KR101793378B1 - Composition comprising the extract of Spatholobus suberectus for anti-diabetes - Google Patents

Abstract

The present invention relates to a composition for preventing, alleviating, or treating diabetes comprising a Spatholobus suberectus Dunn (SS) extract as an effective component. The present inventors have verified through various molecular biological experiments that the SS extract contains large amounts of antioxidants such as flavonoids and polyphenols, and thus exhibits antioxidant activity. Further, the SS extract shows -glucosidase inhibition activity in vitro, and promotes glucose uptake in the cell, and in streptozotocin-induced diabetic mice, shows anti-diabetic activities including suppression of a rise in blood sugar level. Accordingly, the SS extract according to the present invention may be beneficially used in the development of drugs for preventing, alleviating, or treating diabetes, functional health foods, and cosmetic products, etc. Additionally, SS is a natural product with negligible toxicity that can be easily purchased, and thus is suited for alleviating or treating chronic diseases such as diabetes, and since high anti-diabetic effect was found even through oral administration in diabetic mice, SS can be utilized in various formulations.

Description

[0001] The present invention relates to an antidiabetic composition comprising an extract of Spatholobus suberectus for anti-diabetes,

The present invention relates to a composition for preventing, improving or treating diabetes mellitus comprising an extract of blood-brain-sparing and the like as an active ingredient.

Diabetes is one of the metabolic diseases characterized by hyperglycemia. According to the International Diabetes Federation (IDF), in 2014, 380 million people were diagnosed with diabetes, and by 2035, the number of diabetic patients is expected to reach 590 million. As such, diabetes is becoming a serious threat to human health.

As a treatment for diabetes, natural products are attracting interest because of their low cost and low side effects. Such natural products are often used as adjuvants in combination with therapeutic drugs, which also promote the interaction of drugs with natural products. In addition, traditional natural products exhibiting an anti-diabetic effect are known. For example, the most well-known is Metformin, which is derived from a herb named Galega officinalis Linn and is a first-generation drug for the treatment of diabetes It is the most widely used (Bailey and Day, 2004).

On the other hand, Spatholobus suberectus Dunn (SS) is a generic term in China called 'Jixueteng' and belongs to the leguminosae family. Stem parts of blood and blood have been used to improve blood flow, improve irregular menstruation, reduce menstrual pain, decrease blood circulation, and treat rheumatism. In addition, clinical studies have shown that the blood-brain barrier has a strong inhibitory effect on the gene encoding hepcidin (HAMP) and is an inhibitor of lactate dehydrogenase A (LDH-A) It has been reported that MDA-MB-231, which is a cell line, exhibits anticancer effect. Furthermore, we found that matrix metalloproteinase (MMP-1, -3, -9) and human chondrosarcoma cell, SW1353, inhibit the expression level of matrix metalloproteinase (TIMP-1) inhibitor. Through the above-mentioned research results, it is known that it inhibits osteoclastogenesis and stimulates cartilage formation. In addition, it has been reported that it also inhibits the activity of elastase (HNE), a protease involved in inflammation secreted from human-derived neutrophils.

However, there is no report on the effect of blood-banking on the prevention or treatment of diabetes.

The inventors of the present invention have found that, while conducting research for the development of diabetic natural product therapeutic agents, the extracts of antimicrobial compounds have high antioxidative effects by containing high levels of flavonoids and polyphenols. In vitro and in vivo experiments have shown that antidiabetic effects The present invention has been completed on the basis thereof.

Accordingly, it is an object of the present invention to provide a pharmaceutical composition for preventing or treating diabetes mellitus comprising an extract of blood-bank blood as an active ingredient.

It is another object of the present invention to provide a health functional food composition for diabetes mellitus comprising an extract of blood-brain-sparing and the like as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to accomplish the object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating diabetes, which comprises an extract of a blood-brain extract as an active ingredient.

Further, the present invention provides a health functional food composition for diabetes mellitus comprising an extract of blood-brain-sparing and the like as an active ingredient.

