KR101788234B1 - Highly replicative and avirulent recombinant influneza virus, and use thereof - Google Patents

Abstract

The present invention relates to a recombinant influenza virus (H1N1 strain) comprising a mutant NS protein of an NS protein of a pathogenic avian influenza virus, a composition for preparing the recombinant influenza virus, a method for producing the recombinant influenza virus, an influenza virus containing the recombinant influenza virus A vaccine, and antisera against the recombinant influenza virus as an active ingredient.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to recombinant influenza viruses,

The present invention relates to a recombinant influenza virus (H1N1 strain) comprising a mutant NS protein of an NS protein of a pathogenic avian influenza virus, a composition for preparing the recombinant influenza virus, a method for producing the recombinant influenza virus, an influenza virus containing the recombinant influenza virus A vaccine, and antisera against the recombinant influenza virus as an active ingredient.

Influenza virus belongs to the genus Omnomyvirus, and has eight single-stranded RNA fragments as negative genomes. From the eight RNA fragments, hemagglutinin (HA), neuraminidase (NA) The nucleoprotein (NP), matrix proteins 1 and 2 (matrix, M1, M2), polymerase A, B1 and B2 (polymerase subunit A, B1 &B2; PA, PB1 and PB2, respectively) Proteins 1 and 2 (nonstructural protein 1 &2; NS1, NS2, respectively) are made.

In the past, the human influenza A vaccine was a unit vaccine that only HA and NA were purified by inactivating the rearranged strain, which is excellent in proliferation of the fetal growth, as formalin, and it is known that the most popular human influenza virus and developmental proliferation A / Puerto Rico / 8/34 (PR8).

In recent years, the use of reverse genetics technology has led to the development of well-known PR8 viruses or A / WSN / 33 (H1N1) viruses, or A / Ann Arbor / 6/60 (H2N2) viruses that have been attenuated by low temperature adaptation Were cloned into a viral genome transcription vector and cloned into a vector expressing the PA, PB1, PB2, and NP coding regions. Twelve plasmids (Patent No. 0908757) were transfected into a cell line such as 293T, To construct a recombinant virus by transfecting eight plasmids (Patent No. 0862758), producing a desired virus or carrying out viral genome transcription in one direction of the vector and producing mRNA in the other direction.

Generally, HA and NA genes are amplified by PCR method from recently popular viruses, cloned into a reverse genetics vector, and transfected with the remaining 6 genes of PR8 to produce a vaccine strain and inactivate the virus to produce a sadox vaccine. PR8 can not be used as a virulence vaccine because of the pathogenicity of the mouse. Therefore, it is possible to use the backbone of the PR8 virus, but when the NS1 gene is deleted and the NS1 gene is not present, 6 genes of A / Ann Arbor / 6/60 (H2N2) viruses that have been adapted at low temperatures and reduced pathogenicity are used (Virology 1998, 252: 324-330; PLoS one 2009,4 (6): e5984) The nucleotide sequence derived from the HA gene is inserted into the PB1 gene of the A / turkey / OH / 313053/04 (H3N2) virus which has been adapted at low temperature (Virology 2003, 306: 18-24; Journal of Virology 2010, 84: 44-51) And then transfected with 6 genes and the HA and NA genes of the most recent viruses to produce attenuated live monocotyledons (Journal of Virology 2011, 85: 456-459).

Although the live monocotyledonous gland can proliferate in vivo and form immunity even when a small number of viruses are inoculated, there is a disadvantage in that the productivity of the vaccine produced in the above manner is significantly lower than that of PR8. Therefore, in the case of the Sadok vaccine, even if the pathogenicity of the mouse remains, the mutation of the internal gene of the PR8 virus or the mutation of the HA and NA amino acids of the vaccine virus may be improved to improve the proliferation in the fetus (Vaccine 2010, 28: 8008-8014 ; Vaccine 2011, 29: 5153-5162; Vaccine 2011, 29: 8032-8041), and virus production technology was reduced to reduce fetal pathogenicity (Archives of Virology 2011, 156: 557-563).

Pathogenicity of influenza viruses has been associated with a number of genes, and various pathogenic amino acid mutations have been reported in HA, NA, PA, PB1, PB2, NP and NS. NS1, which is specifically encoded from NS protein coding polynucleotides, is known to play an important role in inhibiting the innate immunity of host cells, but its functions vary.

NS1 inhibits IFN-β transcription, inhibits the antiviral action of double-stranded RNA-activated protein kinase (PKR), 2'-5 'oligoadenylate synthetase (OAS) / RNase L, Inhibit the migration of nuclei to the cytoplasm while enhancing viral mRNA translation and inhibit apoptosis of host cells (Journal of General Virology 2008, 89: 2359-2376). NS1 is an RNA-binding domain consisting of amino acids 1 to 73, an effector domain consisting of amino acids 79 to 207, PDZ-ligand (PL) motifs binding to various host cell PDZ domains 230 amino acid) (Science 2006 311: 1576-1580).

On the other hand, KBNP-0028 (KCTC 10866BP, hereinafter referred to as "0028") is a safe vaccine mainly because it does not have a fetal pathogenicity due to high productivity and low pathogenic H9N2 subtype avian influenza virus (AIV), has high productivity and has no mutation related to pathogenicity to mammals It is a registered patent (Patent No. 0708593).

It is known that the recombinant virus (rPR-NS (0028)) with the remaining 7 genome fragments of the PR8 virus has low pathogenicity in mice, high immunogenicity and proliferation in the developmental bacterium. And the variation of the amino acid associated with these properties is specified (Patent No. 10-1426407).

In particular, the rPR8-NS (0028) -EPEV recombinant virus, in which the PL-motif of the NS1 PL-motif is replaced with the EPEV, is known to increase the proliferative activity, but the mammalian pathogenicity remains and the SNU9037 virus originating from the H9N2 subtype AIV In the case of rPR8-NS (9037) recombinant virus prepared by the NS genome fragment and the remaining 7 genome fragments of PR8 virus, it is known that the developmental productivity of PR8 virus is significantly higher than that of PR8 virus (Patent No. 10-1414225) It is pathogenic.

That is, A / Puerto Rico / 8/34 (H1N1) virus (hereinafter referred to as "PR8 virus; NC_002016 to NC_002023 gene") is widely used as a vaccine strain of H1N1 strain of avian influenza virus and has good immunogenicity and proliferation Although there is a problem of poor safety, there is no other developed vaccine, and it is used despite the potential virulence. In order to eliminate the remaining pathogenicity, a reverse genetics vector for the recombinant virus production using the NS8 genome of the PR8 virus was developed, but the proliferation was equal to or less than that of the PR8 virus and the PL motif of the NS1 gene was changed from the GSEV to the EPEV , The proliferation is increased, but the virulence of mouse vaccination is significantly lower than that of PR8, but it is still pathogenic because it causes temporary weight loss.

Therefore, there is a need for a technique for improving the proliferative activity of a developing animal without the mammalian pathogenicity which can be useful for the development of an influenza vaccine.

Therefore, the present inventors mutated the 0028 NS protein coding nucleotide to produce a recombinant virus which is superior to rPR8-NS (0028) and has no mouse pathogenicity than rPR8-NS (0028) -EPEV, The genome fragment of 0028NS-Q220R NS, in which glutamine (Q) was substituted with arginine (R) and arginine (R) of 63 of NS2 (NEP) protein was replaced with glutamic acid (E), and the remaining 7 genome fragments of PR8 (0028) -Q220R recombinant virus was prepared by mixing the recombinant viruses of the present invention with each other to produce a recombinant virus of rPR8-NS (0028) -Q220R, which was superior to rPR8-NS (0028)

Accordingly, an object of the present invention is to provide a mutated non-tropic protein (NS) -coding polynucleotide of a pathogenic avian influenza virus; And Polymerase B1 (PB1) coding polynucleotides, polymerase B2 (PB2) coding polynucleotides, polymerase A (PA) coding polynucleotides, nucleocapsid (NP) coding polynucleotides, matrix proteins (H1N1 strain) and avian influenza virus (H1N1) avian influenza virus comprising a polynucleotide encoding a polynucleotide, a polynucleotide encoding a polynucleotide, a polynucleotide encoding a polynucleotide, a polynucleotide encoding a polynucleotide, a polynucleotide encoding a polynucleotide, a polynucleotide encoding a polynucleotide, a polynucleotide encoding a nucleotide polymorphism,

Another object of the present invention is to provide a mutant non-vegetative crude protein (NS) of an avian pathogenic avian influenza virus; And H1N1 strain of avian influenza virus polymerase B1 (PB1), polymerase B2 (PB2), polymerase A (PA), nucleocapsid (NP), matrix protein (M), hemagglutinin protein (HA) A recombinant H1N1 strain of avian influenza virus comprising neuraminidase (NA).

Yet another object of the present invention is to provide a recombinant vector comprising a variant non-tropic protein (NS) -coding polynucleotide of a pathogenic avian influenza virus; A recombinant vector comprising the Polymerase B1 (PB1) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising the Polymerase B2 (PB2) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising the Polymerase A (PA) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising a nucleocapsid (NP) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising a matrix protein (M) coding polynucleotide of H1N1 strain avian influenza virus; A recombinant vector comprising a hemagglutinin protein (HA) coding polynucleotide of H1N1 strain avian influenza virus; And a recombinant vector comprising a neuraminidase (NA) coding polynucleotide of the H1N1 strain of avian influenza virus.

Yet another object of the present invention is to provide a cell transformed with the above-mentioned transforming composition.

It is still another object of the present invention to provide a bird influenza virus vaccine containing the recombinant H1N1 strain avian influenza virus as an active ingredient.

It is still another object of the present invention to provide a composition for avian influenza virus diagnosis comprising the recombinant H1N1 strain of avian influenza virus as an active ingredient.

Yet another object of the present invention is to provide a method for producing recombinant H1N1 strain of avian influenza virus, comprising contacting said composition with a cell.

The present inventors mutated the 0028 NS protein coding nucleotide to produce a recombinant virus which is superior to rPR8-NS (0028) and has no mouse pathogenicity than rPR8-NS (0028) -EPEV, The 0028NS-Q220R NS genome fragment was constructed in which glutamine (Q) was substituted with arginine (R), arginine (R) of 63 of NS2 (NEP) protein was replaced with glutamic acid (E), and the remaining 7 genome fragments of PR8 virus (0028) -Q220R recombinant virus was prepared by mixing the recombinant viruses of the present invention with each other to produce a recombinant virus of rPR8-NS (0028) -Q220R, which was superior to rPR8-NS (0028)

Hereinafter, the present invention will be described in more detail

An example of the present invention is a mutant non-tropic protein (NS) -coding polynucleotide of low pathogenic avian influenza; And Polymerase B1 (PB1) coding polynucleotides, polymerase B2 (PB2) coding polynucleotides, polymerase A (PA) coding polynucleotides, nucleocapsid (NP) coding polynucleotides, matrix proteins (H1N1 strain) and avian influenza virus M) coding polynucleotide, a hemagglutinating protein (HA) -coding polynucleotide and a neuraminidase (NA) -coding polynucleotide. The present invention also relates to a composition for the production of avian influenza virus strain H1N1.

The mutant non-tropic protein (NS) of the pathogenic avian influenza virus is a modified NS1 protein or a modified NS2 protein. In addition, the mutated non-engrafting protein-encoding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 6. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The modified NS1 protein may include an amino acid sequence in which the amino acid at position 220 of the wild-type NS1 protein (SEQ ID NO: 1) is substituted with arginine, for example, the amino acid sequence of SEQ ID NO: 3.

The modified NS2 protein may include an amino acid sequence in which the amino acid at position 63 of the wild-type NS2 protein (SEQ ID NO: 2) is replaced with glutamic acid, for example, the amino acid sequence of SEQ ID NO: 4.

The non-tropic protein (NS) is used generically to refer to the NS1 protein and the NS2 (NEP) protein, which are generated by splicing different from non-tropic protein (NS) -coding polynucleotides. For example, by splicing differentially from an unglycosylated (NS) gene comprising the nucleotide sequence of SEQ ID NO: 5 in the H1N1 strain of avian influenza virus, specifically the genome of the PR8 virus (NC_002016 to NC_002023 genes) A wild type NS1 protein comprising the amino acid sequence of SEQ ID NO: 1 or a wild type NS2 (NEP) protein comprising the amino acid sequence of SEQ ID NO: 2.

Likewise, the mutant non-vegetative crude protein (NS) comprises a mutant NS1 protein comprising the amino acid sequence of SEQ ID NO: 3 or a sequence having the sequence of SEQ ID NO: 3, by different splicing from the mutant non- Producing a mutant NS2 (NEP) protein comprising the amino acid sequence of SEQ ID NO: 4.

