KR101783256B1 - DNA-Mn hybrid paticles and manufacturing method thereof - Google Patents
DNA-Mn hybrid paticles and manufacturing method thereof Download PDFInfo
- Publication number
- KR101783256B1 KR101783256B1 KR1020150191735A KR20150191735A KR101783256B1 KR 101783256 B1 KR101783256 B1 KR 101783256B1 KR 1020150191735 A KR1020150191735 A KR 1020150191735A KR 20150191735 A KR20150191735 A KR 20150191735A KR 101783256 B1 KR101783256 B1 KR 101783256B1
- Authority
- KR
- South Korea
- Prior art keywords
- dna
- particles
- present
- manganese
- hybrid
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C01—INORGANIC CHEMISTRY
- C01G—COMPOUNDS CONTAINING METALS NOT COVERED BY SUBCLASSES C01D OR C01F
- C01G45/00—Compounds of manganese
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Inorganic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Luminescent Compositions (AREA)
Abstract
The present invention relates to a DNA-Mn hybrid particle and a method for producing the DNA-Mn hybrid particle, and more particularly, to a DNA-Mn hybrid particle and a method for producing the DNA- And manganese is used together to produce particles in which DNA and manganese are bound to each other. Thus, manganese acts as a coenzyme to promote the activity of the DNA polymerase, and the biomaterial The present invention relates to DNA-Mn hybrid particles capable of widening the application field of DNA and a method for producing the same.
Description
The present invention relates to a DNA-Mn hybrid particle and a method for producing the DNA-Mn hybrid particle, and more particularly, to a DNA-Mn hybrid particle and a method for producing the DNA- And manganese is used together to produce particles in which DNA and manganese are bound to each other. Thus, manganese acts as a coenzyme to promote the activity of the DNA polymerase, and the biomaterial The present invention relates to DNA-Mn hybrid particles capable of widening the application field of DNA and a method for producing the same.
Nucleic acids such as DNA and RNA have attracted much attention as biomaterials for biotechnology due to their characteristics. Recently, a therapeutic agent for a disease using nucleic acid has been developed as in the following patent documents.
<Patent Literature>
10-1998-0701695 (published on Jun. 25, 1998) "recombinant DNA in which DNA encoding myosin heavy chain SM1 isoform protein is inserted into vector DNA, an organism into which an electro-recombinant DNA is introduced, Sclerosis drug "
However, the technology using the conventional nucleic acid is mainly limited to the biotechnology field, and the technology for utilizing nucleic acid such as DNA in other fields other than biotechnology is not widely studied, and there is a problem that the perfection of the technology is poor.
Therefore, there is an increasing need to develop a technique that can effectively utilize particles prepared by combining substances capable of imparting different functions to nucleic acids such as DNA, in other fields other than biotechnology.
SUMMARY OF THE INVENTION The present invention has been made to solve the above problems,
The present invention provides DNA-Mn hybrid particles having both DNA characteristics and manganese characteristics, and a method for producing the same.
It is another object of the present invention to provide a DNA-Mn hybrid particle in which manganese, which is a constituent of particles to be produced, can promote the activity of DNA polymerase in the course of production and promote the generation of particles, and a method for producing the same.
It is another object of the present invention to provide a DNA-Mn hybrid particle capable of using DNA as a biomaterial as a material of an energy storage device and a method for producing the same.
In order to achieve the above object, the present invention is implemented by the following embodiments.
According to an embodiment of the present invention, a method for preparing a DNA-Mn hybrid particle according to the present invention uses manganese in the course of polymerizing DNA using a DNA polymerase to form a DNA- .
According to another embodiment of the present invention, there is provided a method for producing a DNA-Mn hybrid particle according to the present invention, comprising the steps of: generating a circular replication DNA; And a particle producing step of producing manganese-bound particles by using manganese together in a process of producing new strand DNA by using a polymerase.
