KR101780765B1 - Recombinant Microorganism for Producing Flavonol Rhamnoside and Uses thereof - Google Patents

Abstract

The present invention relates to a recombinant microorganism for producing flavonol rhamnoside and a use thereof, and more particularly, to a recombinant microorganism for producing flavonol rhamnoside, which comprises a first vector comprising a gene encoding flavonol 3- O -rhamnosyltransferase (ArGt-3) ( Glg ), a gene coding for phosphoglucomycutase ( pgm2 ), a gene encoding glutamyltransferase ( glf ), a gene coding for glucose 1-phosphate thymidyltransferase (tgs), a TDP (Dh) encoding a glucose 4,6-dehydrogenase, a gene (ep) encoding TDP-4-keto-6-deoxyglucose 3,5-epimerase, and a gene encoding a TDP- A recombinant microorganism into which a second vector having a gene (kr) encoding a maltase is inserted, and a method for producing flavonol rhamnoside using the recombinant microorganism.
When the recombinant microorganism for producing flavonol rhamnoside according to the present invention is used, a large amount of flavonol rhamnoside is produced and used effectively as a pharmaceutical composition through various actions ranging from prevention of cardiovascular diseases, antioxidant activity, anti-obesity activity and anticancer activity .

Description

{Recombinant Microorganism for Producing Flavonol Rhamnoside and Uses thereof}

The present invention relates to a recombinant microorganism for producing flavonol rhamnoside and a use thereof, and more particularly, to a recombinant microorganism for producing flavonol rhamnoside, which comprises a first vector comprising a gene encoding flavonol 3- O -rhamnosyltransferase (ArGt-3) ( Glg ), a gene coding for phosphoglucomycutase ( pgm2 ), a gene encoding glutamyltransferase ( glf ), a gene coding for glucose 1-phosphate thymidyltransferase ( tgs ), a TDP ( Dh ) encoding a glucose 4,6-dehydrogenase, a gene ( ep ) encoding TDP-4-keto-6-deoxyglucose 3,5-epimerase, and a gene encoding a TDP- A recombinant microorganism into which a second vector having a gene ( kr ) encoding a maltase is inserted, and a method for producing flavonol rhamnoside using the recombinant microorganism.

Flavonoids are secondary metabolites present in various plants, and these secondary metabolites accumulate in the tissues or organs of plants depending on the surrounding environmental conditions and stage of development. More than 8,000 naturally occurring flavonoids are found mostly in higher plants (Harborne JB et al ., Phytochemistry , 55: 481-504, 2000; Ververidis F, et al ., Biotechnol J , 2: 1214-1234, (Gattuso G et al ., Molecules, 12: 1641-1673, 2007), and is widely distributed in fruits, vegetables, peanuts, seeds, stems, flowers, roots, tea, wine and coffee. Flavonol, a kind of flavonoid, is divided into quercetin, chemerol, myrcetin, maurine and picetine according to phenolic -OH located in different skeletons from the 3-hydroxyflavone skeleton. As they are known to have various pharmacological activities ranging from prevention of cardiovascular diseases, antioxidant activity, anti-obesity activity and anticancer activity, there is a growing interest in the development and utilization of substances.

Most flavonoid drugs exist in the form of glycosides (Xiao J, Muzashvili TS, Georgiev MI et al., Biotechnol Adv. , 32: 1145-56, 2014). Glycocide is a molecule formed by combining sugars with non-carbohydrate components, and is an important factor in determining the solubility, bioactivity and bioavailability of natural products (Wang X et al., FEBS Lett , 583: 3303-3309, 2009). Depending on the kind of the sugar, glycosides can be distinguished from glucosides, lanosides, mannosides and fructosides, and can be distinguished from pyranoside and furanoside according to the ring structure.

On the other hand, microbial biotransformation (microbial biotransformation) is asbestos peogil Russ (Aspergillus), Bacillus (Bacillus), saccharose in my process (Saccharomyces), Streptomyces (Streptomyces) and E. coli life by using a microorganism, such as (E. coli) (Bartmanska A, Tronina T, Poplonski J, Huszcza E et al., Curr Drug Metab , 14: 1083-97, 2013), which can mass produce flavonoids and flavonol glycosides. In particular, Escherichia coli is the most widely used microorganism in industrial use and contributes to the production of therapeutic proteins, biochemicals, biofuels, cosmetics and functional food compositions.