Namely, the modified NS1 protein is encoded from polynucleotides (the last three being end codons) comprising the 27th base to the 719th base in the nucleotide sequence of SEQ ID NO: 6, and the 27th base in the nucleotide sequence of SEQ ID NO: (NEP) protein linked to a protein encoded by polynucleotides ranging from the polynucleotide up to the 56th base and polynucleotides containing the 529th base to the 864th base (the last three being end codons). The modified NS1 protein is, for example, a protein comprising the amino acid sequence of SEQ ID NO: 3, and the modified NS2 protein is, for example, a protein comprising the amino acid sequence of SEQ ID NO:

The polymerase B1 (PB1) may contain the amino acid sequence of SEQ ID NO: 7. In addition, the Polymerase B1 (PB1) -coding polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 14. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The polymerase B2 (PB2) may contain the amino acid sequence of SEQ ID NO: 8. The polymerase B2 (PB2) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 15. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The polymerase A (PA) may comprise the amino acid sequence of SEQ ID NO: 9. In addition, the polymerase A (PA) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 16. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The nucleocapsid (NP) may comprise the amino acid sequence of SEQ ID NO: 10. Also, the nucleocapsid (NP) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 17. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The matrix protein (M) may comprise the amino acid sequence of SEQ ID NO: 11. In addition, the matrix protein (M) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 18. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The hemagglutinin protein (HA) may comprise the amino acid sequence of SEQ ID NO: 12. In addition, the hemagglutinating protein (HA) -coding polynucleotide may be a nucleotide sequence encoding a peptide containing the protein, for example, a nucleotide sequence of SEQ ID NO: 19. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The neuraminidase (NA) may comprise the amino acid sequence of SEQ ID NO: 13. In addition, the neuraminidase (NA) protein coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 20. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The substantial identity is determined by aligning each nucleotide sequence with any other nucleotide sequence to the greatest extent possible and analyzing the sequence to determine whether any of the other nucleotide sequences is at least 70%, at least 90% % Or more of sequence homology.

The H1N1 strain of avian influenza virus may be A / Puerto Rico / 8/34 (H1N1) virus (hereinafter referred to as "PR8 virus", NC_002016 to NC_002023 gene) and is widely used for vaccine production of H1N1 strain avian influenza virus .

The above pathogenous avian influenza virus is AIN / chicken / Korea / KBNP-0028/2000 (H9N2) (registered patent No. 0708593, hereinafter referred to as KBNP-0028) which is a domestic pathogenic avian influenza virus and the KBNP- (KCTC 10866BP), which was deposited on October 26, 2005 in the gene bank located in Eun-dong, Yuseong-gu, Daejeon, Republic of Korea, which is a low-pathogenic isolate as in Example 1 of Patent No. 0708593.

Another example of the present invention is a mutant non-avirulent protein (NS) of an avian pathogenic avian influenza virus; And H1N1 strain of avian influenza virus polymerase B1 (PB1), polymerase B2 (PB2), polymerase A (PA), nucleocapsid (NP), matrix protein (M), hemagglutinin protein (HA) The present invention relates to recombinant H1N1 strain avian influenza viruses, including neuraminidase (NA).

The mutant non-tropic protein (NS) of the pathogenic avian influenza virus is a modified NS1 protein or a modified NS2 protein. In addition, the mutated non-engrafting protein-encoding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 6. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The modified NS1 protein may include an amino acid sequence in which the amino acid at position 220 of the wild-type NS1 protein (SEQ ID NO: 1) is substituted with arginine, for example, the amino acid sequence of SEQ ID NO: 3.

The modified NS2 protein may include an amino acid sequence in which the amino acid at position 63 of the wild-type NS2 protein (SEQ ID NO: 2) is replaced with glutamic acid, for example, the amino acid sequence of SEQ ID NO: 4.

The non-tropic protein (NS) is used generically to refer to the NS1 protein and the NS2 (NEP) protein, which are generated by splicing different from non-tropic protein (NS) -coding polynucleotides. For example, by splicing differentially from an unglycosylated (NS) gene comprising the nucleotide sequence of SEQ ID NO: 5 in the H1N1 strain of avian influenza virus, specifically the genome of the PR8 virus (NC_002016 to NC_002023 genes) A wild type NS1 protein comprising the amino acid sequence of SEQ ID NO: 1 or a wild type NS2 (NEP) protein comprising the amino acid sequence of SEQ ID NO: 2.

Likewise, the mutant non-vegetative crude protein (NS) comprises a mutant NS1 protein comprising the amino acid sequence of SEQ ID NO: 3 or a sequence having the sequence of SEQ ID NO: 3, by different splicing from the mutant non- Producing a mutant NS2 (NEP) protein comprising the amino acid sequence of SEQ ID NO: 4.

Namely, the modified NS1 protein is encoded from polynucleotides (the last three being end codons) comprising the 27th base to the 719th base in the nucleotide sequence of SEQ ID NO: 6, and the 27th base in the nucleotide sequence of SEQ ID NO: (NEP) protein linked to a protein encoded by polynucleotides ranging from the polynucleotide up to the 56th base and polynucleotides containing the 529th base to the 864th base (the last three being end codons). The modified NS1 protein is, for example, a protein comprising the amino acid sequence of SEQ ID NO: 3, and the modified NS2 protein is, for example, a protein comprising the amino acid sequence of SEQ ID NO:

In the case of the recombinant virus containing the above variant type non-vegetable protein, it has excellent proliferative activity and low mouse pathogenicity.

The polymerase B1 (PB1) may contain the amino acid sequence of SEQ ID NO: 7. In addition, the Polymerase B1 (PB1) -coding polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 14. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The polymerase B2 (PB2) may contain the amino acid sequence of SEQ ID NO: 8. The polymerase B2 (PB2) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 15. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The polymerase A (PA) may comprise the amino acid sequence of SEQ ID NO: 9. In addition, the polymerase A (PA) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 16. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The nucleocapsid (NP) may comprise the amino acid sequence of SEQ ID NO: 10. Also, the nucleocapsid (NP) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 17. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The matrix protein (M) may comprise the amino acid sequence of SEQ ID NO: 11. In addition, the matrix protein (M) -coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 18. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The hemagglutinin protein (HA) may comprise the amino acid sequence of SEQ ID NO: 12. In addition, the hemagglutinating protein (HA) -coding polynucleotide may be a nucleotide sequence encoding a peptide containing the protein, for example, a nucleotide sequence of SEQ ID NO: 19. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The neuraminidase (NA) may comprise the amino acid sequence of SEQ ID NO: 13. In addition, the neuraminidase (NA) protein coding polynucleotide may be a nucleotide sequence encoding a peptide comprising the protein, for example, a nucleotide sequence of SEQ ID NO: 20. Or a nucleotide sequence having substantial identity to the nucleotide sequence.

The substantial identity is determined by aligning each nucleotide sequence with any other nucleotide sequence to the greatest extent possible and analyzing the sequence to determine whether any of the other nucleotide sequences is at least 70%, at least 90% % Or more of sequence homology.

The H1N1 strain avian influenza virus and the less virulent avian influenza virus are the same as described above.

The recombinant H1N1 strain of avian influenza virus was deposited with the Genetic Resources Center, Biotechnology Research Center, Daejeon, on Dec. 15, 2014, and received the deposit number KCTC12732BP.

Therefore, the recombinant H1N1 strain of avian influenza virus is excellent for the development of influenza virus vaccine, which is excellent in proliferative activity, mouse pathogenicity, and safe and effective. Especially, it can be used not only as a sadox vaccine but also as a virulent vaccine.

Another example of the present invention is a recombinant vector comprising a variant non-tropic protein (NS) -coding polynucleotide of a pathogenic avian influenza virus; A recombinant vector comprising the Polymerase B1 (PB1) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising the Polymerase B2 (PB2) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising the Polymerase A (PA) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising a nucleocapsid (NP) coding polynucleotide of the H1N1 strain of avian influenza virus; A recombinant vector comprising a matrix protein (M) coding polynucleotide of H1N1 strain avian influenza virus; A recombinant vector comprising a hemagglutinin protein (HA) coding polynucleotide of H1N1 strain avian influenza virus; And a recombinant vector comprising a neuraminidase (NA) coding polynucleotide of the H1N1 strain of avian influenza virus.

The respective protein coding polynucleotides may be contained in a total of eight vectors contained in each vector, or may be one in which two or more protein coding polynucleotides are contained in one vector. For example, It is also possible that the above eight kinds of protein coding polynucleotides are all contained in one vector.

The term "vector" means means for expressing a gene of interest in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors and adeno-associated viral vectors. The vector that can be used as the recombinant vector may be a plasmid (for example, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series and pUC19, etc.), phage (e.g.,? gt4? B,? -Charon,? z1 and M13) or viruses It is not limited.

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be any conventional vector used in the art to express an exogenous protein in plants, animals or microorganisms. The recombinant vector may be constructed by a variety of methods known in the art.

The recombinant vector may be constructed with prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector and the prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (for example, pL? Promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), a ribosome binding site for initiation of translation and a transcription / translation termination sequence. When a eukaryotic cell is used as a host, the origin of replication that functions in eukaryotic cells contained in the vector includes f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, and BBV replication origin But is not limited thereto. Also, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus promoter and the tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

In addition, the present invention is not limited to the PR8 virus-based reverse genetics vector system, because the reverse genetics vector system for production of recombinant influenza virus, which is excellent in proliferation in the developmental field and has no mouse pathogenicity, Influenza reverse genetics vector system.

Another example of the present invention relates to a cell transformed with the above-mentioned transforming composition.

The cell may be one or more selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells, but is not limited thereto, and any cell capable of producing a recombinant virus can be used.

Another example of the present invention relates to avian influenza virus vaccine containing the recombinant H1N1 strain avian influenza virus as an active ingredient.

The vaccine is not only excellent in immunogenicity but also has no pathogenicity against mammals including birds and birds.

The vaccine is applicable not only to birds such as chickens and ducks but also to mammals including humans, pigs, dogs, mice, horses, cats, sheep, sheep, goats, camels and the like.

Another example of the present invention relates to a composition for avian influenza virus diagnosis comprising the recombinant H1N1 strain avian influenza virus antisera as an active ingredient.

The antiserum may be obtained from algae or mammals, but is not limited thereto. In addition, the subject to be diagnosed may be algae or mammals, for example, mammals other than humans.

Another example of the present invention relates to a method for producing recombinant H1N1 strain avian influenza virus comprising contacting said composition with a cell.

The method may further comprise isolating the recombinant H1N1 strain of avian influenza virus produced.

The present invention relates to a recombinant influenza virus (H1N1 strain) comprising a mutant NS protein of an NS protein of a pathogenic avian influenza virus, a composition for preparing the recombinant influenza virus, a method for producing the recombinant influenza virus, an influenza virus containing the recombinant influenza virus And a recombinant influenza virus as an active ingredient. The recombinant influenza virus is useful for the development of a virulent vaccine as well as a sadoc vaccine since it has high embryogenesis and no pathogenicity to birds and mammals. Lt; / RTI >

And 1 is measured rPR8, rPR8-NS (0028) and rPR8-NS (0028) weight each day after -Q220R Recombinant Virus 10 ⁶ EID50 BALB / C mice inoculated with in accordance with one embodiment of the invention showing the weight change will be.
2 is then inoculated rPR8, rPR8-NS (0028) -EPEV and rPR8-NS (9037) 10 ⁶ EID50 recombinant virus according to an embodiment of the present invention, BALB / C mice by measuring body weight daily showing the weight change will be.
FIG. 3 illustrates a cleavage map of an expression vector for producing a modified NS protein according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Comparative Example 1. Preparation of virus containing wild-type NS protein

A recombinant virus having a wild-type NS protein-coding polynucleotide derived from a pathogenic avian influenza virus was prepared.

Specifically, pHW191-PB2, pHW192-PB1, pHW193-PA, pHW194-HA, pHW195-NP, pHW196-NA, pHW197-M corresponding to the whole cDNA of PR8 (A / Puerto Rico / 8 / , And plasmid for pHW198-NS reverse genetics (Vaccine 2002, 20: 3165-3170). And Dr. Webster from Jude Children's Research Hospital.

Then, 293T cells (Life Resource Center, KCTC) were suspended in a 6-well cell culture vessel in MEM (GIBCO BRL) medium containing 5% (v / v) FBS in an amount of 2 × 10 ⁶ / And then adhering for 3 to 4 hours. Then, the medium was removed and 2 ml of Opti-MEM medium (Invitrogen Co. USA) was added.

Then, each of the 8 plasmids prepared above was added to a 1.5 ml tube so that the amount of each plasmid was 300 ng. Opti-MEM medium was added to a final volume of 25 μl, and PLUS reagent (Invitrogen Co USA) and 69 μl of Opti-MEM medium were mixed and added to a 1.5 ml tube containing plasmid, followed by reaction at room temperature for 15 minutes. During the waiting period, 96 μl of lipofectamine (Invitrogen Co) and Opti-MEM were mixed and reacted for 15 minutes. 100 μl of the mixture was added to the plasmid-containing tube, followed by further reaction for 15 minutes.

The obtained reaction product was added to each well containing the 293T cells in an amount of 100 ul. After culturing the 6-well culture vessel for 20 hours at 5% CO ₂ and 37 ° C, 10 ug of trypsin per well (2.5 ug / 4ul) was added and the supernatant was harvested after 24 hours. ., NY) was inoculated with 200 ul of the above-harvested stock solution as a urinary catheter pathway. The inoculated cells were incubated for 3 days at 37 ° C., and the umbilical fluid was harvested to measure hemagglutination when the hemagglutination occurred. The RNA was extracted from the virus grown in the same manner by the same method, After confirming that the PR8 virus (including NC_002016 to NC_002023) was properly manufactured, it was stored at -70. The strain thus constructed was used as PR8 virus in the following experiment.