According to another embodiment of the present invention, in the method for producing DNA-Mn hybrid particles according to the present invention, the particles are characterized by having a spherical shape.
According to another embodiment of the present invention, in the method for producing DNA-Mn hybrid particles according to the present invention, each of the particles has a plurality of layered structures.
According to another embodiment of the present invention, in the method for producing a DNA-Mn hybrid particle according to the present invention, the manganese promotes the activity of the DNA polymerase.
According to another embodiment of the present invention, in the method for producing a DNA-Mn hybrid particle according to the present invention, the particle is used as a material of an energy storage device.
According to another embodiment of the present invention, in the method for producing DNA-Mn hybrid particles according to the present invention, the size and shape of the particles can be changed by controlling the amount of manganese used.
According to another embodiment of the present invention, in the method for producing a DNA-Mn hybrid particle according to the present invention, the DNA generating step may include a nucleotide sequence allowing complementary binding to a primer at both ends, And a ligation step of ligation of the nick portion by addition of a lyase to the hybridization step.
According to another embodiment of the present invention, the DNA-Mn hybrid particle according to the present invention is formed by combining DNA and Mn.
According to another embodiment of the present invention, the DNA-Mn hybrid particle according to the present invention has a spherical shape and one spherical particle has a plurality of layered structures.
According to the present invention, the following effects can be obtained by this embodiment.
The present invention has both DNA and manganese properties.
In addition, the present invention has the effect of promoting the production of particles by promoting the activity of DNA polymerase in the production process of manganese, which is a constituent of the particles to be produced.
Further, the present invention has an effect of enabling DNA, which is a biomaterial, to be used as a material of an energy storage device.
1 is a SEM image of particles according to one embodiment of the present invention.
Figure 2 is a TEM image of a particle according to one embodiment of the present invention.
3 is a 3D SEM image of a particle according to one embodiment of the present invention.
Figure 4 is a fluorescence microscope image of a particle according to one embodiment of the present invention.
5 is a graph showing EDX analysis results of particles according to one embodiment of the present invention.
FIG. 6 is a SEM image of the particles prepared according to the concentration change of Mn
FIG. 7 is a graph showing a cyclic voltammetry experiment result of particles according to an embodiment of the present invention. FIG.
Hereinafter, DNA-Mn hybrid particles according to the present invention and a method for producing the same will be described in detail with reference to the accompanying drawings. Unless defined otherwise, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and, if conflict with the meaning of the terms used herein, It follows the definition used in the specification. Further, the detailed description of known functions and configurations that may unnecessarily obscure the subject matter of the present invention will be omitted. Throughout the specification, when an element is referred to as "including " an element, it is understood that the element may include other elements as well, without departing from the other elements unless specifically stated otherwise.
Hereinafter, DNA-Mn hybrid particles according to the present invention and a method for producing the same will be described in detail with reference to the accompanying drawings. Unless defined otherwise, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and, if conflict with the meaning of the terms used herein, It follows the definition used in the specification. Further, the detailed description of known functions and configurations that may unnecessarily obscure the subject matter of the present invention will be omitted. Throughout the specification, when an element is referred to as "including " an element, it is understood that the element may include other elements as well, without departing from the other elements unless specifically stated otherwise.
One embodiment of the present invention relates to a method for producing DNA-Mn hybrid particles. In the method for producing DNA-Mn hybrid particles, manganese is used in the process of polymerizing DNA using a DNA polymerase, And manganese-bonded particles are formed. Specifically, the method for producing the DNA-Mn hybrid particles comprises: a DNA producing step of producing a circular DNA for replication; and a step of preparing DNA of a new strand using the DNA polymerase, And manganese is used together to generate particles in which DNA and manganese are combined.
The step of generating DNA is a step of generating a circular DNA for replication. The step of generating DNA is a step of generating a circular DNA for replication, in which a base sequence for allowing complementary binding to the primer at both ends, ssDNA having an arbitrary base sequence at the center is mixed with a primer, And a ligation step of ligating the nick portion by further adding a lagase after the hybridization step. The DNA for replication produced after the ligating step has a complete circular shape.
