIG. 15 shows the expression of IL-1β, IL-6 or TNF-α, which is an inflammation-inducing cytokine, by treating siRNA (siRNA) targeting Randomized Sequence RNA (ScRNA) or IPMK gene after inducing endotoxemia in RAW 264.7 cells Of the total protein.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing or treating an inflammatory disease containing an IPMK expression or activity inhibitor as an active ingredient.

The IPMK expression inhibitor may be any one or more selected from the group consisting of an antisense nucleotide complementary to the mRNA of the IPMK gene, a small interfering RNA (siRNA), and a short hairpin RNA (shRNA) have. Specifically, the IPMK expression inhibitor may be an siRNA complementarily binding to the mRNA of the IPMK gene, wherein the siRNA comprises a sense strand consisting of the nucleotide sequence of SEQ ID NO: 9 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: .

The IPMK gene may comprise a polynucleotide of any sequence known in the art. In one embodiment of the present invention, the IPMK gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO:

The polynucleotide includes a polynucleotide sequence consisting of the nucleotide sequence of SEQ ID NO: 13, as well as a polynucleotide having a base sequence substantially the same as the polynucleotide and a fragment thereof. A polynucleotide having substantially the same base sequence may have 80% or more, specifically 90% or more, more specifically 95% or more homology with the polynucleotide of the present invention. The polynucleotide of the present invention may include a variant in which one or more base sequences are substituted, deleted, or inserted, so long as the polynucleotide of the present invention encodes a protein having equivalent activity.

The IPMK expression inhibitor may include a variant having one or more substitutions, insertions, deletions, and combinations thereof that do not degrade its activity. Such a mutant may have 80% or more homology with the IPMK expression inhibitor sequence of the present invention. Specifically, it may have 90%, more specifically 95% or more homology. The IPMK expression inhibitor may be synthesized by various methods known in the art, such as by direct chemical synthesis or by in vitro transcription.

The antisense nucleotide refers to binding (hybridizing) to a complementary base sequence of DNA, immature-mRNA or mature mRNA to inhibit the flow of genetic information from DNA to protein, as defined in the Watson-Crick base pair.

The siRNA refers to a short double-stranded RNA capable of inducing RNA interference through cleavage of a specific mRNA. In one embodiment of the present invention, the siRNA may be composed of a sense strand having the nucleotide sequence of SEQ ID NO: 9 and an antisense strand having the nucleotide sequence of SEQ ID NO: 10. In addition, the siRNA is not limited to a complete pair of double-stranded RNA portions paired with each other in RNA, but also includes a mismatch (corresponding base is not complementary), a bulge (no base corresponding to one side chain) It can also include non-paired parts. The siRNA end structure can be either a smooth end or a protruding end if the target gene can be repressed by RNA interference, and the 3 'end protruding structure and the 5' end protruding structure are both possible. The sense strand may have an additional base sequence of dCdT overhang at the 3 'end.

The shRNA may be a double-stranded RNA of a hairpin structure having a loop region of a base constituting the shRNA. The bases in such a loop region may be those known in the art, and the double stranded portion of the RNA may be constructed in the same manner as an siRNA that may have the characteristics as described above.

The activity inhibitor of IPMK may be any one or more selected from the group consisting of compounds, peptides, peptide mimetics and antibodies that complementarily bind to the IPMK protein.

The IPMK protein may comprise a polypeptide consisting of any sequence known in the art. In one embodiment of the invention, the IPMK protein may be a polypeptide consisting of the amino acid sequence of SEQ ID NO: 14.

The polypeptide may be a mutant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein. Amino acid exchanges in proteins or peptides that do not globally alter the activity of the molecule are known in the art. And may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like in some cases. Accordingly, the present invention may include a polypeptide having an amino acid sequence substantially the same as the polypeptide having the amino acid sequence of SEQ ID NO: 14, and mutants or fragments thereof. The substantially identical polypeptide may have a homology of 80% or more, specifically 90% or more, more specifically 95% or more, with the polypeptide of the present invention.

Such peptides and peptide mimetics may inhibit the activity of the IPMK protein by inhibiting binding of the IPMK protein to other proteins. The peptide may be a mutant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein. The non-hydrolyzable peptide mimetics can be prepared by using as main residues a β-turn dipeptide core, keto-methylene pseudopeptides, azepine, benzodiazepine, β-amino alcohol or substituted γ-lactam ring.