20 μl of the above-described urokinase solution and 20 μl of 0.1% (w / v) chicken erythrocytes extracted from the chicken hatching the SPF developmental cells (Sunrise Co., NY) inoculated with each of the above samples were spotted on a glass plate and mixed with plate hemagglutination The positive samples were stored at -70 and used for the experiments.

In addition, rPR8-NS (0028) -EPEV (= rPR8-KBNP-0028 (NS-EPEV)), rPR8-NS (0028) 10-1426407) and rPR8-NS (9037) (Patent No. 1414225). The recombinant viruses were cultured in the same manner as in the above-mentioned method and stored in -70 for the experiment.

Example 1. Production of recombinant virus containing modified NS protein

Hoffmann's reverse genetics vector system (Patent No. 0862758) was used for the production of recombinant viruses containing the modified NS protein.

Specifically, primers (SEQ ID NOS: 21 and 22) were prepared to substitute glutamine at position 220 of NS1 protein of virus with arginine while simultaneously substituting glutamic acid at position 63 of arginine at NS2 (NEP). The base sequence of the fryer is shown in Table 1 below.

SEQ ID NO: denomination Sequence listing (5 '-> 3') 21 0028-Q220R-F AATGGCGAGAACAATTGGGTC 22 0028-Q220R-R TTTCGTTTCTGCTTTGGAGG

Then, the plasmid extracted from the clone selected by cloning the gene (SEQ ID NO: 5) coding for the NS protein of the virus of Patent No. 10-1426407 in pHW2000 was subjected to site-directed mutagenesis using the above primers to obtain 0028NS-Q220R Plasmid (including modified NS protein coding polynucleotide) was prepared.

Then, a recombinant virus having the plasmid for reverse genetics and the 0028NS-Q220R plasmid of pHW191-PB2, pHW192-PB1, pHW193-PA, pHW194-HA, pHW195-NP, pHW196-NA and pHW197- 293T cells (Life Resource Center, KCTC) were suspended in 6-well cell culture dishes in MEM (GIBCO BRL) medium containing 5% (v / v) FBS in an amount of 2 × 10 ⁶ cells / Well and allowed to adhere for 3 to 4 hours, after which the medium was removed and 2 ml of Opti-MEM medium (Invitrogen Co. USA) was added.

Next, all of the 8 plasmids prepared above were put into one 1.5 ml tube in an amount of 300 ng each, and Opti-MEM medium was added to a final volume of 25 ul. To the other 1.5 ml tube was added PLUS reagent (Invitrogen Co.). USA) and 69 μl of Opti-MEM medium. The mixture was added to a 1.5 ml tube containing the plasmid, followed by reaction at room temperature for 15 minutes.

Then, lipofectamine 4ul (Invitrogen Co) and Opti-MEM 96ul were mixed and reacted for 15 minutes. Then, 100ul was added to the plasmid-containing tube, followed by additional reaction for 15 minutes. The obtained reaction product was added to each well containing the 293T cells in an amount of 100 ul. After culturing the 6-well culture vessel with 5% CO ₂ at 37 for 20 hours, 10 ug of trypsin per well (2.5 ug / 4 ul) was added and after 24 hours, the supernatant was obtained. , NY) was inoculated with 200 ul of the above-harvested stock solution as a urinary catheter pathway.

After incubation for 37 days at 37 ° C, the membrane fluid was harvested and the hemocyte aggregation activity was measured. When the hemocyte aggregation occurred, the hemocyte agglutination titers were measured and diluted 100 times to proliferate in the same manner.

Example 2. Nucleotide Sequence Determination and Analysis

RNA was extracted from the prepared recombinant virus to determine the nucleotide sequence of the NS gene to confirm that the virus was properly constructed.

First, the genomic RNA of rPR8-NS (0028) -Q220R virus was extracted from the intestinal membrane fluid using an acid-guanidinium-phenol method (Chomzinski and Sacci, 1985). Specifically, for the RNA isolation, 1 ml of easyBlue (iNtRON Co. Ltd., Seoul, Korea) was added to 100 μl of the culture solution obtained in Example 1-2 and the RNA was isolated according to the method provided by the manufacturer , And dissolved in 10 ul of sterilized tertiary distilled water treated with DEPC (diethyl-pyrocarbonate; Sigma Chemical Co, St. Louis, MO, USA).

Then, 1 μl of 1st strand buffer (iNtRON Co.), 1 μl of 0.1M DTT (iNtRON Co.), 1 μl of 2.5 mM dNTP (iNtRON Co.), 1 μl of random hexamer (50 ng / μl) And 10 ul of the RNA solution were mixed, heated at 70 for 15 minutes, and quenched on ice. Then, after standing at room temperature for 10 minutes, 1 ul of reverse transcriptase (iNtRON Co.) was added, reacted at 42 for 1 hour, and then the reverse transcriptase was inactivated at 95 for 5 minutes.

Then, 1 μl of 10 × PCR buffer (iNtRON Co.), 0.2 μl of 2.5 mM dNTP (iNtRON Co.), 5 pmol of primer (Bm-NS-1; Bm-NS-890R primer; Hoffmann et al., Archives Virol, 2001) (Perkin-Elmer Co, Foster City, CA, USA), 0.2ul each of Taq polymerase (iNtRON Co .; 1 U / ul), 7.2ul of sterilized distilled water and 1ul of the above- , Denaturation at 94 for 4 minutes, followed by 35 cycles of 94 to 20 seconds, 52 to 15 seconds, and 72 to 2 minutes, followed by reaction at 72 for 7 minutes to perform PCR (PCR) The obtained amplification product was subjected to electrophoresis on 1.0% by weight agarose gel, stained with ethidium bromide and observed.

Next, the NS protein coding polynucleotide sequence of rPR8-NS (0028) -Q220R virus was amplified using an automatic DNA analyzer (ABI Prism 3700, Applied Biosystems Co.) and a dye terminator kit (Perkin Elmer, Foster, CA). Subsequently, the nucleotide sequence was translated into the NS1 and NS2 amino acid sequences using the Bioedit program and the mutations of amino acid No. 220 of NS1 and amino acid No. 63 of NS2 (NEP) were confirmed.

As a result, rPR8-NS (0028) -Q220R (the NS protein coding polynucleotide of PR8 virus was mutated into nucleotide 220 of glutamine of NS1 protein and mutant NS gene of 0028 which was simultaneously substituted with arginine 63 of arginine of NS2 (NEP) , And the recombinant virus was stored at -70 and used in the following experiment.

Example 3. Measurement of virus proliferation potency

To measure the proliferative activity of the recombinant viruses in the fetus (50% embryo infection dose, EID 50 / ml), each recombinant virus was decanted to 10 ^-1 to 10 ^-9 with phosphate buffer solution, And 100ul of the umbilical cord were inoculated into five SPF developmental bouts of 10 to 11 days of age. After incubation for 3 days, the urothelial fluid was harvested, and the cell viability was confirmed by red blood cells of the chicken, and the virus titer (EID ₅₀ / ml) was measured according to the Reed-Muench equation. The results are shown in Table 2 below.

virus Activity (EID ₅₀ / ml (log 10)) rPR8 9.0 ± 0.4 rPR8-NS (0028) 9.0 ± 0.4 rPR8-NS (0028) -EPEV 9.4 ± 0.2 rPR8-NS (0028) -Q220R 9.6 ± 0.2

As shown in Table 2, virus titer _{(EID 50 / ml (log10)} ) to look at, in the case of PR8 ^9.0 10, for the ^{rPR8-NS (0028) 10 9.0} , rPR8-NS (0028) for 10 -EPEV ^9.4, rPR8-NS (0028) for -Q220R 10 ^9. confirmed to ⁶ show the EID ₅₀ / ml. That is, it was confirmed that the rPR8-NS (0028) -Q220R of the example exhibited higher fetal growth than rPR8, rPR8-NS (0028) and rPR8-NS (0028) -EPEV as comparative examples.

Example 4. Pathogenicity measurement of recombinant virus

Each of the recombinant viruses, each decimal dilution sol retil (Virbac SA, France), a BALB / C mice anesthetized with 15mg / kg (6 week-old female, Ltd. Core Tech) nasal 5 can in PBS 10 ⁶ EID ₅₀ . Thereafter, the presence or absence of the dead body was examined daily, the body weight change was measured in FIG. 1 and FIG. 2, and when the body weight was reduced by 30%, it was considered dead.

As can be seen in FIG. 2, the mortality rate is 100% for rPR8 and rPR8-NS (9037), and rPR8-NS (0028), rPR8-NS (0028) The mortality rate was 0% in EPEV, rPR8-NS (0028) -Q220R and control (inoculation with phosphate buffer solution instead of virus), and the decrease in body weight was observed in mice inoculated with rPR8-NS (0028) and rPR8-NS (0028) -Q220R , But it was confirmed that there was a significant decrease in body weight (marked with an indicator; P <0.05) on the 7th and 8th days of inoculation in rPR8-NS (0028) -EPEV inoculated mice compared to the control. That is, rPR8-NS (0028) -EPEV showed good proliferation but decreased body weight, but rPR8-NS (0028) -Q220R showed no weight loss and good proliferation.