In the particle generation step, manganese is used together with the circular replication DNA generated in the DNA production step to generate a DNA-manganese-bound particle in the process of generating a new strand DNA by using a DNA polymerase DNA cloning DNA, a DNA polymerase and a manganese compound are added together and reacted at a constant temperature for a predetermined time to prepare DNA-Mn hybrid particles in which DNA and Mn are combined. The manganese is abundantly present in the crust and requires a trace amount in the human body. In the particle generation step, the manganese promotes the activity of the DNA polymerase and, at the same time, And hybridized to produce DNA-Mn hybrid particles. The DNA-Mn hybrid particles have a spherical shape, and each of the DNA-Mn hybrid particles has a plurality of layered structures. In addition, the size and shape of the particles can be changed by controlling the amount of manganese used in the particle generating step. Further, the DNA-Mn hybrid particles can be used as a material of an energy storage device.
Another embodiment of the present invention includes DNA-Mn hybrid particles produced by the above-mentioned method for producing DNA-Mn hybrid particles.
Hereinafter, the present invention will be described in more detail by way of examples. However, these are only for the purpose of illustrating the present invention in more detail, and the scope of the present invention is not limited thereto.
≪ Example 1 > Production of circular DNA for replication
1) both ends of the ssDNA [5'-ATAGTGAGTCGTATTAACGTACCAACAAATGTGAATGCAGACCAAAGAATTACTTGAATTCTTTGGTCTGCATTCACATTTTAGAGGCATATCCCT-3 '] having an arbitrary base sequence (ACGTACCAACAAATGTGAATGCAGACCAAAGAATTACTTGAATTCTTTGGTCTGCATTCACATTTTAGAGGCAT) the nucleotide sequence (ATAGTGAGTCGTATTA, ATCCCT) and a center to allow the primers and the complementary coupling designed to. Then, a primer [5'-TAATACGACTCACTATAGGGAT-3 '] was designed.
2) The ssDNA and the primer were added to the nuclease-free water so that the concentration of the ssDNA and the primer was 10 μM, and then the ssDNA and the primer were bound together using a thermal cycler (
3) Afterwards, in order to ligate the nick portion, Ligase buffer and T4 Ligase were added to the resulting solution in step 2) of Example 1, , And the mixture was ligation at room temperature for 8 hours to prepare a circular DNA for replication.
<Example 2> Preparation of DNA-Mn hybrid particles
1) To clone the new strand DNA from the circular DNA for replication, circular DNA (0.3 pmol) was added with phi29 DNA polymerase (500 units), rNTP mix (200 nmol), 40 mM Tris-HCl, 50 mM KCl, NH 4 ) 2 SO 4 , 4 mM DTT (
2) 2 mM MnCl 2 was also mixed in the procedure 1) of Example 2 to bind the manganese to the duplicated DNA.
3) After the procedure of 1) and 2) of Example 2, DNA-Mn hybridization was carried out by reacting at 30 ° C for 20 hours.
<Example 3> Identification of size and shape of DNA-Mn hybrid particles
1) The particles prepared in Example 2 were analyzed using a scanning electron microscope (SEM) with different magnifications and are shown in FIGS. 1 (a) and 1 (b). In addition, the particles prepared in Example 2 were analyzed using a transmission electron microscope (TEM) and a 3D SEM, and they are shown in FIGS. 2 and 3, respectively.
2) Through SEM images of FIGS. 1 (a) and 1 (b), spherical particles having a diameter of 7 to 10 탆 can be identified. One spherical particle is composed of several layered structures, 60 nm. In addition, it was confirmed from the TEM image of FIG. 2 that the particle shape consistent with the SEM image of FIGS. 1 (a) and 1 (b) was confirmed. Also, the solidity of the spherical particles was confirmed through the 3D SEM image of FIG.