In one embodiment of the invention, the extract is selected from the group consisting of water, C ₁ to C ₄ lower alcohols, ethyl acetate, acetone, butyl acetate, 1,3-butylene glycol, methylene chloride, It may be one that has been extracted with the chosen solvent.

In another embodiment of the present invention, the composition may have antioxidant ability.

In another embodiment of the present invention, the composition may inhibit alpha-glucosidase activity.

In another embodiment of the present invention, the composition may be one having an effect of improving blood sugar.

In another embodiment of the present invention, the composition may promote intracellular glucose uptake.

The present invention also provides a method of preventing or treating diabetes, comprising the step of administering to a subject a pharmaceutical composition comprising an extract of blood-brain-sparing and the like as an active ingredient.

Further, the present invention provides a method for preventing or treating diabetes mellitus, such as a blood-brain extract.

The inventors of the present invention have confirmed that antioxidative effects resulting from the antioxidative effects of flavonoids and polyphenols, which are antioxidative substances, are present in a large amount by the extracts of the blood and blood, and furthermore, in vitro , the extracts of the blood and blood have inhibited alpha-glucosidase activity And the effect of promoting glucose uptake in the cell, and it was confirmed that antidiabetic effect including the inhibition of blood glucose elevation in streptozotocin-induced diabetic mice was exhibited, and thus the blood extract of the present invention can prevent, improve, or treat diabetes A health functional food, a cosmetic product, and the like.

In addition, since blood is easy to purchase and has little toxicity, it is suitable for the improvement or treatment of chronic diseases such as diabetes, and it has a high antidiabetic effect even when administered orally in diabetic mice, There are advantages that can be utilized.

FIG. 1 is a graph showing the result of measuring the DPPH radical scavenging activity of water extract (SA) such as blood and blood and ethanol extract (SE) such as blood.
FIGS. 2A and 2B are graphs showing results of analysis of oxygen radical absorption capacity (ORAC) for water extract (SA) such as blood and blood and ethanol extract (SE) such as blood.
FIG. 3 shows the results of measurement of alpha-glucosidase inhibitory activity on water extract (SA) and blood ethanol extract (SE).
Fig. 4 shows the results of cytotoxicity of water extract (SA) such as blood and blood and ethanol extract (SE) such as blood, through MTT assay.
FIG. 5 shows the results of 2-NDGB absorption assay for water extract (SA) such as blood and blood and ethanol extract (SE) such as blood, in order to evaluate intracellular glucose uptake ability by the blood extract.
6A and 6B are graphs showing the results of the oral glucose tolerance test for diabetes mellitus-induced mouse model by administration of streptozotocin (STZ) (NT: normal control, STZ + DW: diabetic group, Acarbose: diabetic group, acarbose group, SA: diabetic group) SE: diabetes mellitus induced ethanol extraction.
FIG. 7A shows the results of measurement of the expression of diabetes-related genes by the blood-brain extracts through RT-PCR, and FIG. 7B shows quantitation of expression amounts of the genes.

The inventors of the present invention have confirmed that an antimicrobial effect including an improvement in blood glucose level is demonstrated through in vitro and in vivo experiments, and that the present invention has been completed based on this finding.

Accordingly, the present invention provides a pharmaceutical composition for the prevention or treatment of diabetes, comprising an extract of blood-bank blood as an active ingredient.

The term " diabetes mellitus " used in the present invention is a type of metabolic disorder such as insufficient secretion of insulin or a failure to function normally. It is characterized by hyperglycemia with high blood glucose concentration, It causes symptoms and signs and excretes glucose from the urine. Diabetes mellitus includes type 1 diabetes, which is caused by insulin secretion due to the breakdown of pancreatic beta cells, type 2 diabetes caused by insufficient insulin secretion in the body or by insulin resistance that cells do not respond to insulin . In the present invention, diabetes includes both type 1 diabetes and type 2 diabetes.

As used herein, the term " prevention " means any action that inhibits diabetes or delays the onset of diabetes by administration of the pharmaceutical composition according to the present invention.

