KR101773066B1 - Composition for Preventing or Treating Osteoarthritis Comprising 3'-Siallylactose or Derivatives Thereof - Google Patents

Abstract

The present invention relates to a composition for preventing or treating osteoarthritis comprising 3-sialyllactose, a derivative thereof, or a pharmaceutically acceptable salt thereof as an effective component. The 3-sialyllactose of the present invention promotes chondrogenesis and effectively inhibits the breakdown of cartilage tissues at the same time, and thus is useful as a composition for preventing or treating osteoarthritis.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing or treating degenerative arthritis containing 3'-sialyllactose or a derivative thereof as an active ingredient. BACKGROUND ART Composition for Preventing or Treating Osteoarthritis Comprising 3'-Siallylactose or Derivatives Thereof [

The present invention relates to a composition for the prophylaxis or treatment of osteoarthritis containing 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient.

Osteoarthritis (OA) is a degenerative joint disease that is primarily caused by suppression of cartilage ECM synthesis and promotion of cartilage destruction. Many pathologic risk factors and pathophysiological processes associated with aging contribute to the progression of degenerative arthritis. Mechanical stresses, including joint instability and damage, and aging-related factors that are prone to degenerative arthritis are potential degenerative arthritis-causing mechanisms. These factors include the degradation of the extracellular matrix (ECM) by Mmp (matrix metalloproteinase) due to the activation of biochemical pathways in chondrocytes, a unique cell type that produces a variety of catabolism and assimilation factors, and the dedifferentiation of chondrocytes, Resulting in the interruption of ECM synthesis via apoptosis (pelletier JP et al., Arthritis Rheum., 44: 1237-47, 2001). In particular, the cartilage tissue that forms the joint is not normally regenerated in vivo once it is damaged. Damage to cartilage tissue of these joints is associated with severe pain, limited to daily activities, and chronicization can lead to fatal degenerative arthritis, which interferes with normal life or professional activities.

Until now, there has been no treatment for arthritis, and usually NSAID (non-steroidal anti-inflammatory drugs) are used for the purpose of relieving joint inflammation. However, NSAID-based drugs are inadequate treatment for degenerative arthritis, which is a noninflammatory arthritis requiring promotion of cartilage formation and inhibition of cartilage destruction, since NSAID-based drugs are primarily intended to temporarily relieve joint inflammation Pritchard MH et al., Annals of the Rheumatic Diseases, 37: 493-503, 1978). These nonsteroidal antiinflammatory drugs (NSAIDs) are suitable for the prevention of inflammation as a therapeutic agent for rheumatoid arthritis, which is an inflammatory arthritis. However, it is pointed out that adverse effects such as accelerated cartilage damage or cardiovascular, gastrointestinal tract, kidney and liver are pointed out.

In addition, the autologous chondrocyte transplantation technique developed for the current cartilage formation is a method of collecting the cartilage and cartilaginous parts already formed on the top of the patient to create a supernatural bone by digging a proper hole on the damaged cartilage and transplanting it Although some patients have been successful, they can only be performed on patients who have few cartilage tissue destruction and are capable of autologous transplantation (Peterson L et al., J Bone Joint Surg Am. : 17-24, 2003).

On the other hand, 3'-sialyllactose in the milk oligosaccharide has anti-inflammatory properties that affect the bacterial activity in the intestines, and it has been reported that useful bacteria in the intestines can grow well Izquierdo-Useros N et al., Plos Biol , 2012,10 ). Since sialic lactose is present in breast milk, side effects on dosing have already been verified and studies on various functions are under way. It has been confirmed that the treatment of autoimmune disease by IgG changes in patients with rheumatoid arthritis (US 5164374) , 3'-sialyllactose is not known yet.

Accordingly, the inventors of the present invention have made efforts to find a novel substance that can effectively prevent and treat degenerative arthritis. As a result, it has been confirmed that 3'-sialyllactose inhibits cartilage tissue destruction at the same time as promoting cartilage formation , Thereby completing the present invention.