Therefore, in order to highly express the flavonol lambsoside conjugated with Lambroose and Flavonol in E. coli, a glucose promoting spread protein gene ( glf , glk ) derived from Zymomonas mobilis , which is necessary for the biosynthesis process of flavonol lambsoside , Talia and Arabidopsis or (Arabidopsis 3- O -rhamnosyltransferase (ArGt-3) gene derived from a thaliana- derived flavonol-3- O -rhamnosyltransferase (ArGt-3) gene. In order to stably express such a protein, Which is capable of simultaneously expressing a plurality of genes in a single vector without causing an abnormal expression problem such as generation of a stop codon and a frame shift in the cloning step, rather than simultaneously transforming a plurality of monocistronic vectors having the same It is known that implementation of multi-monocistronic gene expression is desirable for stable gene expression (Korean Patent Laid-Open No. 10-2014-0042398).

Therefore, the present inventors have made intensive efforts to more stably produce flavonol lambsoside. As a result, the present inventors have found that seven genes including a vector containing ArGt-3 gene and glf and glk necessary for production of flavonol lambsoside are cloned A multi-monocistronic vector was prepared and stable gene expression was confirmed by an individual promoter (T7). Further, the vector was introduced into a microbial host to confirm the ability to produce stable flavonol lambsoside from the host, and the present invention was completed.

It is an object of the present invention to provide a recombinant microorganism for producing flavonol rhamnoside.

Another object of the present invention is to provide a method for producing flavonol rhamnoside using a recombinant microorganism for producing flavonol rhamnoside.

In order to achieve the above object, the present invention provides a vector comprising a first vector comprising a gene encoding a flavonol 3- O -rhamnosyltransferase (ArGt-3) and a gene encoding glkokinase ( glk ) gene encoding a dehydratase (pgm2), the gene encoding the glucose facilitated diffusion protein (glf), glucose 1-phosphate gene encoding a thymidine group-transferase (tgs), encoding the TDP- glucose 4,6-dehydratase enzyme Gene ( dh ), a gene ( ep ) encoding TDP-4-keto-6-deoxyglucose 3,5-epimerase and a gene ( kr ) encoding TDP-glucose 4-ketoreductase A recombinant microorganism for producing flavonol rhamnoside having a second vector introduced therein.

The present invention also provides a method for producing a flavonol compound, comprising culturing the recombinant microorganism in a flavonol-containing medium to produce a flavonol lambsoside; And recovering the resulting flavonol rhamnoside. The present invention also provides a method for producing flavonol rhamnoside.

When the recombinant microorganism for producing flavonol rhamnoside according to the present invention is used, a large amount of flavonol rhamnoside is produced and used effectively as a pharmaceutical composition through various actions ranging from prevention of cardiovascular diseases, antioxidant activity, anti-obesity activity and anticancer activity .

1 is a schematic diagram of a pET32a (+) vector comprising a recombinant lambda expression cassette, a piBR181 multi-monocystronic vector containing it and a flavonol 3- O -lambsinosyl transferase gene.
Figure 2 shows the results of analysis of biotransformed phytase lambsoside by HPLC-PDA and LC-QTOF-ESI / MS.
FIG. 3 shows the result of confirming the concentration of the strain and the flavonol bioconversion rate over time in order to confirm the optimum flavonol concentration through substrate inhibition.
FIG. 4 shows the results of comparing the bioconversion rates by glucose concentration in order to determine optimal glucose concentrations for flavonol bioconversion.
FIG. 5 shows the result of bioconversion of strains to confirm the bioconversion of flavonol according to the presence of the glf of the glucose promoting diffusion protein.
6 is a result of confirming the bioconversion pattern of the phytetin in the 3 L fermenter over time.
Fig. 7 shows the conversion rates of phycetin (Fis), quercetin (Que), myristine (Myr), chemerol (Kmf) and morin into rhomboside.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In the present invention, in order to more stably produce flavonol lambsoside, a vector containing a flavonol 3- O -rhamnosyltransferase gene necessary for the production of flavonol lambsoside and a vector containing seven genes in a multi- As a result of producing a multi-monocistronic vector, stable expression of a gene involved in the production of flavonol ranoside by an individual promoter (T7) was confirmed, and the vector was introduced into the microorganism host, It was confirmed that the production ability of the ballolanoside was confirmed.