The antibody may be a monoclonal antibody, a polyclonal antibody or a recombinant antibody. Antibodies to a particular protein can be readily prepared using techniques well known in the art if the sequence of the protein is known. Such monoclonal antibodies can be prepared using hybridoma methods or phage antibody library techniques known in the art. Generally, hybridoma cells that secrete monoclonal antibodies can be made by fusing immune cells and cancer cell lines isolated from immunologically appropriate host animals, such as mice injected with antigen protein. The cell fusion of these two groups is fused using a method known in the art such as polyethylene glycol, and the antibody producing cells are proliferated by a standard culture method. Subcloning is performed using a limiting dilution method to obtain a uniform cell population, and hybridoma cells capable of producing an antigen-specific antibody can be produced in vitro or in vivo. The antibodies prepared by the above methods can be separated and purified by methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography and the like.

The polyclonal antibody can be prepared by injecting an immunogen-causing biomarker protein or fragment thereof into an external host according to methods known in the art. The external host may be a mammal such as a mouse, rat, sheep, or rabbit. When the immunogen is injected intra-muscularly, intraperitoneally or subcutaneously, it may be administered with an adjuvant to increase antigenicity. Thereafter, blood can be routinely taken from an external host to obtain serum showing improved titer and specificity for the antigen, and separating and purifying the antibody therefrom.

Wherein the inflammatory disease is selected from inflammatory skin diseases, allergic diseases, inflammatory bowel disease, peritonitis, osteomyelitis, cachexia, meningitis, encephalitis, pancreatitis, cystic fibrosis, bronchitis, gout, spondylitis, arthritis, Lyme disease, vasculitis, sepsis, , Acute respiratory distress syndrome, chronic hepatitis, esophagitis, gastritis, colitis, pneumonia, bronchitis, sore throat, kidney failure, psoriasis, anemia or fibrosis.

In a specific example of the present invention, the present inventors have found that mice in which IPMK gene is specifically removed from bone marrow cells have a higher survival rate for sepsis (see FIG. 1), less body temperature and weight decrease than those in wild type mice, (See Figs. 2 to 4). In addition, the mice in which the IPMK gene was specifically removed from the bone marrow cells during induction of endotoxemia showed an increase in mRNA and protein expression levels of IL-1β, IL-6 and TNF-α, which are inflammation-inducing cytokines, (Fig. 5 to Fig. 10). In addition, unlike wild-type mice, mice in which IPMK gene was specifically removed from bone marrow cells during induction of endotoxemia did not express mRNA of IL-1β, IL-6, and TNF-α, which are inflammatory cytokines in macrophages isolated from bone marrow cells And an increase in the amount of protein expression was inhibited (see FIGS. 11 and 12). In addition, it was confirmed that the increase in mRNA and protein expression levels of inflammation-inducing cytokines IL-1β, IL-6 and TNF-α was suppressed in cells treated with siRNA against the IPMK gene (FIGS. 14 and 15).

Thus, a substance that inhibits the expression or activity of IPMK may be useful for the treatment of inflammatory diseases.

The pharmaceutical composition may contain 10 to 95% by weight of the IPMK expression or activity inhibitor according to the present invention, which is an active ingredient, based on the total weight of the pharmaceutical composition. In addition, the pharmaceutical composition of the present invention may further contain at least one active ingredient which exhibits the same or similar functions in addition to the above-mentioned effective ingredients.

Compositions of the present invention may also include carriers, diluents, excipients, or a combination of two or more thereof commonly used in biological formulations. The pharmaceutically acceptable carrier is not particularly limited as long as it is suitable for delivering the composition in vivo. Examples include Merck Index, 13th ed., Merck & Inc. Sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, or a mixture of at least one of these components. At this time, other conventional additives such as an antioxidant, a buffer, a bacteriostatic agent and the like may be added as necessary.

When the composition is formulated, it is prepared using diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, surfactants and the like which are usually used.

The composition of the present invention may be formulated as an oral preparation or a parenteral preparation. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, troches and the like, which may contain one or more excipients such as starch, calcium carbonate, sucrose, Lactose, gelatin, and the like. Lubricants such as magnesium stearate and talc may also be added. On the other hand, liquid formulations include suspensions, solutions, emulsions or syrups, which may contain excipients such as wetting agents, sweeteners, fragrances, preservatives and the like.

Formulations for parenteral administration may include injections such as sterile aqueous solutions, non-aqueous solutions, suspensions, and emulsions.

Examples of the non-aqueous solvent and suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like.

The composition of the present invention can be administered orally or parenterally according to the desired method, and parenteral administration can be carried out by external or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection, Can be selected.

