KR101775350B1 - Method for Detection and Quantitation of amino caproic acid Using Artificial Genetic Circuits - Google Patents
Method for Detection and Quantitation of amino caproic acid Using Artificial Genetic Circuits Download PDFInfo
- Publication number
- KR101775350B1 KR101775350B1 KR1020150076602A KR20150076602A KR101775350B1 KR 101775350 B1 KR101775350 B1 KR 101775350B1 KR 1020150076602 A KR1020150076602 A KR 1020150076602A KR 20150076602 A KR20150076602 A KR 20150076602A KR 101775350 B1 KR101775350 B1 KR 101775350B1
- Authority
- KR
- South Korea
- Prior art keywords
- gene
- aminocaproic acid
- caprolactam
- nitr
- delete delete
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D223/00—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom
- C07D223/02—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom not condensed with other rings
- C07D223/06—Heterocyclic compounds containing seven-membered rings having one nitrogen atom as the only ring hetero atom not condensed with other rings with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D223/08—Oxygen atoms
- C07D223/10—Oxygen atoms attached in position 2
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/005—Amino acids other than alpha- or beta amino acids, e.g. gamma amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/05—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in nitriles (3.5.5)
- C12Y305/05001—Nitrilase (3.5.5.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a method for detecting and quantifying aminocaproic acid using a redesigned gene circuit, and more particularly, to a method for converting 竜 -caprolactam used as a precursor of nylon 6 from aminocaproic acid in an aqueous solution, And a method for analyzing and quantifying aminocaproic acid using a gene circuit capable of detecting lactam.
The ε-caprolactam regulatory gene induces the expression of the fluorescent protein in proportion to the amount of ε-caprolactam produced by the gene circuit for converting the aminocaproic acid into ε-caprolactam according to the present invention, whereby aminocaproic acid Can be rapidly detected and quantitated, and there is an effect that can be used for the purpose of quantitative analysis of aminocaproic acid and activity analysis of aminocaproic acid biosynthesis enzyme.
Description
The present invention relates to a method for detecting and quantifying aminocaproic acid using a redesign gene circuit, and more particularly, to a method for detecting and quantifying aminocaproic acid using a gene circuit capable of detecting aminocaproic acid, which is a precursor of? -Caprolactam used as a precursor of
Aminocaproic acid is an analog of amino acid lysine. It is a typical inhibitor of plasminogen system in blood. It is an antifibrinolytic agent used for bleeding and surgery. Aminocaproic acid is also a representative precursor of ε-caprolactam. Ε-caprolactam, which is produced from aminocaproic acid, is used as a precursor of
Therefore, if a rapid and accurate detection and quantification method of the produced aminocaproic acid is developed, it can be effectively used for molecular evolution through high-speed search for the biosynthesis of aminocaproic acid, development of a highly efficient enzyme process, and development of a new microorganism strain. However, the aminocaproic acid quantification and detection methods reported so far are only currently used as analytical methods using HPLC and LC-MS as a typical method (Wu YH et al . J Chromatogr B Analyt Technol Biomed Life Sci . 15: 885- 886: 61-5, 2012). This method can be used for trace analysis (minimum 62.5 ng / ml = 0.47 mM), but expensive equipment is required and filtration and pretreatment are required to remove impurities, enzymes and cellular components before analysis. Especially, the analysis time is long and the complexity of the step is so high that the number of samples that can be processed per day is not as high as several hundreds, and the improvement of the biosynthetic enzyme which requires comparison and analysis of millions of mass samples in a short time, It is very unfit for writing purposes.
The present inventors have developed a technique capable of detecting and quantifying various compounds using gene redesign cells that can overcome the limitations of such device analysis (Korean Patent No. 1,222,056, Korean Patent Application No. 10-2013 -0164442, Korean Patent Application No. 10-2012-0066846, PCT / KR2014 / 001360). The present invention relates to a method for constructing a gene circuit that sensitively senses a single cell intracellular activity using a transcriptional regulator capable of detecting various compounds in a cell. For example, the present inventors have developed a gene circuit capable of detecting phenol compounds, isoprenes, toluene and benzene compounds through fluorescence expression of gene circuits (Korean Patent No. 1,222,056). The use of these gene circuits in the search for novel enzymes can lead to molecular evolution studies that can acquire useful genes at high speed in various gene groups including the environment and the meta genome library and can increase the target enzyme activity by controlling the sensitivity to compounds Enzyme process development is also possible. Despite this possibility, however, the composition of the gene circuit capable of detecting the major polymeric material, aminocaproic acid compound, is not yet known.
Accordingly, the present inventors have made extensive efforts to develop a method for detecting and quantifying aminocaproic acid. As a result, they have found that a novel enzyme obtained from a metagenomic gene converting aminocaproic acid into ε-caprolactam in an aqueous solution and ε-caprolactam When a microorganism including the redesigned gene circuit is used, an artificial gene circuit for detecting aminocaproic acid is fabricated by using a gene circuit that senses and generates a fluorescent signal, and when a minute amount of aminocaproic acid is detected / And the present invention was completed.
It is an object of the present invention to provide a redesigned gene circuit for detecting aminocaproic acid.
It is another object of the present invention to provide a recombinant microorganism for the detection of aminocapronic acid, which comprises a redesigned gene circuit for detecting aminocaproic acid.
It is still another object of the present invention to provide a method for detecting and quantifying aminocaproic acid using the recombinant microorganism for detecting an aminocaproic acid.
In order to achieve the above object, the present invention provides a method for producing a protein comprising the steps of: (i) a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam; (Ii) a nitR gene encoding a NitR (nitrilase regulator) protein that recognizes epsilon -caprolactam; (Iii) at least one reporter gene selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene; (iv) a promoter that regulates the expression of the nitR gene; And (v) an aminocaprone acid sensing redesign comprising a nitA promoter (P nitA ) which binds NitR (protein) recognizing the? -Caprolactam to induce the expression of downstream reporter gene. Lt; / RTI >
The present invention also provides a recombinant microorganism for detecting an aminocaproic acid containing a gene circuit for redesign for the detection of aminocaproic acid.
The present invention also relates to a method for producing an aminocaproic acid-containing recombinant microorganism, comprising the steps of: (a) contacting the aminocaproic acid-detecting recombinant microorganism with a sample containing aminocaproic acid; And (b) detecting the presence of aminocaproic acid by analyzing the activity of the expressed reporter protein by detecting aminocaproic acid and detecting the presence of aminocaproic acid.
The present invention also provides a method for producing an aminocaproic acid, comprising: (a) contacting a sample containing aminocaproic acid with a recombinant microorganism for detecting the aminocaproic acid; And (b) analyzing the activity of the reporter protein induced by the aminocaproic acid present in the sample to quantify aminocaproic acid present in the sample.
(A) contacting the metacinome library sample with the aminocaproic acid-sensing recombinant microorganism; (b) analyzing the activity of the reporter protein whose expression is induced by the aminocaproic acid present in the sample, and quantifying aminocaproic acid in the sample; And (c) selecting a strain contained in a sample containing aminocaproic acid as an aminocapronic acid-producing strain.
The present invention also provides a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam in the aqueous solution of SEQ ID NO: 1 or SEQ ID NO: 28 and a microorganism transformed with the gene.
The present invention also relates to a protein which converts from aminocaproic acid to epsilon -caprolactam in an aqueous solution which is encoded by a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam in the aqueous solution of SEQ ID NO: 1 or SEQ ID NO: And a method for converting aminocaproic acid into epsilon -caprolactam using the protein.
The re-designed gene circuit recognizing aminocaproic acid according to the present invention produces 竜 -caprolactam in proportion to the amount of aminocaproic acid, and the ε-caprolactam regulatory gene controls expression of the fluorescent protein in proportion to the amount of ε-caprolactam The aminocaproic acid can be rapidly detected and quantitated. Thus, there is an effect that can be used for the purpose of quantitative analysis of aminocaproic acid and activity analysis of aminocaproic acid biosynthetic enzyme. The present invention enables the detection of a trace amount of aminocaproic acid with a high sensitivity of about 10 [mu] M and enables cell-based analysis that has not been possible in the past. Therefore, a novel aminocaproic acid- The present invention can be efficiently utilized even in the process of searching for the present invention.
1 is a schematic diagram showing a microorganism containing a gene circuit (ACA-GESS) for redesign for the detection of aminocaproic acid according to the present invention.
FIG. 2 shows the result of measurement with a fluorescent plate reader in order to verify sensitivity to various concentrations of aminocaproic acid in a gene circuit (ACA-GESS) for redesign for the detection of aminocaproic acid according to the present invention.
3 is a schematic diagram showing a microorganism containing a T7-ACA-GESS gene redesign circuit for improving the detection and quantification ability of aminocaproic acid of the present invention.
4A and 4B are schematic diagrams showing construction of a T7-ACA-GESS gene redesign circuit for improving the detection and quantification ability of aminocapronic acid of the present invention.
5 is a graph showing the sensitivity evaluation of aminopuronic acid of the transformant (2 plasmid system) of Example 5. Fig.
6 is a graph showing the sensitivity evaluation of aminocapronic acid of the transformant (1 plasmid system) of Example 6. Fig.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.
(I) a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam; (Ii) a nitR gene encoding a NitR protein that recognizes epsilon -caprolactam; (Iii) at least one reporter gene selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene; (iv) a promoter that regulates the expression of the nitR gene; And (v) a nitA promoter which binds NitR (protein) recognizing the? -Caprolactam to induce the expression of a downstream reporter gene.
The present invention relates to (i) a transformant in which a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam is inserted into chromosomal DNA; And [(ii) a nitR gene encoding a NitR protein that recognizes epsilon -caprolactam; (Iii) at least one reporter gene selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene; (iv) a promoter that regulates the expression of the nitR gene; And (v) a caprolactam-detecting redesign gene circuit comprising a nitA promoter which binds NitR (protein) recognizing said? -Caprolactam to induce expression of a downstream reporter gene. Re-design gene circuit.
The present invention is based on the application of a GEF (Green fluorescence linked enzyme screening system) (Korean Patent No. 1,222,056) which senses various compounds using a redesign gene circuit and eventually detects various compound synthase activities with high sensitivity , Which is applied to the detection and quantification of aminocaproic acid, is a method capable of efficiently analyzing the quantification of aminocaproic acid quickly and with high sensitivity.
* The synthetic gene circuit of the present invention is composed of a gene encoding a protein converting aminocaproic acid into? -Caprolactam and a nitR gene encoding NitR protein recognizing? -Caprolactam converted and a nitA promoter as a binding site thereof And the NitR protein reacted with the NitR protein in response to the amount of aminocaproic acid induces the expression of the fluorescent protein by mediating the transcriptional regulation of the nitA promoter so that finally the aminocaproic acid can be quantitatively analyzed as a redesigned gene circuit have. As shown in Fig. 1, epsilon -caprolactam is converted into aminocaproic acid, and epsilon -caprolactam is used as a representative substrate of NitR protein. Aminocaproic acid is a quantitative Fluorescence analysis can be done.
In the present invention, the protein converting from aminocaproic acid to epsilon -caprolactam may be characterized in that it has conversion efficiency in an aqueous solution.
The method for analyzing aminocaproic acid according to the present invention requires a gene circuit for converting from aminocaproic acid to epsilon -caprolactam in an aqueous solution and a redesigned gene circuit for detecting and quantifying epsilon -caprolactam produced from aminocaproic acid. This gene circuit constructed a new sensing microorganism (Fig. 1) by utilizing 竜 -caprolactam detection and quantification technology (Korean Patent Application No. 10-2013-0138399). In the most important embodiment of the present invention, a new gene encoding a protein converting from aminocaproic acid to epsilon -caprolactam in an aqueous solution is obtained from the metagenome derived from the tidal flats and is being developed as a core component of the detection technology using this gene circuit. In addition, a new caprolactam-converting enzyme has been discovered from the metagenome and is being developed as a key component of the detection technology using the gene circuit.
The gene coding for a protein which is converted from i) aminocaproic acid to epsilon -caprolactam may exist independently in the microorganism from the rest of the constitutions of (ii) to (v), and the genome of the metagenome, In the form cloned into another expression vector, or inserted into the chromosomal DNA of the microorganism.
In the present invention, the gene encoding the novel metagenome-derived protein that converts from aminocapronic acid to epsilon -caprolactam in the aqueous solution is represented by SEQ ID NO: 1 or SEQ ID NO: 28, and the novel metagenome-derived protein is represented by SEQ ID NO: 29 May have an amino acid sequence. However, the gene coding for a protein (i) of the present invention that converts from aminocaproic acid to epsilon -caprolactam is not limited to the above sequence, but may be a gene encoding an enzyme capable of converting aminocaproic acid into caprolactam Can be used in the present invention without any particular limitation. The nitR gene is derived from Alcaligenes faecalis JM3 and is represented by SEQ ID NO: 2, and the nitA promoter gene is derived from Alcaligenes faecalis JM3 and is represented by SEQ ID NO: 3.
In the present invention, a NitR protein recognizing epsilon -caprolactam synthesized from a metagenome-derived novel protein that converts from aminocaproic acid to epsilon -caprolactam in an aqueous solution is bound to induce the expression of a downstream reporter gene region containing the nitA promoter may be characterized by activating the promoter of the reporter gene to the downstream of the reporter gene can be expressed by the NitR protein binding.
In the present invention, a new gene derived from the metagenome transforming from aminocaproic acid to epsilon -caprolactam in the aqueous solution, a gene encoding the nitr gene recognizing? -Caprolactam and a promoter regulating the expression of the NitR protein Are connected to each other in a mutually operable manner.
Rhodococcus It is reported that rhodochrous J1 nitrilase activates the expression of a sub-gene by epsilon -caprolactam. This indicates that NitR, a regulatory protein of nitrile-decomposing operon, is converted to ε-caprolactam And activating the nitA promoter that regulates NitA transcription.
In addition, the nitR-P nitA transcription factor derived from R. rhodochrous J1 was heterologously recombined into Streptomyces species and applied to the expression system for induction of the over-expression of the target protein. The exogenous ε-caprolactam was added to the downstream of the nitA promoter There is a report that the expression of the target gene is effectively overexpressed.
The nitr- P nitA Transcriptional regulators are classified by the complementary sequence analysis into the transcription regulatory group of the XylS / AraC type. The XylS / AraC transcriptional regulatory group is characterized by the presence of a Helix-turn-Helix sequence complementary to the C-terminal region as an active factor, recognizing and binding to a specific genetic sequence and acting as a dimer. Generally, a gene is bound to a specific genetic sequence to physically restrict the corresponding gene to inhibit the expression of transcription, and when the target gene is recognized, the gene is released in a structural manner to initiate transcription expression.
The nitR gene and the nitA promoter may be nitr genes derived from a strain having a nitrilase activity and a nitA promoter. The nitrile activity may be obtained from Aeribacillus pallidus , A. pallidus DAC521, A. pallidus RAPc8, Arabidopsis thaliana , Arthrobacter sp., Arthrobacter sp. J-1, Alcaligenes faecalis , A. faecalis JM3, A. faecalis ATCC 8750, A. faecalis MTCC 10757, A. faecalis MTCC 126, Alcaligenes sp., Alcaligenes sp. ECU0401, Aspergillus niger , A. niger K10, Fusarium solani , F. solani IMI 196840, F. solani O1, Mus musculus , Sorghum bicolor , Homo sapiens, Acidovorax facilis , A. facilis 72W, Acinetobacter sp., Agrobacterium sp., Arabis hirsuta , Bacillus subtilis , B. subtilis E9, Bacillus sp., Bacillus sp. OxB-1, Bacillus sp. UG-5B, Bradyrhizobium japonicum , B. japonicum USDA110, Brassica napus , B. rapa , B. rapa subsp. pekinensis, Comamonas testosteroni , Fusarium oxysporum , F. oxysporum f. sp. melonis, Gibberella moniliformis , Halomonas sp. alphaCH3, Hordeum vulgare , Klebsiella pneumoniae , K. pneumoniae subsp. ozaenae, Nocardia . globerula , N. globerula NHB-2, Nocardia sp., Penicillium marneffei , P. multicolor, Pseudomonas fluorescens , P. fluorescens 11387, P. fluorescens EBC 191, P. putida , P. putida 11388, P. putida MTCC 5110, Pseudomonas sp., Rhizobium sp. 11401, Rhodobacter sphaeroides , R. sphaeroides LHS-305, Rhodococcus equi , R. equi CCTCC.M.205114, R. fascians , R. fascians MTCC-1531, R. rhodochrous , R. rhodochrous ATCC 33278, R. rhodochrous ATCC 39484 , R. rhodochrous J1, R. rhodochrous K22, R. rhodochrous MTCC-291, R. rhodochrous PA-34, R. rhodochrous tG1-A6, Rhodococcus sp., Rhodococcus sp. ATCC39484, Rhodococcus sp. NCIMB 11215, Rhodococcus sp. NCIMB 11216, Rhodococcus sp. NDB 1165, Sorghum bicolor , Synechocystis sp., Synechocystis sp. PCC6803 and Zea mays .
