KR101788096B1 - Kit and method for screening antibacterial compound using thiamine monophosphate kinase - Google Patents

Abstract

The present invention relates to screening kits and screening methods for antimicrobials using thiamine monophosphate kinase (ThiL). More particularly, the present invention relates to screening kits and screening methods for antimicrobial substances using thiamine monophosphate kinase (ThiL) Lt; RTI ID = 0.0 > and / or < / RTI > kits and methods to screen for substances that are effective in inhibiting and killing bacteria.

Description

TECHNICAL FIELD The present invention relates to a kit for screening antimicrobial substances using thiamine monophosphate kinase and a screening method for screening antibacterial compounds using thiamine monophosphate kinase,

The present invention relates to screening kits and screening methods for antimicrobials using thiamine monophosphate kinase (ThiL). More particularly, the present invention relates to screening kits and screening methods for antimicrobial substances using thiamine monophosphate kinase (ThiL) Lt; RTI ID = 0.0 > and / or < / RTI > kits and methods to screen for substances that are effective in inhibiting and killing bacteria.

Although there are a variety of antibiotics (or antimicrobials) used to control bacterial infections, the antibiotics may often be ineffective because of the inevitable resistance to antibiotics. The selection and dissemination of inherent or acquired antimicrobial resistance mechanisms among bacteria interferes with the various chemical methods of treatment including antibiotics that have so far been discovered and promotes the development of many bacterial species with antibiotic resistance. For these reasons, the mortality rate of recent bacterial infections is increasing. Therefore, there is a strong need to develop new therapeutic and prophylactic strategies to control infection by bacteria.

Among the various bacteria, Pseudomonas aeruginosa is known to be a highly adaptable environment for increasing ecological aptitude despite the presence of traditional antibiotic treatment methods. Rapidly Antibiotic-Resistant Clinical Separation Pseudomonas aeruginosa is becoming an increasingly popular alternative to phage therapy for the treatment of P. aeruginosa infection.

Korean Patent Publication No. 10-2015-0015589 discloses that the protein expressed by PA4834 plays a role as a siderophore transporter related to the transport mechanism of iron essential for the growth of P. aeruginosa, Pseudomonas aeruginosa antibiotics have been disclosed, but nevertheless there is still a need to find new targets for antibiotics of P. aeruginosa infection.

Biochemical pathways, on the other hand, control the synthesis and metabolism of molecules required by all living organisms. Blocking the metabolic pathway by inhibiting one or more enzymes in the pathway can sometimes result in deleterious consequences to the organism, or specific affliction, such as a congenital abnormality in metabolism, or death. Ultimately, suppression of pathways leading to the death of organisms is a priori suppression of pathways required for survival and is defined as essential pathways.

Thiamine pyrophosphate (TPP) is an essential cofactor in all organisms, from bacteria to humans. Bacteria can produce TPP through their own biosynthetic pathway, but mammals, including humans, Should be. In most cases, thiamine is the form taken by the cell, which is converted to TPP by thiamine pyrophosphokinase (TPK). Some bacteria also have TPK and utilize transported thiamine. However, Pseudomonas aeruginosa ) is an E. coli having only thiamine kinase (ThiK) instead of TPK ( Escherichia lt; / RTI > does not have a TPK homology gene in a genome similar to E. coli . In these bacteria, the thiamine transported is first converted to thiamine monophosphate (TMP n) by ThiK, and then the second phosphorylation reaction is carried out using the thiamine monophosphate kinase (ThiL), the last enzyme in the thiamine biosynthesis pathway ).

Therefore, the present inventors have found that ThiL can be a good target for antimicrobial molecules since it is essential for the TPM biosynthesis as well as the thiamine salvage pathway as a result of efforts to discover a new target of antimicrobial agent against P. aeruginosa infection And completed the present invention by developing a ThiL kinase assay kit.

Disclosure of the Invention The present invention has been conceived to solve the above-mentioned problems, and provides a kit capable of screening a substance that inhibits the activity of thiamine monophosphate kinase (ThiL).