Accordingly, the present invention provides, in one aspect, a vector comprising a gene encoding a flavonol 3- O -rhamnosyltransferase (ArGt-3) and a gene encoding glkokinase ( glk ), a phosphogluco mutease gene encoding the (pgm2), the gene encoding the glucose facilitated diffusion protein (glf), glucose 1-phosphate gene encoding a thymidine group-transferase (tgs), TDP- glucose 4,6-dehydratase gene encoding the enzyme ( dh ), a gene ( ep ) encoding TDP-4-keto-6-deoxyglucose 3,5-epimerase and a gene ( kr ) encoding TDP-glucose 4-ketoreductase And a recombinant microorganism for producing flavonol rhamnoside in which a second vector is introduced.

In the present invention, rhamnose is a kind of glycoside, and is a generic name in which a hydroxyl group of rhamnose and hemiacetal is bonded to an ether phase with another compound

In the present invention, the expression cassette is characterized in that it includes a minimal structure (Biobrick) necessary for expression and cloning of a gene such as a promoter, a ribosome binding site, a multicloning site and the like. More particularly, the expression cassette of the present invention comprises a T7 promoter, (b) a Lac operator, (c) a ribosome binding site (RBS), (d) a multiple cloning site ), (e) a T7 transcription terminator (TT), (f) a Bam HI cleavage site, and (g) an Xho I cleavage site.

In the present invention, a promoter is a site to which transcription regulatory elements bind, and may be composed of a core promoter, a proximal promoter, and a distal promoter.

The core promoter is the smallest part of the promoter required for transcription to occur. Refers to a portion within about 45 bases forward from the transcription start site, where RNA polymerase and general transcriptional regulatory elements are combined, and the proximal promoter refers to a portion within about 250 bases forward from the transcription start site, It is known to be a major part directly affecting regulation and is located far from the starting point of the discrete promoter transcription initiation site and plays a more or less weaker and more subordinate role than the proximemer promoter in regulating transcription.

The T7 promoter is a bacteriophage-derived promoter, and since E. coli RNA polymerase has a very low expression rate, it is a high-expression promoter commonly used when E. coli is used as a host for protein production. In addition, the T7 promoter is located in the lac operator, and the lac repressor binds to this region. In normal times, gene expression is suppressed by T7 polymer raise, and when the expression inducer such as IPTG is added, , And expression is terminated by recognizing the T7 expression ending site,

In the present invention, the Bgl II cleavage site is present at the front of the promoter of the expression system, the Spe I and Hind III cleavage sites are present at the multicloning site, and the Bam HI and Xho I cleavage sites are sequentially introduced after the transcription termination site But can be constructed on other restriction enzyme cuts if such a site is present in the sequence of the foreign gene to be inserted and is not suitable for cloning, such as cleaving the foreign gene in the cloning process, and such selection is obvious to those skilled in the art .

More specifically, in the multi-cloning site of the expression cassette according to the invention glf, glk, pgm2, tgs, dh, ep And kr respectively Followed by cloning to prepare a monocystronic vector. In this case, it is necessary to insert Xba I and Hind III recognition sites at both ends of each gene. Normally, by inserting a cleavage site artificially recognized by a specific restriction enzyme at the end of the gene amplification primer, Is obvious to those skilled in the art. In the present invention, as shown in Table 2, primers containing Xba I and Hind III restriction site sequences were used to amplify the gene.