It is an object of the present invention to provide a pharmaceutical composition and food for preventing, ameliorating or treating osteoarthritis containing 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient .

In order to achieve the above object, there is provided a pharmaceutical composition for preventing or treating osteoarthritis comprising 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient do.

The present invention also provides a food for preventing or ameliorating osteoarthritis containing 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient.

The 3'-sialyllactose of the present invention is useful as a composition for the prevention or treatment of osteoarthritis, since it promotes cartilage formation and effectively inhibits cartilage tissue destruction.

Figure 1 is a schematic diagram showing the mechanism of degenerative arthritis induction by various cognitive and assimilating factors.
Figure 2 shows the chemical structure of 3'-sialyllactose.
FIG. 3 shows the result of treating 3'-sialyllactose by chondrocyte concentration to confirm that 3'-sialyllactose does not show cytotoxicity on cartilage cells.
FIG. 4 shows the results (A and B) of increased expression of type II collagen (Col2a1) by treating 3'-sialyllactose at various concentrations on chondrocytes, and that Col2a1 reduced by IL- (C and D). It was confirmed that Sox-9 activity decreased by IL-1β was increased by 3'-sialyllactose (E).
FIG. 5 shows the results (A and B) of increasing expression of Mmp3 and Mmp13 inducing joint destruction by IL-1β in chondrocytes, and the expression of Mmp3 and Mmp13 increased by IL-1β was 3'- (C and D) which were confirmed to be reduced by sialyl lactose.
Fig. 6 shows the result of confirming that Erk phosphorylation increased by IL-1? In chondrocytes was inactivated by 3'-sialyllactose.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

Arthritis can be classified into non-inflammatory arthritis and inflammatory arthritis. Non-inflammatory arthritis includes osteoarthritis (degenerative arthritis, osteoarthritis, OA), and inflammatory arthritis is a typical example of rheumatoid arthritis (Yusuf E et al , Ann Rheum Dis , 70: 60-67 , 2011 , Berebaum F et al., Osteoarthritis Cartilage, 21: 16-21, 2013).

Osteoarthritis is also known as degenerative arthritis, and the cause of the disease is not yet clear, but it is known that a variety of triggers such as heredity, trauma, obesity, aging, and metabolic abnormalities are involved. These factors break the balance between attacking factors and defensive factors in cartilage cells, promoting cartilage tissue destruction, and worsening cartilage wear, which causes the patient to feel pain due to a characteristic pathologic change in osteoarthritis. (Pelletier JP et al., Arthritis Rheum. , 4: 1237-47, 2001).

On the other hand, in the case of rheumatoid arthritis (RA), unlike degenerative arthritis caused by cartilage cell and cartilage tissue destruction, autoimmune disease progression is known to be an important causative factor. Rheumatoid arthritis is a chronic autoimmune disease that is characterized by inflammation and proliferation of synovial cells. Unlike osteoarthritis, rheumatoid arthritis causes osteoporosis and osteoporosis of the periarticular bone. Rheumatoid arthritis is caused by inflammation of the synovial membrane that spreads to the joint capsule, ligament, tendon, and invades the bone. Therefore, osteoarthritis and rheumatoid arthritis are completely different from each other in the cause and progress of the invention, and their treatment methods are also different.

Previously known therapies for rheumatoid arthritis include non-steroidal anti-inflammatory drugs (NSAIDs), penicillamine, steroid hormones, TNF inhibitors, interleukin inhibitors, JAK inhibitors and anti-CD related inhibitors (Pritchard MH et al., Ann Rheum Dis , 37: 493-503, 1978; 2014 Frost & Sullivan report: Product and pipeline analysis of the global rheumatoid arthritis therapeutics market). Although NSAID drugs and steroidal hormones are used in patients with degenerative arthritis for the purpose of relieving joint pain and inflammation, they can not act as substantial degenerative arthritis drugs because they alleviate symptoms rather than treating the disease itself (Abramson SB et al., Osteoarthritis Cartilage , 7: 380-1, 1999). In addition, degenerative arthritis, which is mainly caused by cartilage cell and cartilage destruction, differs from rheumatoid arthritis, which is an inflammatory arthritis. Therefore, degenerative arthritis treatment is also different from rheumatoid arthritis treatment.