The composition according to the invention is administered in a pharmaceutically effective amount. It may vary depending on the type of disease, severity, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of excretion, duration of treatment, The composition of the present invention may be administered alone or in combination with other therapeutic agents. When administered concomitantly, the administration can be sequential or simultaneous.

However, for the desired effect, the amount of the active ingredient contained in the pharmaceutical composition according to the present invention may be 0.001 to 10,000 mg / kg, specifically 0.1 g to 5 g / kg. The administration may be one time per day and may be divided into several times.

In addition, the present invention provides a health functional food for the improvement of an inflammatory disease containing an IPMK expression or activity inhibitor as an active ingredient.

The expression or activity inhibitor of the IMPK may have the above-described characteristics. For example, the IPMK expression inhibitor may be any one selected from the group consisting of antisense nucleotides complementary to the mRNA of the IPMK gene, small interference RNA, and short hairpin RNA. Meanwhile, the activity inhibitor of IPMK may be any one or more selected from the group consisting of compounds, peptides, peptide mimetics and antibodies that complementarily bind to the IPMK protein.

Wherein the inflammatory disease is selected from inflammatory skin diseases, allergic diseases, inflammatory bowel disease, peritonitis, osteomyelitis, cachexia, meningitis, encephalitis, pancreatitis, cystic fibrosis, bronchitis, gout, spondylitis, arthritis, Lyme disease, vasculitis, sepsis, , Acute respiratory distress syndrome, chronic hepatitis, esophagitis, gastritis, colitis, pneumonia, bronchitis, sore throat, kidney failure, psoriasis, anemia or fibrosis.

In a specific example of the present invention, the inventors of the present invention found that mice in which IPMK gene was specifically removed from bone marrow cells had a higher survival rate for sepsis (see FIG. 1), decreased body temperature and body weight 2 and FIG. 3), an increase in mRNA and protein expression levels of inflammation-inducing cytokines IL-1β, IL-6 and TNF-α is suppressed in macrophages isolated from tissues or bone marrow cells in the induction of endotoxemia (See Figs. 5 to 12). In addition, it was confirmed that increase of mRNA and protein expression level of IL-1β, IL-6 and TNF-α, which are inflammation-inducing cytokines, was suppressed in cells treated with siRNA against IPMK gene (FIGS. 14 and 15).

Therefore, a substance that inhibits the expression or activity of IPMK can be usefully used for the improvement of inflammatory diseases.

The expression or activity inhibitor of IPMK of the present invention may be added directly to food or used with other food or food ingredients. At this time, the content of the active ingredient to be added may be determined depending on the purpose. Generally, the content in the health functional food may be 0.01 to 90 parts by weight of the total food weight.

There is no particular limitation on the form and kind of the health functional food. The form of the health functional food to which the substance is added may be a tablet, a capsule, a powder, a granule, a liquid, a ring and the like.

The health functional food of the present invention may contain various flavoring agents or natural carbohydrates as an additional ingredient such as a normal health functional food. The above-mentioned natural carbohydrates are sugar alcohols such as monosaccharides such as glucose and fructose, polysaccharides such as disaccharides such as maltose and sucrose, dextrin and cyclodextrin, and xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like.

In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, Alcohol, and the like. These components may be used independently or in combination. The proportion of such additives may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

Further, the present invention provides a method for producing an IPMK-expressing cell line, comprising: 1) preparing an IPMK expressing cell line; 2) treating the cell line of step 1) with the test substance; 3) measuring the level of expression or activity of IPMK in the cell line treated with the test substance; And 4) screening the test substance for which the expression or activity level of IPMK is decreased as compared with the control group in which the test substance is not treated.

The IPMK gene expressed in the cell line of step 1) may comprise a polynucleotide consisting of any sequence known in the art. In one embodiment of the present invention, the IPMK gene may be a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: The polynucleotide may have the above-described characteristics. In addition, the cell line may be such that the IPMK protein or fragment thereof is overexpressed by transformation of the IPMK gene.

The level of expression or activity of IPMK can be measured by immunoprecipitation, radioimmunoassay, enzyme immunoassay, immunohistochemistry, RT-PCR, Western blot or flow cytometry. However, the transcript or the protein encoded therefrom Any method of measuring the amount can be used.

Wherein the inflammatory disease is selected from inflammatory skin diseases, allergic diseases, inflammatory bowel disease, peritonitis, osteomyelitis, cachexia, meningitis, encephalitis, pancreatitis, cystic fibrosis, bronchitis, gout, spondylitis, arthritis, Lyme disease, vasculitis, sepsis, , Acute respiratory distress syndrome, chronic hepatitis, esophagitis, gastritis, colitis, pneumonia, bronchitis, sore throat, kidney failure, psoriasis, anemia or fibrosis.