The expression cassette according to the invention glf, glk, pgm2, tgs, dh, ep And kr In order to insert, the blunt end or cohesive end cleavage planes obtained by treating the 5 'and 3' ends of the expression cassette with the same restriction enzymes of the 3 'and 5' ends of the respective gene fragments, respectively, are ligated to each other Can be manufactured.

In the present invention, the amplified enzyme gene fragment is artificially excluded from the Xba I And HindIII were inserted at each end and treated with the above restriction enzymes. After treatment with SpeI and HindIII so as to cleave the multicloning site of the vector piBR181 produced by the method of Korean Patent Laid-Open No. 10-2014-0042398, Each was subjected to ligation to prepare a monocystronic vector containing one gene. In order to construct these vectors again, firstly, the vector containing the glf is cleaved with Bgl II and Xho I to isolate only the gene fragment containing the expression cassette and glf , and the fragment is digested with Bam HI and Xho I glk was introduced into the vector, and glf And < RTI ID = 0.0 > glk . ≪ / RTI > Then, the vector was digested again with Bam HI and Xho I, and the gene fragment containing the expression cassette and pgm2 isolated from the vector into which pgm2 treated with Bgl II and Xho I had been introduced was ligated to this region to obtain glf , glk, and pgm2 were sequentially inserted into the expression cassette. Similarly, tgs , dh , ep And kr gene were sequentially inserted into the vector in the same manner to finally produce a multi-monocystronic vector containing all seven genes. The gene coding for the flavonol 3- O -rhamnosyltransferase (ArGt-3) was cloned alone in the Eco RI / Xho I site of the pET32a (+) vector because the restriction enzyme sites did not match (Fig.

In the process of preparing the multi-monocystronic expression vector, when Xba I and Spe I, or the ends treated with Bam HI and Bgl II are ligated to each other, the sequence of the original restriction enzyme cleavage site is scar sequence ).

In the present invention, a restriction enzyme can also be used as a restriction endonuclease. An enzyme which recognizes a specific nucleotide sequence of a double-stranded DNA molecule and catalyzes cleavage of the part or its periphery Quot; Most restriction enzymes are characterized in that they cleave DNA at a position with a specific nucleotide sequence called a recognition site or restriction site, respectively.

Ligation usually occurs when the DNA end sequences cleaved by restriction enzymes are identical to each other, and can be cleaved with the same restriction enzyme even after ligation. However, in the case of Xba I and Spe I, there is a special case where the sequence is different from each other, but the ligation is possible but leaves a scar sequence which can not be cleaved by the enzyme after ligation , And ligation-compatible restriction enzyme pairs are apparent to those skilled in the art even if Xba I -Spe I is different from the sequence of the restriction enzyme cleavage site.

Since the expression cassette of the present invention is shorter in distance from the promoter and the transcription termination site than the conventional expression cassette, it is possible to recycle the T7 polymerase in expressing the foreign gene, thus enabling multi-round transcription High expression can be realized.

In the present invention, the second vector is a multi-monocystronic expression vector.

The multi-monocystronic vector of the present invention may include two or more expression cassettes in which a foreign gene is inserted, preferably two or more and ten or fewer.

In the present invention, a vector is a carrier that stably transports a desired foreign gene fragment into a host cell, has autonomous replication function, can contain an antibiotic resistance gene, and has a multiple cloning site (MCS ), Which makes it easy to insert a foreign gene.

In the present invention, a multi-monocistronic expression vector may be mixed with a multi-monocystronine vector or a multi-monocystronic vector.

A cistron is a unit of microstructure that can perform a genetic function in a structural gene, and can be classified as a monocistron or a polycistron. Since monocistron determines the primary structure of one kind of polypeptide chain in a structural gene, the multi-monocystronic vector of the present invention is characterized in that it contains a large number of single cistron have.

The genes required for the biosynthesis of flavonol rhamnoside according to the present invention include Zymomonas mobilis mobilis) glucose-diffusion promoting protein gene derived from (glf, glk), phosphoglucoisomerase Muta dehydratase gene (pgm2), glucose 1-phosphate transferase gene group-thymidine (tgs), TDP-glucose 4,6-dehydrogenase gene ( dh ), TDP-4-keto-6-deoxyglucose 3,5-epimerase gene ( ep ) And TDP-glucose 4-ketoreductase gene ( kr ) and Arabidopsis 3- O -rhamnosyltransferase (ArGt-3) gene derived from E. coli thaliana .