For example, most of the therapies developed until 2014 for the treatment of degenerative arthritis can combine several structures with mesenchymal stem cells, which promote col2a1 and ECM secretion, to promote cartilage regeneration by inserting them into the cartilage- . On the other hand, in the case of the treatment of rheumatoid arthritis, it is confirmed that the development of the therapeutic agent is proceeding in order to intrinsically suppress the inflammatory cytokine by developing the TNF inhibitor, the interleukin inhibitor, the JAK inhibitor, and the anti-CD related inhibitor (2014 Frost & Sullivan report: 1. Product and pipeline analysis of the global knee cartilage repari market, 2. Product and pipeline analysis of the global rheumatoid arthritis therapeutics market. In other words, the therapeutic targets of rheumatoid arthritis, which has an inflammatory tendency and degenerative arthritis which has non-inflammatory tendency in various types of arthritis, have different forms.

Based on these results, there is a completely different cause of disease in degenerative arthritis and rheumatoid arthritis. Also, the currently developed therapeutic agent is degenerative arthritis, cartilage regeneration, rheumatoid arthritis, inflammation inhibition It can be confirmed that the process is basically proceeding. Therefore, the target factors for treatment of degenerative arthritis and the target factors for treatment of inflammatory rheumatoid arthritis should be applied differently.

The terms "osteoarthritis (OA) " and" osteoarthritis "of the present invention are used interchangeably and should be understood in the same sense.

In the present invention, expression of Mmp3 and Mmp13, which promotes the expression of type II collagen (Col2a1), which plays an important role in joint formation, and at the same time promotes destruction of cartilage tissue, while 3'-sialyllactose does not exhibit toxicity to cartilage cells . ≪ / RTI > In addition, it was confirmed that 3'-sialyllactose directly participates in the regulation of the activity of the transcription factor Sox-9 involved in the expression of Col2a1, and the 3'-sialyllactose directly controls the pErk signaling system involved in the expression of Mmp3 and Mmp13 Respectively.

Accordingly, the present invention relates to a pharmaceutical composition for preventing or treating degenerative arthritis (Osteoarthritis) comprising 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient, .

In the present invention, the 3'-sialyllactose may be characterized by having a structure represented by the following general formula (1).

(I)

The single test compound used in the present invention is 3'-sialyllactose, the chemical formula of which is C ₂₃ H ₃₈ NO ₁₉ Na, and is a single compound of natural origin that is abundant in breast milk ( 2).

In the present invention, the pharmaceutical composition for preventing or treating degenerative arthritis containing 3'-sialyllactose as an active ingredient may be characterized by having at least one of the following characteristics:

1) increased expression of type II collagen (Col2a1);

2) decreased expression of matrix metalloproteinase 3 (Mmp3) or matrix metalloproteinase 13 (Mmp13);

3) increased Sox-9 activity; And

4) Increased inactivation of p-ERK.

In the present invention, it may further comprise a pharmaceutically acceptable carrier, excipient or diluent. A "pharmaceutically acceptable carrier" is a substance that can be added to the active ingredient to help formulate or stabilize the formulation and does not cause significant toxic effects on the patient.

The carrier refers to a carrier or diluent that does not irritate the patient and does not interfere with the biological activity and properties of the 3'-sialyllactose according to the present invention. Examples of the pharmaceutical carrier that is acceptable for the composition to be formulated into a liquid solution include sterilized and sterile water, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added and formulated into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Other carriers are described, for example, in Remington ' s Pharmaceutical Sciences (E. W. Martin).