It is another object of the present invention to provide a method for screening an antimicrobial substance using the screening kit.

In order to solve the above-mentioned problems, the present invention provides a thiamine monophosphate kinase (ThiL); ATP (adenosine triphosphate); Thiamine monophosphate (TMP); And a reagent capable of measuring the amount of ATP.

According to a preferred embodiment of the present invention, the antimicrobial substance may exhibit an antimicrobial activity against a bacterium having no thiamine pyrophosphokinase (TPK) protein or a gene encoding the thiamine pyrophosphokinase (TPK) protein.

According to another preferred embodiment of the present invention, the bacterium is Escherichia coli belonging to Enterobacteria coli , Salmonella species, and Pseudomonas aeruginosa .

According to another preferred embodiment of the present invention, the reagent capable of measuring the amount of ATP may indicate the amount of ATP through the intensity of luminescence.

The present invention also provides a method for screening an antimicrobial substance using the screening kit.

According to a preferred embodiment of the present invention, the screening method comprises the steps of: a) sequentially adding buffer, TMP and ATP to the tube 1; b) adding distilled water, ThiL protein and candidate material to tube 2; c) mixing tubes 1 and 2; d) adding the mixture of step c) to a test well containing a reagent capable of measuring the amount of ATP; And e) measuring light emission of the test well in the step d).

According to another preferred embodiment of the present invention, the activity of ThiL, which is based on the intensity of luminescence measured in step e), is suppressed by 70% or more as compared with the activity of ThiL measured in a control group to which no candidate substance is added , The candidate substance can be judged as an antimicrobial substance.

According to another preferred embodiment of the present invention, the antimicrobial substance may exhibit antimicrobial activity against a bacterium having no thiamine pyrophosphokinase (TPK) protein or a gene encoding the thiamine pyrophosphokinase (TPK) protein.

According to another preferred embodiment of the present invention, the bacterium is Escherichia coli belonging to Enterobacteria coli , Salmonella species, and Pseudomonas aeruginosa .

The antimicrobial substance against bacteria having no thiamine pyrophosphokinase (TPK) including P. aeruginosa can be rapidly and easily screened by measuring the inhibition level of ThiL using the screening kit provided in the present invention. The ThiL assay, which is based on the screening method of the present invention, is substrate specific and potent and very useful for the detection of ThiL inhibitors. Therefore, the screening kit and method of the present invention can provide a novel antimicrobial substance that does not have a TPK protein or a gene encoding the TPK protein, and can effectively inhibit or kill a bacterium ThiL is essential.

1 is a schematic diagram showing thiamine biosynthesis pathway and TPP-dependent enzymes of P. aeruginosa.
FIG. 2 is a graph showing the growth rate of the wild-type and thiE mutant pseudomonas aeruginosa according to the TPP administration concentration through the OD value and the concentration of TPP in the human body.
Fig. 3 shows a cleavage map of a recombinant vector expressing the ThiL protein.
FIG. 4 shows the activity of the enzyme according to the ThiL protein concentration as a value of RLU (Relative Light Unit) indicating the consumption of ATP in the ThiL kinase assays.
FIG. 5 is a graph showing the activity of ThiL by measuring the amount of ATP according to time after reacting with different substrate conditions at the time of performing ThiL kinase assays.
FIG. 6 shows the activity of ThiL by measuring the amount of ATP according to time after the reaction using TMP and thiamine as substrates respectively in the ThiL kinase assays.
Figure 7 is a graph showing growth rates of thiE mutants at various thiamine concentrations.

Hereinafter, the present invention will be described in more detail.

As described above, with the recent increase in the number of bacterial species with a high resistance to antibiotics, the mortality rate of recent bacterial infection patients is increasing, and there is a strong demand for the development of new therapeutic and preventive strategies to control bacterial infection .