In the present invention, the use of Escherichia coli (E. coli) BL21 (DE3) with the recombinant microorganism, but, if the microorganism used for microbial biotransformation is possible to use anything.

In the present invention, biotransformation, also referred to as biotransformation or biotransformation, refers to a biotransformation reaction that converts a substance introduced into a living body into another substance or binds with metabolites in the body.

In another aspect, the present invention provides a method for producing a flavonol compound, comprising: (a) culturing the recombinant microorganism in a flavonol-containing medium to produce a flavonol lambsoside; And (b) recovering the resulting flavonol lambsoside.

In the present invention, the flavonol is picetin, chemerol, myrcetin, morin, and quercetin, but is not limited thereto.

In the present invention, the recombinant microorganism can be cultured at 20 캜 or 37 캜, but is not limited thereto.

When culturing the recombinant microorganism in the present invention, the medium to be used can be easily selected by those skilled in the art, and preferably LB medium can be used.

In the present invention, IPTG (Isopropyl beta-D-1-thiogalactopyranoside) may be used in the culturing process to induce gene expression. The substance is a substance that initiates foreign gene expression by effecting elimination of the lac repressor bound to the lac operator. The treatment method and treatment concentration of IPTG can be easily selected by a person skilled in the art.

In the present invention, a method for mass culture of microorganisms to produce flavonol rhamnoside may be a shaking culture, a continuous culture, a batch culture, a fed-batch culture, and the like. It is not.

[ Example ]

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Example  One : Multi-monocystronic  Production of expression vector

1-1: Flavonol Lamboside  Isolation of genes for production

The vectors, plasmids and strains used in the present invention are shown in Table 1.

Vector and plasmid Explanation source pIBR181 Monosystronic vector modified from pET28a + and containing f1 pBR322 ori, Km ^r (kanamycin resistance gene) Invention pET32 (a) + ArGt-3 PET32 (a) + vector containing ArGt-3 Invention pCDF-Duet-tgs.dh pCDF-Duet vector containing tgs.dh Simkhada et al., Biotechnol Bioeng 107: 154-162, 2010 pACYC-Duet-ep.kr pACYC-Duet vector containing ep.kr Simkhada et al., Biotechnol Bioeng 107: 154-162, 2010 PiBR181-tgs.dh.ep.kr.pgm2 piBR181 vector containing tgs.dh.ep.kr.pgm2.galU Invention piBR181-tgs.dh.ep.kr.pgm2. glf.glk. piBR181 vector containing tgs.dh.ep.kr.pgm2.galU.glf.glk Invention Strain Explanation Strain number source Escherichia coli XL-1 Blue (MRF ') Cloning host Stratagene, USA E. coli BL21 (DE3) ompT hsdT _{hsdS (r B -m B -)} gal (DE3) Novagen E. coli BL21 (DE3) pET32a-ArGt-3 Arabidopsis BL21 (DE3) strain containing pET32 + vector containing thaliana- derived ArGt-3 S ₁ Invention E. coli BL21 (DE3) pCDF-Duet-TGS. pACYC-Duet-ep.kr. pET32a-ArGt-3 (DE3) strain containing pCDF-Duet-tgs.dh, pACYC- Duet-ep.kr and pET32a-ArGt-3 S ₂ Invention E. coli BL21 (DE3) pCDF-Duet-TGS. pACYC-Duet-ep.kr. piBR181.pgm2. pET32a-ArGt-3 BL21 (DE3) strain containing pCDF-Duet-tgs.dh, pACYC- Duet-ep.kr, piBR181.pgm2 and pET32a-ArGt-3 vector S ₃ Invention E. coli BL21 (DE3) piBR181.tgs.dh.ep.kr.pgm2. pET32a-ArGt-3 BL21 (DE3) strain containing piBR181.tgs.dh.ep.kr.pgm2 and pET32a-ArGt-3 vector S ₄ Invention E. coli BL21 (DE3) piBR181.tgs.dh.ep.kr.glf.glk.pgm2. pET32a-ArGt-3 BL21 (DE3) strain containing piBR181.tgs.dh.ep.kr.glf.glk.pgm2 and pET32a-ArGt-3 vector S ₅ Invention