In one embodiment of the present invention, the nitR gene encoding the NitR protein and the nitA promoter are Alcaligenes faecalis JM3. It has been reported that the nitR- P nitA system derived from A. faecalis JM3 regulates expression by epsilon -caprolactam in the same manner as the gene derived from R. rhodochrous J1 and stably maintains its effect even in a heterologous E. coli. In the present invention, Was applied to the gene circuit that detects caprolactam. However, the present invention is not limited to the nitR- P nitA system derived from A. faecalis JM3, and the regulatory protein capable of detecting usable ε-caprolactam may be used as a regulatory protein of the strain in which the nitrease is reported Can be used.
In the present invention, the fluorescent protein may be selected from the group consisting of GFP, GFP UV , sfGFP and RFP. The antibiotic resistance gene may be selected from the group consisting of an ampicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, And a resistance gene.
In the present invention, the redesigned gene circuit may include a gene encoding a ribosome binding site (RBS). The reporter gene may be a gene encoding a fluorescent protein and a double reporter gene composed of an antibiotic resistance gene .
In the present invention, the redesigned gene circuit may include not only the promoter but also RBS (Ribosome Binding Site) and / or transcription termination factor which facilitates the expression of the reporter protein. That is, as a site for regulating the expression of the regulatory protein, RBS and / or a transcription termination factor may be contained in addition to the promoter.
In general, protein expression begins in AUG (methionine) or GUG (valine), which is the initiation codon in mRNA. The distinction between AUG and GUG, which are located in residues of ribosomes in proteins, and AUG and GUG, as protein initiation codons, (Or Shine-Dalgarno (SD) sequence) rich in RBS (or Shine-Dalgarno (SD) sequence). In the present invention, RBS (RBSε) for E. coli or RBS (RBSx), which can be integrally used for all strains, can be used to facilitate the expression of reporter protein in the host E. coli. In one embodiment of the present invention, T7 RBS May be available.
In the present invention, the transcription termination factor may preferably be rrnBT1T2 or tL3, and in addition, any transcription termination agent commonly used in the art may be used to constitute the present invention.
In the present invention, the reporter may be at least one selected from a fluorescent protein and an antibiotic resistance gene. GFP, GFP UV , sfGFP or RFP can be preferably used as the fluorescent protein, and the fluorescent protein that can be used in the present invention is not limited to this example as long as the object of the present invention can be achieved. In addition, the antibiotic resistance gene may be a common antibiotic resistance gene such as an ampicillin resistance gene, a gene resistant to antibiotics such as kanamycin, chloramphenicol, and tetracycline.
In one embodiment of the invention, the reporter may be a dual reporter consisting of both a fluorescent protein and an antibiotic resistance gene, or multiple reporters composed of two or more reporters.
The term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in the appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. However, the present invention includes other forms of vectors having functions equivalent to those known or known in the art. Typical expression vectors for mammalian cell culture expression are based on, for example, pRK5 (EP 307,247), pSV16B (WO 91/08291) and pVL1392 (Pharmingen).
The expression " expression control sequence "means a DNA sequence that is essential for the expression of a coding sequence operably linked to a particular host organism. Such regulatory sequences include promoters for carrying out transcription, any operator sequences for regulating such transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. For example, regulatory sequences suitable for prokaryotes include promoters, optionally operator sequences, and ribosome binding sites. Eukaryotic cells include promoters, polyadenylation signals and enhancers. The most influential factor on the expression level of the gene in the plasmid is the promoter. As the promoter for high expression, SRα promoter and cytomegalovirus-derived promoter are preferably used.
In order to express the DNA sequences of the present invention, any of a wide variety of expression control sequences may be used in the vector. Examples of useful expression control sequences include, for example, early and late promoters of SV40 or adenovirus, lac system, trp system, TAC or TRC system, T3 and T7 promoters, major operator and promoter regions of phage lambda, fd A regulatory region of a coding protein, a promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, a promoter of said phosphatase, such as Pho5, a promoter of yeast alpha-mating system and a prokaryotic or eukaryotic cell or a virus And other sequences known to modulate the expression of the gene of < RTI ID = 0.0 > SEQ ID < / RTI > The T7 RNA polymerase promoter < RTI ID = 0.0 > 10 < / RTI > Can be useful for expressing protein NSP in E. coli.
A nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. This may be the gene and regulatory sequence (s) linked in such a way that the appropriate molecule (e. G., Transcriptional activator protein) is capable of gene expression when bound to the regulatory sequence (s). For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a whole protein participating in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; Or the ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; Or a ribosome binding site is operably linked to a coding sequence if positioned to facilitate translation. Generally, "operably linked" means that the linked DNA sequences are in contact and, in the case of a secretory leader, are in contact and present in the reading frame. However, the enhancer need not be in contact. The linkage of these sequences is carried out by ligation (linkage) at convenient restriction sites. If such a site does not exist, a synthetic oligonucleotide adapter or a linker according to a conventional method is used.
As used herein, the term "expression vector" is usually a recombinant carrier into which a fragment of different DNA is inserted, and generally means a fragment of double-stranded DNA. Herein, the heterologous DNA means a heterologous DNA that is not naturally found in the host cell. Once an expression vector is in a host cell, it can replicate independently of the host chromosomal DNA, and several copies of the vector and its inserted (heterologous) DNA can be generated.
As is well known in the art, to increase the level of expression of a transfected gene in a host cell, the gene must be operably linked to a transcriptional and detoxification regulatory sequence that functions in the selected expression host. Preferably the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further comprise a useful expression marker in the eukaryotic expression host.
In another aspect, the present invention relates to a recombinant microorganism for the detection of aminocaproic acid, which contains the genetic circuit for the aminocaproic acid detection redesign.
In the present invention, the host microorganism into which the gene circuit is introduced may be Escherichia coli, Pseudomonas, yeast, plant cells, animal cells and the like.
According to the present invention, electroporation can be preferably used to transform the aminocaproic acid sensing redesign gene circuit into a suitable host microorganism, in order to increase the efficiency of transformation.
Host cells transformed or transfected with the above expression vectors constitute another aspect of the present invention. As used herein, the term "transformation" means introducing DNA into a host and allowing the DNA to replicate as an extrachromosomal factor or by chromosomal integration. As used herein, the term "transfection" means that an expression vector, whether or not any coding sequence is actually expressed, is accepted by the host cell.
The host cell of the invention may be a prokaryotic or eukaryotic cell. In addition, a host having high efficiency of introduction of DNA and high efficiency of expression of the introduced DNA is usually used. this. Known eukaryotic and prokaryotic hosts such as E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, and yeast, insect cells such as Spodoptera prougiperata (SF9), animal cells such as CHO and mouse cells,
Of course, it should be understood that not all vectors and expression control sequences function equally well in expressing the DNA sequences of the present invention. Likewise, not all hosts function identically for the same expression system. However, those skilled in the art will be able to make appropriate selections among a variety of vectors, expression control sequences and hosts without undue experimentation and without departing from the scope of the present invention. For example, in selecting a vector, the host should be considered because the vector must be replicated within it. The number of copies of the vector, the ability to control the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered. In selecting the expression control sequence, a number of factors must be considered. For example, the relative strength of the sequence, controllability and compatibility with the DNA sequences of the present invention should be considered in relation to particularly possible secondary structures. The single cell host may be selected from a selected vector, the toxicity of the product encoded by the DNA sequence of the present invention, the secretion characteristics, the ability to fold the protein correctly, the culture and fermentation requirements, the product encoded by the DNA sequence of the invention And ease of purification. Within the scope of these variables, one skilled in the art can select various vector / expression control sequences / host combinations that can express the DNA sequences of the invention in fermentation or in large animal cultures. A binding method, a panning method, a film emulsion method, or the like can be applied as a screening method for cloning cDNA of NSP protein by expression cloning.
By " substantially pure "in the context of the present invention is meant that the DAN sequence encoding the polypeptides and polypeptides according to the invention is substantially free of other proteins derived from bacteria.
The host cell for expressing the recombinant protein is Escherichia coli which can cultivate a high concentration of cells in a short time, is easy to genetically manipulate, and the genetic and physiological characteristics are well known prokaryotic cells such as coli), Bacillus subtilis (Bacillus subtillis) has been widely used. However, in order to solve the problems of post-translational modification, secretion process, active three-dimensional structure, and active state of protein, recently, unicellular eukaryotic cell yeast series ( Pichia pastoris , Saccharomyces cerevisiae , Hansenula polymorpha, etc.), filamentous fungi, insect cells, plant cells, mammalian cells, etc. Therefore, the recombinant protein is used as a host cell for the production of recombinant proteins, The use of not only E. coli but also other host cells is easily applicable to those of ordinary skill in the art.
In yet another aspect, the present invention relates to a method for producing (i) a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam; (Ii) a nitR gene encoding a NitR protein that recognizes epsilon -caprolactam; (Iii) at least one reporter gene selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene; (iv) a promoter that regulates the expression of the nitR gene; And (v) a gene circuit containing a T7 promoter which is activated by a T7 RNA polymerase and induces expression of said reporter gene,
A NtR protein encoding a T7 RNA polymerase and a NitR protein recognizing epsilon -caprolactam are bound to each other so that a nitA promoter that induces the expression of a gene encoding a downstream T7 RNA polymerase is inserted into a chromosome, The present invention relates to a recombinant microorganism for detecting lonic acid.
In order to dramatically amplify the detection signal of the present invention, the gene circuit has been improved as follows to improve the detection ability of the recombinant microorganism for detecting aminocaproic acid. That is, a gene encoding T7 RNA polymerase is inserted into the chromosome of the host cell to induce expression in chromosomal DNA by inserting T7 RNA polymerase under the nitA promoter regulating the expression of the NitR protein, and a gene encoding the aminocaproic acid to epsilon -caprolactam, a nucleotide sequence encoding a nitR gene that recognizes epsilon -caprolactam, and a nucleotide sequence encoding a T7 promoter on a fluorescent protein (FIG. 4). More specifically, the NitR protein is expressed by epsilon -caprolactam produced by aminocaproic acid, and thus nitA T7 RNA polymerase is expressed by the promoter. The T7 promoter is activated by the expressed T7 RNA polymerase and finally the sfGFP fluorescent protein, a sub-gene, is expressed.
In yet another aspect, the present invention provides a method for detecting an aminocaproic acid, comprising: (a) contacting the aminocaproic acid-detecting recombinant microorganism with a sample containing aminocaproic acid; And (b) detecting the presence of aminocaproic acid by analyzing the activity of the expressed reporter protein by detecting aminocaproic acid and detecting the presence of aminocaproic acid.
In another aspect, the present invention provides a method for producing an aminocaproic acid, comprising: (a) contacting a sample containing aminocaproic acid with a recombinant microorganism for detecting the aminocaproic acid; And (b) analyzing the activity of the reporter protein induced by the expression of aminocaproic acid in the sample to quantitate aminocaproic acid present in the sample.
In the present invention, the activity of the reporter protein can be measured by microorganism colony image analysis, fluorescence spectrum analysis, fluorescence flow cytometry (FACS), and antibiotic resistance assay.
According to the present invention, the microorganism transformed with the gene circuit is a sensing microorganism capable of detecting aminocaproic acid. Preferably, the timing of substrate addition may be adjusted so as to isolate the activation step of the cell growth-redesign gene circuit to optimize the sensing response. For example, the substrate treatment step may comprise recovering healthy microorganisms grown in a nutrient medium and treating the recovered microorganisms with a substrate in a minimal medium.
The nutrient medium or minimal medium will be applicable to a variety of media commonly used in the art.
Preferably, when the cell growth (OD 600 ) of the transformed microorganism is about 0.4 to 0.6, the substrate can be treated to optimize the enzyme activation reaction, more preferably, the activation reaction is allowed to proceed for 16 to 24 hours, The reaction can be optimized.
Redesign to Detect Aminocaproic Acid When any aminocaproic acid is treated in a recombinant microorganism containing a gene circuit, the concentration of the compound changes depending on the function and activity of the intracellular enzyme gene. Therefore, if quantitative increase of reporter such as fluorescence and antibiotic resistance by the induction function of aminocaproic acid is investigated by using various measuring techniques such as fluorescence analyzer and antibiotic resistance, a new method capable of detecting and quantifying aminocaproic acid inside and outside the cell with high sensitivity Thereby providing a measurement method.
In addition, the fluorescent protein and antibiotic resistance protein used as a reporter in the present invention can be applied not only to a highly sensitive assay but also to a specific cell without passing through the cell membrane. Therefore, Respectively. Therefore, since each single cell plays a role as an independent reaction tank and analyzer, it is possible to measure the activity of the expression-induced reporter by detecting the aminocaproic acid liberated by the enzyme reaction. Hundreds to millions of large- Samples can be measured using fluorescence flow cytometry (FACS), microcolony fluorescence image analysis, fluorescence spectroscopy analysis, and mass scanning with antibiotic selective media.
In one embodiment of the present invention, in order to perform system verification of the redesigned gene circuit constructed in the present invention and quantitative signal analysis of aminocaproic acid, a gene (e. G., A form of a meta genome, 3HBD was cloned into a separate expression vector, and 3HBD was inserted into the chromosomal DNA of E. coli) and CL-GESS (Korean Patent Application No. 10-2013-0138399) were introduced together with aminocaproic acid (6- aminocaproic acid), the fluorescence intensity was measured. As shown in FIG. 2, FIG. 5 and FIG. 6, fluorescence values were observed according to the concentration of aminocaproic acid in the culture medium containing aminocaproic acid (Figs. 2, 5, and 6).
In yet another aspect, the present invention provides a method for detecting an aminocaproic acid, comprising: (a) contacting a metagenomic library sample with the aminocaproic acid-detecting recombinant microorganism; (b) analyzing the activity of the reporter protein whose expression is induced by the aminocaproic acid present in the sample, and quantifying aminocaproic acid in the sample; And (c) selecting a strain contained in a sample containing aminocaproic acid as an aminocapronic acid-producing strain.
In the present invention, the step of contacting the metacinome library sample with the recombinant microorganism for detecting aminocaproic acid may be carried out by co-culturing a strain of the meta genome library with a recombinant microorganism for detecting aminocaproic acid, Can be carried out by treating the culture medium of the strain contained in the meta genome library.
In another aspect, the present invention relates to a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam in the aqueous solution of SEQ ID NO: 1, and a microorganism transformed with the gene.
In another aspect, the present invention relates to a protein that converts from aminocaproic acid into epsilon -caprolactam, which is encoded by a gene encoding a protein that converts from aminocaproic acid to epsilon -caprolactam in the aqueous solution of SEQ ID NO: 1, To < RTI ID = 0.0 > epsilon -caprolactam. ≪ / RTI >
Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.
Construction of a redesigned gene circuit
In order to construct a redesigned gene circuit for detecting aminocaproic acid produced from various precursors by enzymes, the present invention includes a CL-GESS gene circuit (Korean Patent Application No. 10-2013-0138399) obtained in a previous study, A gene circuit containing a gene that converts epsilon -caprolactam from lonic acid was co-transformed into host cells (Fig. 1).
First, the gene cloning process for constructing CL-GESS is as follows. First, based on the GESS plasmid constructed through previous studies, a proteolytic enzyme-regulated gene (dmpR) and a promoter region for expression of the reporter gene were identified by Alcaligenes Recombination method was introduced to replace the nitR gene from faecalis JM3.