In a specific example of the present invention, the inventors of the present invention found that mice in which IPMK gene was specifically removed from bone marrow cells had a higher survival rate for sepsis (see FIG. 1), decreased body temperature and body weight 2 and FIG. 3), an increase in mRNA and protein expression levels of inflammation-inducing cytokines IL-1β, IL-6 and TNF-α is suppressed in macrophages isolated from tissues or bone marrow cells in the induction of endotoxemia (See Figs. 5 to 12). In addition, it was confirmed that increase of mRNA and protein expression level of IL-1β, IL-6 and TNF-α, which are inflammation-inducing cytokines, was suppressed in cells treated with siRNA against IPMK gene (FIGS. 14 and 15).

Therefore, a substance whose expression or activity of IPMK screened by the above method is decreased as compared with the control group can be usefully used for the treatment of inflammatory diseases.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are illustrative of the present invention, and the contents of the present invention are not limited thereto.

In mice induced sepsis IPMK  Comparison of survival rates according to presence or absence of genes

In order to compare the survival rates of IPMK genes in sepsis - induced mice, IPMK - specific mice were prepared. Specifically, mice were prepared by inserting loxP sites in the 51 bp upstream intron at the 6th exon of IPMK and loxP sites under 2476 bp of the 6th exon termination codon, and these were defined as Ipmk ^{fl / fl} . The mice expressing the Cre-recombinant enzyme only by activation of the Ipmk ^{fl / fl} mouse and the LysM promoter specifically expressing the bone marrow cells were crossed with each other to prepare a mouse in which the IPMK gene was specifically removed from the bone marrow cells. This is defined as Ipmk ^ΔMac .

8 week old male C57BL / 6J mice (Ipmk ^{fl / fl} ) as wild-type male C57BL / 6J mice were used as a control group, and 8 week old male C57BL / 6J mice (Ipmk ^ΔMac ) in which the IPMK gene was specifically removed from bone marrow cells prepared as described above were prepared. The control and experimental mice were anesthetized and the cecum was removed. The cecum was removed, and about 70% of the entire cecum was knotted with a surgical suture and then passed through the cecum with a 21G needle. The abdominal cavity was closed with a surgical suture, and the skin was sutured once more with a clip. 1 ml of saline was injected at 37 ° C, and the survival rate was measured at 24-hour intervals after surgery. The survival rate was calculated by the Kaplan - Meier survival analysis method. Statistical analysis was performed using the log - rank method, with a significance maximum limit of p <0.05.

As a result, as shown in Fig. 1, the survival rate of sepsis-specific mice with IPMK gene was increased compared to wild-type mice (Fig. 1).

Endotoxemia  In induced mice IPMK  Comparison of body temperature changes with and without genes

Wild type 8 week old male C57BL / 6J mice and bone marrow cells. Lipopolyssacharides O26 (B6, Sigma aldrich) dissolved in physiological saline was administered 4.5 mg / kg to 8 week old male C57BL / 6J mice in which the IPMK gene was specifically removed Lt; / RTI &gt; to induce endotoxemia. Rectal temperature was measured for 48 hours at 6 hour intervals in mice induced with endotoxemia, and body weight and ingestion were measured 48 hours after induction of endotoxemia.

As a result, as shown in FIG. 2 to FIG. 4, the mice in which the IPMK gene was specifically removed from the bone marrow cells showed less decrease in body temperature and body weight than mice in the wild type, and the feeding amount was increased (FIG. 2 to FIG. 4).

Endotoxemia  In induced mice IPMK  Comparison of mRNA expression of inflammatory cytokines with and without gene

<3-1> Endotoxemia  After induction 6 hours mRNA  Comparison of expression changes

First, endotoxemia was induced in mice by the same conditions and methods as in Example 2. After 6 hours, the mice were sacrificed, and the spleen, lung and cerebral cortical tissues were obtained from the sacrificed mice, respectively. RNA was extracted according to a conventional method, and the extracted RNA was extracted with NanoDrop Technologies Inc., USA). Water (DEPC water) to which diethyl pyrocarboxylic acid was added was added to the quantified RNA, and the RNA concentration was adjusted to 300 ng / μl. 10 쨉 l of RNA, oligo-dT primer and water added with diethyl pyrocarbonic acid were mixed and first denatured for 5 minutes at 65 캜. Then, 4 μl of 5 × reaction buffer, 2 μl of dNTP, 0.5 μl of RNase inhibitor and 0.5 μl of RTase were added, and cDNA synthesis kit (Enzynomics, KOREA) The reaction was conducted at 50 ° C for 1 hour and at 75 ° C for 5 minutes to perform a reverse transcription reaction. Real-time reverse transcription was performed using synthesized cDNA, SYBRgreen (Toyobo, JAPAN) and the primers shown in Table 1 according to the manufacturer's method to analyze the expression levels of IL-6 and TNF-α mRNA. All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