Gene glf (glucose diffusion facillitate protein) necessary for the flavonol biosynthetic ramno seed, glk (glucosekinase), pgm2 ( phosphoglucomutase), tgs (glucose 1-phosphate thymidylyltransferase), dH (TDP-glucose 4,6-dehydratase), ep (TDP-4-keto-6-deoxyglucose 3,5-epimerase) And kr (TDP-glucose 4-ketoreductase), an enzyme gene fragment was obtained using the primers shown in Table 2 and conventional PCR techniques.

primer Oligonucleotide  The sequence (5'-3 ') Restriction enzyme site glf-F (SEQ ID NO: 1) TCTAGA ATGAGTTCTGAAAGTAGTCAGGGT Xba I glf-R (SEQ ID NO: 2) AAGCTT CTACTTCTGGGAGCGCCACATCTC Hind III glk-F (SEQ ID NO: 3) TCTAGA ATGGAAATTGTTGCGATTGACATC Xba I glk-R (SEQ ID NO: 4) AAGCTT TTAAAAAATATTATTCAACTTCAG Hind III pgm2-F (SEQ ID NO: 5) TCTAGA ATGAGCTGGAGAACGAGCTATGAACGC Xba I pgm2-R (SEQ ID NO: 6) AAGCTT TTACGAATTTGAGGTCGCTTTTACAAT Hind III tgs-F (SEQ ID NO: 7) TCTAGA ATGAAAATGCGTAAAGGTATT Xba I tgs-R (SEQ ID NO: 8) AAGCTT TTAATTTGAATCCTTCGTCAT Hind III dh-F (SEQ ID NO: 9) TCTAGA GTGAAGATACTTATTACTGGC Xba I dh-R (SEQ ID NO: 10) AAGCTT TTACTGGCGTCCTTCATAGTT Hind III ep-F (SEQ ID NO: 11) TCTAGA ATGGAGTTACTCGACGTCGAC Xba I ep-R (SEQ ID NO: 12) AAGCTT TCACCGGGCCGGTCCCACGCC Hind III kr-F (SEQ ID NO: 13) TCTAGA ATGAGATGGCTGATCACCGGC Xba I kr-R (SEQ ID NO: 14) AAGCTT TCATGCTGCTCCTCGCCGGGT Hind III

The seven gene amplification products obtained by PCR were respectively excised with Xba I- Hind III and the piBR181 vector prepared by the method of Korean Patent Publication No. 10-2014-0042398 with Spe I - Hind III, respectively, and then inserted into the piBR181 vector Seven kinds of individual recombinant plasmids containing each of the seven gene fragments were prepared (Fig. 1).

1-2: Flavonol Lamboside  For manufacturing Multi-monocystronic  Production of expression vector

In order to insert the above seven genes into a single vector, the following production process was performed.

The vector into which glf was introduced was cleaved with Bgl II and Xho I to isolate only the gene fragment containing the expression cassette and glf from this, and the fragment was digested with Bam HI And a vector introduced with glk cleaved with Xho I to give glf And < RTI ID = 0.0 > glk . ≪ / RTI > Then, the vector was digested again with Bam HI and Xho I, and the gene fragment containing the expression cassette and pgm2 isolated from the vector into which pgm2 treated with Bgl II and Xho I had been introduced was ligated to this region to obtain glf , glk, and pgm2 were sequentially inserted into the expression cassette. Similarly, tgs , dh , ep And kr gene were sequentially inserted into the vector in the same manner to finally prepare a multi-monocystronic vector containing all seven genes. On the other hand, the gene coding for the flavonol 3- O -lambosyltransferase (ArGt-3) was cloned alone in the Eco RI / Xho I site of the pET32a (+) vector, .