Accordingly, the present invention has found that ThiL can be a good target for antimicrobial molecules, and a kit for screening antimicrobial substances through measurement of ThiL kinase activity is provided, thereby finding a solution to the above-mentioned problem. By measuring the inhibition level of ThiL using the kit of the present invention, it is possible to quickly and easily screen the antimicrobial substance against bacteria having no thiamine pyrophosphokinase (TPK) including Pseudomonas aeruginosa, Or capable of effectively inhibiting or killing bacteria that do not have a gene encoding the same.

The present invention relates to thiamine monophosphate kinase (ThiL); ATP (adenosine triphosphate); Thiamine monophosphate; And a reagent capable of measuring the amount of ATP.

The term "screening kit " of the present invention means a kit used for selecting a substance showing a specific effect among a plurality of candidate substances. For the purpose of the present invention, the screening kit may be, but not limited to, a kit for use in screening a substance capable of effectively inhibiting or killing bacteria by inhibiting the activity of ThiL.

In the present invention, the term "antimicrobial substance "," antibiotic substance ", or "antimicrobial molecule" have been used in combination, but all refer to substances exhibiting antibacterial activity against bacteria.

As shown in Fig. 1, the Pseudomonas aeruginosa strain was transformed into Escherichia coli having only thiamine kinase (ThiK) instead of TPK lt; / RTI > does not have a TPK homology gene in a genome similar to E. coli . In these bacteria, the transported thiamine is first converted to Thiamine monophosphate by ThiK, and then the second phosphorylation is carried out via the thiamine monophosphate kinase (ThiL), the last enzyme in the thiamine biosynthetic pathway It happens. Thus, ThiL is essential for TPP biosynthesis as well as the thiamine salvage pathway and can be a good target for antimicrobial molecules.

Addition of extracellular TPP may bypass ThiL, but TPP is not readily transported to the bacteria as shown in Fig. Figure 2 shows that thiE mutants that can not produce TPP and rely on extracellular TPP for growth require TPP replenishment in excess of 100 uM for wild-type growth. However, since only 140 nM of TPP is available in human blood, ThiL inhibition will kill P. aeruginosa in the human body.

Therefore, the antimicrobial substance screened by the kit of the present invention does not have a TPK protein or a gene encoding the TPK protein, and thus can exhibit an antimicrobial activity against all bacteria in which ThiL is essential. Preferably, Escherichia coli , Salmonella Salmonella species, and Pseudomonas aeruginosa , but the present invention is not limited thereto.

In a preferred embodiment of the present invention, a pET 28b thiL (BL21) vector for expressing the ThiL protein was prepared, and the cleavage map of the prepared vector was as shown in FIG. The thiL gene sequence information used in the recombinant vector is available from a known database, and specifically the thiL gene sequence may be as disclosed in NCBI Reference Sequence NP 25740.1.

The wild type ThiL of Pseudomonas aeruginosa isolated through the expression of the recombinant vector was purified as a recombinant protein having a His tag. As shown in FIG. 4, the consumption of ATP increased according to the throughput of the purified protein, Lt; RTI ID = 0.0 > ThiL < / RTI >

In the screening kit of the present invention, the reagent capable of measuring the amount of ATP is not particularly limited as long as it can measure the amount of ATP, but may be one that measures the amount of ATP through the intensity of light emission. In one embodiment of the present invention, the amount of ATP remaining after the reaction was measured using a commercially available Kinase-glo ^® reagent (Promega).

The present invention also provides a method for screening an antimicrobial substance using the screening kit.

The screening method comprises: a) adding buffer, TMP and ATP to the tube 1 in order; b) adding distilled water, ThiL protein and candidate material to tube 2; c) mixing tubes 1 and 2; d) adding the mixture of step c) to a test well containing a reagent capable of measuring the amount of ATP; And e) measuring light emission of the test well in the step d).

First, the step a) will be described.

The buffer of step a) is not particularly limited as long as it is a commonly used reaction buffer, but it may preferably have the composition of Table 2. ATP and TMP are used as substrates for ThiL, and ATP is used as a measure of the activity of ThiL. ATP and TMP can be diluted appropriately for distilled water considering the amount used.

Next, step b) will be described.