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutical active materials is well known in the art. The composition is preferably formulated for parenteral use. The compositions may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for high drug concentrations. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, a polyol (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.) and suitable mixtures thereof. In some cases, the composition may include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol or sodium chloride. Sterile injectable solutions can be prepared by incorporating the required amount of 3'-sialyl lactose, optionally in combination with one or a combination of the ingredients described above, in a suitable solvent followed by sterile microfiltration. In general, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and other necessary ingredients from those described above. In the case of sterile powders for the preparation of sterile injectable solutions, some preparative methods involve vacuum drying and freeze-drying (freeze-drying), which produces powders of the active ingredient and any additional desired ingredients from a pre-sterilized- )to be.

In addition, the pharmaceutical composition according to the present invention may be orally or parenterally administered at a dose and frequency that may vary depending on the severity of the suffering patient. The composition may be administered to the patient as a bolus or as a continuous infusion if desired.

The composition containing 3'-sialyllactose of the present invention can suppress degeneration of cartilage tissue following joint aging and promote cartilage formation to treat degenerative arthritis.

There are many known degenerative arthritis treatments such as artificial arthroplasty, cartilage, cartilage, and cartilage. However, artificial arthroplasty requires pain, burden, and complication. It is. In addition, there is a limited range of treatment because only autologous patients are implanted (Peterson et al., J Bone Joint Surg Am, 85: 17-24, 2003). The autologous chondrocyte transplantation is a method of obtaining chondrocytes from the cartilage tissue collected from the top of the patient, cultivating and expanding the necessary number of cells in vitro, and filling the injured cartilage part. However, this is also complicated and challenging because of the limited donor tissue and the need for surgery to harvest tissue for transplantation (Yoon et al., Jorunal of Rheumatic Diseases , 19, 2012). In addition, there is a method of obtaining mesenchymal stem cells from tissues such as autologous bone marrow, muscle and fat, and differentiating them from the outside of the body to inject them into articular cartilage damage sites. However, when mesenchymal stem cells are differentiated into chondrocyte based on TGF-b, there is a risk that the mesenchymal stem cells are differentiated into chondrocytes by BMP, and when mesenchymal stem cells are differentiated into chondrocytes, (Park et al., J Korean Orthopedic Research Society, 18: 2, 2015; Mamidi MK et al., Osteoarthritis Cartilage, 24: 1307-16, 2016). In addition, most of the degenerative arthritis medicines and health foods developed to date have a tendency to focus on cartilage cell activity, cartilage regeneration effect, pain relief and antiinflammation effect, which are practically important for degenerative arthritis treatment.

Therefore, it is possible to solve the problems of conventional degenerative arthritis medicines and health foods, such as side effects, reduction of cartilage regeneration effect and safety, and 3'-sialyllactose, which is one of the breast- It can be expected to be useful as a raw material for prevention, treatment or improvement.

In another aspect, the present invention relates to a food for preventing or ameliorating osteoarthritis containing 3'-sialyllactose, a derivative thereof or a pharmaceutically acceptable salt thereof as an active ingredient.

The food of the present invention can be manufactured in all forms such as functional food, nutritional supplement, health food and food additives. For example, as a health food, the 3'-sialyllactose of the present invention can be prepared in the form of tea, juice and drink and then consumed for drinking, granulated, encapsulated and powdered. Functional foods also include beverages (including alcoholic beverages), fruits and processed foods (such as canned fruits, bottled, jam, marmalade, etc.), fish, meat and processed foods such as ham, sausages, , Breads and noodles (eg udon, buckwheat noodles, ramen noodles, spaghetti, macaroni, etc.), fruit juice, various drinks, cookies, sugar, dairy products such as butter, chitzs, edible vegetable fats, margarine, vegetable protein, , Frozen foods, various kinds of seasonings (for example, soybean paste, soy sauce, sauces, etc.) by adding the 3'-sialyllactose of the present invention.