Example  2: Multi- Monosystronic  Using an expression vector Flavonol Laminocyte  production

2- 1: Pisetin Laminocyte  Confirmation of substrate inhibition through bioconversion

(S ₁ strain) into which pET32a (+) - ArGt-3 vector containing only ArGt-3 alone was introduced to identify substrate inhibition through bioconversion of flavon (fisetin). The different concentrations of phytetin (0.2 mM, 0.3 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1.0 mM) dissolved in DMSO were biotransformed in 50 mL of the oil culture medium at 37 ° C. The mice were inoculated at 6-hour intervals until 24 hours, and then inoculated at 12-hour intervals until 60 hours. One mL of sample was taken in each flask and centrifuged at 12,000 rpm for 10 minutes. The supernatant corresponding to twice the volume of ethyl acetate was extracted, and the remaining cell pellet was mixed with water and the cell density was measured with a spectrophotometer having a UV absorbance of 600 nm. The ethyl acetate fraction was dried and then added again to 100 μL of methanol and analyzed by HPLC-PDA. The peak area in the HPLC-PDA analysis procedure was used to determine bioconverted phytase lambsoside.

As a result of HPLC-PDA analysis, it was possible to observe the peak of the biotransformed phytatin lambsoside in 14.8 minutes. Further, through LC-QTOF-ESI / MS analysis, values ranging from [M + H] ⁺ m / z ⁺ to 433.1096 were obtained (FIG. 2).

As a result of confirming the substrate inhibition effect on the flavonol biotransformation, the biotransformation products of picetin increased exponentially up to 48 hours and became static for 60 hours (FIG. 3). As a result, it was confirmed that phycetin was maximally bioconverted for 48 hours. In addition, the maximum conversion of picetin reached 41.8% when the OD ₆₀₀ value of the cell concentration reached 3.5 at a concentration of 0.3 mM of picetin. At a concentration of more than 0.3 mM of picetine, cell growth rate and substrate conversion gradually decreased. It can be seen that the higher the concentration of picetin, the more toxic to the culture environment of E. coli (FIG. 3).

2- 2: Flavonol  Determine optimal glucose concentration for biotransformation

To determine the optimal glucose concentration for the strain at the time of bioconversion of flavonol, strain S ₁ was cultured at 37 ° C until the cell concentration reached OD ₆₀₀ 0.5-0.7, and further cultured at 20 ° C for 20 hours , And the strains were inoculated into media containing three different concentrations of glucose (5%, 10%, 15%) and 0.3 mM of picetin, and the picetin bioconversion activity of E. coli was analyzed by HPLC-PDA.

As a result, it was confirmed that the conversion rate to picetyl rhamnoside in the medium containing 10% glucose was the highest at 48.5% for 48 hours of culture time (FIG. 4).

2-3: Genes of Glucose Promoting Diffusion Protein glf ) Depending on whether Bioconversion ability  Confirm

There is no gene (glf) of glucose-diffusion promoting protein, a recombinant strain that contains a multi-vector overexpressing TDP- ramno agarose _{(S 2; pCDF-Duet-} tgs.dh, pACYC-Duet-ep.kr, pET32a-ArGt-3 , S ₃ ; pCDF-Duet-tgs.dh, pACYC-Duet-ep.kr, piBR181.pgm2.pET32a-ArGt-3), glf -free multi-monocystronic vector (piBR181.tgs.dh.ep.kr mono-cis tronic vector (piBR181.tgs.dh.ep.kr.glf.glk.pgm2, pET32a-ArGt-3 - .pgm2, pET32a-ArGt-3) recombinant strains containing a (S ₄₎ and including a multi-glf ) using a recombinant strain (S ₅₎ including a confirmed the biotransformation capacity of blood paroxetine. The recombinant strains were cultured under the same conditions as in Example 2-2. Samples were extracted at different time intervals and analyzed by HPLC-PDA.

As a result, S ₄ strain showed 80% conversion rate than S _{2 and} S ₃ strain which showed 68% and 72% conversion, respectively. In addition, the strain S ₅ showed a conversion rate of 95% (FIG. 5). It was confirmed that the glucose - promoting diffusion protein improves the conversion of flavonol to rhomboside.