ThiL in step b) is a kinase that produces TPP using ATP and TMP as substrates, and commercially available products can be used. In one embodiment of the present invention, a pET 28b thiL (BL21) vector was prepared as described above, and a wild-type ThiL recombinant protein of Pseudomonas aeruginosa having His tag was prepared and used.

The candidate substance of step b) refers to a substance that can be applied to a patient suffering from a bacterial infection to improve or modify the symptoms of the patient. ThiL-suppressing substances may be included without limitation.

Next, the step c) will be described.

The step c) may be performed by mixing tubes 1 and 2 prepared in steps a) and b), for example, using a pipette. Immediately after mixing, the mixture is immediately subjected to the d) step of adding to the test well containing the reagent capable of measuring the amount of ATP. At this time, the mixing time is set to time 0. In one embodiment of the present invention, the mixture was transferred to a test well containing a reagent capable of measuring the amount of ATP every 5 minutes after time 0, waited 10 minutes after the final test for stabilizing the luminescence signal, The measurement step e) was performed.

In step e), ThiL measures the amount of ATP remaining after completion of the reaction for producing TPP using ATP and TMP as a substrate. The intensity of the light emitted by the reagent for measuring the amount of ATP is measured using a photometer .

If the activity of ThiL based on the intensity of the luminescence measured in the step e) is inhibited by 70% or more as compared with the activity measured in the control group to which the candidate substance is not added, the candidate substance can be judged to be an antimicrobial substance.

FIG. 5 shows that the antimicrobial screening method of the present invention uses a substrate-specific ThiL kinase reaction, and detects only the activity of ThiL with ATP and TMP.

Furthermore, FIG. 6 shows that the ThiL protein (wild type) reacts only when TMP is used as a substrate, but not when thiamine is used as a substrate. This demonstrates that the screening kit of the present invention and the screening method using the same are useful for detecting substrate specific and robust ThiL inhibitors.

In one embodiment of the present invention, experiments were conducted as described in Example 7 to establish a criterion as to what degree of inhibition of ThiL activity could be judged as antimicrobial agents suitable for treating bacterial infections. As a result, as shown in Fig. 7, when thiamine concentration in the medium was reduced to 1/3 (16.7 [mu] M, about 70% reduction) when the thiE mutant growth rate in the medium containing 50 [mu] thiE mutant pseudomonas aeruginosa growth was reduced by about 35%, and inhibition of ThiL activity by 70% or more in antibiotics resistant Pseudomonas aeruginosa including wild type caused 70% or more decrease of intracellular TPP production, By at least 35%.

Therefore, a substance that inhibits the activity of ThiL by 70% or more inhibits growth of Pseudomonas aeruginosa, which is resistant to wild-type and existing antibiotics, and thus is an antibacterial substance suitable for the combination treatment with single or other antimicrobial substances in the prevention or treatment of P. aeruginosa infection It can be judged.

The present invention will now be described more specifically with reference to the following examples. However, the following examples should not be construed as limiting the scope of the present invention, and should be construed to facilitate understanding of the present invention.

Preparation of bacteria and badges

Thiamine-phosphate synthase (thiE) transposon variant Pseudomonas aeruginosa was purchased from the University of Washington and was transformed with 60 μg / ml of tetracycline for mutant selection and 50 μM of thiamine supplemented with 50 μM Luria-Bertani) medium. As a control, PAO1 (wild type) was maintained in LB medium without supplement. Both strains were shake-cultured at 37 ° C and 180 rpm.

reagent

Thiamine and thiamine pyrophosphate (TPP) were dissolved in water and diluted with M9 glucose medium to give a final concentrate. 4 mM TPP was diluted 2-fold to 14 points, and 5 μl of each dilution point was added to the test well.