As used herein, the term " treatment " refers to any action that improves or alters the symptoms of diabetes by administration of the pharmaceutical composition according to the present invention.

The blood extract of the present invention can be extracted using a conventional solvent known in the art for extracting an extract from a natural product, that is, under ordinary temperature and pressure conditions. For example, in the present invention, the blood-brain extracts are selected from the group consisting of water, a 1 to 4 carbon alcohol, ethyl acetate, acetone, butyl acetate, 1,3-butylene glycol, methylene chloride, Or more of the solvent, and preferably ethanol can be used for extraction. In addition, the method for extracting blood-extracting extracts can be extracted by various methods such as room temperature extraction, hot water extraction, cold extraction, reflux extraction, microwave extraction, and ultrasonic extraction, but is not limited thereto.

The extract thus prepared may be filtered, concentrated or dried to remove the solvent, and may be subjected to both filtration, concentration and drying. For example, the filtration can be performed using a filter paper or a vacuum filter, the concentration can be carried out using a vacuum concentrator, and the lyophilization can be carried out, but the present invention is not limited thereto.

Further, the extract extracted with the solvent may be further fractionated with a solvent selected from the group consisting of butanol, hexane, methylene chloride, acetone, ethyl acetate, ethyl ether, chloroform, water, and a mixed solvent thereof. The fractionation temperature may be 4 캜 to 120 캜, but is not limited thereto.

In the examples of the present invention, the following experiment was carried out in order to investigate whether the blood extract of the present invention extracted by the above method had a therapeutic effect on diabetes.

In one embodiment of the present invention, a large amount of polyphenols and flavonoids, which are antioxidant substances in the blood extract, are contained. Based on these results, antioxidative effects of the extracts of the blood and blood are obtained through analysis of DPPH radical scavenging activity and oxygen radical absorption capacity (See Example 2).

In another embodiment of the present invention, it is known that polyphenols exhibiting antioxidant activity play a major role in diabetes. Based on this analysis, the alpha-glucosidase inhibitory activity of the extracts of the blood extracts was analyzed, (See Example 3). ≪ tb > < TABLE > In addition, it was confirmed that the two kinds of blood extracts at the cell level do not induce cytotoxicity and promote intracellular glucose uptake (see Example 4).

In another embodiment of the present invention, it has been confirmed that an ethanol extract such as a blood-sugar-containing ethanol extract has an effect of inhibiting blood glucose elevation through oral glucose tolerance test in mice in which diabetes was induced by administration of streptozotocin (STZ) MRNA expression of SOD1, GPx-1, NOX-1, HO-1, IRS-1, GLUT-4 and PI3K was examined by the addition of ethanol extract, It was confirmed that expression of the genes was restored (see Example 6).

From the results of the above examples, it was experimentally confirmed that the blood-sugar extract is effective in preventing, ameliorating, or treating diabetes.

The pharmaceutical composition according to the present invention may contain an extract of blood-brain and the like as an active ingredient, and may be contained in an amount of 0.01 to 90% by weight based on the total weight of the composition, and may further include a pharmaceutically acceptable carrier. Such pharmaceutically acceptable carriers are those conventionally used in the field of application and include, but are not limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, And may further contain other conventional additives such as antioxidants and buffers as needed. In addition, it can be formulated into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders, lubricants and the like. Suitable pharmaceutically acceptable carriers and formulations can be suitably formulated according to the respective ingredients using the methods disclosed in Remington's reference. The pharmaceutical composition of the present invention is not particularly limited to a formulation, but may be formulated into injections, inhalants, external skin preparations, and the like.

The pharmaceutical composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) depending on the intended method, and the dose may vary depending on the condition and the weight of the patient, The mode of administration, the route of administration, and the time, but may be appropriately selected by those skilled in the art.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, sequentially or concurrently with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition of the present invention may vary depending on the age, sex, condition, body weight, the degree of absorption of the active ingredient in the body, the rate of inactivation and the excretion rate, the type of disease, 0.001 to 150 mg, preferably 0.01 to 100 mg per kg of body weight, may be administered daily or every other day, or one to three divided doses per day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

As another aspect of the present invention, the present invention provides a health functional food composition for diabetes mellitus comprising an extract of a blood-brain extract as an active ingredient.