2-4: Scale-up Flavonol  Biotransformation

To determine the bioconversion of pysetin in a 3 L fermentor using S ₅ strain, which is optimal for production of flavonol rhamnoside. Glucose was added at an interval of 1 hour in the presence of 300 mg (0.35 mM) of picetin in a fermenter at 25 ° C, pH 7, and 10% glucose, and cultured for 36 hours. After 12 hours and 24 hours, the same amount of picetin was added. Samples were taken at intervals of 12 hours up to 60 hours and analyzed by HPLC-PDA.

As a result, it was confirmed that the picetine was converted to picetin rhamnoside 100% when the culture was performed for 12 hours. When 24 hours had elapsed, picetine showed 100% conversion. However, thereafter, the rate of biotransformation of picetin decreased. The picetine injected after 24 hours did not completely convert to the picetin rhamnoside until 60 hours. The picetine conversion rate between 48 hours and 60 hours remained constant. It was confirmed that a total of 1.026 g (342 mg / L, 0.27 mM) of phytatin lambsoside was produced until 48 hours (FIG. 6).

2-5: Other Flavonol  Biological conversion confirmation

S ₅ was used to confirm the bioconversion of flavonol other than picetin. 0.3 mM of chemerol, myristine, myrin and quercetin were injected into a shaking flask containing the S ₅ strain cultured under the same conditions as in Example 2-2, and cultured for 48 hours.

As a result, Kemperol, quercetin and myristate showed biological conversion rates ranging from 95 to 100%, similar to picetine. On the other hand, the morin showed a bioconversion rate of less than 15% (Fig. 7).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-University Cooperation Foundation Sunmoon University <120> Recombinant Microorganism for Producing Flavonol Rhamnoside and          Uses thereof <130> P15-B107 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> glF-F <400> 1 tctagaatga gttctgaaag tagtcagggt 30 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> GlF-R <400> 2 aagcttctac ttctgggagc gccacatctc 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> glK-F <400> 3 tctagaatgg aaattgttgc gattgacatc 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Glk-R <400> 4 aagcttttaa aaaatattat tcaacttcag 30 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pGM2-F <400> 5 tctagaatga gctggagaac gagctatgaa cgc 33 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pGM2-R <400> 6 aagcttttac gaatttgagg tcgcttttac aat 33 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> tgs-F <400> 7 tctagaatga aaatgcgtaa aggtatt 27 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> tgs-R <400> 8 aagcttttaa tttgaatcct tcgtcat 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dH-F <400> 9 tctagagtga agatacttat tactggc 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> dh-R <400> 10 aagcttttac tggcgtcctt catagtt 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ep-F <400> 11 tctagaatgg agttactcga cgtcgac 27 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ep-R <400> 12 aagctttcac cgggccggtc ccacgcc 27 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> kr-F <400> 13 tctagaatga gatggctgat caccggc 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> kr-R <400> 14 aagctttcat gctgctcctc gccgggt 27

Claims (3)

A first vector comprising a gene encoding a flavonol 3- O - rhamnosyltransferase and a gene encoding glkokinase ( glk ), a gene encoding phosphoglucomycutase, a gene encoding a glucose promoting diffusion protein glf), glucose 1-phosphate gene encoding a thymidine group-transferase (tgs), glucose 4,6-TDP- dehydration gene (dh), TDP-4- keto-6-deoxy-glucose coding for the enzyme 3, A second vector into which a gene ( ep ) encoding 5-epimerase and a gene ( kr ) encoding TDP-glucose 4-ketoreductase are introduced is introduced into a recombinant Escherichia coli for producing a flavonol lanoside.
The recombinant Escherichia coli according to claim 1, wherein the flavonol 3- O -rhamnosyltransferase is derived from Arabidopsis thaliana .
A process for preparing a flavonol rhamnoside comprising the steps of:
(a) culturing the recombinant E. coli of claim 1 in a flavonol-containing medium to produce flavonol rhamnoside; And
(b) recovering the resulting flavonol rhamnoside.

Images