TPP  Dose response experiment

Day before the experiment, PAO1 with the thiE mutant M9-glucose medium _{(Na 2 HPO 4 6.78 g /} L, KH 2 PO 4 3 g / L, NH 4 Cl 1 g / L, NaCl 0.5 g / L, MgSO 4 0.49 g / L, CaCl ₂ 0.014 g / L, and glucose 3.6 g / L) and 50 μM M9 glucose thiamine medium, respectively. The following day, the overnight cultures were inoculated again in fresh, identical media with a 1: 20 dilution ratio. Thereof when the growth has reached the logarithmic (log-phase), the bacterial culture was diluted in M9-glucose mucin (2.5 / L) medium to give a final inoculum size of 0.00025 to ₆₀₀ OD. 45 μl of the diluted culture was transferred to a testing well containing 5 μl of TPP. The test was carried out on a 384-well microplate with black transparent bottom (Greiner # 781091). Binwells were filled with PBS to minimize edge effects due to dehydration and heat distribution. When addition of the reagents was complete, the plates were placed in a 37 ° C incubator for 18 hours. Growth was measured by absorbance (600 nm) using a spectrophotometer.

As a result, it was confirmed that the TPP was not easily transported to the bacteria as shown in Fig. Figure 2 shows that thiE mutants that can not produce TPP and rely on extracellular TPP for growth require TPP replenishment in excess of 100 uM for wild-type growth. However, since only 140 nM of TPP is available in the human blood as shown in the table of Fig. 2, ThiL inhibition will kill P. aeruginosa in the human body.

ThiL  Protein expression protocol

In order to express the ThIL protein, pET 28b thiL (BL21) recombinant vector was prepared by the following procedure.

Vector Production Course

A primer (forward primer: TAGGTTCATATGGGTGAGTTCGAGCTGATCCGCC, reverse primer: TAGGTTAAGCTTTCAGTCACGTTGGGTTCCGAAATGTTGG) is prepared by PCR with the restriction enzyme endonuclease sequence of NdeI and HindIII, and the thiL gene of P. aeruginosa is amplified by polymerase chain reaction (PCR). The amplified thiL gene and the resulting pET28b vector are cut with restriction enzymes and ligated to produce a recombinant vector. Made recombinant vector is then transformed in E. coli BL21, markers (selection marker) of Kanamycin transformed E was applied on LB agar containing 50 μg / ml. to obtain E. coli BL21. Transfected E. coli BL21 is identified by sequencing and PCR.

Inoculation and induction

E. coli BL21 transformed with pET 28b thiL vector was inoculated on LB containing kanamycin 50 μg / ml and incubated overnight at 37 ° C. and 180 rpm. Then, 3 ml of the culture was added to 300 ml of LB containing 50 μg / ml kanamycin (1: 100 dilution) until the OD reached 0.3-0.5 (2 hr 30 min), followed by addition of 1 mM IPTG and incubation at 37 ° C for 3 hrs.

Ultrasonic grinding

After 3 hours, the culture was transferred to a centrifuge tube (50 ml), centrifuged at 3300 rpm for 10 minutes, and the supernatant was discarded. At this time, the cell pellet can be stored at -20 ° C. The cell pellet was resuspended in 5 ml of DPBS supplemented with a protease inhibitor. After sonication at 4 ° C for 10 cycles (total 10 minutes), the sonicated bacteria were transferred to a 2 ml tube and centrifuged at 14,000 rpm for 1 minute. The supernatant was collected in a 50 ml tube.

refine

The storage buffer in the column was removed and 10 ml of binding buffer was loaded. The collected supernatant was loaded onto the column and loaded with 10 ml of wash buffer. The 1.5 ml elution buffer was separated and loaded three times and only the last two elutions were collected.

Desalting by filtration

A sample of all eluted proteins (3 ml) was transferred to a filter column (30K) and 1 ml of Tris HCl pH 8.0 was added to the column. Centrifugation at 4,000 rpm (maximum rpm) for 15 minutes and all remaining capacity was collected by sweeping the pipette tip in the column. The collection was resuspended in 2 ml of Tris HCl.

Protein dilution

The protein concentration was determined by the Bradford method and the protein was diluted to 1 mg / ml. Once dilution was achieved, the protein was aliquoted in small doses. Proteins were rapidly frozen in liquid nitrogen and frozen proteins were stored in liquid nitrogen.