Primers used in PCR primer The primer sequence (5 '- &gt; 3') IL-6 forward (SEQ ID NO: 1) ATGAACAACGATGATGCACTT IL-6 reverse (SEQ ID NO: 2) TATCCAGTTTGGTAGCATCCAT TNF-a forward (SEQ ID NO: 3) CACAAGATGCTGGGACAGTGA TNF-a reverse direction (SEQ ID NO: 4) GAGGCTCCAGTGAATTCGGA IL-1? Forward (SEQ ID NO: 5) GCCTCGTGCTGTCGGACC IL-1 beta reverse (SEQ ID NO: 6) TGTCGTTGCTTGGTTCTCCTTG

As a result, as shown in FIG. 5 to FIG. 7, unlike the wild-type mice, the mice in which the IPMK gene was specifically removed showed a mRNA expression level of IL-6 and TNF-α in the spleen, lung and cerebral cortex (Figs. 5 to 7).

<3-2> Endotoxemia  18 hours after induction mRNA  Comparison of expression changes

1β, IL-6 and TNF-α in the same conditions and in the same manner as in Example <3-1>, except that the cerebral cortex or hypothalamic tissue obtained from the sacrificed mice was used 18 hours after induction of endotoxemia MRNA expression level of mRNA was analyzed. The primer sequences used are as shown in Table 1 above. All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

As a result, as shown in FIG. 8, unlike the wild-type mice, the mice in which the IPMK gene was specifically removed from the bone marrow cells showed mRNA expression levels of IL-1β, IL-6 and TNF-α in the cerebral cortex or hypothalamus (Fig. 8).

Endotoxemia  In induced mice IPMK  Comparison of Protein Expression Changes of Inflammatory Cytokines with and without Gene

First, endotoxemia was induced in mice by the same conditions and methods as in Example 2. Six hours later, blood was collected from the orbital vein and allowed to coagulate at room temperature for 30 minutes, and then centrifuged to obtain the supernatant serum. On the other hand, mice were sacrificed and cerebral cortical tissue was obtained from the sacrificed mice and proteins were extracted according to conventional methods. Protein amounts of IL-6 and TNF-a were assayed according to the manufacturer's method using an enzyme-linked immunosorbant assay (ELISA) kit (BD biosciences, Cat no. 555240 and 558534). All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

As a result, as shown in FIG. 9 and FIG. 10, unlike the wild-type mice, the mice in which the IPMK gene was specifically removed from the bone marrow cells were found to express the IL-6 or TNF-a protein, which is an inflammation- inducing cytokine in the serum and cerebral cortex An increase in the expression level was suppressed (Figs. 9 and 10).

Endotoxemia  Derived macrophages from the bone marrow cells of the induced mice IPMK  Comparison of Expression of Inflammatory Cytokines with and Without Gene

Macrophages were isolated from the bone marrow of 8-week-old wild-type C57BL / 6J mice and bone marrow-derived 8-week-old male C57BL / 6J mice in which the IPMK gene had been specifically removed and dispensed at a rate of 1 × 10 ⁶ per well on a 6-well plate. After 24 hours, the cells were treated with lipid polysaccharide dissolved in PBS at a concentration of 100 ng / ml to induce endotoxinemia. After 6 hours, cell cultures were obtained and the amount of IL-1 [beta] and TNF- [alpha] protein was assayed according to the manufacturer's method using an ELISA kit (BD biosciences, Cat No. 559603 and 558534).

On the other hand, in the above procedure, the culture solution was removed, and 700 μl of tri-reagent (MRC) was added to the remaining cells to obtain cells. RNA was extracted according to a conventional method, and mRNA expression levels of intracellular IL-1β, IL-6 and TNF-α were analyzed in the same manner as in Example <3-1>. All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

As a result, as shown in FIG. 11 and FIG. 12, unlike the wild-type mice, the mice in which the IPMK gene was specifically removed from the bone marrow cells were treated with the inflammation-inducing cytokines IL-1β, IL-6 or TNF -α (FIG. 11 and FIG. 12).