As used herein, the term " improvement " means all actions that at least reduce the degree of symptom associated with the condition being treated. At this time, the health functional food composition may be used simultaneously or separately as a medicine for treatment before or after onset of the disease for the prevention or improvement of diabetes.

The term " health functional food composition " used in the present invention includes at least one of carrier, diluent, excipient and additives, and may be formulated into a tablet, pill, powder, . Examples of foods that can be added to the extract of the present invention include various foods, powders, granules, tablets, capsules, syrups, drinks, gums, tea, vitamin complexes, and health functional foods. Examples of the additive that can be further included in the present invention include natural carbohydrates, flavors, nutrients, vitamins, minerals (electrolytes), flavors (synthetic flavors, natural flavors and the like), colorants, fillers, At least one selected from the group consisting of alginic acid and its salts, organic acids, protective colloid thickening agents, pH adjusting agents, stabilizers, preservatives, antioxidants, glycerin, alcohols, carbonating agents and flesh. Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. As the above-mentioned flavors, natural flavors (tautatin, stevia extract (for example, rebaudioside A and glycyrrhizin) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used. The composition according to the present invention can be used in various forms such as flavorings such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and heavies, factic acid and its salts, alginic acid and its salts, , pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages, etc. Other compositions according to the present invention may contain flesh for the production of natural fruit juices and vegetable drinks . These components may be used independently or in combination. Specific examples of the carrier, excipient, diluent and additives include, but are not limited to, lactose, dextrose But are not limited to, sucrose, sorbitol, mannitol, erythritol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylquilolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water , At least one selected from the group consisting of sugar syrup, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil is preferably used.

As another embodiment of the present invention, the present invention provides a method for the prevention or treatment of diabetes comprising an extract of blood-bank or the like as an active ingredient.

The term " individual " as used herein refers to a subject in need of treatment of a disease, and more specifically refers to a mammal such as a human or non-human primate, mouse, dog, cat, horse, do.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Preparation of extracts such as blood

(1:15, w / v) or 10 times of ethanol (1:10, w / v) were added to the 30 g of the stem of the blood- ) Was added and the mixture was extracted for 12 hours in a shaking incubator at 60 ° C. The extracted blood extracts were filtered using a filter paper and lyophilized. The extract of the blood-brain extract obtained through the above procedure was dissolved in distilled water (DW) or dimethyl sulfoxide (DMSO), or stored in a refrigerator at 4 ° C for future experiments.

1-2. Preparation and management of experimental animals

For animal experiments, 7 week old BALB / c male mice were used and purchased from Samtako (Osan, Korea). All items related to animal testing strictly adhered to the Guiding Principles in the National Research Council and the Laboratory Ethics Committee of Kyungpook National University. The mice used in the experiment were selected from 20-22 g mice weighing 20-22 g that had been purified for 1 week before the experiment. The mice were fed free of sterilized drinking water and feed, 22 ± 1 ° C and 55 ± 5 % Humidity, and light was adjusted at 12 hour intervals. The groups for the experiment were as follows, with 5 mice per group. (STZ +) and STZ + ethanol extract (SE) treated group (STZ + control group (NT), streptozotocin (STZ) + positive control group acarbose, STZ + SE).

1-3. Total polyphenol content measurement

The total polyphenol content in the samples was performed using the slightly modified version of Folin Ciocalteu's colorimetric method. 2 [mu] l of a 10 mg / ml sample was added to 10 [mu] l of Folin Ciocalteu reagent, and the solution was incubated at room temperature for 5 minutes. Next, 100 μl of sodium carbonate solution (7% V / W) and 70 μl of distilled water were added and incubated for 90 minutes. The microplate reader (VICTOR3, Perkin Elmer, Waltham, Mass., USA) nm absorbance of the solution was measured. The total polyphenol content in the sample was calculated according to the following equation based on catechin milligram equivalent (CE) / calibration curve.