First, the GESS plasmid pGESS-T2 was prepared by the method described in Korean Patent Publication No. 2010-0131995, and the preparation method is as follows.
The PCR product of the 425 bp rrnBT1T2 transcription termination factor from SEQ ID NO: 4 and 5 primers was amplified from pHCEIIB vector (BioReaders, Korea), and the PCR product of dPR and dmp operatorpromoter region from pGESS-T1 and 2,831 bp of GFP reporter protein region Was amplified with the primers of SEQ ID NOS: 6 and 7 and then inserted into the C-terminus of the GFP reporter protein by homologous recombination. The constructed pGESS-T1-1 is composed of 5,901 bp and is a clone in which a transcription termination factor is inserted into the reporter protein of pGESS-T1. pGESS-T1-1 was digested with EcoRI, and the tL3 transcription termination factor, which was PCR-amplified from the pKD46 vector with the primers of SEQ ID NOS: 8 and 9, was ligated to the C-terminus of dmpR and introduced into Escherichia coli by electroporation to finally give 6,171 bp Of pGESS-T2 was constructed,
SEQ ID NO: 4: 5'-ATGGACAAGCTGTACAAGTAAGCTTCTGTTTTGGCGGATGAGAGAAGA -3 '
SEQ ID NO: 5:
5'-AGCGGATAACAATTTCACACAGAAACAGCTATGACCATGATTACGCCAAGAGTTTGTAGAAACGCAAAAAGG-3 '
SEQ ID NO: 6: 5'-TCTCTCATCCGCCAAAACAGGAATTCCTAGCCTTCGATGCCGATTT-3 '
SEQ ID NO: 7: 5'-TCTTCTCTCATCCGCCAAAACAGAAGCTTACTTGTACAGCTTGTCCAT-3 '
SEQ ID NO: 8: 5'-CCCGAATTCTTCTTCGTCTGTTTCTACTG-3 '
SEQ ID NO: 9: 5'-CCCGAATTCAATGGCGATGACGCATCCTCA-3 '
Using the pGESS-T2 as a primer, the reporter protein sequence located downstream of the nitA promoter (P nitA ) and the nitA promoter interacting with the transcription regulatory factor NitR protein was positioned in the opposite direction to the nitr gene, Interference was excluded. NitR , a transcription factor, was obtained by polymerase chain reaction (PCR) using the primers of SEQ ID NOS: 10 and 11 after extracting the genome of A. faecalis strain. The nitA promoter region was also identified by the A. faecalis genome as a template, 12, and 13 primers. Finally, the final P- nitA - nitR- P nitR gene fragment was finally cloned by PCR.
SEQ ID NO: 10: 5'-CGACAAGGAGGATGTCCATGGATGGAGCAATGGTCCACCA -3 '
SEQ ID NO: 11: 5'-AGAAGGAATAAGCTTGCCGGCCTTCATGATGATG-3 '
SEQ ID NO: 12: 5'-GGGGCCGGCAAGCTTGCCGGCCTTCATGATGATG-3 '
SEQ ID NO: 13: 5'- AAGGCCGGCAAGCTTGCCGGCCCCAGGT-3 '
The CL-GESS gene circuit and the metagenome library prepared by the above method were co-transformed and then plated on LB solid medium supplemented with 50 mM aminocaproic acid and 50 μg / ml of ampicillin and 12.5 μg / ml of chloramphenicol. After culturing at 37 占 폚 for 24 hours, colonies expressing the fluorescent protein were obtained using a fluorescence microscope. The colonies formed in the solid medium were again shake-cultured in a 2 ml test tube at 37 占 폚 for 10 hours. Then, 50 占 퐂 / ml of ampicillin, 12.5 占 퐂 / ml of chloramphenicol, various concentrations of aminocaproic acid and 1% , And the cells were incubated with shaking at 37 DEG C for 24 hours to induce fluorescence expression and re-measured. The plasmid was extracted from the colonies in which fluorescence expression was confirmed, and the gene circuit including the gene that converts the? -Caprolactam from the CL-GESS gene circuit and aminocaproic acid was isolated and purified. A gene circuit comprising a gene that converts epsilon -caprolactam from aminocaproic acid secures a high yield concentration and performs a full sequence analysis. The sequence is shown in SEQ ID NO: 1.
System validation of re-design gene circuits and quantitative signal analysis for aminocaproic acid
In order to confirm the quantitative sensing function of aminocaproic acid in the redesign gene circuit constructed in Example 1, a gene circuit including a gene for converting ε-caprolactam from aminocaproic acid and CL-GESS were introduced through heat shock One E. coli DH5? Single colony was plated on solid medium at 50 占 퐂 / ml of ampicillin and 12.5 占 퐂 / ml of chloramphenicol and cultured at 37 占 폚 for about 24 hours. The colonies formed in the solid medium were again shake-cultured in a 2 ml test tube at 37 占 폚 for 10 hours. Then, 50 占 퐂 / ml of ampicillin, 12.5 占 퐂 / ml of chloramphenicol, various concentrations of aminocaproic acid and 1% , And the mixture was incubated with shaking at 37 DEG C for 24 hours to induce fluorescence expression. As a result, it was confirmed that fluorescence according to the concentration of aminocaproic acid was expressed through a fluorescent plate reader (FIG. 2).
As a result of analyzing ACA-GESS in a single cell unit using a microplate reader, the concentration of the aminocaproic acid was 10 μM to 50 mM. As the concentration increased, (Table 1 and Fig. 2).
From the above results, it was confirmed that the aminocaproic acid detection system constructed in the present invention was fluorescently expressed only by aminocaproic acid, and that aminocaproic acid at a level of 10 μM could be detected.
Aminocaproic acid Construction of a redesigned gene circuit for quantitative signal amplification
The T7-ACA-GESS gene circuit was constructed (Fig. 3) to further enhance the quantitative sensing ability of aminocaproic acid in the redesign gene circuit identified in Example 2 (Fig. 3). A fragment in which T7 RNA polymerase is inserted under a promoter regulating the expression of the NitR protein is expressed in chromosomal DNA of E. coli DH5.alpha., A gene for converting the aminocaproic acid into .epsilon.-caprolactam, and a corresponding .epsilon.-caprolactam A nucleotide sequence encoding a nitr gene, and a nucleotide sequence encoding a T7 promoter on a fluorescent protein (FIG. 3).
3-1: Construction of DH5α-pNitA-T7RNAP cells
First, the rrnBT1 terminator was used for the termination of the upper gene expression of host cell chromosomal DNA, the primers of SEQ ID NOs: 14 and 15 were used for the pNitA promoter gene, the primers of SEQ ID NOs: 16 and 17 were used, and the primers of SEQ ID NOs: 18 and 19 were used for T7 RNA polymerase And amplified by PCR. The amplified product was purified and then subjected to overlap PCR using three primers of SEQ ID NOS: 20 and 21, respectively. Then, rrnBT1 terminator-pNitA-T7 RNA polymerase gene and bglA flanking region and kanamycine-inserted vector obtained by overlap PCR were amplified with primers of SEQ ID NOS: 22 and 23 and ligated using gibson assembly method. The bglA flanking region-kanamycine-rrnBT1 terminator-pNitA-T7 RNA polymerase- bglA flanking region was amplified with the primers of SEQ ID NOs: 24 and 25 and inserted into the BglA site of the chromosomal DNA of DH5α by homologous recombination 4).
SEQ ID NO: 14: 5'-ttaattaaaggcatcaaataaaacgaaagg -3 '
SEQ ID NO: 15: 5'-ggcgcgcccagctgtcta-3 '
SEQ ID NO: 16: 5'-ccgccctacacagctgggcgcgcccccccaaccctcttgttcac-3 '
SEQ ID NO: 17: 5'-atgtatatctccttgtcgcggtatcc-3 '
SEQ ID NO: 18: 5'-ggataccgcgacaaggagatatacatatgaacacgattaacatcgctaagaacg-3 '
SEQ ID NO: 19: 5'-ttacgcgaacgcgaagtccgactctaagat-3 '
SEQ ID NO: 20
: 5'-cggcgagaagctgggccgcgggaattcgatttaattaaaggcatcaaataaaacgaaagg-3 '
SEQ ID NO: 21
: 5'-tcgtgaggatgcgtcatcgccattgaattcttacgcgaacgcgaagtccgactctaagat-3 '
SEQ ID NO: 22
: 5'-atcttagagtcggacttcgcgttcgcgtaagaattcaatggcgatgacgcatcctcacga-3 '
SEQ ID NO: 23
: 5'-cctttcgttttatttgatgcctttaattaaatcgaattcccgcggcccagcttctcgccg-3 '
SEQ ID NO: 24: 5'-gtcagcaatgacttttttcagttcagtcag-3 '
SEQ ID NO: 25: 5'-ggactatcgctggaagtcgccgcgcagggg-3 '
3-2: Construction of T7CLGESS plasmid
In order to replace the pNitA of CLGESS prepared by the method of Example 1 with the T7 promoter, pNitA was deleted using the inverse PCR method using the primers of SEQ ID NOs: 26 and 27 and replaced with the T7 promoter (FIG.
SEQ ID NO: 26: 5'- atcctgattaactttataaggagatatacatatgagca -3 '
SEQ ID NO: 27: 5'- ccctatagtgagtcgtattaaagcttttgacggctagctc -3 '
3-3: Construction of DH5α-pNitA-T7RNAP / T7CLGESS
A DH5α-pNitA-T7RNAP / T7CLNESS was prepared by transforming the plasmid containing the T7CLGESS plasmid and the ε-caprolactam conversion gene prepared in Example 3-2 into the DH5α-pNitA-T7RNAP strain prepared in Example 3-1, pNitA-T7RNAP / T7CLGESS strain A single colony was plated on solid medium at 50 占 퐂 / ml of ampicillin and 12.5 占 퐂 / ml of chloramphenicol and cultured at 37 占 폚 for about 24 hours. The colonies formed in the solid medium were again shake-cultured in a 2 ml test tube at 37 占 폚 for 10 hours. Then, 50 占 퐂 / ml of ampicillin, 12.5 占 퐂 / ml of chloramphenicol, various concentrations of aminocaproic acid and 1% , And the mixture was incubated with shaking at 37 DEG C for 24 hours to induce fluorescence expression. As a result, it was confirmed that fluorescence according to the concentration of aminocaproic acid was expressed through a fluorescent plate reader.
Meta genome From the gene Caprolactam Derivation of Converting Enzymes
The inventors of the present invention have found that the nucleotide sequence of SEQ ID NO: 28, which converts aminocaproic acid to -caprolactam from the meta genome gene of Example 1 through the CL-GESS gene circuit (Korean Patent Application No. 10-2013-0138399) 3HBD 'having the amino acid sequence of SEQ ID NO: 29 was obtained and applied to the ACA-GESS system of the present invention.
More specifically, the following primers were designed based on the nucleotide sequence of SEQ ID NO: 1 obtained in Example 1 above.
Forward primer (SEQ ID NO: 30)
(F, 5'-TTTCATATGAACTTAACGGGAAAA-3 ')
The reverse primer (SEQ ID NO: 31)
(R, 5'-TTTCTCGAGTTATTGCGCTACCCAAC-3 ')
The above primers were designed as Nde I and Xho I cleavage sites, respectively. PCR was performed using the primers shown in SEQ ID NO: 1 as a template, and as a result, the 3HBD gene could be amplified. The pET28 (+) - 3HBD expression vector was constructed by inserting the amplified 3HBD PCR product into the plasmid vector pET28 (+) (Novagen, USA) using restriction enzymes Nde I and Xho I.
Production of Transformed Microorganisms into which an Expression Vector Containing a Caprolactam Converting Enzyme Gene and CL-GESS were Incorporated (2-plasmid system)
The pET28 (+) - 3HBD expression vector prepared in Example 4 and the CL-GESS expression vector obtained in Example 1 were transformed into Escherichia coli EPI300 (DE3) (Novagen, USA) through thermal shock. Prior to such transformation, the pET28 (+) - 3HBD expression vector prepared in Example 4 was transfected with a vector backbone of pET28 (+) - 3HBD for vector compatibility with the CL-GESS expression vector ) Was converted to 'p15A' by the gibson assembly method. As described above, the pET28 (+) - 3HBD expression vector in which the starting point of the vector backbone is changed to p15A and the expression vector of CL-GESS are transformed together, and this is called a 2-plasmid system.
Production of a transformed microorganism into which a caprolactam-converting enzyme gene is inserted into chromosomal DNA of a microorganism and CL-GESS is introduced (1-plasmid system)
The present inventors used a redesigned gene circuit of the present invention to devise a system in which only one expression vector was introduced in order to further improve the plasmid stability of the strain. As a result, a gene encoding caprolactam-converting enzyme was inserted into an expression vector Instead of introducing the caprolactam-converting enzyme gene into the chromosomal DNA of the microorganism, a modified microorganism is prepared, and CL-GESS prepared in Example 1 is introduced into the modified microorganism. As a result, A new ACA-GESS system with only one expression vector was implemented. Since only the expression vector of CL-GESS is transformed into the microorganism as described above, this is called a 1-plasmid system.
Specifically, the above-described 1-plasmid system was constructed by using the pET28a-3HBD expression vector of Example 4 as a template and performing PCR using the primers of SEQ ID NO: 32 and SEQ ID NO: 33 to obtain a 'T7 promoter-3HBD-T7 terminator' (1.141 bp) containing the gene construct of pGEM-int-T7CLgess was amplified and PCR was performed using the primers of SEQ ID NOS: 34 and 35, The PCR products were digested with DpnI, gel eluted and ligated into the gibson reaction. The resulting reaction product was subjected to colony PCR (Km-int-F1 / # 6 primer) and the prepared intermediate sequence was confirmed.
(3,181 bp) of the homologous recombination product (3,181 bp) was amplified by PCR using the primers of SEQ ID NOs: 36 and 37 with the intermediate plasmid thus prepared as a template, followed by digestion with DpnI for cleavage, and gel elution. The purified homologous recombinant product (3,181 bp) was obtained from Korean Patent No. 10-0681815 and PLoS One. 2013 Nov 11; 8 (11): e79979. In summary, pKD46 DNA was transformed into E. coli host and cultured in LA at 30C (pKD46 has a temp sensitive ori). One colony was inoculated into LA and cultured overnight at 30C. 50 ml of arabinose and 1% (v / v) seed were inoculated into 100 ml of LA broth, and the cells were cultured until OD600 was 0.5, thereby preparing an electrocompetent cell. 100 ng of the 3,181 bp PCR product was transformed after 50 ul of each cell, and recovered after 1 hour at 37 ° C. The cells were then spread on an LK plate and cultured at 37 ° C. The cultured cells were subjected to colony PCR with SEQ ID NO: 38 / SEQ ID NO: 39 primer to select the colonies from which ~ 3.4 kb product was generated. The sequence was confirmed and the homologous recombination product (3,181 bp) was inserted into the BglA gene position of EPI300 (DE3) (DE3) -3HBD strain was established, and then the expression vector of CL-GESS obtained in Example 1 was transformed into the EPI300 (DE3) -3HBD strain through thermal shock.
Re-design of Example 5 (2-plasmid system) and Example 6 (1-plasmid system) System validation of gene circuit and quantitative signal analysis for aminocaproic acid
First, in order to confirm the quantitative sensing function of the 2-plasmid system, which is the redesign gene circuit constructed in Example 5, on the aminocaproic acid, a single colony of Escherichia coli of the 2-plasmid system was infected with 50 μg / ml of ampicillin, 30 LB added with / / ml kanamycin was plated on a solid medium and cultured at 37 째 C for about 24 hours. The colonies formed in the solid medium were again shake-cultured in a 2 ml test tube at 37 ° C for 10 hours. Then, 50 μg / ml of ampicillin, 30 μg / ml of kanamycin and various concentrations of aminocaproic acid and 1% And the mixture was incubated with shaking at 37 DEG C for 16 hours to induce fluorescence expression.