Endotoxemia  In induced cells IPMK  For the gene To siRNA  Of Inflammatory Cytokines

<6-1> To siRNA  by IPMK  Confirmation of gene expression inhibition

As a control, random RNA (scrambled RNA, ScRNA) was used to confirm that the expression of IPMK gene was suppressed by siRNA against IPMK gene. The random RNA was composed of a sense strand having the nucleotide sequence of SEQ ID NO: 7 and an antisense strand having the nucleotide sequence of SEQ ID NO: 8, and the sense strand was made to have a nucleotide sequence of dTdT overhang at the 3 'end. Meanwhile, the siRNA targeting the IPMK gene consists of a sense strand having the nucleotide sequence of SEQ ID NO: 9 and an antisense strand having the nucleotide sequence of SEQ ID NO: 10, and the sense strand has the nucleotide sequence of dCdT as an overhang at the 3 ' . RAW 264.7 cell line, a mouse-derived macrophage cell line, was dispensed into a 6-well plate at 7.5 × 10 ⁵ per well. After 16 hours, siRNA for 100 pmole of IPMK gene or 100 pmole of random RNA was mixed with 125 占 퐇 of Opti-MEM (Invitrogen, US, Cat No. 31985070). Then, the siRNA and the random RNA were mixed in 125 μl of Opti-MEM containing 9 μl of lipofectamine LTX (Invitrogen, US, Cat No. 15338-100) and then reacted. After 5 minutes, 250 쨉 l of the reaction solution was added to a 6-well plate in which RAW 264.7 cells grew and cultured. After 48 hours, the cell culture was removed, and the remaining cells were added with 700 占 퐇 of tri-reagent (MRC) to obtain cells. RNA was extracted according to a conventional method, and an IPMK reverse primer described as the IPMK forward primer (5'-CAGAGAGGUCCUAGUUAAUUUCA-3 ') and SEQ ID NO: 12 (5'-AGUGAAAUUAACUAGGACCUCUCUGUU-3' The degree of inhibition of IPMK gene expression was analyzed by the same method as in Example <3-1>. All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

As a result, as shown in Fig. 13, the expression of IPMK gene was inhibited by treating siRNA against IPMK gene regardless of whether induction of endotoxemia was induced (Fig. 13).

<6-2> IPMK  Comparison of the expression changes of inflammatory cytokines in cell lines with suppressed gene expression

SiRNA or random RNA targeting the IPMK gene was treated with RAW 264.7 cells in the same manner as in Example <6-1>, and after 42 hours, the lipopolysaccharide dissolved in PBS was treated at a concentration of 100 ng / Induced toxinemia. After 6 hours, the cell culture was obtained and the amount of IL-1?, IL-6 and TNF-? Were analyzed according to the manufacturer's method using an ELISA kit (BD biosciences, Cat no. 559603, 555240 and 558534).

On the other hand, in the above procedure, the culture solution was removed, and 700 μl of tri-reagent (MRC) was added to the remaining cells to obtain cells. RNA was extracted according to a conventional method, and mRNA expression levels of intracellular IL-1β, IL-6 and TNF-α were analyzed in the same manner as in Example <3-1>. All experiments were expressed as mean ± SEM. Statistical analysis was done by Student's t-test. The maximum limit of significance was p <0.05.

As a result, as shown in Fig. 14 and Fig. 15, an increase in mRNA and protein expression levels of IL-1β, IL-6 and TNF-α, which are inflammation-inducing cytokines, was suppressed in cells treated with siRNA against IPMK gene (Figs. 14 and 15).