Y = 0.0538x + 0.0136, R < 2 > = 0.9979

1-4. Total flavonoid content measurement

The total flavonoid content in the sample was measured using a slightly modified colorimetric method. 2 μl of a sample at a concentration of 10 mg / ml, 0.1 ml of distilled water and 5 μl of 5% sodium nitrite were added to a 96-well plate and incubated at room temperature for 10 minutes. 10 [mu] l of 10% aluminum chloride was then added and further incubated for an additional 10 min. Next, 40 μl of 1 M sodium hydroxide and 45 μl of distilled water were added and the absorbance was measured at 405 nm using a microplate reader. Catechin was used as a standard index, and the total flavonoid content was expressed as mg equivalent catechin mg / g CE (catechin equivalent) calculated according to the following formula.

Y = 0.0141x + 0.0018, R < 2 > = 0.999.

1-5. Oxygen radical absorbance capacity (ORAC) assay

0.1 M sodium phosphate buffer (pH 7.0), 2 μl of sample and 100 μl of fluorescence of 400 nM were placed in a 96-well black plate, mixed and reacted. After incubation at 37 ° C for 10 minutes, 100 μl of 40 mM 2,2-azobis (2-methylpropionamidine) dihydrochloride (AAPH) was added, and immediately after that, recorded every 5 minutes for 120 minutes using a microplate reader. 12.5 [mu] M trolox was used as the reference material, and ORAC was calculated according to the following formula.

trolox: concentration of trolox

AUC: area under the curve

k: dilution factor

1-6. Alpha-glucosidase inhibition assay (α-Glucosidase inhibition assay)

2 μl of sample and 100 μl of alpha-glucosidase (0.2 Unit / ml) were dissolved in 0.1 M sodium phosphate buffer (pH 7.0), and the mixture was put into a 96-well plate. After measuring the absorbance at 405 nm, 100 μl of p-nitrophenyl-α-D-glucopyranoside (PNPG) was added to the substrate and the absorbance was immediately measured with a microplate reader , And then the values were recorded every 2 minutes for 20 minutes. Alpha-glucosidase inhibitory activity was calculated according to the following formula.

1-7. Cell culture and cell viability assay (MTT assay)

C2C12 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin at 37 ° C and 5% CO ₂ .

On the other hand, cell viability assay was performed by MTT assay. For this, the cells were seeded in 96-well plates and the samples were treated with various concentrations of cells and incubated for 24 hours. Then, 50 μl of MTT solution (5 mg / ml in PBS) was added and incubated for 1 hour at 37 ° C and 5% CO ₂ for 1 hour. After removal of the MTT solution, 200 μl of dimethyl sulfoxide (DMSO) was added to the cells and the absorbance was measured at 570 nm using a microplate reader. Cell viability after measurement was calculated according to the following formula.

1-8. Cell differentiation and 2-NDGB uptake assay (2-NDGB uptake assay)

C2C12 cells were seeded in 96-well black plates to induce differentiation into myoblasts after cells were grown to 90% of the well area. The medium was replaced with a medium for DMEM differentiation containing 2% horse serum and 1% penicillin-streptomycin in a general cell culture medium, followed by culturing for 8 days at 37 ° C under 5% CO _{2. The} medium was renewed every 2 days I replaced it. Thereafter, the serum-free medium was added to starved cells for 12 hours, and then incubated with 2-NBDG, a 20 μM fluorescent glucose analogue, in the presence or absence of 100 nM insulin. After 1 hour, the cells were rinsed with cold PBS and fluorescence was measured with a microplate reader at an absorption wavelength of 485 nm and an emission wavelength of 535 nm.