Korea Biotechnology Research Institute KCTC12732BP 20141215

<110> Seoul National University R & DB Foundation <120> HIGHLY REPLICATIVE AND AVIRULENT RECOMBINANT INFLUNEZA VIRUS, AND          USE THEREOF <130> DPP20156132KR <150> KR 10-2014-0181875 <151> 2014-12-16 <160> 22 <170> Kopatentin 2.0 <210> 1 <211> 230 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of 0028 NS1 (w) <400> 1 Met Asp Ser Asn Thr Val Ser Ser Phe Gln Val Asp Cys Phe Leu Trp   1 5 10 15 His Val Arg Lys Arg Phe Ala Asp Gln Glu Leu Gly Asp Ala Pro Phe              20 25 30 Leu Asp Arg Leu Arg Arg Asp Gln Lys Ser Leu Arg Gly Arg Gly Ser          35 40 45 Thr Leu Gly Leu Asp Ile Glu Thr Ala Thr Arg Gly Gly Lys Gln Ile      50 55 60 Val Glu Arg Ile Leu Phe Lys Glu Ser Asp Glu Ala Leu Lys Met Thr  65 70 75 80 Val Ala Ser Val Ala Thr Arg Tyr Leu Thr Asp Met Thr Leu Glu                  85 90 95 Glu Met Ser Arg Asp Trp Phe Met Leu Met Pro Lys Gln Lys Val Ala             100 105 110 Gly Ser Leu Cys Ile Lys Ile Asp Gln Ala Ile Met Asp Lys Thr Ile         115 120 125 Thr Leu Lys Ala Asn Phe Ser Val Thr Phe Gly Arg Leu Glu Thr Leu     130 135 140 Ile Leu Leu Arg Ala Phe Ser Glu Glu Gly Ala Ile Val Gly Glu Ile 145 150 155 160 Ser Pro Leu Pro Ser Leu Pro Gly His Thr Asp Glu Asp Val Lys Asn                 165 170 175 Ala Ile Gly Val Leu Ile Gly Gly Leu Glu Trp Asn Asn Asn Thr Val             180 185 190 Arg Val Ser Glu Thr Leu Gln Arg Phe Ala Trp Arg Ser Ser Asp Glu         195 200 205 Asn Gly Arg Pro Pro Leu Pro Pro Lys Gln Lys Gln Lys Met Ala Arg     210 215 220 Thr Ile Gly Ser Glu Val 225 230 <210> 2 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of 0028 NS2 (w) <400> 2 Met Asp Ser Asn Thr Val Ser Ser Phe Gln Asp Ile Leu Met Arg Met   1 5 10 15 Ser Lys Met Gln Leu Gly Ser Ser Ser Glu Asp Leu Asn Gly Ile Ile              20 25 30 Thr Gln Phe Glu Ser Leu Lys Leu Tyr Arg Asp Ser Leu Gly Glu Ala          35 40 45 Val Met Arg Met Gly Asp Leu His Ser Leu Gln Ser Arg Asn Arg Lys      50 55 60 Trp Arg Glu Gln Leu Gly Gln Lys Phe Glu Glu Ile Arg Trp Leu Ile  65 70 75 80 Glu Glu Val Arg His Arg Leu Lys Ile Thr Glu Asn Ser Phe Glu Gln                  85 90 95 Ile Thr Phe Met Gln Ala Leu Gln Leu Leu Leu             100 105 110 Ile Arg Thr Phe Ser Phe Gln Leu         115 120 <210> 3 <211> 230 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of 0028 NS1 (m) <400> 3 Met Asp Ser Asn Thr Val Ser Ser Phe Gln Val Asp Cys Phe Leu Trp   1 5 10 15 His Val Arg Lys Arg Phe Ala Asp Gln Glu Leu Gly Asp Ala Pro Phe              20 25 30 Leu Asp Arg Leu Arg Arg Asp Gln Lys Ser Leu Arg Gly Arg Gly Ser          35 40 45 Thr Leu Gly Leu Asp Ile Glu Thr Ala Thr Arg Gly Gly Lys Gln Ile      50 55 60 Val Glu Arg Ile Leu Phe Lys Glu Ser Asp Glu Ala Leu Lys Met Thr  65 70 75 80 Val Ala Ser Val Ala Thr Arg Tyr Leu Thr Asp Met Thr Leu Glu                  85 90 95 Glu Met Ser Arg Asp Trp Phe Met Leu Met Pro Lys Gln Lys Val Ala             100 105 110 Gly Ser Leu Cys Ile Lys Ile Asp Gln Ala Ile Met Asp Lys Thr Ile         115 120 125 Thr Leu Lys Ala Asn Phe Ser Val Thr Phe Gly Arg Leu Glu Thr Leu     130 135 140 Ile Leu Leu Arg Ala Phe Ser Glu Glu Gly Ala Ile Val Gly Glu Ile 145 150 155 160 Ser Pro Leu Pro Ser Leu Pro Gly His Thr Asp Glu Asp Val Lys Asn                 165 170 175 Ala Ile Gly Val Leu Ile Gly Gly Leu Glu Trp Asn Asn Asn Thr Val             180 185 190 Arg Val Ser Glu Thr Leu Gln Arg Phe Ala Trp Arg Ser Ser Asp Glu         195 200 205 Asn Gly Arg Pro Pro Leu Pro Pro Lys Gln Lys Arg Lys Met Ala Arg     210 215 220 Thr Ile Gly Ser Glu Val 225 230 <210> 4 <211> 121 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of 0028 NS2 (m) <400> 4 Met Asp Ser Asn Thr Val Ser Ser Phe Gln Asp Ile Leu Met Arg Met   1 5 10 15 Ser Lys Met Gln Leu Gly Ser Ser Ser Glu Asp Leu Asn Gly Ile Ile              20 25 30 Thr Gln Phe Glu Ser Leu Lys Leu Tyr Arg Asp Ser Leu Gly Glu Ala          35 40 45 Val Met Arg Met Gly Asp Leu His Ser Leu Gln Ser Arg Asn Glu Lys      50 55 60 Trp Arg Glu Gln Leu Gly Gln Lys Phe Glu Glu Ile Arg Trp Leu Ile  65 70 75 80 Glu Glu Val Arg His Arg Leu Lys Ile Thr Glu Asn Ser Phe Glu Gln                  85 90 95 Ile Thr Phe Met Gln Ala Leu Gln Leu Leu Leu             100 105 110 Ile Arg Thr Phe Ser Phe Gln Leu Ile         115 120 <210> 5 <211> 890 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > nucleotide sequence of 0028 NS (w) <400> 5 agcaaaagca gggtgacaaa aacataatgg attctaacac tgtgtcaagc tttcaggtag 60 actgctttct ctggcatgtc cgcaaacgat ttgcagacca agaactgggt gatgccccat 120 tccttgaccg gcttcgccga gatcagaagt ccctaagagg aagaggcagc actcttggtc 180 tggacattga aacagctacc cgtgggggaa agcagatagt ggagcggatt cttttcaaag 240 aatccgatga ggcacttaaa atgactgttg cttcagtacc ggctacacgc tatctaactg 300 atatgactct tgaagaaatg tcaagggact ggttcatgct catgcccaag cagaaagtgg 360 caggttccct ttgcatcaaa atagaccagg caataatgga taaaaccatc acattgaaag 420 caaacttcag tgtgactttt ggtcggctgg aaaccctaat actacttaga gctttctcag 480 aggaaggagc aattgtggga gaaatctcac cgttaccctc tcttccagga catactgatg 540 aggatgtcaa aaatgcaatt ggggtcctca tcggaggact tgaatggaat aataacacag 600 ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtgatgag aatgggagac 660 ctccactccc tccaaagcag aaacagaaaa tggcgagaac aattgggtca gaagtttgaa 720 gaaataaggt ggctgatcga agaggtgcga catagattaa agattacgga gaacagcttt 780 gaacaaataa catttatgca agccttacaa ctattgcttg aagtggagca agagataaga 840 actttctcgt ttcagcttat ttgataataa aaaacaccct tgtttctact 890 <210> 6 <211> 890 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > nucleotide sequence of 0028 NS (m) <400> 6 agcaaaagca gggtgacaaa aacataatgg attctaacac tgtgtcaagc tttcaggtag 60 actgctttct ctggcatgtc cgcaaacgat ttgcagacca agaactgggt gatgccccat 120 tccttgaccg gcttcgccga gatcagaagt ccctaagagg aagaggcagc actcttggtc 180 tggacattga aacagctacc cgtgggggaa agcagatagt ggagcggatt cttttcaaag 240 aatccgatga ggcacttaaa atgactgttg cttcagtacc ggctacacgc tatctaactg 300 atatgactct tgaagaaatg tcaagggact ggttcatgct catgcccaag cagaaagtgg 360 caggttccct ttgcatcaaa atagaccagg caataatgga taaaaccatc acattgaaag 420 caaacttcag tgtgactttt ggtcggctgg aaaccctaat actacttaga gctttctcag 480 aggaaggagc aattgtggga gaaatctcac cgttaccctc tcttccagga catactgatg 540 aggatgtcaa aaatgcaatt ggggtcctca tcggaggact tgaatggaat aataacacag 600 ttcgagtctc tgaaactcta cagagattcg cttggagaag cagtgatgag aatgggagac 660 ctccactccc tccaaagcag aaacgaaaaa tggcgagaac aattgggtca gaagtttgaa 720 gaaataaggt ggctgatcga agaggtgcga catagattaa agattacgga gaacagcttt 780 gaacaaataa catttatgca agccttacaa ctattgcttg aagtggagca agagataaga 840 actttctcgt ttcagcttat ttgataataa aaaacaccct tgtttctact 890 <210> 7 <211> 757 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 PB1 <400> 7 Met Asp Val Asn Pro Thr Leu Leu Phe Leu Lys Val Pro Ala Gln Asn   1 5 10 15 Ala Ile Ser Thr Thr Phe Pro Tyr Thr Gly Asp Pro Pro Tyr Ser His              20 25 30 Gly Thr Gly Thr Gly Tyr Thr Met Asp Thr Val Asn Arg Thr His Gln          35 40 45 Tyr Ser Glu Lys Gly Arg Trp Thr Thr Asn Thr Glu Thr Gly Ala Pro      50 55 60 Gln Leu Asn Pro Ile Asp Gly Pro Leu Pro Glu Asp Asn Glu Pro Ser  65 70 75 80 Gly Tyr Ala Gln Thr Asp Cys Val Leu Glu Ala Met Ala Phe Leu Glu                  85 90 95 Glu Ser His Gly Ile Phe Glu Asn Ser Cys Ile Glu Thr Met Glu             100 105 110 Val Val Gln Gln Thr Arg Val Asp Lys Leu Thr Gln Gly Arg Gln Thr         115 120 125 Tyr Asp Trp Thr Leu Asn Arg Asn Gln Pro Ala Ala Thr Ala Leu Ala     130 135 140 Asn Thr Ile Glu Val Phe Arg Ser Asn Gly Leu Thr Ala Asn Glu Ser 145 150 155 160 Gly Arg Leu Ile Asp Phe Leu Lys Asp Val Met Glu Ser Met Asn Lys                 165 170 175 Glu Glu Met Gly Ile Thr Thr His Phe Gln Arg Lys Arg Arg Val Arg             180 185 190 Asp Asn Met Thr Lys Lys Met Ile Thr Gln Arg Thr Met Gly Lys Lys         195 200 205 Lys Gln Arg Leu Asn Lys Arg Ser Tyr Leu Ile Arg Ala Leu Thr Leu     210 215 220 Asn Thr Met Thr Lys Asp Ala Glu Arg Gly Lys Leu Lys Arg Arg Ala 225 230 235 240 Ile Ala Thr Pro Gly Met Gln Ile Arg Gly Phe Val Tyr Phe Val Glu                 245 250 255 Thr Leu Ala Arg Ser Ile Cys Glu Lys Leu Glu Gln Ser Gly Leu Pro             260 265 270 Val Gly Gly Asn Glu Lys Lys Ala Lys Leu Ala Asn Val Val Arg Lys         275 280 285 Met Met Thr Asn Ser Gln Asp Thr Glu Leu Ser Phe Thr Ile Thr Gly     290 295 300 Asp Asn Thr Lys Trp Asn Glu Asn Gln Asn Pro Arg Met Phe Leu Ala 305 310 315 320 Met Ile Thr Tyr Met Thr Arg Asn Gln Pro Glu Trp Phe Arg Asn Val                 325 330 335 Leu Ser Ile Pro Ile Met Phe Ser Asn Lys Met Ala Arg Leu Gly             340 345 350 Lys Gly Tyr Met Phe Glu Ser Lys Ser Met Lys Leu Arg Thr Gln Ile         355 360 365 Pro Ala Glu Met Leu Ala Ser Ile Asp Leu Lys Tyr Phe Asn Asp Ser     370 375 380 Thr Arg Lys Lys Ile Glu Lys Ile Arg Pro Leu Leu Ile Glu Gly Thr 385 390 395 400 Ala Ser Leu Ser Pro Gly Met Met Met Gly Met Phe Asn Met Leu Ser                 405 410 415 Thr Val Leu Gly Val Ser Ile Leu Asn Leu Gly Gln Lys Arg Tyr Thr             420 425 430 Lys Thr Thr Tyr Trp Trp Asp Gly Leu Gln Ser Ser Asp Asp Phe Ala         435 440 445 Leu Ile Val Asn Ala Pro Asn His Glu Gly Ile Gln Ala Gly Val Asp     450 455 460 Arg Phe Tyr Arg Thr Cys Lys Leu Leu Gly Ile Asn Met Ser Lys Lys 465 470 475 480 Lys Ser Tyr Ile Asn Arg Thr Gly Thr Phe Glu Phe Thr Ser Phe Phe                 485 490 495 Tyr Arg Tyr Gly Phe Val Ala Asn Phe Ser Met Glu Leu Pro Ser Phe             500 505 510 Gly Val Ser Gly Ile Asn Glu Ser Ala Asp Met Ser Ile Gly Val Thr         515 520 525 Val Ile Lys Asn Asn Met Ile Asn Asn Asp Leu Gly Pro Ala Thr Ala     530 535 540 Gln Met Ala Leu Gln Leu Phe Ile Lys Asp Tyr Arg Tyr Thr Tyr Arg 545 550 555 560 Cys His Ile Gly Asp Thr Gln Ile Gln Thr Arg Arg Ser Phe Glu Ile                 565 570 575 Lys Lys Leu Trp Glu Gln Thr Arg Ser Ser Ays Gly Leu Leu Val Ser             580 585 590 Asp Gly Gly Pro Asn Leu Tyr Asn Ile Arg Asn Leu His Ile Pro Glu         595 600 605 Val Cys Leu Lys Trp Glu Leu Met Asp Glu Asp Tyr Gln Gly Arg Leu     610 615 620 Cys Asn Pro Leu Asn Pro Phe Val Ser His Lys Glu Ile Glu Ser Met 625 630 635 640 Asn Asn Ala Val Met Met Pro Ala His Gly Pro Ala Lys Asn Met Glu                 645 650 655 Tyr Asp Ala Val Ala Thr Thr His Ser Trp Ile Pro Lys Arg Asn Arg             660 665 670 Ser Ile Leu Asn Thr Ser Gln Arg Gly Val Leu Glu Asp Glu Gln Met         675 680 685 Tyr Gln Arg Cys Cys Asn Leu Phe Glu Lys Phe Phe Pro Ser Ser Ser     690 695 700 Tyr Arg Arg Pro Val Gly Ile Ser Ser Met Val Glu Ala Met Val Ser 705 710 715 720 Arg Ala Arg Ile Asp Ala Arg Ile Asp Phe Glu Ser Gly Arg Ile Lys                 725 730 735 Lys Glu Glu Phe Thr Glu Ile Met Lys Ile Cys Ser Thr Ile Glu Glu             740 745 750 Leu Arg Arg Gln Lys         755 <210> 8 <211> 759 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 PB2 <400> 8 Met Glu Arg Ile Lys Glu Leu Arg Asn Leu Met Ser Gln Ser Arg Thr   1 5 10 15 Arg Glu Ile Leu Thr Lys Thr Thr Val Asp His Met Ala Ile Ile Lys              20 25 30 Lys Tyr Thr Ser Gly Arg Gln Glu Lys Asn Pro Ala Leu Arg Met Lys          35 40 45 Trp Met Met Ala Met Lys Tyr Pro Ile