ThiL  protein Assay  protocol

The ThiL protein assay developed in the present invention is a kinase assay system specifically designed for the isolated ThiL protein. The ThiL protein is a kinase that produces TPP using both ATP and TMP as substrates. Thus, measuring the residual ATP in the reaction quantifies the kinase activity. This assay utilizes a Promega kinase-glo ^® luminescent kinase assay platform (luminescent kinase assay platform).

Kinase - glo ^®  Preparation of luminescent kinase reagent

The Kinase-glo ^® was added to buffer (V379B) is dissolved at room temperature (dissolved in the water for a more rapid thawing). The total buffer volume was then added to the substrate brown bottle and shaken and inverted gently to reconstitute the frozen substrate. ^® Kinase-glo reagent was stored at -20 ℃ use immediately, or separated with a small capacity (1ml).

ThiL kinase assay conditions are shown in Table 1 below.

The reaction buffer is prepared in the composition shown in Table 2 below.

ATP (100 mM) and TMP (200 mM) were dissolved in distilled water to prepare a substrate and diluted to a suitable concentration.

Reaction tube preparation

Two 1.5 ml tubes were used for the reaction. Tube 1 contains ATP, TMP and reaction buffer. Tube 2 contains protein dissolved in distilled water. Tube 1 is prepared (added in the amount described in Table 1) by adding buffer, TMP, and ATP in order. Tube 2 is prepared by adding protein to distilled water (added in the capacity shown in Table 1). Mix tubes 1 and 2 by pipetting them at least 5 times.

Kinase - glo ^® Kinase Reaction Measurements by

Preparation of a white plate (BD # 353296), followed by the addition of 50 μl of Kinase-glo reagent ^® in the test wells.

The entire volume of tube 2 was transferred to tube 1 and mixed well by pipetting. The reaction (tubes 1 and 2) of 50 μl immediately transferred to a test well containing the Kinase-glo reagent ^®. This time is zero. After the 50 μl reaction was every 5 minutes Kinase-glo ^® reagent after the last test for stabilization transferred light-emitting signal to the test well, wait 10 minutes available photometric light emission at each reaction time using the (Spectra Max M5) containing the Were measured. The emission signal is maintained for at least one hour.

The activity of the ThiL protein prepared in Example 2 using the ThiL protein assay of Example 3 was verified as follows. ThiL kinase assay conditions were as follows.

Assay conditions: 20 [mu] M ATP; 50 [mu] M TMP; Of 50mM Tris-HCl, 5mM MgCl ₂ And 0.35 M KCl; 6, 17, 50 and 150 μg of ThiL protein dissolved in 300 μL of total reaction volume, reaction at room temperature for 1 hour.

As a result of the assay under the above conditions, it was confirmed that the consumption of ATP was increased in proportion to the amount of protein as shown in FIG. Thus, it can be seen that the ThiL protein prepared in Example 2 shows activity.

ThiL  Verification of Substrate Specificity of Kinase Reaction

In order to verify the substrate specificity of the ThiL kinase reaction, the ThiL protein assay of Example 3 was used to conduct experiments under the following three conditions.

Assay Condition 1: 20 μM ATP, 50 μM TMP and 150 μg ThiL protein.

Assay Condition 2: 0 μM ATP, 50 μM TMP and 150 μg ThiL protein (no ATP).

Assay Condition 3: 20 μM ATP, 0 μM TMP and 150 μg ThiL protein (no TMP).

All three assay conditions were 50 mM Tris-HCl, 5 mM MgCl ₂ And a buffer containing 0.35M KCl was used and reacted for 0 to 140 minutes.

As a result, as shown in FIG. 5, it was confirmed that the amount of ATP was decreased with time as ThiL protein used ATP and TMP as a substrate in Assay Condition 1. However, in the case of Assay Conditions 2 and 3 without ATP or TMP, the reaction did not occur and the amount of ATP remained unchanged (Assay Condition 2), indicating the minimum background signal (Assay Condition 3). This confirms that ThiL kinase assays detect only the activity of ThiL with ATP and TMP.