1-9. OGTT (Oral glucose tolerance test) assay

In the present invention, streptozotocin (hereinafter referred to as STZ), which induces diabetes by destroying pancreatic beta cells that produce insulin to induce diabetes in mice, was used. STZ was dissolved in 50 mM citric acid buffer (pH 4.5) and administered intraperitoneally to mice at a dose of 50 mg / kg once every two days for a total of 3 times. Only mice showing blood glucose level of 300 ㎎ / dL or more after STZ administration were selected and used in this experiment. After oral administration of the drug to each group of mice, all mice were given 2 g / kg of glucose. Blood was collected from the subcutaneous vein of the mice at 0, 30, 60, 90, 120, and 150 minutes after the administration of the drug, respectively.

1-10. RNA extraction and reverse transcription polymerase chain reaction (RT-PCR)

After the oral glucose tolerance test (OGTT) was carried out, the mice were sacrificed after 2 weeks of distilled water (DS), blood extract (SE) and acarbose were administered, and the mice were sacrificed and FavorPrepTM Tri- RNA Reagent (FAVORGEN, USA). Next, cDNA was synthesized using 2 μl of the extracted RNA. For this, 20 μl of the reaction solution was mixed with Oligo dT, e-Taq DNA polymerase (solgent, Korea) and primers specific to each mouse gene, . The respective genes and their primer sequences are shown in Table 1 below.

mRNA Primer Sequence SEQ ID NO: SOD1 Forward TAACTGAAGGCCAGCATGGG One Reverse GCTCCCAGCATTTCCAGTCT 2 GPx-1 Forward CAGTCCACCGTGTATGCCTT 3 Reverse GTAAAGAGCGGGTGAGCCTT 4 NOX-1 Forward GGGGTCAAACAGAGGAGAGC 5 Reverse ATCCTGGGCATTGGTGAGTG 6 HO-1 Forward AGCCCCACCAAGTTCAAACA 7 Reverse TCTCTGCAGGGGCAGTATCT 8 IRS-1 Forward TCCACAGCCTCTTCTTCTGCTT 9 Reverse CAGGTCTCAGCCACACATTCT 10 GLUT-4 Forward CGGCTCTGACGATGGGGAA 11 Reverse GTAGTGAGGGTGCCTTGTGG 12 PI3K Forward ATTGACCTACACCTGGGGGA 13 Reverse TTGAAGAACCCGGAGCAACA 14 GAPDH Forward GGCAAATTCAACGGCACAGT 15 Reverse CTCGTGGTTCACACCCATCA 16

RT-PCR conditions for cDNA synthesis were 30 minutes at 50 ° C, 15 minutes at 95 ° C, denaturation at 95 ° C for 20 seconds, annealing at each temperature for 40 seconds, and The extension was repeated 35 cycles of 1 min at 72 캜 for a final extension of 5 min at 72 캜.

1-11. Statistical analysis

Experiments were performed independently 3 times each, and each experimental data was expressed as the mean ± standard deviation of the results of 3 experiments. Statistical analysis was performed by Student's t test using a Microsoft Excel program. p <0.05 was considered significant.

Example 2. Analysis of antioxidant activity of extracts of blood-forming antibiotics

2-1. Analysis of total polyphenol and flavonoid content in extracts

The antioxidant activity of natural extracts is mainly related to the content of polyphenols and flavonoids in natural extracts. Therefore, the contents of total polyphenols and flavonoids in water extract (SA) and ethanol extract (SE) were measured according to the methods of Examples 1-3 and 1-4.

As a result, as shown in Table 2, it was confirmed that the ethanol extract had a significantly higher content of total polyphenols and flavonoids than water extracts such as blood.

Sample Total phenolic contents Total flavonoid contents Yield (%) mg / g GAE mg / g CE SA 185.65 ± 0.54 185.59 + 0.64 6.17 SE 298.20 ± 1.12 271.30 ± 19.61 10.13

2-2. Analysis of DPPH radical scavenging activity

DPPH radical scavenging activity assay was performed to evaluate the antioxidative ability of extracts such as blood, blood and the like. DPPH (2,2-diphenyl-1-picrylhydrazyl) is a deep purple crystalline powder composed of stable free radical molecules. When radicals combine with antioxidants, the radicals lose their deep purple color and turn bright yellow. Strong antioxidants have strong scavenging activity. As shown in Fig. 1, when 0.1 mM DPPH ethanol solution was reacted with water extract (SA) such as blood or blood, ethanol extract (SE), the extract of ethanol extract (IC ₅₀ = 175.07 ㎍ / (IC ₅₀ = 106.48 ㎍ / ㎖).