Thr Ala Asp Lys Arg Ile Thr      50 55 60 Glu Met Ile Pro Glu Arg Asn Glu Gln Gly Gln Thr Leu Trp Ser Lys  65 70 75 80 Met Asn Asp Ala Gly Ser Asp Arg Val Met Val Ser Pro Leu Ala Val                  85 90 95 Thr Trp Trp Asn Arg Asn Gly Pro Ile Thr Asn Thr Val His Tyr Pro             100 105 110 Lys Ile Tyr Lys Thr Tyr Phe Glu Arg Val Glu Arg Leu Lys His Gly         115 120 125 Thr Phe Gly Pro Val His Phe Arg Asn Gln Val Lys Ile Arg Arg Arg     130 135 140 Val Asp Ile Asn Pro Gly His Ala Asp Leu Ser Ala Lys Glu Ala Gln 145 150 155 160 Asp Val Ile Met Glu Val Val Phe Pro Asn Glu Val Gly Ala Arg Ile                 165 170 175 Leu Thr Ser Glu Ser Gln Leu Thr Ile Thr Lys Glu Lys Lys Glu Glu             180 185 190 Leu Gln Asp Cys Lys Ile Ser Pro Leu Met Val Ala Tyr Met Leu Glu         195 200 205 Arg Glu Leu Val Arg Lys Thr Arg Phe Leu Pro Val Ala Gly Gly Thr     210 215 220 Ser Ser Val Tyr Ile Glu Val Leu His Leu Thr Gln Gly Thr Cys Trp 225 230 235 240 Glu Gln Met Tyr Thr Pro Gly Gly Glu Val Arg Asn Asp Asp Val Asp                 245 250 255 Gln Ser Leu Ile Ile Ala Ala Arg Asn Ile Val Arg Arg Ala Ala Val             260 265 270 Ser Ala Asp Pro Leu Ala Ser Leu Leu Glu Met Cys His Ser Thr Gln         275 280 285 Ile Gly Gly Ile Arg Met Val Asp Ile Leu Arg Gln Asn Pro Thr Glu     290 295 300 Glu Gln Ala Val Asp Ile Cys Lys Ala Ala Met Gly Leu Arg Ile Ser 305 310 315 320 Ser Ser Phe Ser Phe Gly Gly Phe Thr Phe Lys Arg Thr Ser Gly Ser                 325 330 335 Ser Val Lys Arg Glu Glu Glu Val Leu Thr Gly Asn Leu Gln Thr Leu             340 345 350 Lys Ile Arg Val His Glu Gly Tyr Glu Glu Phe Thr Met Val Gly Arg         355 360 365 Arg Ala Thr Ala Ile Leu Arg Lys Ala Thr Arg Arg Leu Ile Gln Leu     370 375 380 Ile Val Ser Gly Arg Asp Glu Gln Ser Ile Ala Glu Ala Ile Ile Val 385 390 395 400 Ala Met Val Phe Ser Gln Glu Asp Cys Met Ile Lys Ala Val Arg Gly                 405 410 415 Asp Leu Asn Phe Val Asn Arg Ala Asn Gln Arg Leu Asn Pro Met His             420 425 430 Gln Leu Leu Arg His Phe Gln Lys Asp Ala Lys Val Leu Phe Gln Asn         435 440 445 Trp Gly Val Glu Pro Ile Asp Asn Val Met Gly Met Ile Gly Ile Leu     450 455 460 Pro Asp Met Thr Pro Ser Ile Glu Met Ser Met Arg Gly Val Arg Ile 465 470 475 480 Ser Lys Met Gly Val Asp Glu Tyr Ser Ser Thr Glu Arg Val Val Val                 485 490 495 Ser Ile Asp Arg Phe Leu Arg Ile Arg Asp Gln Arg Gly Asn Val Leu             500 505 510 Leu Ser Pro Glu Glu Val Ser Glu Thr Gln Gly Thr Glu Lys Leu Thr         515 520 525 Ile Thr Ser Ser Ser Met Met Trp Glu Ile Asn Gly Pro Glu Ser     530 535 540 Val Leu Val Asn Thr Tyr Gln Trp Ile Ile Arg Asn Trp Glu Thr Val 545 550 555 560 Lys Ile Gln Trp Ser Gln Asn Pro Thr Met Leu Tyr Asn Lys Met Glu                 565 570 575 Phe Glu Pro Phe Gln Ser Leu Val Pro Lys Ala Ile Arg Gly Gln Tyr             580 585 590 Ser Gly Phe Val Arg Thr Leu Phe Gln Gln Met Arg Asp Val Leu Gly         595 600 605 Thr Phe Asp Thr Ala Gln Ile Ile Lys Leu Leu Pro Phe Ala Ala Ala     610 615 620 Pro Pro Lys Gln Ser Arg Met Gln Phe Ser Ser Phe Thr Val Asn Val 625 630 635 640 Arg Gly Ser Gly Met Arg Ile Leu Val Arg Gly Asn Ser Pro Val Phe                 645 650 655 Asn Tyr Asn Lys Ala Thr Lys Arg Leu Thr Val Leu Gly Lys Asp Ala             660 665 670 Gly Thr Leu Thr Glu Asp Pro Asp Glu Gly Thr Ala Gly Val Glu Ser         675 680 685 Ala Val Leu Arg Gly Phe Leu Ile Leu Gly Lys Glu Asp Lys Arg Tyr     690 695 700 Gly Pro Ala Leu Ser Ile Asn Glu Leu Ser Asn Leu Ala Lys Gly Glu 705 710 715 720 Lys Ala Asn Val Leu Ile Gly Gln Gly Asp Val Val Leu Val Met Lys                 725 730 735 Arg Lys Arg Asp Ser Ser Ile Leu Thr Asp Ser Gln Thr Ala Thr Lys             740 745 750 Arg Ile Arg Met Ala Ile Asn         755 <210> 9 <211> 716 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 PA <400> 9 Met Glu Asp Phe Val Arg Gln Cys Phe Asn Pro Met Ile Val Glu Leu   1 5 10 15 Ala Glu Lys Thr Met Lys Glu Tyr Gly Glu Asp Leu Lys Ile Glu Thr              20 25 30 Asn Lys Phe Ala Ala Ile Cys Thr His Leu Glu Val Cys Phe Met Tyr          35 40 45 Ser Asp Phe His Phe Ile Asn Glu Gln Gly Glu Ser Ile Ile Val Glu      50 55 60 Leu Gly Asp Pro Asn Ala Leu Leu Lys His Arg Phe Glu Ile Ile Glu  65 70 75 80 Gly Arg Asp Arg Thr Met Ala Trp Thr Val Val Asn Ser Ile Cys Asn                  85 90 95 Thr Thr Gly Ala Glu Lys Pro Lys Phe Leu Pro Asp Leu Tyr Asp Tyr             100 105 110 Lys Glu Asn Arg Phe Ile Glu Ile Gly Val Thr Arg Arg Glu Val His         115 120 125 Ile Tyr Tyr Leu Glu Lys Ala Asn Lys Ile Lys Ser Glu Lys Thr His     130 135 140 Ile His Ile Phe Ser Phe Thr Gly Glu Glu Met Ala Thr Lys Ala Asp 145 150 155 160 Tyr Thr Leu Asp Glu Glu Ser Arg Ala Arg Ile Lys Thr Arg Leu Phe                 165 170 175 Thr Ile Arg Gln Glu Met Ala Ser Arg Gly Leu Trp Asp Ser Phe Arg             180 185 190 Gln Ser Glu Arg Gly Glu Glu Thr Ile Glu Glu Arg Phe Glu Ile Thr         195 200 205 Gly Thr Met Arg Lys Leu Ala Asp Gln Ser Leu Pro Pro Asn Phe Ser     210 215 220 Ser Leu Glu Asn Phe Arg Ala Tyr Val Asp Gly Phe Glu Pro Asn Gly 225 230 235 240 Tyr Ile Glu Gly Lys Leu Ser Gln Met Ser Lys Glu Val Asn Ala Arg                 245 250 255 Ile Glu Pro Phe Leu Lys Thr Thr Pro Arg Pro Leu Arg Leu Pro Asn             260 265 270 Gly Pro Pro Cys Ser Gln Arg Ser Lys Phe Leu Leu Met Asp Ala Leu         275 280 285 Lys Leu Ser Ile Glu Asp Pro Ser His Glu Gly Glu Gly Ile Pro Leu     290 295 300 Tyr Asp Ala Ile Lys Cys Met Arg Thr Phe Phe Gly Trp Lys Glu Pro 305 310 315 320 Asn Val Val Lys Pro His Glu Lys Gly Ile Asn Pro Asn Tyr Leu Leu                 325 330 335 Ser Trp Lys Gln Val Leu Ala Glu Leu Gln Asp Ile Glu Asn Glu Glu             340 345 350 Lys Ile Pro Lys Thr Lys Asn Met Lys Lys Thr Ser Gln Leu Lys Trp         355 360 365 Ala Leu Gly Glu Asn Met Ala Pro Glu Lys Val Asp Phe Asp Asp Cys     370 375 380 Lys Asp Val Gly Asp Leu Lys Gln Tyr Asp Ser Asp Glu Pro Glu Leu 385 390 395 400 Arg Ser Leu Ala Ser Trp Ile Gln Asn Glu Phe Asn Lys Ala Cys Glu                 405 410 415 Leu Thr Asp Ser Ser Trp Ile Glu Leu Asp Glu Ile Gly Glu Asp Val             420 425 430 Ala Pro Ile Glu His Ile Ala Ser Met Arg Arg Asn Tyr Phe Thr Ser         435 440 445 Glu Val Ser His Cys Arg Ala Thr Glu Tyr Ile Met Lys Gly Val Tyr     450 455 460 Ile Asn Thr Ala Leu Leu Asn Ala Ser Cys Ala Ala Met Asp Asp Phe 465 470 475 480 Gln Leu Ile Pro Met Ile Ser Lys Cys Arg Thr Lys Glu Gly Arg Arg                 485 490 495 Lys Thr Asn Leu Tyr Gly Phe Ile Ile Lys Gly Arg Ser His Leu Arg             500 505 510 Asn Asp Thr Asp Val Val Asn Phe Val Ser Met Glu Phe Ser Leu Thr         515 520 525 Asp Pro Arg Leu Glu Pro His Lys Trp Glu Lys Tyr Cys Val Leu Glu     530 535 540 Ile Gly Asp Met Leu Ile Arg Ser Ala Ile Gly Gln Val Ser Arg Pro 545 550 555 560 Met Phe Leu Tyr Val Arg Thr Asn Gly Thr Ser Lys Ile Lys Met Lys                 565 570 575 Trp Gly Met Glu Met Arg Arg Cys Leu Leu Gln Ser Leu Gln Gln Ile             580 585 590 Glu Ser Met Ile Glu Ala Glu Ser Ser Val Lys Glu Lys Asp Met Thr         595 600 605 Lys Glu Phe Phe Glu Asn Lys Ser Glu Thr Trp Pro Ile Gly Glu Ser     610 615 620 Pro Lys Gly Val Glu Glu Ser Ser Ile Gly Lys Val Cys Arg Thr Leu 625 630 635 640 Leu Ala Lys Ser Val Phe Asn Ser Leu Tyr Ala Ser Pro Gln Leu Glu                 645 650 655 Gly Phe Ser Ala Glu Ser Arg Lys Leu Leu Leu Ile Val Gln Ala Leu             660 665 670 Arg Asp Asn Leu Glu Pro Gly Thr Phe Asp Leu Gly Gly Leu Tyr Glu         675 680 685 Ala Ile Glu Glu Cys Leu Ile Asn Asp Pro Trp Val Leu Leu Asn Ala     690 695 700 Ser Trp Phe Asn Ser Phe Leu Thr His Ala Leu Ser 705 710 715 <210> 10 <211> 498 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 NP <400> 10 Met Ala Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Asp   1 5 10 15 Gly Glu Arg Gln Asn Ala Thr Glu Ile Arg Ala Ser Val Gly Lys Met              20 25 30 Ile Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Glu Leu Lys          35 40 45 Leu Ser Asp Tyr Glu Gly Arg Leu Ile Gln Asn Ser Leu Thr Ile Glu      50 55 60 Arg Met Val Leu Ser Ala Phe Asp Glu Arg Arg Asn Lys Tyr Leu Glu  65 70 75 80 Glu His Pro Ser Ala Gly Lys Asp Pro Lys Lys Thr Gly Gly Pro Ile                  85 90 95 Tyr Arg Arg Val Asn Gly Lys Trp Met Arg Glu Leu Ile Leu Tyr Asp             100 105 110 Lys Glu Glu Ile Arg Arg Ile Trp Arg Gln Ala Asn Asn Gly Asp Asp         115 120 125 Ala Thr Ala Gly Leu Thr His Met Met Ile Trp His Ser Asn Leu Asn     130 135 140 Asp Ala Thr Tyr Gln Arg Thr Arg Ala Leu Val Arg Thr Gly Met Asp 145 150 155 160 Pro Arg Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser                 165 170 175 Gly Ala Ala Gly Ala Ala Val Lys Gly Val Gly Thr Met Val Met Glu             180 185 190 Leu Val Arg Met Ile Lys Arg Gly Ile Asn Asp Arg Asn Phe Trp Arg         195 200 205 Gly Glu Asn Gly Arg Lys Thr Arg Ile Ala Tyr Glu Arg Met Cys Asn     210 215 220 Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Lys Ala Met Met Asp 225 230 235 240 Gln Val Arg Glu Ser Arg Asn Pro Gly Asn Ala Glu Phe Glu Asp Leu                 245 250 255 Thr Phe Leu Ala Arg Ser Ala Leu Ile Leu Arg Gly Ser Val Ala His             260 265 270 Lys Ser Cys Leu Pro Ala Cys Val Tyr Gly Pro Ala Val Ala Ser Gly         275 280 285 Tyr Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe     290 295 300 Arg Leu Leu Gln Asn Ser Gln Val Tyr Ser Leu Ile Arg Pro Asn Glu 305 310 315 320 Asn Pro Ala His Lys Ser Gln Leu Val Trp Met Ala Cys His Ser Ala                 325 330 335 Ala Phe Glu Asp Leu Arg Val Leu Ser Phe Ile Lys Gly Thr Lys Val             340 345 350 Leu Pro Arg Gly Lys Leu Ser Thr Arg Gly Val Gln Ile Ala Ser Asn         355 360 365 Glu Asn Met Glu Thr Met Glu Ser Ser Thr Leu Glu Leu Arg Ser Arg     370 375 380 Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn Thr Asn Gln Gln Arg 385 390 395 400 Ala Ser Ala Gly Gln Ile Ser Ile Gln Pro Thr Phe Ser Val Gln Arg                 405 410 415 Asn Leu Pro Phe Asp Arg Thr Thr Ile Met Ala Ala Phe Asn Gly Asn             420 425 430 Thr Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Ile Ile Arg Met Met         435 440 445 Glu Ser Ala Arg Pro Glu Asp Val Ser Phe Gln Gly Arg Gly Val Phe     450 455 460 Glu Leu Ser Asp Glu Lys Ala Ala Ser Pro Ile Val Pro Ser Phe Asp 465 470 475 480 Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr                 485 490 495 Asp Asn         <210> 11 <211> 252 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 M <400> 11 Met Ser Leu Leu Thr Glu Val Glu Thr Tyr Val Leu Ser Ile Ile Pro   1 5 10 15 Ser Gly Pro Leu Lys Ala Glu Ile Ala Gln Arg Leu Glu Asp Val Phe              20 25 30 Ala Gly Lys Asn Thr Asp Leu Glu Val Leu Met Glu Trp Leu Lys Thr          35 40 45 Arg Pro Ile Leu Ser Pro Leu Thr Lys Gly Ile Leu Gly Phe Val Phe      50 55 60 Thr Leu Thr Val Ser Glu Arg Gly Leu Gln Arg Arg Arg Phe Val  65 70 75 80 Gln Asn Ala Leu Asn Gly Asn Gly Asp Pro Asn Asn Met Asp Lys Ala                  85 90 95 Val Lys Leu Tyr Arg Lys Leu Lys Arg Glu Ile Thr Phe His Gly Ala             100 105 110 Lys Glu Ile Ser Leu Ser Tyr Ser Ala Gly Ala Leu Ala Ser Cys