In order to confirm the quantitative sensing function of the 1-plasmid system constructed in Example 6 as the redesigned gene circuit for aminocaproic acid, a single colony of E. coli of the 1-plasmid system was infected with 50 μg / ml of ampicillin Lt; RTI ID = 0.0 > 37 C < / RTI > for about 24 hours. The colonies formed in the solid medium were again shake-cultured in a 2 ml test tube at 37 ° C for 10 hours. Then, 50 μg / ml of amphicillin, various concentrations of aminocaproic acid and 1% of culture medium were added to the LB liquid medium, And incubated for 16 hours with shaking to induce fluorescence expression.
Fluorescent expression of the two systems was confirmed by fluorescent plate reader according to the concentration of aminocaproic acid.
Aminocaproic acid was added at 10 μM to 50 mM, and ACA-GESS was analyzed by a microplate reader in a single cell unit. As a result, microcapsules were detected from 10 μM aminocaproic acid. (Figs. 5 and 6). The quantitative detection function evaluation results of aminocaproic acid in the 2-plasmid system, which is a redesign gene circuit constructed in Example 5, are shown in Table 2 below. The results of the quantitative detection function evaluation of aminocaproic acid in the 1-plasmid system, which is a redesign gene circuit constructed in Example 6, are shown in Table 3 below.
From the above results, it can be seen that the aminocaproic acid detection system constructed in the present invention is fluorescently expressed only by aminocaproic acid, and that aminocaproic acid can be detected to a trace level of 10 μM.
While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.
<110> Korea Institute of Bioscience and Biotechnology <120> Method for Detection and Quantitation of Amino Caproic Acid Using Artificial Genetic Circuits <130> 2015-DPA-1070 <160> 40 <170> Kopatentin 2.0 <210> 1 <211> 31339 <212> DNA <213> Unknown <220> <223> metageom <400> 1 ctgatacact cacgtggaat gattaaatat gaaaccgacg ccaaaaccgg gtttatcgtt 60 gccgatcgct tccagtcaat gccggttgcc tatcccgcca actacggttc actaacccag 120 tctttagccg gtgacggcga cccgctggat gttatctttt atactcgtgc gccgctggcc 180 ccggggacgt tgattaagct gcgcgcaata ggcgtcctga agatgatcga cggcggtgaa 240 aaggacgaca aaattgtcgc cgtgccggcc agtaaaattg accccactta tgacaacatc 300 aaagaattga gcgatctgcc caagattgaa gttcaacgtc tggaatcttt cttccgcgtg 360 tacaaagatc tgccggaagg gcgcaagaag gtcgaattaa acggtttcaa cgacgccgcc 420 acggcaaagc aagagatcaa acaggcctgg gatgcctgga aagagaaaaa accgcagcaa 480 taaatggtat gccggatggc aaaagtttat ccggcattta cttttatcac tgtactgcca 540 gcttacgcag gcgtgaaata tccacgcttt tttgggcctc tgccagactc caggtagttt 600 gcaggtttaa ccacatttcg ggtgagctgc caatcaccac agagagttta atcgccatct 660 caggcgttag ggctgctttc ccggttaata gtcgacttgc cgttgaaggt gcaatctcca 720 tagctctggc aaactcgcgc aggctgacat tgagttcttc cagcgcttcc tgaatgatat 780 ccccaggacg gggatgattt gccatcttca tcaatgatag tcctcgtagt ccagtatgta 840 cgcgtcgcca ttgacgaatt caaacgtaat acgccagtta cctgaaacag ctattgccca 900 tatgccatca cgatcaccta ccagaggatg tagcttataa ccgggcatat tgatatctgt 960 aaccttgctt gccgcatcaa taacggcaag cctgtgtcgt aatcgtcgga catgtttcgc 1020 cataacgcct gatgttcttc catgaagaaa caaatctcgc aatcccttgt gtctgaagtt 1080 catgatcatc cgtatcatcc ttgttccttc aagaggaaca ctaccattaa tgttccgtga 1140 agcgcaacgc caagattgcg atttttaaaa ttgtgcggcg aatgcgctaa aagaaaaagg 1200 gagaagggga atatctggaa agcgtcacgc aagaattgcc ggatggcagg cctacacgcg 1260 cattttgctg gtgtaggccg gataagcttg cgccatccgg caaaaaagat tactccagtt 1320 gtgagttcag acgctcaatc tctttacgcc attgcgcctg taacagcggt ttttgatgtt 1380 tcggcttgcg ggcgagatcg tcggccagac gctgttccag atcgaggagt tgttccagca 1440 atccatcgct gtcacagctt atttcagctt tcgcttcgac cactgttttg ggaacggtta 1500 tctccgcgga cgtttcccta atacgcgcat tgaccgcctc cagatcgtgc cattcactga 1560 gttcgccatt gtcgattaac cagaaccggt tacagctttg gctgataagc tgccggtcgt 1620 gactgaccag caacacgccg ccgttatagc tttgtagcgt ttctgccagc gcctctttac 1680 cttccatatc cagatggttg gtcggttcat cgagcatcag cagactgtag cgcgcaagcg 1740 tcagccccac aaacagcagc cgggagcgct caccgccgct taatgtactg accctctgcg 1800 tatgacgaat ccacggaaaa cccgcgctaa tcagcgccat cttgcgaatc tctggctgcg 1860 gggcaaacgc ttccagcgcg tcaaacaatg aatcgttatc ggcaagctga tgcagcgtct 1920 gatcgtaata gcccagcgta acgcgcgggt gcaacaccag tgaaggcgat gccagctgtg 1980 attgaaactg ttgccagata agccttaaca gcgatgattt accgcaacca ttacgcccga 2040 caattgccac gcgatcgccg ctttttaacc ggataccggc aatggaaaac agtgtatctg 2100 tgtcgggagc aggggctaca gacagattgg tcatctccag caaacgatct gcacgcaggg 2160 aatcaccctg caatgttagt gtccactgac ttcctgccgt cacttctgtc tgcacctctt 2220 tcaggcgctg cacctgtttt tccatctgct tggccttgcg ggagagatct tcgttgtcgt 2280 agacccgccc ccaggttgcc agccgtttgc tgctggcggt aacccggtct atctcttttt 2340 gctcagcctt gtggcgcaga gcatcgctga cgtctctttc tgccagcgcc tgacgtgccg 2400 cgctacaggg cagatcaaag gcatggagag tgcgatcgcg caggatccac gttccgtgag 2460 tcaccgcgtc cagcaactgc gggtcgtggg aaaccaccac aaaactgcca gaccagttct 2520 gt; gcagcagcag gtcaggatta cgcatcaatg cccgcgctaa tagcaagcgt gtgtgctggc 2640 caccgctcaa cgtttgcgct gtcagagata aattctctgg cgtgaaaccc atttcggcaa 2700 gcagcgcttc aactcgccat tgttgagccg cacgctcatg ctcaggaagt tgagcgagaa 2760 cggcttcctg cagcgtaaga ggcaatatat cgtcaggtag atgttgttct acacgcgcga 2820 gatggcagtg attcgcttgc gcgattgctc cactggtggg cgaaatcgtg ccatcgagca 2880 gtcttaacag cgtgcttttg ccgcagccgt tgtaaccgat aagcccgatg cggtcgcctt 2940 ttttcagggt aaaggaaaga tcgtcgaata gcgtgccgaa tgccgtatca acgtgtaagg 3000 attgtgcggt tagtaatgtg ctcattgttg cttactcaag agttacaggc gtgaaaacgc 3060 ctcgtcaaac atcgctgacg ataacccggt aagcccgaga gaaggggatt tagaagttag 3120 cttcgctcaa gcagaagtta tcgcagcacg ataccgataa cgcttgagca ctggcgatcg 3180 ccaaaagcat gtgaaacgat aaaacgttca cagtacagca taagtatcct ccttttgttt 3240 ttcagagtgt tgatcggtag cgaaagtgta atcgcaaatt acactttcgc gcaaactttg 3300 cggcccggc agcaatgtgc cgccgggcaa accgtcagat agaagtacga cggtagtcgc 3360 gatattccgc ctgccagaaa ttatcgtcaa tagcctgttg cagcgcttca gcggaggttt 3420 tcaccgccac accttgctgc tgggccattt taccgacggc aaaggcaatg gcacgagaaa 3480 ccgtctgaat atctttcagt tccggtagca ccagtccttc accgttgagc accagcggtg 3540 aatactgtgc cagcgtttca ctggccgaca tcagcatttc atcagtgatg cgcgacgcgc 3600 cagaagcaat cacgccaagg ccaatacccg ggaagatata ggcgttgtta cactgggcga 3660 tcgggtaagt tttctctttc cacactaccg gtgcaaacgg gctaccggtc gcaaccagcg 3720 cgttaccttc ggtccaggcg ataatatcct gcggcgtggc ttctacacga gaagtcgggt 3780 tagacagcgg catgacgatc ggacgcggac aatgcttgtg catttcgcgg ataatctctt 3840 cggtaaacag accaacctgt ccggaaaccc cgatcaggat gtcaggttta acgttgcgga 3900 ccacatcgag caacgacagg acatcttctt gtgtatccca gtgctgcaga ttttcgcgtt 3960 tttgcaccag tttggtctgg aaggagagca ggttcggcat tttgtcggtt aacaggccga 4020 agcgatcgac catgaatacg cgttgacgcg ccgcttcttc gcttaaacct tctcgctgga 4080 tttgcgcaat gatctgctcg gcgatcccgc atccggcgga acccgcgccg aggaagacga 4140 tgttttgttc gctcagctgg cttccggccg cgcggctagc cgcaatcagc gtaccgacgg 4200 taaccgccgc ggtgccctga atatcgtcgt taaatgagca aatttcatcg cgataacggg 4260 tcagcagtgg catagcgttt ttctgggcga aatcttcaaa ctgcaacagc acgtccggcc 4320 agcgatgctt cacggcctgg atgaattcat caacgaattc gtagtattca tcatcagtga 4380 tacgcggatt gcgccagccc atatacagcg gatcgttcag cagttgctgg ttgttggtcc 4440 ccacgtccag taccaccgga agtgtatagg ccgggctaat tccgccacat gcggtataca 4500 gcgacagttt accgattgga atgcccatcc cgccgatccc ctgatcgcca agacctaaaa 4560 tacgttcgcc atcggtgaca acgatgacct tgatattgtg gttagggacg ttttgcagga 4620 tatcgtccat attgtggcgg ttctgataag agataaacac gccgcgcgca cgacgataaa 4680 tctcagagaa acgctcacag gctgcgccga ccgttggggt atagataact ggcatcatct 4740 catccaggtg attatgcacc aatcggtaaa acagggtttc gttggtgtcc tggatgttgc 4800 gcaggtaaat atgcttgtcg atttcggttt tgaagccctg atattggatc caggcgcgtt 4860 cagcctgttc ttcaatcgtt tcgacgactt ccggcagtaa ccccagcagg ttgaagttac 4920 ggcgttcttc cacactgaag gcgctccctt tattcagtaa agggaattcc agcagtaccg 4980 ggccagcgta agggatgtaa agggaacgca gttttttagt ttcgttttcc atgtcactca 5040 ctcttttttg aataaccgtc cctggcgctc tttatgatcg tatgtggcct gtccgccagg 5100 gaaacgggcg aagtataaag cattgtgaat gggttaaggg gttttataag caaaaacacc 5160 actgcggttg caatggtgtt tatctcgtta ctcagtcaga cgtgcgaaag gctacttgcc 5220 gtcagcgcgg cgctttcttc cagtaggatt gttgaccacg ttggttttgt caccttcggt 5280 cacgatttta cgttgatttg agattttgtg gtccagtccg agaatatgac gggcctgacg 5340 gttcgatttc attctaactc cttaatcctg ttactggttt caagggcgag cccgtatgag 5400 aacggacgaa atacaacctg atataaagcc gatgttcaac ataacggctt tctggatggt 5460 cggtcatttt atctgaaagg tcaatgctta agcggcaaat gagaactatc ccgtatgtaa 5520 catacttttc cccgggcgtc ctatactagt aactccgacg acaacacagg agagcggtaa 5580 tgactatcca taagaaaggt caggcacact gggaaggcga cattaagcgc ggcaaaggca 5640 ctgtgtcgac cgaaagtggc gtgttgaatc agcaaccgta tgggtttaat acacgatttg 5700 aaggtgagaa aggtaccaat cccgaagagt tgattggcgc ggcccatgca gcctgcttct 5760 cgatggcgct ttcactgatg ctgggtgaag cagggtttac cccagatgcc attgatacca 5820 ctgccgatgt ttctctggat aaggtagatg ccgggtttgc gatcactaaa gtcgcgttgc 5880 atagccaggt gagcgtgccg gggatagacg ccgccacgtt tgacggcatc atccagaaag 5940 caaaagccgg atgcccggta tctcaggttc tgaaagcgga aataacgctg gattacaaac 6000 tgaagtctta ataaagtcgt gccggatgtg accagttctt atccggcacc tgatgatgtt 6060 attgcgctac ccaaccgcca tccatattcc acgctacgcc acgcacttgc gccgcaccgt 6120 ctgaacataa gaataacgca agattcccta actgctctgg ggtaacgaat tcgcgcgacg 6180 gctgcttttc agccagcagg gcgtcacggg cagcctcagg ctctgcgcct tcggcaatac 6240 gcttatcgat ctgctgctgg accagcggcg ttagcaccca gccgggacac agcgcattgc 6300 aggtaatttc cgtctgcgcg gtttccagcg cgatggtctt ggttaatccc accacaccgt 6360 gcttcgctgc tacgtacgca gatttctctt ttgaagccac caggccgtga acagaagcga 6420 tattaatgat gcgcccccag tttcgcgcgc gcataccggg aagcgccaga cgcgtggtgt 6480 gaaaaacgga ggagaggtta atcgcgataa tcgcgttcca tttatcaacc gggaaggttt 6540 ctatcggtga aacatgctgg atcccggcgt tattgataag aatatccaca ccgccgaatt 6600 cgctctctgc atagcgcatc atgtcggcaa tttgcgcttc atcgctcaga tccgcgccat 6660 gatagcctgg cgttttgcca tactgcgcaa cagcgtcttt ggcggcatca acatcaccaa 6720 acccgttgag gatcagggtg gcgccagctt gcgccagcac ctgtgcgata cctaatccga 6780 taccgctggt cgagccggta accagggcgg tttttcccgt taagttcatg atgattctcc 6840 ttaaacaatt ccggtggtgt agaagacgcc gatgacaaac agtacggcca gacttttaat 6900 gatggtaata gcgaaaattc cgccatacgc ctggcgatgg ctaaggccgg tgatagccaa 6960 taaggtaatg accgcgccgt tatgcggtag ggtgtccata ccgccgctgg ccatagatgc 7020 cacgcggtgg aagacttcaa gtgggatatt ggcggcatgt gcggcagcga taaaagtgtc 7080 agacatggcg gcaagcgcaa tactcatccc gccagacgcc gaaccggtga tcccggcaag 7140 cgtggtaatg ctgatagcct cattgagcag cgggtcagga atagccgcca gcgcttttga 7200 cagcacaagg aagcccggca gggcggcgat cactgcgcca aaaccgtact ctgacgcggt 7260 gttcatcgcc gcaaggatcg cgccgcctac cgccgttctg ctgccttccg ccaggcgacc 7320 tttaatgttg cggtagccga agagcaccac cagcaggatc ccagaaatca gcgccgcttc 7380 cactgcccag atagcggtga ttttaccgac ttcggtggta atcggtttgg caagacccgg 7440 aagttcaagt tgatgcgtgg cgccgtacca ctgtgggatc cagcgggtaa acagcaggtt 7500 aaatacccca accaggatca gcggagagat cgcgatgatc gggttcggca gattaatgtt 7560 atccggcgtt tccggctcgt ttaacagttc agtgccatag ccttcattct ttgcctgcgc 7620 tttacgacgc tgacgttcga gataaaccag accgacgaaa ataataaaca gcgagcctat 7680 cagccccagc cacggcgcgg cccaggcgtt agtcccaaag aagctggtcg gaataatgtt 7740 ctggatctgc ggcgtgcctg gcagagcgtc catcgtgaag gagaacgcgc ccagcgcaac 7800 ggtggccggg atcaggcgct taggaatatt actctggcgg aacaactccg ccgcaaatgg 7860 atacaccgca aacgccacga cgaacagcga aaccccgccg taggttaaca gcgcacacac 7920 cgcacgatc accgggatgg cgtgacgacg accgaggatg ttgatagcgg cggcaacaat 7980 ggaacgtgaa aatccagata actcgattaa cttgccaaac actgcaccca gcaagaacac 8040 cgggaagtaa agcttcacaa aaccgaccat tttttccata aacaggccgg tgaaagcagg 8100 gccgacggcg ctgggttcag tgagtaatac agcacctaat gccgcgatgg gggcaaacag 8160 gatgacgctg tatccgcgat aggctgcaag catcagcagg cccagtgctg ccagggcgat 8220 taatacactc atcatgactc cttattatta