<Example 4> Identification of constituents of DNA-Mn hybrid particles
1) The particles prepared in Example 2 were stained with DNA staining dyes DAPI, SYBR Green and SYTOX Orange, respectively, and then analyzed using a fluorescent microscope (Eclipse Ti (Nikon) (a), (b) and (c).
2) The particles prepared in Example 2 were confirmed by Energy Dispersion X-ray (EDX) and are shown in FIG. 5 and Table 1 below. FIG. 5 is a graph showing the results of analysis of the EDX spectrum, and Table 1 shows the content of particles prepared in Example 2. FIG.
3 (a), (b) and (c) of FIG. 4, it can be seen that the particles prepared in Example 2 were composed of DNA because the particles had strong fluorescent light. 5 and Table 1 show that the particles prepared in Example 2 were composed of carbon (C), nitrogen (N), oxygen (O), phosphorus (P) and manganese (Mn). Therefore, it can be seen that the particles prepared in Example 2 consisted of DNA and Mn.
<Example 5> Confirmation of morphology of DNA-Mn hybrid particles according to the change of Mn concentration
1) DNA-Mn hybrid particles were prepared in the same manner as in Example 2 except that 0.4 mM MnCl 2 was used instead of 2.0 mM MnCl 2 .
2) The particles prepared in Example 2 and the particles prepared in 1) of Example 5 were analyzed using SEM and are shown in FIGS. 6 (a) and 6 (b), respectively.
6 (a) and 6 (b) show that when the manganese concentration is varied in the manufacturing process, the arrangement of the layers constituting the particle changes, and the overall shape of the manganese varies. It is because it affected.
<Example 6> Confirmation that DNA-Mn hybrid particles can be used as an energy storage material
1) Whether the particles prepared in Example 2 can be used as a material of an energy storage device is confirmed by a cyclic voltammetry experiment and is shown in FIGS. 7 (a) and 7 (b). The cyclic voltammetry experiment was carried out using a three-electrode cell type, in which particles prepared in Example 2 and carbon were mixed and used as a working electrode. Ag / AgCl (3M NaCl) and platinum were used as a reference electrode and a conter electrode, respectively . The data in Figures 7 (a) and 7 (b) were obtained in an aqueous solution of 1.0 M Na 2 SO 4 and Figure 7 (a) shows the changing potential (V ws. Ag / AgCl) and sweep rate (V ws. Ag / AgCl) and the sweep rate (mVS -1 ) of the DNA-Mn hybrid particle electrode under the sweep rate (mVS -1) ) Is the specific capacitance plot of the DNA-Mn hybrid particle electrode.
2) The current and specific capacitance were measured by changing the voltage from 10mV / s to 2000mV / s. As a result, it was confirmed that the redox peak was clear and that the maximum value was 92F / g Mn at 10mV / s 7 (a)). In addition, it was confirmed that the position of the peak slightly shifted under various current density conditions (see FIG. 7 (b)). It can be seen that the above-mentioned phenomenon appears in a capacitor which is one of the energy storage materials, and that the particles prepared in Example 2 can be used as an energy storage material.
While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Should be interpreted as belonging to the scope.