Met         115 120 125 Gly Leu Ile Tyr Asn Arg Met Gly Ala Val Thr Thr Glu Val Ala Phe     130 135 140 Gly Leu Val Cys Ala Thr Cys Glu Gln Ile Ala Asp Ser Gln His Arg 145 150 155 160 Ser His Arg Gln Met Val Thr Thr Thr Asn Pro Leu Ile Arg His Glu                 165 170 175 Asn Arg Met Val Leu Ala Ser Thr Thr Ala Lys Ala Met Glu Gln Met             180 185 190 Ala Gly Ser Ser Glu Gln Ala Ala Glu Ala Met Glu Val Ala Ser Gln         195 200 205 Ala Arg Gln Met Val Gln Ala Met Arg Thr Ile Gly Thr His Ser Ser     210 215 220 Ser Ser Ala Gly Leu Lys Asn Asp Leu Leu Glu Asn Leu Gln Ala Tyr 225 230 235 240 Gln Lys Arg Met Gly Val Gln Met Gln Arg Phe Lys                 245 250 <210> 12 <211> 565 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 HA <400> 12 Met Lys Ala Asn Leu Leu Val Leu Leu Cys Ala Leu Ala Ala Ala Asp   1 5 10 15 Ala Asp Thr Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Asp Thr              20 25 30 Val Asp Thr Val Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn          35 40 45 Leu Leu Glu Asp Ser His Asn Gly Lys Leu Cys Arg Leu Lys Gly Ile      50 55 60 Ala Pro Leu Gln Leu Gly Lys Cys Asn Ile Ala Gly Trp Leu Leu Gly  65 70 75 80 Asn Pro Glu Cys Asp Pro Leu Leu Pro Val Arg Ser Trp Ser Tyr Ile                  85 90 95 Val Glu Thr Pro Asn Ser Glu Asn Gly Ile Cys Tyr Pro Gly Asp Phe             100 105 110 Ile Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe         115 120 125 Glu Arg Phe Glu Ile Phe Pro Lys Glu Ser Ser Trp Pro Asn His Asn     130 135 140 Thr Asn Gly Val Thr Ala Ala Cys Ser His Glu Gly Lys Ser Ser Phe 145 150 155 160 Tyr Arg Asn Leu Leu Trp Leu Thr Glu Lys Glu Gly Ser Tyr Pro Lys                 165 170 175 Leu Lys Asn Ser Tyr Val Asn Lys Lys Gly Lys Glu Val Leu Val Leu             180 185 190 Trp Gly Ile His His Pro Pro Asn Ser Lys Glu Gln Gln Asn Leu Tyr         195 200 205 Gln Asn Glu Asn Ala Tyr Val Ser Val Val Thr Ser Asn Tyr Asn Arg     210 215 220 Arg Phe Thr Pro Glu Ile Ala Glu Arg Pro Lys Val Arg Asp Gln Ala 225 230 235 240 Gly Arg Met Asn Tyr Tyr Trp Thr Leu Leu Lys Pro Gly Asp Thr Ile                 245 250 255 Ile Phe Glu Ala Asn Gly Asn Leu Ile Ala Pro Met Tyr Ala Phe Ala             260 265 270 Leu Ser Arg Gly Phe Gly Ser Gly Ile Ile Thr Ser Asn Ala Ser Met         275 280 285 His Glu Cys Asn Thr Lys Cys Gln Thr Pro Leu Gly Ala Ile Asn Ser     290 295 300 Ser Leu Pro Tyr Gln Asn Ile His Pro Val Thr Ile Gly Glu Cys Pro 305 310 315 320 Lys Tyr Val Arg Ser Ala Lys Leu Arg Met Val Thr Gly Leu Arg Asn                 325 330 335 Ile Pro Ser Ile Gln Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe             340 345 350 Ile Glu Gly Gly Trp Thr Gly Met Ile Asp Gly Trp Tyr Gly Tyr His         355 360 365 His Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser Thr     370 375 380 Gln Asn Ala Ile Asn Gly Ile Thr Asn Lys Val Asn Thr Val Ile Glu 385 390 395 400 Lys Met Asn Ile Gln Phe Thr Ala Val Gly Lys Glu Phe Asn Lys Leu                 405 410 415 Glu Lys Arg Met Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe Leu             420 425 430 Asp Ile Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Glu         435 440 445 Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu Tyr Glu Lys     450 455 460 Val Lys Ser Gln Leu Lys Asn Asn Ala Lys Glu Ile Gly Asn Gly Cys 465 470 475 480 Phe Glu Phe Tyr His Lys Cys Asp Asn Glu Cys Met Glu Ser Val Arg                 485 490 495 Asn Gly Thr Tyr Asp Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu Asn             500 505 510 Arg Glu Lys Val Asp Gly Val Lys Leu Glu Ser Met Gly Ile Tyr Gln         515 520 525 Ile Leu Ala Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu Val     530 535 540 Ser Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu Gln 545 550 555 560 Cys Arg Ile Cys Ile                 565 <210> 13 <211> 549 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of PB8 NA <400> 13 Met Asn Pro Asn Gln Lys Ile Ile Thr Ile Gly Ser Ile Cys Leu Val   1 5 10 15 Val Gly Leu Ile Ser Leu Ile Leu Gln Ile Gly Asn Ile Ser Ser Ile              20 25 30 Trp Ile Ser His Ser Ile Gln Thr Gly Ser Gln Asn His Thr Gly Ile          35 40 45 Cys Asn Gln Asn Ile Ile Thr Tyr Lys Asn Ser Thr Trp Val Lys Asp      50 55 60 Thr Thr Ser Val Ile Leu Thr Gly Asn Ser Ser Leu Cys Pro Ile Arg  65 70 75 80 Gly Trp Ala Ile Tyr Ser Lys Asp Asn Ser Ile Arg Ile Gly Ser Lys                  85 90 95 Gly Asp Val Phe Val Ile Arg Glu Pro Phe Ile Ser Cys Ser His Leu             100 105 110 Glu Cys Arg Thr Phe Phe Leu Thr Gln Gly Ala Leu Leu Asn Asp Lys         115 120 125 His Ser Ser Gly Thr Val Lys Asp Arg Ser Pro Tyr Arg Ala Leu Met     130 135 140 Ser Cys Pro Val Gly Glu Ala Pro Ser Pro Tyr Asn Ser Arg Phe Glu 145 150 155 160 Ser Val Ala Trp Ser Ala Ser Ala Cys His Asp Gly Met Gly Trp Leu                 165 170 175 Thr Ile Gly Ile Ser Gly Pro Asp Asn Gly Ala Val Ala Val Leu Lys             180 185 190 Tyr Asn Gly Ile Ile Thr Glu Thr Ile Lys Ser Trp Arg Lys Lys Ile         195 200 205 Leu Arg Thr Gln Glu Ser Glu Cys Ala Cys Val Asn Gly Ser Cys Phe     210 215 220 Thr Ile Met Thr Asp Gly Pro Ser Asp Gly Leu Ala Ser Tyr Lys Ile 225 230 235 240 Phe Lys Ile Glu Lys Gly Lys Val Thr Lys Ser Ile Glu Leu Asn Ala                 245 250 255 Pro Asn Ser His Tyr Glu Glu Cys Ser Cys Tyr Pro Asp Thr Gly Lys             260 265 270 Val Ile Ile Ser Gly Pro Asp Asn Gly Ala Val Ala Val Leu Lys Tyr         275 280 285 Asn Gly Ile Ile Thr Glu Thr Ile Lys Ser Trp Arg Lys Lys Ile Leu     290 295 300 Arg Thr Gln Glu Ser Glu Cys Ala Cys Val Asn Gly Ser Cys Phe Thr 305 310 315 320 Ile Met Thr Asp Gly Pro Ser Asp Gly Leu Ala Ser Tyr Lys Ile Phe                 325 330 335 Lys Ile Glu Lys Gly Lys Val Thr Lys Ser Ile Glu Leu Asn Ala Pro             340 345 350 Asn Ser His Tyr Glu Glu Cys Ser Cys Tyr Pro Asp Thr Gly Lys Val         355 360 365 Met Cys Val Cys Arg Asp Asn Trp His Gly Ser Asn Arg Pro Trp Val     370 375 380 Ser Phe Asp Gln Asn Leu Asp Tyr Gln Ile Gly Tyr Ile Cys Ser Gly 385 390 395 400 Val Phe Gly Asp Asn Pro Arg Pro Glu Asp Gly Thr Gly Ser Cys Gly                 405 410 415 Pro Val Tyr Val Asp Gly Ala Asn Gly Val Lys Gly Phe Ser Tyr Arg             420 425 430 Tyr Gly Asn Gly Val Trp Ile Gly Arg Thr Lys Gly His Ser Ser Arg         435 440 445 His Gly Phe Glu Met Ile Trp Asp Pro Asn Gly Trp Thr Glu Thr Asp     450 455 460 Ser Lys Phe Ser Val Arg Gln Asp Val Val Ala Met Thr Asp Trp Ser 465 470 475 480 Gly Tyr Ser Gly Ser Phe Val Gln His Pro Glu Leu Thr Gly Leu Asp                 485 490 495 Cys Met Arg Pro Cys Phe Trp Val Glu Leu Ile Arg Gly Arg Pro Lys             500 505 510 Glu Lys Thr Ile Trp Thr Ser Ala Ser Ser Ser Ser Phe Cys Gly Val         515 520 525 Asn Ser Asp Thr Val Asp Trp Ser Trp Pro Asp Gly Ala Glu Leu Pro     530 535 540 Phe Ser Ile Asp Lys 545 <210> 14 <211> 2274 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 PB1 <400> 14 atggatgtca atccgacctt acttttctta aaagtgccag cacaaaatgc tataagcaca 60 actttccctt atactggaga ccctccttac agccatggga caggaacagg atacaccatg 120 gatactgtca acaggacaca tcagtactca gaaaagggaa gatggacaac aaacaccgaa 180 actggagcac cgcaactcaa cccgattgat gggccactgc cagaagacaa tgaaccaagt 240 ggttatgccc aaacagattg tgtattggag gcgatggctt tccttgagga atcccatcct 300 ggtatttttg aaaactcgtg tattgaaacg atggaggttg ttcagcaaac acgagtagac 360 aagctgacac aaggccgaca gacctatgac tggactctaa atagaaacca acctgctgca 420 acagcattgg ccaacacaat agaagtgttc agatcaaatg gcctcacggc caatgagtct 480 ggaaggctca tagacttcct taaggatgta atggagtcaa tgaacaaaga agaaatgggg 540 atcacaactc attttcagag aaagagacgg gtgagagaca atatgactaa gaaaatgata 600 acacagagaa caatgggtaa aaagaagcag agattgaaca aaaggagtta tctaattaga 660 gcattgaccc tgaacacaat gaccaaagat gctgagagag ggaagctaaa acggagagca 720 attgcaaccc cagggatgca aataaggggg tttgtatact ttgttgagac actggcaagg 780 agtatatgtg agaaacttga acaatcaggg ttgccagttg gaggcaatga gaagaaagca 840 aagttggcaa atgttgtaag gaagatgatg accaattctc aggacaccga actttctttc 900 accatcactg gagataacac caaatggaac gaaaatcaga atcctcggat gtttttggcc 960 atgatcacat atatgaccag aaatcagccc gaatggttca gaaatgttct aagtattgct 1020 ccaataatgt tctcaaacaa aatggcgaga ctgggaaaag ggtatatgtt tgagagcaag 1080 agtatgaaac ttagaactca aatacctgca gaaatgctag caagcatcga tttgaaatat 1140 ttcaatgatt caacaagaaa gaagattgaa aaaatccgac cgctcttaat agaggggact 1200 gcatcattga gccctggaat gatgatgggc atgttcaata tgttaagcac tgtattaggc 1260 gtctccatcc tgaatcttgg acaaaagaga tacaccaaga ctacttactg gtgggatggt 1320 cttcaatcct ctgacgattt tgctctgatt gtgaatgcac ccaatcatga agggattcaa 1380 gccggagtcg acaggtttta tcgaacctgt aagctacttg gaatcaatat gagcaagaaa 1440 aagtcttaca taaacagaac aggtacattt gaattcacaa gttttttcta tcgttatggg 1500 tttgttgcca atttcagcat ggagcttccc agttttgggg tgtctgggat caacgagtca 1560 gcggacatga gtattggagt tactgtcatc aaaaacaata tgataaacaa tgatcttggt 1620 ccagcaacag ctcaaatggc ccttcagttg ttcatcaaag attacaggta cacgtaccga 1680 tgccatatag gtgacacaca aatacaaacc cgaagatcat ttgaaataaa gaaactgtgg 1740 gagcaaaccc gttccaaagc tggactgctg gtctccgacg gaggcccaaa tttatacaac 1800 attagaaatc tccacattcc tgaagtctgc ctaaaatggg aattgatgga tgaggattac 1860 caggggcgtt tatgcaaccc actgaaccca tttgtcagcc ataaagaaat tgaatcaatg 1920 aacaatgcag tgatgatgcc agcacatggt ccagccaaaa acatggagta tgatgctgtt 1980 gcaacaacac actcctggat ccccaaaaga aatcgatcca tcttgaatac aagtcaaaga 2040 ggagtacttg aggatgaaca aatgtaccaa aggtgctgca atttatttga aaaattcttc 2100 cccagcagtt catacagaag accagtcggg atatccagta tggtggaggc tatggtttcc 2160 agagcccgaa ttgatgcacg gattgatttc gaatctggaa ggataaagaa agaagagttc 2220 actgagatca tgaagatctg ttccaccatt gaagagctca gacggcaaaa atag 2274 <210> 15 <211> 2280 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 PB2 <400> 15 cgagatagc acaaaaacca ccgtggacca tatggccata atcaagaagt acacatcagg aagacaggag 120 aagaacccag cacttaggat gaaatggatg atggcaatga aatatccaat tacagcagac 180 aagaggataa cggaaatgat tcctgagaga aatgagcaag gacaaacttt atggagtaaa 240 atgaatgatg ccggatcaga ccgagtgatg gtatcacctc tggctgtgac atggtggaat 300 aggaatggac caataacaaa tacagttcat tatccaaaaa tctacaaaac ttattttgaa 360 agagtcgaaa ggctaaagca tggaaccttt ggccctgtcc attttagaaa ccaagtcaaa 420 atacgtcgga gagttgacat aaatcctggt catgcagatc tcagtgccaa ggaggcacag 480 gatgtaatca tggaagttgt tttccctaac gaagtgggag ccaggatact aacatcggaa 540 tcgcaactaa cgataaccaa agagaagaaa gaagaactcc aggattgcaa aatttctcct 600 ttgatggttg catacatgtt ggagagagaa ctggtccgca aaacgagatt cctcccagtg 660 gctggtggaa caagcagtgt gtacattgaa gtgttgcatt tgactcaagg aacatgctgg 720 gaacagatgt atactccagg aggggaagtg aggaatgatg atgttgatca aagcttgatt 780 attgctgcta ggaacatagt gagaagagct gcagtatcag cagatccact agcatcttta 840 ttggagatgt gccacagcac acagattggt ggaattagga tggtagacat ccttaggcag 900 aacccaacag aagagcaagc cgtggatata tgcaaggctg caatgggact gagaattagc 960 tcatccttca gttttggtgg attcacattt aagagaacaa gcggatcatc agtcaagaga 1020 gaggaagagg tgcttacggg caatcttcaa acattgaaga taagagtgca tgagggatat 1080 gaagagttca caatggttgg gagaagagca acagccatac tcagaaaagc aaccaggaga 1140 ttgattcagc tgatagtgag tgggagagac gaacagtcga ttgccgaagc aataattgtg 1200 gccatggtat tttcacaaga ggattgtatg ataaaagcag tcagaggtga