tattggggta cagaaagaga cgttatggtt 8280 tcagggcaaa acgcagttga tgctctctgc gttgctggat gtactccttg cgcgaatcat 8340 cccagcgata aaatccctga ccgctgcgta aaccggtatc accgttggct accttgtcag 8400 cgaccaacga catcatctcg ctgccggttg ccagttccgg gagcagatgc cgacaaatat 8460 cctgtaccgt agacagcccg gtcatatctg ccgcttccag cggaccaacc atcgcatagc 8520 gacgtccgag cgaggcgcgc atgacctgat ccaccacctc tgcgctggcg atgccgcttt 8580 taacgatatg aagcgcttca cgcagcaaag caaactgcag tcgattgccg acaaaccctg 8640 gtgcggcgcg atcgagcacg acggcttcca gttgcatcga gagcagccac tgttgcagct 8700 cacgcaggta ttccgctttg gtggcggtgc cggggacaat ttcgaccagc ggaataaaat 8760 gtggcgggtg ccagaaatgg gcgatgagca gccgctcagg atggacgagc ttttctgcca 8820 gcgcatccgg cggcaggccg ctggtattac tggcaatgac ggcctcaggc gcgatcagat 8880 cttccagttg cgcatacaac gcgtgcttga gctcgagccg ctccgggatc gcttcaatca 8940 gtaacccgca cgcagcaatc tccggtagcg aagtcgtacc gtgcagacga ctcacaacct 9000 ggtctttttc gtctacggca aactgttcgg cggtaatcag ctcatccaga ataccgctgg 9060 caacggcgct aatttctgca attcggctgc tatcggtgtc atacagccag acatcgtgac 9120 cataacgggc gaagtgggtg gcaataccga cccccattaa ccccgccccc agaacgcaga 9180 caggcttact ttgcatgaga gacctcctgc aaacgctcta ccgccagcgc tacgccctga 9240 ccgccgccta cgcacagcgt agccagccct ttggtcgcgt tactgcgggc catttcgtgc 9300 aacagtgtca ccaggattcg gcaaccagat gcaccgatgg gatggcccag cgcaatcgcg 9360 ccgccattta cgttcacccg gtcgctgtcc cagttcaggg attcgccaac cgccagcgct 9420 tgtgcggcaa aggcttcgtt ggcctcaatg agatcgacat cattcaacgt ccagcccgct 9480 cgcttcaggc actggagtga cgcttctacc ggcccaaggc ccataatggc gggatcgaca 9540 ccagaaaccg cgtagcctgt tacccgggca agcactggca aattgagttc tgcggctttg 9600 ccggcgctca tcaacatcac cgcggcggca ccatcattga tggatgatgc atttccggcg 9660 gtcaccgtgc cgtttcctgg cagaaatgct ggtttaagtt gcgccagctt gtcggcctga 9720 gtatccgggc gaggctgttc gtcacggtcc accacacgtg gcggcttttt gccttgtggg 9780 acgctaaccg gcgtgatttc cgcgctaaaa cgacccgctt caatggcagc ggcggctttt 9840 tgctgggagc gcagggcaaa agcgtcctgc tgctcacgac tgattacgaa cttatccgcc 9900 agattttcgg cagtaatacc catgtgatag tcgttgaacg catcccacag gccgtcatgg 9960 accacgctgt ctttcatact ggcatgaccc agccgcaggc cggcccgcgc gccgtcgaga 10020 aaatagggcg cattgctcat gctctcctgg cctccggcaa tcacgatttg cgcatcgcca 10080 cagcgaattg cctgtaccgc ctgatgcacc gccttcaggc cagaaccgca caccagatta 10140 atagttaacg ccggtgtggt tgacggcagt cctgcgcgta acgccgtttg tctggccgga 10200 ttctggccgc agcctgtcgt gagcacctga cctaaaatca cttcatcaat ttgttcaggc 10260 gccacagccg ttttttccag cagcgaacgg acaaccgctg tacctaactc cacggcggaa 10320 agtggtgcca gcgcaccatg aaaactgcca atcggggtgc gcgttgccgc gacaattaca 10380 acatcctgca tggtcagctc ctcagttaaa ttgcatttcg gggacagttt cgggcacgat 10440 cagcttgccg gcggttctgg cgacgatttc atccacactg atacccgggg cgcgttcacg 10500 cagaatgaac gccccgtcgg caatttccag cagagccagg tcggtaagca cgcgtttgat 10560 gcaggccacg ccggtcaacg gcagggtgca ggcgggaagc agtttggact caccgctttt 10620 ggaagcatgg gtcattacca cgatgatgtt gtcggctccg gcaaccaggt ccatcgcgcc 10680 gcccatgcct ttcaccattt ttccggggat catccatgag gcgatattgc cgttaacatc 10740 gacttcaaac gcaccgagca ccgtcagatc aacgtggccg ccgcggatca tggcgaagga 10800 ttgcgcagag tcgaaaatcg ccgcgccttt gcgcgccgtc acggtctgtt tcccggcgtt 10860 aatcatgtcg gcatcaattt cgtcttctgt gggaaacggc cccataccca gcaaaccatt 10920 ctctgattgc agcatcacgt ccatgccatc agggatataa tttgccacca gagtgggaat 10980 gccgatccca aggttgacgt aataaccgtc gcgcagctcg cgggcgacgc gcatcgccat 11040 ttgttcacgc gttaacatgg tcaggctcct ttctggcgca gggtgcgttg ttcaatacgt 11100 ttttcaaact gcccctgaat aatgcggtta acgaaaattc cgggagtgtg aatcgctgca 11160 gggtccagtt ctccgggagg gacaatctct tcgacttcca cgacggtaat gcgcccggcg 11220 gcggccatca gcggattaaa gttctgtgcg gtgtggcgat agatgacgtt gccgtaccag 11280 tcggctttcc agcctttaac caatgcaaaa tcaccggtta tcgcctgttc aaggatgtaa 11340 gggcgtccgg caaactcgcg aacctctttc ccttccgcta cgggggttcc atatccagtc 11400 gcggtaaaaa atgccgggat ccccgcgccg cccgcgcgca actgctctgc cagcgtaccc 11460 tgtggcgtca ggatggcttc cagttcgccg ctaagcacct gcttctcaaa cagggcgttt 11520 tcccctacat aggacgcgac cactttgcgc acctggcgcg tttccagcag tacgccgagg 11580 ccaaagccat ccacgccaca gttgtttgat acaacggtaa gtccctgtac ttctcgacgg 11640 cgtacttcgg taatcaggtt ttcagggatc ccacataaac caaaaccgcc cgccagcagc 11700 gtcatgttgt cggtcagtcc ttccagcgcc tcttgataag tggcaacacg tttatccagt 11760 ccagccatac acttgcctcc ccagttgtcc ttgccgacat cattgggggt gaaaaatgat 11820 ttgttaattt taaatttgtg actcactcat tgggtttttt tatcaattta atgttaatta 11880 aaggtattca acaagttaaa ggaatgcgaa atgggaatga gcatcaaaca gttacgcgcg 11940 tttttagcgg tagctcacac tctgaatttt gctcatgcca gtgaaagact gaacatgtcg 12000 caacccgcat taagcctggc gattaaagga ctggaagatt cgctgggcgg ggcgttactg 12060 ttgagaacca cccgcaaagt gactctgacg caggagggag aaacgctgct gaatatgggg 12120 agacagctgc tggcggactg ggagaatacg gaagaagcca tgcgccaacg ctttacgcta 12180 cagcgcggta aaatctcgat cgccgccatg ccctcatttg ccgctaacgt cctgccatcg 12240 gtactgaaaa cgtttcgtga ttcttattct ggtatcaacg taacggttca tgatgtgatc 12300 aatgaacacg tgattgaaat ggtcagtgaa gggcgggtcg agatgggcat agccttcgag 12360 ccggactatt cgggacatct gcatttcacg ccgctcggcg tggatcgttt tatcgcgatt 12420 gtgccgccaa cctgtcggct ggcagacagg gatcgtattg catggcgcga actgctgacg 12480 ctggatttca tcaccttgca acgtccgtca gccgtgcggc tgatgctgga agaacaactg 12540 gtgcaaagcg gacatacgct ggaagtagcg ctggagagcc atcaattagt aaccgttggc 12600 cgtctggtgg ctaacggtct gggcggtagc gccgtacctg cactatgccg cacgcaaatg 12660 gcagagttag gcgcaacctg tatcgatctg gatacgccgg tgatccagcg tcggatcggg 12720 gtttggggt cagcacatca taaattatct actgcttccg aggtgctggt ggattcactg 12780 aaaaaggcgt atcgcacctg acttttcact acggctcagg tcatgtaacc gcccgccagc 12840 atcgaacatc acatccggta tcacttttca gtaatgcctg ttttttctca caaccgtggg 12900 ttgccaatgg acatctgtca cggaaaaagc atccctgggg caacgttcgg tttcccggta 12960 gctcggtttt acgtaacacc aaatcttccg tcagtggcgc gcccgtttta gggacagagt 13020 ccagcaataa ccgtgtgtac ggatgggcgg ggtgagtgag aacgtgttga gcatcgccca 13080 gctcaacaat ttgcccgagg tacatcaccg ccacacggtc gctcatatgg cggaccaccg 13140 acacgttatg cgatatcaat acgtaggtca gatttctgcg cgcctgtagt gacaccagaa 13200 gattgagaat ttgcgcctgc acagagatat ccagtgctga agtgggctca tcgaggacga 13260 taacatccgg ctctgacgat agcgcccggg cgatggcaat acgctggcgt tgtccaccgg 13320 aaaacgcatg cggcagacgg tcgagatatt ccgggcggat gcctacctgt tgggctaaat 13380 cttcagcaag catgcggcgc tcacgttccg gacttcgttt ttggatccat accggctcag 13440 tgatcgtgcg ccacaccggt aagcgaggat ccagcgatga aagagggtcc tgaaagacca 13500 tttgcatacc gttatgctgt ttatcaccac ggcgagaata gcttccctgg ctgggtttca 13560 gcatgcccat cagcagttgc gccagcgtac tttttccaca accggattcg ccaacaatcc 13620 ccagcgtttc accctggcga atctgtaaat ccagaccgtt gagcgcatgc acccgttccg 13680 taaccttgcc aagccagttt ttacgcgcag gaaagttgac atgaacatcc tgcagcgcca 13740 gaaaaaaatc agacatgtgt tgtctccagt tgtggatacc agcaggcaga ttgttgatct 13800 acgcctccct gactacttaa cgcaggcgtt tcttcacaac gaggaccagc ggcaaagcag 13860 cgctcacgaa atgcgcatcc ggcaggtaag caggttaggt tcggtacggt gccggggatc 13920 gcaggtaaca atgcgcgtgg ttcgccgtgt tccggcgcgc atttcagcaa gccgatggaa 13980 tagggatgcg tcggacgttg aataacggtt tgcgtcgggc cactctcaat cacgctcccg 14040 gcatacatga cgtacaaccg gtcgcataac tgtgaaacca ccgccatatc atgactgata 14100 aataacacgg ctgttccgct ggcccgtgct tttaacttca gcaaacgcag cacctgcagt 14160 tgcaccgtga cgtccagcgc ggtggtcggt tcatcggcaa taataagctc tggctcgcac 14220 gaaaaggcca gcgcaatcat cacgcgttgg cgcatcccgc cggaaagctc aaacggaaat 14280 cgtttcatga cctccggcgc gtccgggatt tgcatctctt cgagtagagc gacggcttta 14340 tgacgggcat ccgtgcggct taacgcctgg tgatggcgga tcacctccac catttgctgg 14400 ccgatacgcc tggtcggatt cagtgccgtc atgggctcct gaaagatcat cgcgacgcgt 14460 gcgccgcgcc attggcgcat ttgtttctca ctggcgttga gcacatcttc acccagcagt 14520 gaaacgcgtc cctggtgaat acgatagctt ccctccggaa gcagacgcat ggtgagcatg 14580 gcggtcacgg acttaccgga accggattca cccaccacac caacgatttc tccacggttg 14640 atgatgcagtg atacatggtt cagcgcatgc acatcagctt tatagccggg gaaactcaga 14700 tgtaaatctt cgatttccag tacgggttgt gtcatgactg ttttcctccg gctttcggat 14760 caagcagatc gcgaatacca tcgccaaaga gattaaagcc cacggcggta atcagaatgg 14820 ccgcgccggg aaaagcgcaa taccaccact gatcaagcac ataattgcgg ccaattgcga 14880 ccatcgcgcc ccattcagcg ctcggctgct gtgcgcccag accaataaac ccgagcgtgg 14940 cggccatcag gatcgcactg ccgatatcca gcgaggcctg cacgatgagc gggggcagcg 15000 aattgcgtaa aatgtgccag ctaatcagat gccagcgtga agccccgtaa gtgcgcgccg 15060 cctgtacata ggtgaactga cgcaccacta acgtctgacc gcgtgcgagg cgcacataga 15120 aagggatacg gacgatggca atcgccagca tggcgttaaa caggctgggg cccagcgcgg 15180 cggccaacgc catcgtcagc accagcgaag gaatggacag cataatgtcc atcatccgca 15240 taattatcgc gtcggcgcgc ccgcccatga cacccgacaa gcagcccagc agtgatccca 15300 atcccccggc gatacccacc accaccagac ccgcaacgac cgactgctga cttcctacca 15360 gaacgcggct gaacagatcg cggccaactt catcggtacc aaaccagtga gcggctgacg 15420 ggggcagcag gcgcgcactc aaattgatgg cattaggatc gtgtggcgtt atccacggcg 15480 acagcaccat cagcagcagt atcaatacga tgatgacccc gccaaccagc gtcagcgggc 15540 tacttttcat catccagaac agtttggtcc agtccgtgcg gcgtcgtgct gtctgagggg 15600 ctgtcggcgt ttcttgtgtg agcatcattc agcacctcca cgtccaattc gaggatctac 15660 ccacaaatag agcaaatcca ccaccaggtt gaccagcaca taggcgaacg agaccaccac 15720 ggcaaatccc attaccgccg ggaaatcgag cgcctgaatt gaggtcacca cccaagcgcc 15780 catgcctggc caggcaaaga ccgtttcggt caataccgca ccgtagagca gatcgcccag 15840 cgccaggccg aggacggtga ttgatgggat gagtgcgtta ggcaatgcat agcacagcac 15900 gatgtaccag cccggtaacc cgctggcgcg ggcggtacga atgtaatctt cactcagttg 15960 ctccagcatg gcggaacgaa tctggcgggc aacgatccca agatgtacaa aagccagtgt 16020 caacgacggt aaaatcaggt gctgaagcgc attgaaaaag acttcgccgt tgccttccag 16080 cagtgcatca atcaggtaga acccggtgac gtgagcaggt ggatccagcc agtcgtctaa 16140 acgtccaccg ccgggtaaaa tttgcagatg accgtaaaac agcacgataa cccccagccc 16200 cagccagaat gcaggcgtgg agataccggt aattgccatt agccgaacaa ggtgatcaag 16260 ccagcggtta cgccagaccg cagataaaat acccagcggg atacctatca ccagcgccag 16320 caacaaagag cagaaagcca gctcaagggt agcggggaag aaaatgcgca gttcatccag 16380 taccggacgc ccggtgcgaa tggaggtgcc taaatcgccg tgaaaaatgt cgctgacata 16440 gcgaaaaaac tggacataca gcggttgatt cagccccagc tgttggcgaa tattttcgac 16500 aatttcatcg ctggcgcggt cgcccgccag cagccgtgcg gggtcgccag gtatcagatg 16560 tgaaataata aaggtgatta cgcaaacacc gataaccacc agaataagtc cccagcatcg 16620 ctggcgcaaa atactccaga acgtcattag cttccccttg cggagccaga gcggctccgc 16680 gtaaacgtgg cttatttact catggtggag atattgaaga cctgttccag catggggttg 16740 aatacaaatc ctttgacgtc tttgttcatc gccaactgat agtttttctg gaataaatag 16800 acgtaggccg cttcatcaat cacgatggtt tgcgcctgct ggtagtcatt ggttctggcc 16860 acctgatcgg tcgtagccag cgcgctacgt agcagcttat cgacctcact gttttcatag 16920 aacgaacggt tacccggcaa gcctttctta tctgactcaa accagtagtt cataaacatg 16980 tacgggtcgg caaaatccgg actccagttg ccaatggcaa tgtcgtaatc gcctttgccc 17040 acgcggtcac gcatggtggc gttcgccagt ttttccagct tcaccttaat gcccagtttg 17100 ccaaggcttg cctgggtagc gagcgcgata ggttcccagt ttggatcatt atctgagtac 17160 aggaagctca ggctttcagg tttggtggca actttgtccc acgctgcttt ggctttggct 17220 tcatcgaagc tgtactgcat ggccttatcg tcaaaacccc acatgccttc ggggattggg 17280 ccacgcattt gctttccatt gccgctcagg atcccgttga ccatgccttt ataatcggtg 17340 gcccacgaga tagcgcggcg taaatccacc tgattgagcg gggccttact gttgttgaga 17400 tacagataag tcacgcgcaa tgagggataa tccgccacgt tcactttgcc ttcctgtttt 17460 aaagcagcaa gctggtcaac aggaagcgca tcggcaatgt cgatatcgcc acgggacagt 17520 tgcaggcgac gggaggcgct ttcaccaatg attttgactg agacgcgatt aaacgtcggt 17580 tttgtaccgg cataatgcgg gttaggcacc agcaccagtt gttgtccctt ttgccaactc 17640 ttcagcatga agggaccaga gcctgccgtg ttctgtgcca ggaatccgcg ggcatcgtct 17700 gcggcatgct cttttaagat ggccgggtta atgattgagg caccgtcatt tgccagcgta 17760 tacagaaacg gagcaaacgg ctggctgagg gtaaacttca ccgtggtgtt atcaatggcc 17820 tcaaccttca gatctttcgg gaaagcctcc gcaggtccct gaccaatctt gagcaatcgt 17880 tcgaaggatt gctttaccgc atcagccgtc accggtgttc cgtcggcgaa tttggcatcg 17940 