The health functional food also includes various forms of functional food, nutritional supplement, health food, food additive and the like as a food composition, and it can be prepared in various forms according to a conventional method known in the art, for example, It is possible to prepare sialyl lactose in the form of tea, juice or drink or to granulate, encapsulate or powder the sialyl lactose, or to add these compounds or extracts to beverage, fruit and processed food, fish oil, meat and processed foods thereof, It can be provided by adding it to various foods.

[ Example ]

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: 3 '- To sialyl lactose  Chondrocyte Toxicity Measurement

Chondrocytes were obtained from the cartilage tissue from femoral heads, femoral condyles and tibial plateaus of normal mice 5 days after birth. The resulting chondrocytes were cultured in RPMI 1640 supplemented with 10% (v / v) fetal bovine serum (Gibco, USA), 50 μg / ml streptomycin (Sigma-Aldrich, USA) and 50 units / ml penicillin ) In DMEM medium (Gibco, USA).

In order to confirm that 3'-sialyllactose is not toxic to chondrocytes, chondrocytes were cultured in a 96-well culture container on the basis of 9 × 10 ³ cells / well, and then 3'-sialyl lactose (Genechem Inc., , Korea) were treated at concentrations of 0, 10, 50, 100 and 250 μM, respectively, and cultured in a 5% CO ₂ incubator at 37 ° C. for 24 hours. The toxicity of 3'-sialyllactose to cartilage cells was determined by measuring the absorbance at 450 nm using the EZ-Cytox Cell viablity assay kit (Dozen, Korea).

As a result, it was confirmed that 3'-sialyllactose had no cytotoxicity to chondrocytes at all concentrations and did not adversely affect chondrocyte proliferation (Fig. 3).

Example 2: 3 '- To sialyl lactose  Of cartilage formation and regeneration

2-1: Type II collagen ( Col2a1 ) Increased expression

In order to confirm cartilage formation and regeneration effect by 3'-sialyllactose, the cartilage cells obtained in Example 1 were cultured for 36 hours, and 3'-sialyllactose was added to each of concentrations of 0, 10, 50, 100 and 250 μM And further cultured for 36 hours.

Then, RNA was extracted from chondrocytes using TRI reagent (Molecular Research Center Inc.) in order to perform qRT-PCR, and cDNA obtained by reverse transcription of the RNA was amplified using annealing temperature 55 The expression of type II collagen (Col2a1, 173bp), which is important for cartilage formation, was confirmed by PCR amplification. As a control, Gapdh (450 bp, annealing temperature: 58 캜) was confirmed with the primers of SEQ ID NOS: 3 and 4.

SEQ ID NO: 1: 5'-CACACTGGTAAGTGGGGCAAGA-3 '(Col2a1-S)

SEQ ID NO: 2: 5'-GGATTGTGTTGTTTCAGGGTTCG-3 '(Col2a1-AS)

SEQ ID NO: 3: 5'-TCACTGCCACCCAGAAGAC-3 '(Gapdh-S)

SEQ ID NO: 4: 5'-TGTAGGCCATGAGGTCCAC-3 '(Gapdh-AS)

Total cell lysate was extracted from chondrocytes using a dissolution buffer (150 mM NaCl, 1% NP-40, 50 mM Tris, 5 mM NaF) containing a cocktail of protease inhibitor and phosphatase inhibitor (Roche) Expression of Col2a1 was confirmed. Western blotting and Western blotting using anti-Chol2a1 antibody (Millipore) and anti-Erk antibody (cell signaling) were measured using a computer program to measure the band thickness and concentration, and the relative value was expressed as a densitometer.

As a result, it was confirmed that the expression of Col2a1 in chondrocytes was increased by 3'-sialyllactose and it was found to be effective in promoting cartilage formation (FIGS. 4A and 4B).

2-2: IL- 1β  Type II collagen suppressed by Col2a1 ) Increased expression

IL-1β is a typical inflammatory cytokine that inhibits the expression of Col2a1 in chondrocytes. After culturing chondrocytes for 36 hours, IL-1β (GeneScript, USA) was treated with 5 ng / Expression was decreased.