tctgaatttc 1260 gtcaataggg cgaatcaacg attgaatcct atgcatcaac ttttaagaca ttttcagaag 1320 gatgcgaaag tgctttttca aaattgggga gttgaaccta tcgacaatgt gatgggaatg 1380 attgggatat tgcccgacat gactccaagc atcgagatgt caatgagagg agtgagaatc 1440 agcaaaatgg gtgtagatga gtactccagc acggagaggg tagtggtgag cattgaccgt 1500 tttttgagaa tccgggacca acgaggaaat gtactactgt ctcccgagga ggtcagtgaa 1560 acacagggaa cagagaaact gacaataact tactcatcgt caatgatgtg ggagattaat 1620 ggtcctgaat cagtgttggt caatacctat caatggatca tcagaaactg ggaaactgtt 1680 aaaattcagt ggtcccagaa ccctacaatg ctatacaata aaatggaatt tgaaccattt 1740 cagtctttag tacctaaggc cattagaggc caatacagtg ggtttgtaag aactctgttc 1800 caacaaatga gggatgtgct tgggacattt gataccgcac agataataaa acttcttccc 1860 ttcgcagccg ctccaccaaa gcaaagtaga atgcagttct cctcatttac tgtgaatgtg 1920 aggggatcag gaatgagaat acttgtaagg ggcaattctc ctgtattcaa ctataacaag 1980 gccacgaaga gactcacagt tctcggaaag gatgctggca ctttaactga agacccagat 2040 gaaggcacag ctggagtgga gtccgctgtt ctgaggggat tcctcattct gggcaaagaa 2100 gacaagagat atgggccagc actaagcatc aatgaactga gcaaccttgc gaaaggagag 2160 aaggctaatg tgctaattgg gcaaggagac gtggtgttgg taatgaaacg gaaacgggac 2220 tctagcatac ttactgacag ccagacagcg accaaaagaa ttcggatggc catcaattag 2280                                                                         2280 <210> 16 <211> 2151 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 PA <400> 16 atggaagatt ttgtgcgaca atgcttcaat ccgatgattg tcgagcttgc ggaaaaaaca 60 atgaaagagt atggggagga cctgaaaatc gaaacaaaca aatttgcagc aatatgcact 120 cacttggaag tatgcttcat gtattcagat tttcacttca tcaatgagca aggcgagtca 180 ataatcgtag aacttggtga tccaaatgca cttttgaagc acagatttga aataatcgag 240 ggaagagatc gcacaatggc ctggacagta gtaaacagta tttgcaacac tacaggggct 300 gagaaaccaa agtttctacc agatttgtat gattacaagg agaatagatt catcgaaatt 360 ggagtaacaa ggagagaagt tcacatatac tatctggaaa aggccaataa aattaaatct 420 gagaaaacac acatccacat tttctcgttc actggggaag aaatggccac aaaggcagac 480 tacactctcg atgaagaaag cagggctagg atcaaaacca gactattcac cataagacaa 540 gaaatggcca gcagaggcct ctgggattcc tttcgtcagt ccgagagag agaagagaca 600 attgaagaaa ggtttgaaat cacaggaaca atgcgtaagc ttgccgacca aagtctcccg 660 ccgaacttct ccagccttga aaattttaga gcctatgtgg atggattcga accgaacggc 720 tacattgagg gcaagctgtc tcaaatgtcc aaagaagtaa atgctagaat tgaacctttt 780 ttgaaaacaa caccacgacc acttagactt ccgaatgggc ctccctgttc tcagcggtcc 840 aaattcctgc tgatggatgc cttaaaatta agcattgagg acccaagtca tgaaggagag 900 ggaataccgc tatatgatgc aatcaaatgc atgagaacat tctttggatg gaaggaaccc 960 aatgttgtta aaccacacga aaagggaata aatccaaatt atcttctgtc atggaagcaa 1020 gtactggcag aactgcagga cattgagaat gaggagaaaa ttccaaagac taaaaatatg 1080 aagaaaacaa gtcagctaaa gtgggcactt ggtgagaaca tggcaccaga aaaggtagac 1140 tttgacgact gtaaagatgt aggtgatttg aagcaatatg atagtgatga accagaattg 1200 aggtcgcttg caagttggat tcagaatgag tttaacaagg catgcgaact gacagattca 1260 agctggatag agctcgatga gattggagaa gatgtggctc caattgaaca cattgcaagc 1320 atgagaagga attatttcac atcagaggtg tctcactgca gagccacaga atacataatg 1380 aagggagtgt acatcaatac tgccttgctt aatgcatctt gtgcagcaat ggatgatttc 1440 caattaattc caatgataag caagtgtaga actaaggagg gaaggcgaaa gaccaacttg 1500 tatggtttca tcataaaagg aagatcccac ttaaggaatg acaccgacgt ggtaaacttt 1560 gtgagcatgg agttttctct cactgaccca agacttgaac cacataaatg ggagaagtac 1620 tgtgttcttg agataggaga tatgcttata agaagtgcca taggccaggt ttcaaggccc 1680 atgtcttgt atgtgagaac aaatggaacc tcaaaaatta aaatgaaatg gggaatggag 1740 atgaggcgtt gcctcctcca gtcacttcaa caaattgaga gtatgattga agctgagtcc 1800 tctgtcaaag agaaagacat gaccaaagag ttctttgaga acaaatcaga aacatggccc 1860 attggagagt cccccaaagg agtggaggaa agttccattg ggaaggtctg caggacttta 1920 ttagcaaagt cggtattcaa cagcttgtat gcatctccac aactagaagg attttcagct 1980 gaatcaagaa aactgcttct tatcgttcag gctcttaggg acaacctgga acctgggacc 2040 tttgatcttg gggggctata tgaagcaatt gaggagtgcc tgattaatga tccctgggtt 2100 ttgcttaatg cttcttggtt caactccttc cttacacatg cattgagtta g 2151 <210> 17 <211> 1497 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 NP <400> 17 atggcgtctc aaggcaccaa acgatcttac gaacagatgg agactgatgg agaacgccag 60 aatgccactg aaatcagagc atccgtcgga aaaatgattg gtggaattgg acgattctac 120 atccaaatgt gcaccgaact caaactcagt gattatgagg gacggttgat ccaaaacagc 180 ttaacaatag agagaatggt gctctctgct tttgacgaaa ggagaaataa ataccttgaa 240 gaacatccca gtgcggggaa agatcctaag aaaactggag gacctatata caggagagta 300 aacggaaagt ggatgagaga actcatcctt tatgacaaag aagaaataag gcgaatctgg 360 cgccaagcta ataatggtga cgatgcaacg gctggtctga ctcacatgat gatctggcat 420 tccaatttga atgatgcaac ttatcagagg acaagagctc ttgttcgcac cggaatggat 480 cccaggatgt gctctctgat gcaaggttca actctcccta ggaggtctgg agccgcaggt 540 gctgcagtca aaggagttgg aacaatggtg atggaattgg tcagaatgat caaacgtggg 600 atcaatgatc ggaacttctg gaggggtgag aatggacgaa aaacaagaat tgcttatgaa 660 agaatgtgca acattctcaa agggaaattt caaactgctg cacaaaaagc aatgatggat 720 caagtgagag agagccggaa cccagggaat gctgagttcg aagatctcac ttttctagca 780 cggtctgcac tcatattgag agggtcggtt gctcacaagt cctgcctgcc tgcctgtgtg 840 tatggacctg ccgtagccag tgggtacgac tttgaaaggg agggatactc tctagtcgga 900 atagaccctt tcagactgct tcaaaacagc caagtgtaca gcctaatcag accaaatgag 960 aatccagcac acaagagtca actggtgtgg atggcatgcc attctgccgc atttgaagat 1020 ctaagagtat taagcttcat caaagggacg aaggtgctcc caagagggaa gctttccact 1080 agaggagttc aaattgcttc caatgaaaat atggagacta tggaatcaag tacacttgaa 1140 ctgagaagca ggtactgggc cataaggacc agaagtggag gaaacaccaa tcaacagagg 1200 gcatctgcgg gccaaatcag catacaacct acgttctcag tacagagaaa tctccctttt 1260 gacagaacaa ccattatggc agcattcaat gggaatacag aggggagaac atctgacatg 1320 aggaccgaaa tcataaggat gatggaaagt gcaagaccag aagatgtgtc tttccagggg 1380 cggggagtct tcgagctctc ggacgaaaag gcagcgagcc cgatcgtgcc ttcctttgac 1440 atgagtaatg aaggatctta tttcttcgga gacaatgcag aggagtacga caattaa 1497 <210> 18 <211> 759 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 M <400> 18 atgagtcttc taaccgaggt cgaaacgtac gtactctcta tcatcccgtc aggccccctc 60 aaagccgaga tcgcacagag acttgaagat gtctttgcag ggaagaacac cgatcttgag 120 gttctcatgg aatggctaaa gacaagacca atcctgtcac ctctgactaa ggggatttta 180 ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 240 caaaatgccc ttaatgggaa cggggatcca aataacatgg acaaagcagt taaactgtat 300 aggaagctca agagggagat aacattccat ggggccaaag aaatctcact cagttattct 360 gctggtgcac ttgccagttg tatgggcctc atatacaaca ggatgggggc tgtgaccact 420 gaagtggcat ttggcctggt atgtgcaacc tgtgaacaga ttgctgactc ccagcatcgg 480 tctcataggc aaatggtgac aacaaccaat ccactaatca gacatgagaa cagaatggtt 540 ttagccagca ctacagctaa ggctatggag caaatggctg gatcgagtga gcaagcagca 600 gaggccatgg aggttgctag tcaggctaga caaatggtgc aagcgatgag aaccattggg 660 actcatccta gctccagtgc tggtctgaaa aatgatcttc ttgaaaattt gcaggcctat 720 cagaaacgaa tgggggtgca gatgcaacgg ttcaagtga 759 <210> 19 <211> 1698 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 HA <400> 19 atgaaggcaa acctactggt cctgttatgt gcacttgcag ctgcagatgc agacacaata 60 tgtataggct accatgcgaa caattcaacc gacactgttg acacagtact cgagaagaat 120 gtgacagtga cacactctgt taacctgctc gaagacagcc acaacggaaa actatgtaga 180 ttaaaaggaa tagccccact acaattgggg aaatgtaaca tcgccggatg gctcttggga 240 aacccagaat gcgacccact gcttccagtg agatcatggt cctacattgt agaaacacca 300 aactctgaga atggaatatg ttatccagga gatttcatcg actatgagga gctgagggag 360 caattgagct cagtgtcatc attcgaaaga ttcgaaatat ttcccaaaga aagctcatgg 420 cccaaccaca acacaaacgg agtaacggca gcatgctccc atgaggggaa aagcagtttt 480 tacagaaatt tgctatggct gacggagaag gagggctcat acccaaagct gaaaaattct 540 tatgtgaaca aaaaagggaa agaagtcctt gtactgtggg gtattcatca cccgcctaac 600 agtaaggaac aacagaatct ctatcagaat gaaaatgctt atgtctctgt agtgacttca 660 aattataaca ggagatttac cccggaaata gcagaaagac ccaaagtaag agatcaagct 720 gggaggatga actattactg gaccttgcta aaacccggag acacaataat atttgaggca 780 aatggaaatc taatagcacc aatgtatgct ttcgcactga gtagaggctt tgggtccggc 840 atcatcacct caaacgcatc aatgcatgag tgtaacacga agtgtcaaac acccctggga 900 gctataaaca gcagtctccc ttaccagaat atacacccag tcacaatagg agagtgccca 960 aaatacgtca ggagtgccaa attgaggatg gttacaggac taaggaacat tccgtccatt 1020 caatccagag gtctatttgg agccattgcc ggttttattg aagggggatg gactggaatg 1080 atagatggat ggtatggtta tcatcatcag aatgaacagg gatcaggcta tgcagcggat 1140 caaaaaagca cacaaaatgc cattaacggg attacaaaca aggtgaacac tgttatcgag 1200 aaaatgaaca ttcaattcac agctgtgggt aaagaattca acaaattaga aaaaaggatg 1260 gaaaatttaa ataaaaaagt tgatgatgga tttctggaca tttggacata taatgcagaa 1320 ttgttagttc tactggaaaa tgaaaggact ctggatttcc atgactcaaa tgtgaagaat 1380 ctgtatgaga aagtaaaaag ccaattaaag aataatgcca aagaaatcgg aaatggatgt 1440 tttgagttct accacaagtg tgacaatgaa tgcatggaaa gtgtaagaaa tgggacttat 1500 gattatccca aatattcaga agagtcaaag ttgaacaggg aaaaggtaga tggagtgaaa 1560 ttggaatcaa tggggatcta tcagattctg gcgatctact caactgtcgc cagttcactg 1620 gtgcttttgg tctccctggg ggcaatcagt ttctggatgt gttctaatgg atctttgcag 1680 tgcagaatat gcatctga 1698 <210> 20 <211> 1650 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of PB8 NA <400> 20 atgaatccaa atcagaaaat aataaccatt ggatcaatct gtctggtagt cggactaatt 60 agcctaatat tgcaaatagg gaatataatc tcaatatgga ttagccattc aattcaaact 120 ggaagtcaaa accatactgg aatatgcaac caaaacatca ttacctataa aaatagcacc 180 tgggtaaagg acacaacttc agtgatatta accggcaatt catctctttg tcccatccgt 240 gggtgggcta tatacagcaa agacaatagc ataagaattg gttccaaagg agacgttttt 300 gtcataagag agccctttat ttcatgttct cacttggaat gcaggacctt ttttctgacc 360 caaggtgcct tactgaatga caagcattca agtgggactg ttaaggacag aagcccttat 420 agggccttaa tgagctgccc tgtcggtgaa gctccgtccc cgtacaattc aagatttgaa 480 tcggttgctt ggtcagcaag tgcatgtcat gatggcatgg gctggctaac aatcggaatt 540 tcaggtccag ataatggagc agtggctgta ttaaaataca acggcataat aactgaaacc 600 ataaaaagtt ggaggaagaa aatattgagg acacaagagt ctgaatgtgc ctgtgtaaat 660 ggttcatgtt ttactataat gactgatggc ccgagtgatg ggctggcctc gtacaaaatt 720 ttcaagatcg aaaaggggaa ggttactaaa tcaatagagt tgaatgcacc taattctcac 780 tatgaggaat gttcctgtta ccctgatacc ggcaaagtga taatttcagg tccagataat 840 ggagcagtgg ctgtattaaa atacaacggc ataataactg aaaccataaa aagttggagg 900 aagaaaatat tgaggacaca agagtctgaa tgtgcctgtg taaatggttc atgttttact 960 ataatgactg atggcccgag tgatgggctg gcctcgtaca aaattttcaa gatcgaaaag 1020 gggaaggtta ctaaatcaat agagttgaat gcacctaatt ctcactatga ggaatgttcc 1080 tgttaccctg ataccggcaa agtgatgtgt gtgtgcagag acaattggca tggttcgaac 1140 cggccatggg tgtctttcga tcaaaacctg gattatcaaa taggatacat ctgcagtggg 1200 gtttcggtg acaacccgcg tcccgaagat ggaacaggca gctgtggtcc agtgtatgtt 1260 ggggagcaa acggagtaaa gggattttca tataggtatg gtaatggtgt ttggatagga 1320 aggaccaaag gtcacagttc cagacatggg tttgagatga tttgggatcc taatggatgg 1380 acagagactg atagtaagtt ctctgtgagg caagatgttg tggcaatgac tgattggtca 1440 gggtatagcg gaagtttcgt tcaacatcct gagctgacag ggctagactg tatgaggccg 1500 tgcttctggg ttgaattaat caggggacga cctaaagaaa aaacaatctg gactagtgcg 1560 agcagcattt ctttttgtgg cgtgaatagt gatactgtag attggtcttg gccagacggt 1620 gctgagttgc cattcagcat tgacaagtag 1650 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> 0028-Q220R-F <400> 21 aatggcgaga acaattgggt c 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > 0028-Q220R-R <400> 22 tttcgtttct gctttggagg 20