2-3. Analysis of Oxygen Radical Absorption Capacity (ORAC)

Oxygen radical absorption capacity analysis is performed by measuring the delay time of fluorescent probe decay when antioxidants are present or absent. Free radicals can break fluorescent probes and change fluorescence intensity accordingly. On the other hand, antioxidants can inhibit these changes by free radicals, and the degree of inhibition is evaluated as antioxidant ability. In this experiment, Trolox was used as a standard material, and the experiment was conducted according to the method of Example 1-5.

As a result, as shown in Figs. 2A and 2B, it was confirmed that the ethanol extract (SE) for blood purification and the like had better antioxidative activity than the water extract (SA) such as blood.

Example 3. Alpha-Glucosidase Activity Analysis of Extracts of Blood Leaching

Based on the results of Example 2 above, the present inventors investigated whether an antidiabetic effect of a blood-brain extract was effective. The early stages of type 2 diabetes are associated with postprandial hyperglycemia induced by rapid postprandial insulin secretory damage. Hyperglycemia increases the production of free radicals and reactive oxygen species (ROS) and results in tissue damage and diabetic complications such as nephropathy, cardiovascular disease, neuropathy, foot ulcers, retinopathy, and Alzheimer's disease . Glucosidase is a type of enzyme that hydrolyzes carbohydrates to simple carbohydrate monosaccharides. Glucosidase inhibitors such as acarbose and miglitol slow down the rate of hydrolysis of these carbohydrates and increase the digestibility of carbohydrates And slows the absorption of carbohydrates from the small intestine. Therefore, this glucosidase inhibitor is a promising substance that can inhibit the onset of type 2 diabetes by lowering the postprandial blood glucose level. In this Example, PNPG was used as a substrate, and the inhibition rate of alpha-glucosidase type I from the backer yeast was measured according to the method of Example 1-6.

As a result, as shown in FIG. 3, alpha-glucosidase inhibition efficiencies of water extract (SA) and ethanol extract (SE) were 70% and 90% at 10 μg / This was statistically significantly different from the negative control group. IC _{50 values} of water extract (SA) and ethanol extract (SE) were 7.18 ㎍ / ㎖ and 4.67 ㎍ / ㎖, respectively, and they showed higher inhibitory activity than the positive control group acarbose at the same concentration Could know.

Example 4. Cytotoxicity and promotion of intracellular glucose uptake in extracts of blood extracts

Assessment of glucose uptake in myotubes or adipose cells is important in diabetes research. Therefore, in this Example, MTT assay was performed to verify whether it exhibited cytotoxicity of water extract (SA) such as blood or blood or ethanol extract (SE) such as blood or blood according to the method of Example 1-7. Further, The glucose uptake ability was directly measured using a glucose analogue 2-NDGB by the method of -8.

First, as shown in FIG. 4, the MTT assay showed that water extracts and ethanol extracts of blood and blood were not toxic to cells at a high concentration of 300 μg / ml.

As a result of the 2-NDGB absorption ability evaluation, as shown in Fig. 5, it was observed that the water extract and the ethanol extract of the blood-drawing and the like promoted the glucose uptake in the C2C12 canaliculus cells. In both of the above extracts, And-NDGB absorption in the case of the present invention.

Example 5. in vivo Of diabetes mellitus by extracts from blood

The bar hayeotneun confirmed that this is a-glucosidase inhibitory promoting activity and intracellular glucose absorption, etc. gyehyeol through the in vivo experiment Extract Example 2 to represent 4-to gyehyeol such extract has antioxidant activity through, alpha in vitro. To examine the antidiabetic effect. For this, oral glucose tolerance test was performed on mice induced by diabetes according to the methods of Examples 1-2 and 1-9.