tttttcaggg taaacgtcca ctctttctgg tcgtccgagg ctttccagcc gctggctaaa 18000 tcgccttcaa cttccgtgga acctttacca ccatctgttt tgtactgaac caaccgctgg 18060 taagagggat aggtgaccgt ccagtcattg ttatctatgg tcacagcggg atcgagcgtc 18120 tgcggatcgg cggctttacc aatcactaac atatctttgg gaacggcagc ctgcgcggca 18180 ggcagggcta ccgctaacgc aacggctatc agagcggggc ggaaaaaagc gtttaacgca 18240 ggtgtagtct tcataaccag gctccagaat taaaggggat gttgtgttgt tatagacgtg 18300 acagtgtaac aatctatttg atcgtcaagc agcgggtaac gggcggcatc aggtaattca 18360 aaatgccacc attcgctgtt aataccgaca aaaccaccac caaacataat ggcattgagc 18420 agcaggcggt tacgctgcgc tgccggagga acagacggat gccaggcatg ggaacggtcg 18480 tgcatatcat caaaaccggc ccccatatca aggagatggc cgcgatcgtc catcaacgtg 18540 acgtcaattg ccgtaccccg actgtgattg gaaccaatgg caacatcgac aacatattgc 18600 gggtcgggac aggcattcca cagtatcgcc tgcgcctgct gggggcgata cgcgtcgtac 18660 accaccagcg acaagcccgc cagttgcgca atgctgatgc tttttgccag cgcggttacc 18720 gcctcggtgt gcaacaggca acgcgcttcc ctgtagatag gtgcgccggt aatgttgtcg 18780 gcagtagcgt atttaagatc gatatgcagc gacggaaata tcaccgacag atcgaccagt 18840 tctgggagtt ctgacatagc acgtttcctg tttattgttc gaattgacca aattgttgtt 18900 gtaactggcg attagtttgc aggcgtcctg cgagggcgtc acccagttgc gccaccaccg 18960 cagaaagtaa taagttgaac agacagctca ccggtgccag tgagtcccag aaatgtccgg 19020 tgtcggtttt tacctgaagc aaatcaatgg aataatccct ggcccatggg caccacacat 19080 cggtaattag cgccagcgga atgcagcgtt cagtggcgac acggcaatat tgtcgcgaaa 19140 tagcggagta ggcgcgcata tcggtaataa ccacgtaagg cttgctgaat cccgagttca 19200 gcgactctac ccaactgccg gaaaggcctt cggagtagct gactttaggt cgcagatatt 19260 ccaggtgact aaaaaaggcg ttagcgatcc cgcgggtgga ctggatcccg aggatgtaca 19320 cggcttccgc atgcgccaac tgctgtgcaa tgcgtagaaa agtctcaccc tgagcaagtt 19380 ggtagacgtg ggtaatggcg tcgatttcca gtaacagcga ctggtgcgcc cgatctggca 19440 ggctttgttg ctggtgccag gaatccagtc gttcattcat tccccagggc tgatacggaa 19500 ctacaggcag ctcacgcaga ctggcttttg catcctccag gttacgaaag cccagtttac 19560 gcagataacg tccgacggta atgccgctgg ttccggtcgc tttagcgatg ccatccgcgg 19620 tttcaaatgg gatctgcaca acatgggcta acagccaccc agccacgcgc ttttcgctgg 19680 gcgtcagctg gctaaaggtt tgctctatgc gggtaaataa ctctggtttg gctgtcatta 19740 ccttctcgct gttacttgtc tgtcagatta cggctcactg ttagcgaatt aacaatgcag 19800 gacgcgtgcc aagctgctta cagcggcatg ctggctgttg ttgttaaaac tcagctcaaa 19860 ttcgttaact aatgatcaac atttgtgcag cgtagttcag ttttggtgca acggcagagg 19920 aagcggggta tgaatctgct gatttcgtcg gaacgatcac attgtgggca acatttatcc 19980 ctaagacata agaatcagta attgaaaata taaatttcag ccatatcaat aacaccaatc 20040 tttattctta tgactataag ggtattattt ttcacgagct acattaacgg tgttaagcgc 20100 aagtgtagat attatttata ttatacatgg agtactacaa tgaataaatt ctccctttct 20160 acagcaggta ttctggtcgc agcgctgtta accagtgtca gcgtcaatgc agcaacagat 20220 aacgctaaaa ctgaagtgac tccgaaaggc atgaactgtc aggagtttat tgatttgaac 20280 ccacaaacta tggctccggt ggccttctgg gtgctcaatg aagacgaaga cttcaaaggt 20340 ggcgattacg tagactataa cgaaaccgtt acgactgcag ttcctctgac cgttgaactt 20400 tgtaagaaac atccgcagag cgaattaagt aaaataaaag acgaaatcaa aaaagaatta 20460 tctaaataaa attaagccgt tattaaaacc cagccaaagt gctgggtttt gttatttgtt 20520 acattgtcac ttttttcttt tgcaatactt aagaaatctt tataaagata taaacgcctg 20580 tgccgatact ggataaaagt tagccttttg cagaaggagt ttgtatggcc tggtatccta 20640 ctcgtatttc aacgcgttta accatcggcg gcattctgct gcttgcagta acgactattg 20700 ttatcgtggt gattatgctc tggcgtggtc agccgcgcgt cgttgaaatc aacaccgccc 20760 tgatcgaaga aacagggcaa ggtttaaccc gtcagttgag taccgtattg tcccgaattg 20820 aaggtgagac agtcagcatg tcgcgactgg ctgaagtgtt gcctaacgat gaatctctgt 20880 atcaaagcgt cgttccgcat ctgattggtg aaggtaaaga ctcgattatt accggcggcg 20940 gcatctggcc agaaccagac gccttcaccg caggtgtgga gaaaagaagc tttttctggg 21000 cgcgtaatgc cgaaggaaag cttgtctatt ccaacgatta taacgtcgaa ggatcaagcg 21060 gataccacaa tgaaagctgg tatcagcacg ccaaagggca atcacaaaac aactgcctat 21120 ggtctgatgt ttaccaggat gccagttcag gtgtcaacat ggtgacatgc agcgtgcctt 21180 atcagcaggc gggcaagttt gccggtgtcg ctaccaccga tatccgtctg gataacgtcg 21240 caactttcat gcagcagcag ggcaacagta ctggcggtta cgcgtttgtg gtagacaagc 21300 agggacaaat tctctatttc ccgcaggccg acctggccaa acataaaacc attaacgatc 21360 tggcgcaaag cgcgcagtgg cttatcccgg tgcaaaatgg actgaaatct ttgcgcccga 21420 cagatggggt gaagaccata acgctggaaa atgatctcgt cctgaataca gcgtcacagg 21480 tcatgctgtt cccgatgcca gataccggct gggtcgtagg gcttgtgaca ccagaatcac 21540 gtattgtcgg tcttgccaaa gtgatgatgc aggacgttct ggaggtattg atccctatca 21600 tgacgctgtt gctggtggga tcatggctgg tggttcgtcg actaatttca cgtctcgatg 21660 atactcgtca ggctcttgat gacatcgcgc agggagaagg tgatcttacc cgtcgtctgg 21720 atgttcgcgg caaagatgag atttcggcta tcgccgaggc gtttaacctg ttcgtcgata 21780 aaatctcggc catcctgatt accgtcagaa gcagtagcac agtggtggcg aataacgccg 21840 ttagcctggc tgacagtaat atggagcttt catctcgcgt aacgcagcag gccgctgcgc 21900 tggaagagag ctcagcggct atggagcagt taaatgcgac cgttcatcaa aacgccagta 21960 atacacagtt ggcggatgag ctatccgata acacagcgca aacggccaac cgttgcggtg 22020 atgtgatgca gggcgttatc tctacgatgg ataacgtcag cgcctcatcc ggcagaatgg 22080 tggaaattgt cgctgtcatc gacagcattg cgttccagac caatattctc gccctgaatg 22140 ccgcggttga agccgccaga gcgggtgatg ctggcagagg gtttgccgtc gtggcctccg 22200 aagtgcgcac gctggctcag cgcagtgcca ccgctgccca ggaaattaaa gcgttgattg 22260 atgaatccgt ttctcatgtt ggtagcggaa gtcagcaaat tcacactgcc ggcgaacgtc 22320 tgggagaact ggtcagcaat gtgcgtcagg tacgccagtt gatgggggaa atacgcgttg 22380 cgggtgaaga acagcgtaaa ggtgtttccg aagttacgct cgccgttacc gaaatggaca 22440 gcaccgttca gcaaaacgca tcattaattg atgatgccgc cgcacgtaca caggcattga 22500 aagaggaggc ggagcagttg gcgttgctgg tctcgtcatt cagattgcct gagccttcag 22560 tggcctgata acgacacgat atccgggtgc aaacattgtg cccggataac tccagtataa 22620 tggcgcttaa ccacgattta tcgattttac tcctctttat tgtgccttac aaaactttga 22680 atcattcccc gcttaactct ataatattgg gtgtaaagtc gtttttattc caataagagc 22740 caatattatg gatttaacgc tcaatacagc agccgatatc gtcaaactac tttgcgacag 22800 attgcgtaag gaacggctcg cgcagcaaat gacgcaggca gatgttgccg cgcgttcagg 22860 tgtcggtgtg aataccgttt cgaatctgga agcaggtaaa aatgtaggat ttgagaatct 22920 ggtcaaagtc gcgatggtgt taggctatgg tgacgcgctg gagggcttat tcaaacccag 22980 gatcgacagt ctggatgata ttttgcgtta cgagaagagc gcggcacgtc agcgggtgaa 23040 aaggaaaaat actgatgcct gagcaagtcg atatctttta tgaaggctgg ggtgaaaaat 23100 ggttgtgggg aaaactggtg tcttcctcag ccctgaccgg acgcccgttg atcgcctttg 23160 aatacagtga agacgctaga cgtaaggggc tggaactgtc ccggctaagg ttaccgctga 23220 acggtcctcg tttacgcagg gatttcccgg ctcatcagtt gggattacca ggacccgtgt 23280 acgattcgct acctgatggt tggggtatgc tgttgatgga tcgtttattt aaacgccgtg 23340 gactcaacgc agcgcgcata ggacctctgg agagattaac ctgggtcggc aataacgcaa 23400 tgggcgccat gacgttccgg cccgttcagt cagatgtcga gacgctttca aaagaggatg 23460 ttcctctcga acaactggca tctgaggttc aggaagtcct gagcggcgaa ggcggggaat 23520 tcttgcaaaa actgctccag atgggtggtt caccgcaagg ggccaggcca aaagcgttac 23580 tttatcgtga cagtgtcacg tcaaagttca ccactgcgcc tcccccgggg agcgaaagct 23640 ggttgattaa atttcctgcc aggcatgagc atgctgaggt atgtgcaatc gaagcggtgt 23700 atgctgaatg tttgcggcaa tgtgggatca ctacgcctga taccgcgtat tttaatctgc 23760 ctgacgggca ggcggcattt gctacccgcc gtttcgaccg tgaccaatcg gtccgtattc 23820 ctatgcagag cctggcggca tttaccggtg caaattacca gatacccggt gctttagatt 23880 accgggattt tctgcgcgcc acacagattt gtaccaatga tgtcagagaa aaagcgaaag 23940 cgttcgaacg cgtggttttc aacgtggcat ttaacaaccg cgatgaccat cccaaaaact 24000 ttgcctattt aatgtcagcc gcaggaaact ggactttggc tccggcttac gacgtgacct 24060 ggtgcgaagg acccggcggg tatcatcaaa tggacgtgct gggagaagcg ctggatatcg 24120 aaagaaagca cctgcagcag cttggcgtac aggaagctga gctatcagct gagcatgtga 24180 acgctataat cgacaagatc tgccaccatg caacagcgct aagcgttaca gccaaagaca 24240 aatacgccga tcagataaca caaactacgc tgaatacgat acagaaacag attaatgata 24300 atgtccgccg gttaatgtcc ctgtgatgca gagacagccg ctacacttag cgaagaatta 24360 aatctgagcg aggcaacgtt atggctgaat ttgtcgtgaa tatgctgaaa aacacgccag 24420 tttgggtgta tctgctgttt gcctttctac tgtatcgagg gattaaagcc agaacacctg 24480 ccactgtcac gctggaaaag ctggcgctga tccccgctat ttttttagtc tgggatatct 24540 acgatttaat cacttatcgc gacccgaccc tcattaccta tattcagtgg gcgataggta 24600 tcatcagcgg cgcaatcatt ggctacatat taattaaccc cggcagtttg agccgcagtt 24660 gcgcaccacg gagtattcac cgtccggcag attattccgc attgccattt atgctgctgg 24720 cattcggcgt taagtacgta cttggcgtac ttaacgccat ttcccccgac gttttacgtc 24780 aacccgcaat gagcgccctg gctatcatta ctggcggcat gttcgtcgga gtttttgtgg 24840 ggaaatttac ccgctacgtg agcgtctggc tcaggcttcc cgctcagaac aaccattaac 24900 gtccccaacg attgcgaata taggtcacag cttcctgcgt ttgcggttga ttaaggtaat 24960 cttcgcgaaa caggatcgtg ccgttaatgt acggttcggt ctcgtttaga tcgagctgct 25020 ttttcagttc cggcacaccg ccttttaccg tccagtctgg ctcttttcgc gacggttcgc 25080 cgactttata cagcgcgaca ccaatgtaga ggcgagtgtt ggttgatttc acgacatctg 25140 cccaccattt tgccagtaca tcgtagcgcg ctgcgtcgcg ggcaaaaggc cagtagagtt 25200 gcggtgcgat gtaatccagc aagccctgtt gcacccaacg gcgggtatcg gcataagact 25260 catcatacgc tgccgccccg cgcgtgtcgg agcccgctgg atcgtgcgaa cggttgcgcc 25320 atacgcccgc agggctaacg ccaaactcga cttcaggctt gagtttcttg atggtctgcg 25380 atacctgggc aatcaacctt tgcgtgttat cgcggcgcca gtcagctttg gaagcgaatt 25440 cctggccgta tcttctgaag gtctggctgt cattgagcgc agagccggga gactcggtat 25500 agaagtaatc atcaaactgc acaccgtcaa ccgggtaatt ctcaaccact tccgccacga 25560 tgctggttat ccagtcacgc acttcgggaa taccggggtc taacacaaaa cgctcgcccg 25620 cggtgcggat ccagtcccga tgcaggacgt atacgctgga cggtgtttgt gacagcgtgc 25680 tgtttaattc agtgaccgtc gaaggtttgg tgtttacaga cacgcgatag gggttaagcc 25740 aggcatgaac tttcattccg cgcttatgcg cttcatcgag cataaactgc agcggatcgt 25800 aacccggatc ctggccaatc gtgccggtca gggtatctga ccacggcaga atctttgact 25860 tccacaatgc ggtcccatcg ggcttaacct ggaaaaaaac ggtgttaata ccaagtcgtt 25920 tcaggttgtc cagcttatcc gtcagcgctt tttgctgcag gctgatgcgt acagcaggtg 25980 aactgatgtt cacagatgag atcggcggcc agtcaagacg tgaaaccgtc gccagccaga 26040 tcccacgcac tggctccttg ctctgctgag gtttgctcac cggaggttgc ggagtggttt 26100 tggggccggg cggttgtgaa gaacagctgc caagtaacaa catactgccc acaagtacag 26160 caaaccattt catgttggtc agcggtagtc tggcacgaaa acgggcgata atcttcgcca 26220 gttttttctg ataatttcct gaaaagaaac cggatgctgc catctgattt tgctcttatt 26280 tcttcttatt gcggctgtta gcccagggat cgaaggccgg ttcgggagtg ttatttgagg 26340 cctggtcatg tagagagtcc aggtacagtg cttctacttc tgcccgtgcc cacggcgtac 26400 ggcgcagaaa cttcaaactg gatttaacgc tcggttcatt tttaaagcag ttgatattaa 26460 tgcgttgcgc cagctcagcc caaccataac gttcaaccag ggcattgacc tgcatttcta 26520 gcgtcacgcc atgtaaaggg tctttagaat tatgagcatt catatgaagt ccagttcagt 26580 ggttccagat tttgtcagta gtgagacggg aagaaggtta caagaaagca aagctgccag 26640 caacggcaga aagcggtatg gcgtgacaag ccgtacgtca taccggcaat ggatggatca 26700 atactcttta aaagccagtt ccagacgggc aatcaacggt ttaaacagat aactcatcag 26760 ggttcgttca ccggtcttga tcgtcacgct ggcgggcatt cccgctttaa ttttgtaatc 26820 gcccagcaaa cgcgcgccct ctgctgaaac ctgtacttcc gcaaggtagt aaggctgctg 26880 agtggcttca tcaattaagc ggtccgcaga gatagtcaga acctgggccg gaaccgaagg 26940 taacagcgca tggttaaggg cagggaacag cacatcaacg gttaaaccgg ggaccagttt 27000 atcaatggca tgtacgggta ttttggcatc aatttgcatc ggttgtccgg cggcgacgat 27060 atccatcaaa tgttctccag gctgaatgac gccgcccacg gtactgactt taacatccag 27120 cacaataccg ttaatcggtg agcggatctc ggtgttatcc agctcatgac gcgttgatac 27180 caattcatcc tccagcattg ccacttcttt ttggttttcc gtcagttcag actcaacttc 27240 acgtaaatac tgatgacgca cctggtaggc tttaattttt aattcgttct gctgcgattt 27300 cagtttggca atgttaagaa tatcttctga aacgctgcca gatatttctg ctgcctcgcg 27360 ctccagcacc agtaattgtg ctttggggta atagtttttt tcgctcagcg cccgaatagc 27420 ccctaactcc cggttaatca gagaaaactg gtggtcgcga tagcctttta ttttattgag 27480 attatccgtc tgtccaacca gaccatcaag cgtctcctga atcatcgaca gttcatcctg 27540 aatcgttttg cgacgggtat cgaaaagttt agcctgcaga tttctgactt ctgatagccg 27600 tttattgcca