Claims (30)

(NS) -coding polynucleotides comprising the amino acid sequences of SEQ ID NOS: 3 and 4 of the pathogenic avian influenza virus A / chicken / Korea / KBNP-0028/2000 (H9N2); And
Polymerase B1 (PB1) coding polynucleotides, polymerase B2 (PB2) coding polynucleotides, polymerase A (PA) coding polynucleotides, nucleocapsid (NP) coding polynucleotides, matrix proteins (M) of the H1N1 strain of avian influenza virus ) Coding polynucleotides, hemagglutinating protein (HA) -coding polynucleotides and neuraminidase (NA) -coding polynucleotides;
And a composition for the production of avian influenza virus of the pathogenic H1N1 strain. delete 7. The composition of claim 1, wherein the variant non-protoplast-encoding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 6. The composition of claim 1, wherein the polymerase B1 (PB1) comprises the amino acid sequence of SEQ ID NO: 7. The composition of claim 1, wherein said Polymerase B1 (PB1) -coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 14. The composition of claim 1, wherein the polymerase B2 (PB2) comprises the amino acid sequence of SEQ ID NO: 8. 4. The composition of claim 1, wherein said Polymerase B2 (PB2) -coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: The composition of claim 1, wherein the polymerase A (PA) comprises the amino acid sequence of SEQ ID NO: 9. 7. The composition of claim 1, wherein the polymerase A (PA) -coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 16. 10. The composition of claim 1, wherein the nucleocapsid (NP) comprises the amino acid sequence of SEQ ID NO: 10. 7. The composition of claim 1, wherein the nucleocapsid (NP) -coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: The composition of claim 1, wherein the matrix protein (M) comprises the amino acid sequence of SEQ ID NO: 11. The composition of claim 1, wherein the matrix protein (M) coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 18. 12. The composition of claim 1, wherein the hemagglutinin protein (HA) comprises the amino acid sequence of SEQ ID NO: 12. The composition of claim 1, wherein the hemagglutinating protein (HA) -coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 19. The composition of claim 1, wherein the neuraminidase (NA) comprises the amino acid sequence of SEQ ID NO: 13. 2. The composition of claim 1, wherein the neuraminidase (NA) protein coding polynucleotide comprises the nucleotide sequence of SEQ ID NO: 20. 2. The composition of claim 1, wherein the H1N1 strain of avian influenza virus is an A / Puerto Rico / 8/34 (H1N1) virus. delete Variant type of non-pathogenic avian influenza (NS); And
The H1N1 strain of influenza viruses was isolated from the liver by PCR using polymerase B1 (PB1), polymerase B2 (PB2), polymerase A (PA), nucleocapsid (NP), matrix protein (M), hemagglutinin Neuraminidase (NA);
RTI ID = 0.0 &gt; H1N1 &lt; / RTI &gt; strain of avian influenza virus. 21. The recombinant H1N1 strain of avian influenza virus according to claim 20,
Variant non-asparaginous (NS) coding polynucleotides of pathogenic avian influenza; And
Polymerase B1 (PB1) coding polynucleotides, polymerase B2 (PB2) coding polynucleotides, polymerase A (PA) coding polynucleotides, nucleocapsid (NP) coding polynucleotides, matrix proteins (M) of the H1N1 strain of avian influenza virus ) Coding polynucleotides, hemagglutinating protein (HA) -coding polynucleotides and neuraminidase (NA) -coding polynucleotides;
Wherein the recombinant H1N1 strain of avian influenza virus further comprises a recombinant H1N1 strain of avian influenza virus. The recombinant H1N1 strain of avian influenza virus according to claim 21, wherein the recombinant H1N1 strain avian influenza virus is the accession number KCTC12732BP virus. A recombinant vector comprising a mutant non-asparagine (NS) coding polynucleotide of an infectious avian influenza virus;
A recombinant vector comprising the Polymerase B1 (PB1) coding polynucleotide of the H1N1 strain of avian influenza virus;
A recombinant vector comprising the Polymerase B2 (PB2) coding polynucleotide of the H1N1 strain of avian influenza virus;
A recombinant vector comprising the Polymerase A (PA) coding polynucleotide of the H1N1 strain of avian influenza virus;
A recombinant vector comprising a nucleocapsid (NP) coding polynucleotide of the H1N1 strain of avian influenza virus;
A recombinant vector comprising a matrix protein (M) coding polynucleotide of H1N1 strain avian influenza virus;
A recombinant vector comprising a hemagglutinin protein (HA) coding polynucleotide of H1N1 strain avian influenza virus; And
A recombinant vector comprising the neuraminidase (NA) coding polynucleotide of the H1N1 strain of avian influenza virus;
&Lt; / RTI &gt; 24. A cell transformed with the transforming composition of claim 23. 25. The cell of claim 24, wherein the cell is at least one selected from the group consisting of 293T, MDCK, Vero, DF1, PK15, and ST1 cells. 22. The avian influenza virus vaccine containing the recombinant H1N1 strain of avian influenza virus according to any one of claims 20 to 22 as an active ingredient. 27. The vaccine of claim 26, wherein the vaccine is a live monogamous. 22. A composition for the diagnosis of avian influenza virus, comprising an antisera to recombinant H1N1 strain of avian influenza virus according to any one of claims 20 to 22 as an active ingredient. A method of producing recombinant H1N1 strain avian influenza virus comprising contacting a cell with a composition of any one of claims 1 or 3 to 18 of a recombinant H1N1 strain avian influenza virus effective amount. 30. The method of claim 29, wherein the method further comprises isolating the recombinant H1N1 strain of avian influenza virus produced.

Images