<110> Korea Advanced Institute of Science and Technology <120> PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING          INFLAMMATORY DISEASES COMPRISING INOSITOL POLYPHOSPHATE          MULTIKINASE INHIBITOR AS AN ACTIVE INGREDIENT <130> 2016P-12-029 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> IL-6 forward primer <400> 1 atgaacaacg atgatgcact t 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> IL-6 reverse primer <400> 2 tatccagttt ggtagcatcc at 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha forward primer <400> 3 cacaagatgc tgggacagtg a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNF-alpha reverse primer <400> 4 gaggctccag tgaattcgga 20 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> IL-1 beta forward primer <400> 5 gcctcgtgct gtcggacc 18 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> IL-1 beta reverse primer <400> 6 tgtcgttgct tggttctcct tg 22 <210> 7 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> scrambled RNA sense <220> <221> misc_RNA <222> (19) <223> 3 'overhang dTdT <400> 7 cucacucgug ccgugucua 19 <210> 8 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> scrambled RNA antisense <400> 8 uagacacggc acgagugag 19 <210> 9 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Ipmk siRNA sense <220> <221> misc_RNA <222> (23) <223> 3 'overhang dCdT <400> 9 cagagagguc cuaguuaauu uca 23 <210> 10 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> Ipmk siRNA antisense <400> 10 agugaaauua acuaggaccu cucuguu 27 <210> 11 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Ipmk forward primer <400> 11 cagagagguc cuaguuaauu uca 23 <210> 12 <211> 27 <212> RNA <213> Artificial Sequence <220> <223> Ipmk reverse primer <400> 12 agugaaauua acuaggaccu cucuguu 27 <210> 13 <211> 1251 <212> DNA <213> Homo sapiens <400> 13 atggcaacag agccaccatc ccccctccgg gtcgaggcgc cgggcccccc agaaatgcgg 60 acctcaccgg cgatcgagtc cacccctgag ggcaccccgc agccggcggg cggcagactc 120 cgcttcctca acggctgcgt gcccctctcg catcaggtgg ccgggcacat gtacgggaag 180 gacaaagtgg gtatactgca acatccagat ggcacagttt tgaaacagtt acaaccacct 240 ccaaggggcc caagagagct ggaattctat aatatggttt atgctgctga ctgttttgat 300 ggtgttcttc tagagctacg aaaatatttg ccaaaatatt atggcatctg gtcacctccc 360 actgcaccaa acgatttata cctaaaactg gaagatgtga cccataaatt taataagccc 420 tgtataatgg atgtaaagat agggcaaaaa agctatgatc cttttgcctc atctgagaag 480 attcagcaac aggtcagcaa gtacccatta atggaagaga ttgggttctt ggtgcttggc 540 atgagggttt atcatgttca ttccgatagc tatgagacag aaaaccagca ttacggaaga 600 agcttaacaa aagaaactat aaaggatgga gtctccagat tttttcataa tgggtactgc 660 ttaagaaaag atgctgttgc tgccagtatt cagaagattg agaaaattct gcagtggttt 720 gaaaaccaga agcagcttaa tttttacgca agttcattac tctttgttta tgaaggttca 780 tctcagccaa ccactacaaa attgaatgac agaactttgg cagaaaagtt tttgtccaaa 840 ggacaactgt cagacacaga agtactagag tacaataata actttcatgt gttaagttcc 900 acagctaatg gaaaaataga gtcttcagtg ggcaaaagct tgtccaagat gtatgcgcgt 960 cacaggaaaa tatatacaaa aaagcatcac agtcagactt cattgaaagt tgaaaatctg 1020 gagcaagaca atgggtggaa aagcatgtca caggaacatt taaatggaaa tgtactttcc 1080 caactggaaa aagttttcta ccatcttccc actggttgcc aagagattgc tgaagtagaa 1140 gtgcgaatga tagattttgc tcatgtgttc cctagcaaca caatagatga gggatatgtt 1200 tatgggctaa agcatttaat ttctgtactt cgaagtattt tagacaattg a 1251 <210> 14 <211> 416 <212> PRT <213> Homo sapiens <400> 14 Met Ala Thr Glu Pro Pro Ser Pro Leu Arg Val Glu Ala Pro Gly Pro   1 5 10 15 Pro Glu Met Arg Thr Ser Pro Ala Ile Glu Ser Thr Pro Glu Gly Thr              20 25 30 Pro Gln Pro Ala Gly Gly Arg Leu Arg Phe Leu Asn Gly Cys Val Pro          35 40 45 Leu Ser His Gln Val Ala Gly His Met Tyr Gly Lys Asp Lys Val Gly      50 55 60 Ile Leu Gln His Pro Asp Gly Thr Val Leu Lys Gln Leu Gln Pro Pro  65 70 75 80 Pro Arg Gly Pro Arg Glu Leu Glu Phe Tyr Asn Met Val Tyr Ala Ala                  85 90 95 Asp Cys Phe Asp Gly Val Leu Leu Glu Leu Arg Lys Tyr Leu Pro Lys             100 105 110 Tyr Tyr Gly Ile Trp Ser Pro Pro Thr Ala Pro Asn Asp Leu Tyr Leu         115 120 125 Lys Leu Glu Asp Val Thr His Lys Phe Asn Lys Pro Cys Ile Met Asp     130 135 140 Val Lys Ile Gly Gln Lys Ser Tyr Asp Pro Phe Ala Ser Ser Glu Lys 145 150 155 160 Ile Gln Gln Gln Val Ser Lys Tyr Pro Leu Met Glu Glu Ile Gly Phe                 165 170 175 Leu Val Leu Gly Met Arg Val Tyr His Val His Ser Asp Ser Tyr Glu             180 185 190 Thr Glu Asn Gln His Tyr Gly Arg Ser Leu Thr Lys Glu Thr Ile Lys         195 200 205 Asp Gly Val Ser Arg Phe Phe His Asn Gly Tyr Cys Leu Arg Lys Asp     210 215 220 Ala Val Ala Ala Ser Ile Gln Lys Ile Glu Lys Ile Leu Gln Trp Phe 225 230 235 240 Glu Asn Gln Lys Gln Leu Asn Phe Tyr Ala Ser Ser Leu Leu Phe Val                 245 250 255 Tyr Glu Gly Ser Ser Gln Pro Thr Thr Thr Lys Leu Asn Asp Arg Thr             260 265 270 Leu Ala Glu Lys Phe Leu Ser Lys Gly Gln Leu Ser Asp Thr Glu Val         275 280 285 Leu Glu Tyr Asn Asn Asn Phe His Val Leu Ser Ser Thr Ala Asn Gly     290 295 300 Lys Ile Glu Ser Ser Val Gly Lys Ser Leu Ser Lys Met Tyr Ala Arg 305 310 315 320 His Arg Lys Ile Tyr Thr Lys Lys His His Ser Gln Thr Ser Leu Lys                 325 330 335 Val Glu Asn Leu Glu Gln Asp Asn Gly Trp Lys Ser Met Ser Gln Glu             340 345 350 His Leu Asn Gly Asn Val Leu Ser Gln Leu Glu Lys Val Phe Tyr His         355 360 365 Leu Pro Thr Gly Cys Gln Glu Ile Ala Glu Val Glu Val Arg Met Ile     370 375 380 Asp Phe Ala His Val Phe Pro Ser Asn Thr Ile Asp Glu Gly Tyr Val 385 390 395 400 Tyr Gly Leu Lys His Leu Ile Ser Val Leu Arg Ser Ile Leu Asp Asn                 405 410 415