gagaattgct gcgtcagcgt agtattaaag cggatcacat ccaggtcatc 27660 gcgttctgct aacagacgat cttcgatact ttttgcagaa atatactggg cattcaacgc 27720 gctgaaacgc atttcaagct gcattttatc caaccggacg aggacctgat ttttcttcac 27780 gaagtcgcct tctttgataa agatatcggt tacccgaccg ccgctcagat gctgaatggt 27840 tttgcggtta ctcgatacgg taaccgtacc atcggcgacc acgcccgcat ctaacggagc 27900 ttgcactgcc cagaggataa aactaccgac accaagcaca atgacgatca cgccccggat 27960 aatcggcgac cagatattgg tatctacgcc agcagaggcc gtgttgtggg ggttcttttt 28020 catcatcaag cctcacgttg ctgttcagtc gtggatggag aaggcgtagc caccggtttc 28080 agtacgttgg cctgacgcaa atgggcaaaa acctgatcgc gggtaccaaa ctcctgtata 28140 acgccatcgt taagcagcaa aaccttattg accacgccga gcagcgtcgg gcggtgtgag 28200 ataatgactg tggtttgtcc ctgggtacgc agagcattga tggctttaac gagtgcaaat 28260 tcgcccgcgt cgtcaagatt ggcattcggt tcatcaagca cgataaacgc aggattgtta 28320 tacacggcgc gcgccagccc gatgcgctgc cgctgcccac cggagagctg gtatccacct 28380 gcgcccagca gagtgtcata accttgcggc aagcgcagga tcatctcatg aacgcctgcc 28440 agtaatgcgg cggcgacgat aagctcactg tcattctgcg cgaagcgggc aatgttttgt 28500 gcgatggtac cgtcaaacag ttccacatcc tgcggcagat agccaataga cgggcccagc 28560 agagatttat cccactggca tatatctgcg ccatctattc tgactttccc tgataacggt 28620 ttccagacac caaccagaac ctttgccagc gaggtttttc ctgaggctga agggccgata 28680 attcccagca cttcaccttg ctccagctgg aatgagatat tacgcagtag cggggaatgc 28740 tggccggggg ctgcagcgaa gacgctttcg acgctgatgt tgccattcgg acgcggcagg 28800 gtcagtacct ctttcggcgc cggatactcc ttcagcaagg ttgagagctg atgccacgcg 28860 ctacgaaact gcacgaactg cttccagctg ccaatgactt gttctaccgg gttgaggacg 28920 cggccaagaa tgatcgaggc ggcaatcatc aagcccgggg taatatggcc gccgatcacc 28980 agtaaagccc cggcgcccag cgcaatcgac tgcagcaata cccgcacaaa gcggctgaga 29040 ctgcttaacc cggccgtttt gtcggcaatc tgtgtttgta gcgccagcac tttgttatgt 29100 tgctcctgcc agttggactt cagggtcgaa agcatcccca tcgcttcaat ggcatcggcg 29160 ttttgcagct gtttattcag tttgctggca ttgttaatgg ttaaggcgtg cgcttgctga 29220 atcgggcgct tggtagagat ttcagatacc agcgtcagaa taaataata cgttattccg 29280 ccgagagaaa gatatcccag caggggatgg accaaaaagg cgatgaaaag atatatcggc 29340 gtccagggaa tatccagtaa ggcgaacaga ctattcccgg aaagaaactg acggatctga 29400 tccagttcgg ctaaagattg cgccgggttg ttatcaccgg tagccatctt tcttttaaag 29460 gctgagttaa agaccaactg acttagcttt atatccagcc tgttgccaag cctgaccata 29520 acctgcgcgc gggcagattc aatcatggca ataacgatgt acaagccgac aatcaataag 29580 gttaacatta acagcgtggt ggtattttta ctgaccagca cacgatcgta aacctgtagc 29640 atataaattg ccggcgccag cataagcata ttaatcacac aactaaaaaa cagcagcatc 29700 agaaaagtgg gtttcgttcc ctttaatgca tcattcagtt ctgttggcgt atgctggcgc 29760 gacatagtct tctccttata cgatcaatga actattgcca ttgttgctgg caagggtagt 29820 gggcatttcc agataaaagt caccaatatt cacggtggtc gaattgacgc ccaccaatgt 29880 gatggtgtct gtaccgatag tcacaatggt gttgccattg tttccggtga tagacacgct 29940 gctggcaaaa ttacccgcgt tgatacctaa caagacgaga tcaaggaagt cctgcccgcc 30000 gttggggtta ctgtcaaaac cggtaattcg gtcctgccca aagttggccc caaaggcgaa 30060 gatgtcgctc ccggtgccac cgtccagaat gtcgttacct tcctgaccat tgagaatatc 30120 gtccccgcta ccgccggaga gggtatccgc gcccgcaccg ccaatcatga cgtcgttgcc 30180 aacaccacct tgcaggttat caacgccatc tccgccatcg aggaagtcat tcccgatacc 30240 accaaacaac tggtcgttac cgcccatacc aaacagatag tcgttaccag aaccgcccgt 30300 gatggtattt gcaatggcat taccggtacc aataaaactg ccgttgccgg taaataccag 30360 ttcttccacg ttatcggtga ggtcgtagct gctgaggctg gttcggacaa cgtccgtacc 30420 gctattcaca ccttcgataa ccacatcacc gaaatcatca acgatgtagg tatcatcgcc 30480 cgcgccgccg gtcatactgt cggcaccaag cccgccatca agcgtgtcgt taccggcatc 30540 accttgcaga atatcttgtc ccgcctgacc agagagattg tcgtttccag caccgccgat 30600 gagcagatcg tcacctgcac cgccaagtaa ggtgtcatta ccgccttcac cgcgcaggat 30660 atcgctccag gcagtaccga cgagggtgtt agccccgttg gtaccaacaa taagatcgcc 30720 tacaggctgg gtggtggtcg acgtcaggac aacagggggg ttgccttcat cgtcgacgac 30780 ggtaacgacc acctgcaacg ttctgccgac catagcctgg cccggcgtat aggtagcgga 30840 tgtcgcaccg ttaatgttga cgaatccggt tggcgaactc attctccatt gataagtgaa 30900 attaccgccg ctcagaccat cagcgtcaga aatgcctgaa accaccgctg tcagcgtcag 30960 gctttcagtt ggggtgaggt cgttaattac tggcacaccg gtcgtggcct gattgcgcgg 31020 gaggattgcc tgagtttgtg ccgacaccag ggtttcagcg tcacccatgc ggtcgttaaa 31080 actggcgacc acacgcaacg gtgcgccctg aatagcgcca ggcactctga actcaacgcc 31140 tgttgcctga tctcgccatt ggccgttgac gaatgcctgc caggtcatag tgatggccac 31200 atccgccgcc agcccgttac catccagcaa gttcgccacg ttgacgcgca gcaggtcacc 31260 caccgaagga ttaggattgc tgatggtcag atcgcccgtc gcttgttgcc ccgtcaccca 31320 cagctgcttc ccatcgcca 31339 <210> 2 <211> 984 <212> DNA <213> Alcaligenes faecalis JM3 <400> 2 atggagcaat ggtccaccac ggcaattccc gctacccggc gcgcacccta ttggatggag 60 gccgtcaaca aggcctatgt gcaactggaa tgcgccgttc cctcccgctc cagcgcccct 120 ttcttcggag ccattacgcg tcgtgagctg gcggccgtca gcctctccca tatcacctcg 180 accacacaga cggtactgcg cacgcctttg caaatttcca gagcatccga ggatattttt 240 ctgctcagca ttcaggtggc cggagcggga aaactggttc aggacgaaaa aaccgctcac 300 ctgaaacctg gtgacctggc cctgtacgac tccacccgcc cctatcagct cttgtttgac 360 catgacttcg agcagtatgt gctttctttg cccggctcca tcttgcgcaa gcgtttacac 420 aatgccgagg acatgacggc ctgcaaaatc accagcgccc aatccggcac ggcacgtttg 480 ctctcccata tggtcagcga actgatggac tgcccaccct ccggtggccc aattgtagat 540 ttgtcgcttg ccgacagcct ggtcggtatt ctggtcgctg cgctggcaga aaatctgggc 600 agcctgcctt taagcgacga tacggggtct gtccgacgcg accgcatcaa agcctatgtg 660 ctggaaaatc tgcgcgaccc ggagctgaat ataggcaaga ttgccaaacg tttgagcctg 720 acggccagca ccgtgcatcg cgcctgggag ggcgaagccg attcactgac aaactggatt 780 tggtccatgc gcctgaaagg cgctgaacag gatttgcgcc ggctggccca ccacaacaag 840 accatcacgg aaattgctta ccactggggg ttcagcagct ctgcccattt cagccgggca 900 tttcggcagc actttggtgt gccgcccaaa gaggcccgcg aaagtatgcg ggccctggtt 960 caatcagact cgatgcctgt ctga 984 <210> 3 <211> 748 <212> DNA <213> Alcaligenes faecalis JM3 <400> 3 gccggccttc atgatgatgc gcccgaagtc ccctcgcaaa ctggccagag ggccgatata 60 cacgccctca ccaataatga cgtcaccaat cagtacagcg gtaggatgaa cataggccgt 120 gggatgaacc acgggcacca gcccatcaat agaataaata ttttgcatac ctgcctcgta 180 caaaaagcct gcacccgcag ccggccccag gtccggccaa aaatacgatc atagctgcta 240 cagaccgata taatgcgccg tactctttct ttttgcatcc tatgagcatg ttgtattact 300 ggctggcttt ttccttgggc atggtgtttt acgccgccta cttgtcgcag tcctttttgc 360 tgtcgcaagg catcctctac atgaaggaaa aagatcaatc gccgcccctg ctctggctgt 420 tcacccgcct gatcggcttt attctgcgca ccattcccgg cttgctgatg cgccccatcc 480 ccctgattct gtgggtcgtg ggcatggggc tgacggtgca atacagcttc gcgctttaag 540 ccaggcagcc cccaaccctc ttgttcactg cacggacggc caggccagga tgggggactc 600 ccgctccccc tgcttgcgac tcccagtcaa gcatcctgcg cctgtcagtc aattcatcgc 660 caccttcccc tcctacactg acgcaaacca agacgaccgg gctcggtaag cagcgcggtc 720 tggcgatcag gatcgcggat accgcgac 748 <210> 4 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 atggacaagc tgtacaagta agcttctgtt ttggcggatg agagaaga 48 <210> 5 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 agcggataac aatttcacac agaaacagct atgaccatga ttacgccaag agtttgtaga 60 aacgcaaaaa gg 72 <210> 6 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tctctcatcc gccaaaacag gaattcctag ccttcgatgc cgattt 46 <210> 7 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cttctctcat ccgccaaaac agaagcttac ttgtacagct tgtccat 47 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 cccgaattct tcttcgtctg tttctactg 29 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cccgaattca atggcgatga cgcatcctca 30 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgacaaggag gatgtccatg gatggagcaa tggtccacca 40 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 agaaggaata agcttgccgg ccttcatgat gatg 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ggggccggca agcttgccgg ccttcatgat gatg 34 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 aaggccggca agcttgccgg ccccaggt 28 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 ttaattaaag gcatcaaata aaacgaaagg 30 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 ggcgcgccca gctgtcta 18 <210> 16 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccgccctaca cagctgggcg cgccccccca accctcttgt tcac 44 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 atgtatatct ccttgtcgcg gtatcc 26 <210> 18 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ggataccgcg acaaggagat atacatatga acacgattaa catcgctaag aacg 54 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ttacgcgaac gcgaagtccg actctaagat 30 <210> 20 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cggcgagaag ctgggccgcg ggaattcgat ttaattaaag gcatcaaata aaacgaaagg 60 60 <210> 21 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 tcgtgaggat gcgtcatcgc cattgaattc ttacgcgaac gcgaagtccg actctaagat 60 60 <210> 22 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 atcttagagt cggacttcgc gttcgcgtaa gaattcaatg gcgatgacgc atcctcacga 60 60 <210> 23 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cctttcgttt tatttgatgc ctttaattaa atcgaattcc cgcggcccag cttctcgccg 60 60 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gtcagcaatg acttttttca gttcagtcag 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 ggactatcgc tggaagtcgc cgcgcagggg 30 <210> 26 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 atcctgatta actttataag gagatataca tatgagca 38 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ccctatagtg agtcgtatta aagcttttga cggctagctc 40 <210> 28 <211> 771 <212> DNA <213> Unknown <220> <223> Caprolactam Convertase gene <400> 28 atgaacttaa cgggaaaaac cgccctggtt accggctcga ccagcggtat cggattaggt 60 atcgcacagg tgctggcgca agctggcgcc accctgatcc tcaacgggtt tggtgatgtt 120 gatgccgcca aagacgctgt tgcgcagtat ggcaaaacgc caggctatca tggcgcggat 180 ctgagcgatg aagcgcaaat tgccgacatg atgcgctatg cagagagcga attcggcggt 240 gtggatattc ttatcaataa cgccgggatc cagcatgttt caccgataga aaccttcccg 300 gttgataaat ggaacgcgat tatcgcgatt aacctctcct ccgtttttca caccacgcgt 360 ctggcgcttc ccggtatgcg cgcgcgaaac tgggggcgca tcattaatat cgcttctgtt 420 cacggcctgg tggcttcaaa agagaaatct gcgtacgtag cagcgaagca cggtgtggtg 480 ggattaacca agaccatcgc gctggaaacc gcgcagacgg aaattacctg caatgcgctg 540 tgtcccggct gggtgctaac gccgctggtc cagcagcaga tcgataagcg tattgccgaa 600 cgcgcagagc ctgaggctgc ccgtgacgcc ctgctggctg aaaagcagcc gtcgcgcgaa 660 ttcgttaccc cagagcagtt agggaatctt gcgttattct tatgttcaga cggtgcggcg 720 caagtgcgtg gcgtagcgtg gaatatggat ggcggttggg tagcgcaata a 771 <210> 29 <211> 257 <212> PRT <213> Unknown <220> <223> Unknown <400> 29 Met Asn Leu Thr Gly Lys Thr Ala Leu Val Thr Gly Ser Thr Ser Gly 1 5 10 15 Ile Gly Leu Gly Ile Ala Gln Val Leu Ala Gln Ala Gly Ala Thr Leu 20 25 30 Ile Leu Asn Gly Phe Gly Asp Val Asp Ala Ala Lys Asp Ala Val Ala 35 40 45 Gln Tyr Gly Lys Thr Pro Gly Tyr His Gly Ala Asp Leu Ser Asp Glu 50 55 60 Ala Gln Ile Ala Asp Met Met Arg Tyr Ala Glu Ser Glu Phe Gly Gly 65 70 75 80 Val Asp Ile Leu Ile Asn Asn Ala Gly Ile Gln His Val Val Ser Ile 85 90 95 Glu Thr Phe Pro Val Asp Lys Trp Asn Ale Ile Ale Ile Asn Leu 100 105 110 Ser Ser Val Phe His Thr Thr Arg Leu Ala Leu Pro Gly Met Arg Ala 115 120 125 Arg Asn Trp Gly Arg Ile Ile Asn Ile Ala Ser Val His Gly Leu Val 130 135 140 Ala Ser Lys Glu Lys Ser Ala Tyr Val Ala Ala Lys His Gly Val Val 145 150 155 160 Gly Leu Thr Lys Thr Ile Ala Leu Glu Thr Ala Gln Thr Glu Ile Thr 165 170 175 Cys Asn Ala Leu Cys Pro Gly Trp Val Leu Thr Pro Leu Val Gln Gln 180 185 190 Gln Ile Asp Lys Arg Ile Ala Glu Arg Ala Glu Pro Glu Ala Ala Arg 195 200 205 Asp Ala Leu Leu Ala Glu Lys Gln Pro Ser Arg Glu Phe Val Thr Pro 210 215 220 Glu Gln Leu Gly Asn Leu Ala Leu Phe Leu Cys Ser Asp Gly Ala Ala 225 230 235 240 Gln Val Arg Gly Val Ala Trp Asn Met Asp Gly Gly Trp Val Ala Gln 245 250 255 Glx <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> Atrial sequence <400> 30 tttcatatga acttaacggg aaaa 24 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 tttctcgagt tattgcgcta cccaac 26 <210> 32 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 aatccgccgc cctagacagc tgggcgcgcc taatacgact cactataggg gaattgtgag 60 60 <210> 33 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 ctgggccgcg aattcactag tgatgaattc atccggatat agttcctcct ttcagcaaaa 60 aacccc 66 <210> 34 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 atatccggat gaattcatca ctagtgaatt cgcggcccag 40 <210> 35 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 agtcgtatta ggcgcgccca gctgtctagg gcggcggatt 40 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <220> ≪ 223 > blaA300up (30 mers) <400> 36 gtcagcaatg acttttttca gttcagtcag 30 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> bglA300dn-2 (24 mers) <400> 37 ggactatcgc tggaagtcgc cgcg 24 <210> 38 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> bglA500up (35 mers) <400> 38 cgctgttggc tatttcctct gccagtgaat atccc 35 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> bglA400dn (32 mers) <400> 39 gcggcgctat cgtcaatgtc tcttcggtgg cc 32 <210> 40 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> km-int-F1 (18mers) <400> 40 gcttcctcgt gctttacg 18