The ThiL protein assay of Example 3 was used to further verify the substrate specificity of ThiL. In this example, the amount of residual ATP in the case of reacting using TMP as a substrate and the reaction using thiamine as a substrate was measured and compared.

When thiamine was used as a substrate, the experiment was carried out under the same conditions as the case of using TMP as a substrate, except that thiamine was used as a substrate instead of TMP.

As a result, as shown in FIG. 6, the ThiL protein (wild type) showed a reaction only when TMP was used as a substrate, and no reaction was observed when thiamine was used as a substrate. This demonstrates that the ThiL assay of the present invention is useful for detecting substrate specific and robust ThiL inhibitors.

At various thiamine concentrations thiE   Mutant  Measure growth rate

Since thiE mutants do not synthesize TPP, their growth depends on thiamine transported from the same environment as the culture medium. Based on this fact, in this example, the growth rate of thiE mutants in the medium containing various concentrations of thiamine was measured to confirm the minimum concentration of thiamine that starts to inhibit the growth of P. aeruginosa. Through the identified thiamine concentration, Respectively.

For this, thiE mutants of P. aeruginosa described in Example 1 were cultured in the presence of M9 glucose supplemented with 50 μM, 16.7 μM, 5.6 μM and 0 μM of thiamine (Na ₂ HPO ₄ 6.78 g / L, KH ₂ PO ₄ 3 g / L , NH ₄ Cl 1 g / L, NaCl 0.5 g / L, MgSO ₄ 0.49 g / L, CaCl ₂ 0.014 g / L, and glucose 3.6 g / L).

As a result, as shown in Fig. 7, when thiamine concentration in the medium was reduced to 1/3 (16.7 [mu] M, about 70% reduction) when the thiE mutant growth rate in the medium containing 50 [mu] It was confirmed that the growth of P. aeruginosa was reduced by about 35%. Based on these results, it can be deduced that inhibition of ThiL activity by 70% or more in antibiotic-resistant P. aeruginosa including wild type causes a reduction of 70% or more of intracellular TPP production and at least 35% of growth rate of P. aeruginosa there was.

Therefore, a substance that inhibits the activity of ThiL by 70% or more inhibits growth of Pseudomonas aeruginosa, which is resistant to wild-type and existing antibiotics, and thus is an antibacterial substance suitable for the combination treatment with single or other antimicrobial substances in the prevention or treatment of P. aeruginosa infection It can be judged.

<110> Institut Pasteur Korea <120> Kit and method for screening antibacterial compound using          thiamine monophosphate kinase <130> 1060592 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> thiL forward primer <400> 1 taggttcata tgggtgagtt cgagctgatc cgcc 34 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> thiL reverse primer <400> 2 taggttaagc tttcagtcac gttgggttcc gaaatgttgg 40

Claims (9)

Thiamine monophosphate kinase (ThiL);
ATP (adenosine triphosphate);
Thiamine monophosphate; And
A reagent capable of measuring the amount of ATP;
, Which exhibits antibacterial activity against Pseudomonas aeruginosa . delete delete The screening kit according to claim 1, wherein the reagent capable of measuring the amount of ATP indicates the amount of ATP through the intensity of light emission. A screening method of an antimicrobial substance exhibiting an antimicrobial activity against P. aeruginosa using the screening kit of claim 1. 6. The method of claim 5,
a) adding buffer, TMP and ATP to tube 1 in order;
b) adding distilled water, ThiL protein and candidate material to tube 2;
c) mixing tubes 1 and 2;
d) adding the mixture of step c) to a test well containing a reagent capable of measuring the amount of ATP; And
e) measuring light emission of the test well in step d);
Wherein the antimicrobial agent is a compound of formula (I). 7. The method of claim 6, wherein the activity of ThiL, which is based on the intensity of the luminescence measured in step e), is inhibited by 70% or more compared to the activity of ThiL measured in a control group to which no candidate substance is added, And the substance is judged to be a substance. delete delete

Images