Claims (10)

A pharmaceutical composition for preventing or treating an inflammatory disease comprising as an active ingredient an expression or activity inhibitor of IPMK (inositol polyphosphate multikinase), wherein the IPMK expression inhibitor is an antisense nucleotide complementarily binding to the mRNA of the IPMK gene, A small interfering RNA (RNA) or a short hairpin RNA, and the activity inhibitor of IPMK is an antibody that binds complementarily to the IPMK protein.
delete The pharmaceutical composition according to claim 1, wherein the IPMK expression inhibitor is a small interfering RNA complementarily binding to the mRNA of the IPMK gene.
The pharmaceutical composition according to claim 3, wherein the small interfering RNA is composed of a sense strand consisting of the nucleotide sequence of SEQ ID NO: 9 and an antisense strand consisting of the nucleotide sequence of SEQ ID NO: 10.
The pharmaceutical composition according to claim 3, wherein the IPMK gene is a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 13.
delete The pharmaceutical composition according to claim 1, wherein the IPMK protein is a polypeptide consisting of the amino acid sequence of SEQ ID NO: 14.
The method of claim 1, wherein the inflammatory disease is selected from inflammatory skin diseases, allergic diseases, inflammatory bowel disease, peritonitis, osteomyelitis, meningitis, meningitis, encephalitis, pancreatitis, cystic fibrosis, bronchitis, gout, spondylitis, arthritis, , Sepsis, septic shock, acute respiratory distress syndrome, chronic hepatitis, esophagitis, gastritis, colitis, pneumonia, bronchitis, sore throat, renal failure, psoriasis, anemia or fibrosis, inflammatory diseases.
A health functional food for improving an inflammatory disease comprising an IPMK expression or activity inhibitor as an active ingredient, wherein the IPMK expression inhibitor is an antisense nucleotide complementarily binding to mRNA of IPMK gene, a small interfering RNA or A short hairpin RNA, and the activity inhibitor of IPMK is an antibody that binds complementarily to the IPMK protein.
1) preparing an IPMK expressing cell line;
2) treating the cell line of step 1) with the test substance;
3) measuring the level of expression or activity of IPMK in the cell line treated with the test substance; And
4) selecting a test substance whose expression or activity level of the IPMK is decreased compared to a control group in which the test substance is not treated; and screening the candidate substance for the treatment of an inflammatory disease.

Images