Claims (10)
The particle generation step is performed by adding circular DNA for replication, a DNA polymerase and a manganese compound together and reacting at a constant temperature for a predetermined time,
Wherein the particles are used as a material of an energy storage device.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150191735A KR101783256B1 (en) | 2015-12-31 | 2015-12-31 | DNA-Mn hybrid paticles and manufacturing method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020150191735A KR101783256B1 (en) | 2015-12-31 | 2015-12-31 | DNA-Mn hybrid paticles and manufacturing method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20170080334A KR20170080334A (en) | 2017-07-10 |
| KR101783256B1 true KR101783256B1 (en) | 2017-09-29 |
Family
ID=59356103
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150191735A KR101783256B1 (en) | 2015-12-31 | 2015-12-31 | DNA-Mn hybrid paticles and manufacturing method thereof |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101783256B1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110008797A1 (en) | 2008-03-20 | 2011-01-13 | Fraunhofer-Gesellschaft Zur Foederung Der Angewandten Forschung E.V. | Method and device for the thermal control of temperature-dependent enzymatic reactions using magnetic particles or magnetic beads and alternating magnetic fields |
-
2015
- 2015-12-31 KR KR1020150191735A patent/KR101783256B1/en active IP Right Grant
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110008797A1 (en) | 2008-03-20 | 2011-01-13 | Fraunhofer-Gesellschaft Zur Foederung Der Angewandten Forschung E.V. | Method and device for the thermal control of temperature-dependent enzymatic reactions using magnetic particles or magnetic beads and alternating magnetic fields |
Non-Patent Citations (2)
| Title |
|---|
| Journal of Applied Physics, Vol.115, pp.114108(1-5) (2014.3.)* |
| Nanobiotechnology, Vol.13, No.54, pp.1-10 (2015.9.4.)* |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20170080334A (en) | 2017-07-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9732337B2 (en) | RNA nanoparticles and nanotubes | |
| Tavares et al. | GelMA/bioactive silica nanocomposite bioinks for stem cell osteogenic differentiation | |
| WO2019032241A1 (en) | General and direct method for preparing oligonucleotide-functionalized metal-organic framework nanoparticles | |
| KR101494773B1 (en) | Drug Carrier Having L-DNA Nanocage Structure | |
| CN111511405A (en) | Peptides and nanoparticles for intracellular delivery of mRNA | |
| WO2006096754A3 (en) | Stabilized aptamers to psma and their use as prostate cancer therapeutics | |
| CN106459974A (en) | Novel double-stranded oligo rna and pharmaceutical composition comprising same for preventing or treating fibrosis or respiratory diseases | |
| EP2184609A3 (en) | Compositions and methods for treating lung cancer | |
| CN105327364B (en) | A kind of nanometer hydroxyapatite-siRNA compound and preparation method thereof | |
| Pang et al. | Controlling the pyridinium–zwitterionic ligand ratio on atomically precise gold nanoclusters allowing for eradicating Gram-positive drug-resistant bacteria and retaining biocompatibility | |
| Chen et al. | An ion-gating multinanochannel system based on a copper-responsive self-cleaving DNAzyme | |
| Linko et al. | Stability of DNA origami nanostructures in physiological media: The role of molecular interactions | |
| WO2023102550A3 (en) | Compositions and methods for efficient in vivo delivery | |
| US20200405649A1 (en) | Dna origami nanoparticle delivery of programmed chromosome breakage machinery | |
| KR101783256B1 (en) | DNA-Mn hybrid paticles and manufacturing method thereof | |
| EP2917740B1 (en) | Peptide that can be used in coating agents, adhesion promoters or adhesives for oxidic surfaces | |
| CN108611348B (en) | Preparation method and application of dendritic DNA assembly | |
| JP2024057094A (en) | Programmed DNA-driven self-assembly of RNA hydrogels | |
| CN116555273A (en) | Nucleoside analogue modified aptamer and application thereof | |
| US10590452B2 (en) | DNA-Mn hybrid particles and method of manufacturing the same | |
| CN108498451A (en) | It is a kind of that there is the high DNA nano-medicament carriers for carrying drug effect fruit, preparation method and application | |
| Wu et al. | Titanium dioxide nanoparticles assembled by DNA molecules hybridization and loading of DNA interacting proteins | |
| CN116987693A (en) | Optimized CRISPR/SpCas12f1 system, engineering guide RNA and application thereof | |
| KR102326079B1 (en) | Preparing method of hydrogel for selective release of functional DNA nanostructure and Hydrogel prepared thereform | |
| KR20220061480A (en) | Manufacturing method of circular nucleic acid template for producing high molecular weight protein using hydrogelated nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right | ||
| GRNT | Written decision to grant |