As a result, as shown in FIG. 6A, blood extracts such as blood and blood were kept at a relatively high level in comparison with STZ + distilled water group (STZ + DW) . On the other hand, as shown in FIG. 6B, in the case of ethanol extracts such as blood, the blood glucose level was lower than that of the STZ + DW group and the control group (Acarbose), and gradually decreased with time Respectively.

From the above in vivo results, it was found that ethanol extracts such as blood and blood showed antidiabetic effects. Therefore, the following experiment was conducted using only ethanol extracts such as blood.

Example 6. Analysis of Expression Change of Diabetes Related Gene by Extract of Glycine

Based on the above results, RNA was extracted from liver of each mouse of Example 5 according to the method of Example 1-10, and mRNA expression levels of various genes related to diabetes were measured. GLUT-4 plays an important role in the regulation of glucose in the body as the most important glucose transporter in skeletal muscle glucose metabolism. In GLUT-4 deficient mice, There is a report that type 2 diabetes is induced. It is known that IRS-1 (insulin receptor substrate-1) is a very important protein in the insulin signaling pathway and that IRS-1 protein expression is decreased in many insulin resistance stages. IRS-1 is a PI3- And are known to be activated.

As a result of the experiment, as shown in FIG. 7 (a), the expression of the genes was decreased when STZ was administered to cause diabetes (STZ) compared to the normal control mice. On the other hand, it was confirmed that when the ethanol extract such as blood was added together with STZ, the genes were expressed at a higher level than the normal control. These results were also confirmed by the quantitative results of FIG. 7B.

The above in vitro and in vivo results indicate that ethanol extracts such as blood-brain extracts have antioxidant and antidiabetic effects.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. There will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Composition of the extract of Spatholobus suberectus for          anti-diabetes <130> MP16-290 <160> 16 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOD1_Forward primer <400> 1 taactgaagg ccagcatggg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SOD1_Reverse primer <400> 2 gctcccagca tttccagtct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPx-1_Forward primer <400> 3 cagtccaccg tgtatgcctt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GPx-1_Reverse primer <400> 4 gtaaagagcg ggtgagcctt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOX-1_Forward primer <400> 5 ggggtcaaac agaggagagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOX-1_Reverse primer <400> 6 atcctgggca ttggtgagtg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HO-1_Forward primer <400> 7 agccccacca agttcaaaca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HO-1_Reverse primer <400> 8 tctctgcagg ggcagtatct 20 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IRS-1_Forward primer <400> 9 tccacagcct cttcttctgc tt 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> IRS-1_Reverse primer <400> 10 caggtctcag ccacacattc t 21 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT-4_Forward primer <400> 11 cggctctgac gatggggaa 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLUT-4_Reverse primer <400> 12 gtagtgaggg tgccttgtgg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PI3K_Forward primer <400> 13 attgacctac acctggggga 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PI3K_Reverse primer <400> 14 ttgaagaacc cggagcaaca 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_Forward primer <400> 15 ggcaaattca acggcacagt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_Reverse primer <400> 16 ctcgtggttc acacccatca 20

Claims (7)

A pharmaceutical composition for the prevention or treatment of type 1 diabetes.
The method according to claim 1,
The extract is characterized by being extracted with a solvent selected from the group consisting of water, C ₁ to C ₄ lower alcohols, ethyl acetate, acetone, butyl acetate, 1,3-butylene glycol, methylene chloride, &Lt; / RTI &gt;
The method according to claim 1,
Wherein the pharmaceutical composition has an antioxidant ability.
The method according to claim 1,
Wherein the pharmaceutical composition is characterized by inhibiting alpha-glucosidase activity.
The method according to claim 1,
Wherein said pharmaceutical composition has an effect of improving blood sugar.
The method according to claim 1,
Wherein said pharmaceutical composition promotes intracellular glucose uptake.
Wherein the composition is an effective ingredient for improving type 1 diabetes mellitus.

Images