Claims (40)
Ii) NitR (nitrilase regulator) which recognizes? -Caprolactam The first gene nitR gene encoding a protein, and are possibly connected to each other and the operation nitR gene containing a promoter which control expression of the gene construct nitR; And
Iii) one or more reporter genes selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene, and a reporter gene operatively linked to the reporter gene, wherein when the NitR protein recognizing epsilon -caprolactam is bound, a second gene comprising a promoter nitA (aliphatic nitrilase promoter, P nitA) to induce the expression construct;
Wherein the recombinant microorganism is an aminocaproic acid.
The first gene ⅱ) is nitR gene encoding the nitrilase regulator (NitR) protein that recognizes the ε- caprolactam, and allows mutual connection and the operation nitR gene containing a promoter which control expression of the gene construct nitR ;
(Iii) a gene encoding T7 RNA polymerase, and a gene coding for said T7 RNA polymerase, operably linked to NitR protein recognizing epsilon -caprolactam, the expression of the following reporter gene A second gene construct comprising an inducible nitA promoter (P nitA ); And
iv) at least one reporter gene selected from the group consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene, and, when activated by T7 RNA polymerase, operably linked to the reporter gene, expressing the reporter gene A third genetic construct comprising a T7 promoter inducible;
Wherein the recombinant microorganism is an aminocaproic acid.
Wherein the gene coding for the enzyme for converting from aminocaproic acid to epsilon -caprolactam comprises the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 28.
Wherein the enzyme converting the aminocaproic acid to epsilon -caprolactam comprises the amino acid sequence of SEQ ID NO: 29.
NitR the gene and promoter are nitA nitro relay's (nitrilase) strains derived which is active nitR aminocaproic acid detected for recombinant microorganism, wherein the gene and promoter nitA.
The nitrile-active strains are Aeribacillus pallidus , A. pallidus DAC521, A. pallidus RAPc8, Arabidopsis thaliana , Arthrobacter sp., Arthrobacter sp. J-1, Alcaligenes faecalis , A. faecalis JM3, A. faecalis ATCC 8750, A. faecalis MTCC 10757, A. faecalis MTCC 126, Alcaligenes sp., Alcaligenes sp. Aspergillus niger , A. niger K10, Fusarium solani , F. solani IMI 196840, F. solani O1, Mus musculus , Sorghum bicolor , Homo sapiens, Acidovorax facilis , A. facilis 72W, Acinetobacter sp., Agrobacterium sp., Arabis hirsuta , Bacillus subtilis , B. subtilis E9, Bacillus sp., Bacillus sp. OxB-1, Bacillus sp. UG-5B, Bradyrhizobium japonicum , B. japonicum USDA110, Brassica napus , B. rapa , B. rapa subsp. C. pekinensis, Comamonas testosteroni , Fusarium oxysporum , F. oxysporum f. sp. melonis, Gibberella moniliformis , Halomonas sp. alphaCH3, Hordeum vulgare , Klebsiella pneumoniae , K. pneumoniae subsp. ozaenae, Nocardia. globerula, N. globerula NHB-2, Nocardia sp., Penicillium marneffei, P. multicolor, Pseudomonas fluorescens, P. fluorescens 11387, P. fluorescens EBC 191, P. putida, P. putida 11388, P. putida MTCC 5110, Pseudomonas sp., Rhizobium sp. Rhodobacter sphaeroides , R. sphaeroides LHS-305, Rhodococcus equi , R. equi CCTCC.M.205114, R. fascians , R. fascians MTCC-1531, R. rhodochrous , R. rhodochrous ATCC 33278, R. rhodochrous ATCC 39484 , Rhodochrous J1, R. rhodochrous K22, R. rhodochrous MTCC-291, R. rhodochrous PA-34, R. rhodochrous tg1-A6, Rhodococcus sp., Rhodococcus sp. ATCC 39484, Rhodococcus sp. NCIMB 11215, Rhodococcus sp. NCIMB 11216, Rhodococcus sp. NDB 1165, Sorghum bicolor , Synechocystis sp., Synechocystis sp. ≪ / RTI > PCC6803, and Zea mays .
Wherein the nitr gene comprises the nucleotide sequence of SEQ ID NO: 2. 2. The recombinant microorganism of claim 1,
Wherein the nitA promoter comprises the nucleotide sequence of SEQ ID NO: 3.
Wherein the reporter gene is a double reporter gene consisting of a gene encoding a fluorescent protein and an antibiotic resistance gene.
Wherein the recombinant microorganism contains a gene in which a gene encoding an enzyme converting i) aminocaproic acid into epsilon -caprolactam is cloned, ii) a vector in which the first gene construct is cloned, and iii) Wherein the vector comprises a cloned vector. ≪ RTI ID = 0.0 > 11. < / RTI >
Wherein said recombinant microorganism contains a gene in which a gene encoding an enzyme converting i) aminocaproic acid to epsilon -caprolactam is cloned, and ii) a first gene construct and a third genetic construct Wherein the recombinant microorganism is a recombinant microorganism for detecting aminocaproic acid.
Wherein the gene encoding the enzyme capable of converting i) aminocaproic acid into epsilon -caprolactam is inserted into the chromosome of the microorganism,
Wherein the recombinant microorganism contains the vector in which the ii) the first gene construct and the iii) the second gene construct are cloned together, and the recombinant microorganism for detecting aminocaproic acid.
Wherein said recombinant microorganism contains a gene in which a gene encoding an enzyme converting i) aminocaproic acid to epsilon -caprolactam is cloned, ii) a vector in which a first gene construct is cloned, iii) a second gene cone And iv) a vector in which the third gene construct is cloned. 2. The recombinant microorganism according to claim 1,
Iii) the second gene construct is inserted into the chromosome of the microorganism,
Wherein said recombinant microorganism contains a gene in which a gene encoding an enzyme converting i) aminocaproic acid to epsilon -caprolactam is cloned, and ii) a first gene construct and iv) a third gene construct Wherein the recombinant microorganism is a recombinant microorganism for detecting aminocaproic acid.
Analyzing the activity of the expression-induced reporter protein by detecting aminocaproic acid;
≪ / RTI >
Wherein the activity of the reporter protein is analyzed by a method selected from the group consisting of microbial colony image analysis, fluorescence spectrum analysis, fluorescence flow cytometry analysis (FACS) and antibiotic resistance measurement method .
Analyzing the activity of a reporter protein whose expression is induced by aminocaproic acid present in the sample to quantify aminocaproic acid in the sample; And
Selecting a strain contained in a sample containing aminocaproic acid as an aminocapronic acid-producing strain;
≪ / RTI >
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/KR2015/005446 WO2015183052A1 (en) | 2014-05-30 | 2015-05-29 | Method for quantifying and detecting aminocaproic acid by using redesigned gene circuit |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20140066209 | 2014-05-30 | ||
| KR1020140066209 | 2014-05-30 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| KR20150138110A KR20150138110A (en) | 2015-12-09 |
| KR101775350B1 true KR101775350B1 (en) | 2017-09-07 |
Family
ID=54873868
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020150076602A KR101775350B1 (en) | 2014-05-30 | 2015-05-29 | Method for Detection and Quantitation of amino caproic acid Using Artificial Genetic Circuits |
Country Status (1)
| Country | Link |
|---|---|
| KR (1) | KR101775350B1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101971480B1 (en) * | 2017-09-26 | 2019-04-23 | 한국생명공학연구원 | Method for Detection and Quantification of Nitrile, Lactone or Lactam Compounds Using Mutated Artificial Genetic Circuits |
-
2015
- 2015-05-29 KR KR1020150076602A patent/KR101775350B1/en active IP Right Grant
Also Published As
| Publication number | Publication date |
|---|---|
| KR20150138110A (en) | 2015-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102558931B1 (en) | Nucleic acid-guided nucleases | |
| JP5295206B2 (en) | Luciferase expression cassette and method of use | |
| KR20200111172A (en) | Nepetalactol redox enzyme, nepetalactol synthase, and microorganisms capable of producing nepetalactone | |
| TWI327067B (en) | Antifungal protein and usage thereof | |
| JP2003509029A5 (en) | ||
| KR101481142B1 (en) | Synthetic Promoter for Expressing Corynebacteria | |
| KR102224897B1 (en) | Novel Polypeptide and Antibiotics against Gram-Negative Bacteria Comprising the Polypeptide | |
| Mashruwala et al. | Quorum-sensing-and type VI secretion-mediated spatiotemporal cell death drives genetic diversity in Vibrio cholerae | |
| US6737245B1 (en) | Luciferase expression cassettes and methods of use | |
| KR101775350B1 (en) | Method for Detection and Quantitation of amino caproic acid Using Artificial Genetic Circuits | |
| KR101723868B1 (en) | Method for Detection and Quantitation of -Caprolactam Using Artificial Genetic Circuits | |
| KR101759542B1 (en) | Diclofenac responsive genes in Hydra magnipapillata and the method for diagnosing aquatic environment pollution using the same | |
| EP2689018B1 (en) | Constructs and method for regulating gene expression or for detecting and controlling a dna locus in eukaryotes | |
| KR101134700B1 (en) | Nucleotide which is controlled by autoinducer of Coryneform bacteria and the screening method using it | |
| KR101971480B1 (en) | Method for Detection and Quantification of Nitrile, Lactone or Lactam Compounds Using Mutated Artificial Genetic Circuits | |
| Chand | Engineering Dgcz at the Inhibition Site and Gtp Binding Site for Enhanced C-Di-Gmp Production | |
| WO2007031742A2 (en) | Products and methods relating to the use of the endoribonuclease kid/pemk | |
| Qiu et al. | Methods to study phosphoribosylated ubiquitin ligation and removal | |
| KR20050057373A (en) | Process for production of cephalosporin c | |
| JP2021503904A (en) | Proline hydroxylase and its associated uses, methods and products | |
| JP5396071B2 (en) | Method for inhibiting cell proliferation | |
| KR20160035566A (en) | METHOD FOR PREPARING ε-CAPROLACTAM USING A NOVEL CAPROLACTAM PRODUCING ENZYME | |
| WO2015183052A1 (en) | Method for quantifying and detecting aminocaproic acid by using redesigned gene circuit | |
| WO2015121468A1 (en) | Screening assay for gibberellin inhibitors or analogs | |
| KR20230079107A (en) | Genetically modified Methylobacillus bacteria with improved properties |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| A201 | Request for examination | ||
| E902 | Notification of reason for refusal | ||
| E701 | Decision to grant or registration of patent right |