QRT-PCR and Western blotting were performed in the same manner as in Example 2-1 to confirm whether the expression of this reduced Col2a1 was increased again in chondrocytes by 3'-sialyllactose.

As a result, it was confirmed that Col2a1 inhibited by IL-1? In chondrocytes was gradually increased in expression by 3'-sialyllactose (FIGS. 4C and 4D). That is, it can be seen that 3'-sialyllactose promotes cartilage formation and regeneration.

Example 3: 3 '- To sialyl lactose  Of cartilage formation and activation of regenerative signaling

The expression of Col2a1, which is important for cartilage formation and regeneration, is regulated by the transcription factor Sox-9, so we examined whether Sox-9 transcription factor can be regulated by 3'-sialyllactose.

The Sox-9 reporter gene is inserted in the pGL3 vector in the upstream region of the SV40 promoter, with a Sox9 binding site consisting of 48 genes at the site corresponding to the first intron of the human Col2a1 gene (Zhou G et al., J Biol Chem 1998,12, 14989-97).

One μg of this Sox-9 reporter gene was transfected into chondrocytes using lipofectamine 2000 (Invitrogen) for 3 hours each. The transfected cells were treated with 0, 10, 50, 100, 250 μM 3'-sialyllactose for 24 hours simultaneously with 5 ng / ml interleukin 1 beta (IL-1β) 9 activity was confirmed by luciferase activity.

As a result, it was confirmed that the activity of Sox-9 reduced by IL-1 beta was restored by 3'-sialyllactose (Fig. 4E). This indicates that 3'-sialyllactose directly regulates the activity of Sox-9, and thus the expression of Col2a1, which is important for cartilage formation, is regulated. That is, it shows that 3'-sialyllactose promotes cartilage formation and regeneration.

Example 4: 3 '- To sialyl lactose  Inhibits joint inflammation and inhibits cartilage destruction

IL-1β is a typical inflammatory cytokine that simultaneously reduces Col2a1, which is important for cartilage formation in cartilage cells, while promoting joint inflammation and cartilage tissue destruction. The chondrocytes were treated with 5 ng / ml of IL-1 beta over time and then subjected to qRT-PCR using the conditions and primers shown in Table 1 below by the method of Example 2-1 to confirm the suppression of Mmp3 and Mmp13 expression Respectively.

SEQ ID NO: The sequence (5'-3 ') sense/ Antisense gene Size (bp) Annealing  Temperature (AT, ℃) 5 TCCTGATGTTGGTGGCTTCAG S Mmp3
102
58
6 TGTCTTGGCAAATCCGGTGTA AS 7 TGATGGACCTTCTGGTCTTCTGG S Mmp13
473
55
8 CATCCACATGGTTGGGAAGTTCT AS

Secretory proteins such as Mmp3 and Mmp13 were reacted with 100 μl TCA (trichloroacetic acid) in 900 μl of a serum-free conditioned medium, followed by reaction at 0 ° C for 20 minutes. The supernatant was then removed by centrifugation at 12,000 rpm, 4 ° C for 10 minutes, and reacted with 500 μl of cold 100% acetone for 1 hour at 20 ° C. The sample under reaction with 100% acetone was centrifuged to remove the supernatant, and the protein was finally precipitated and detected. Western blotting and Western blotting using anti-Mmp3 antibody (Abcam) and anti-Mmp13 antibody (Abcam) The band was measured using a computer program to measure the thickness and concentration of the band, and the relative value was expressed by a densitometer.

As a result, it was confirmed that the expression of Mmp3, Mmp13, which induces cartilage tissue destruction causing inflammation of the cartilage in IL-1β, is increased (FIGS. 5A and 5B).

Thus, chondrocyte cells were treated with 5 ng / ml IL-1β and 3'-sialyllactose 0, 10, 50, 100 and 250 μM for 24 hours to confirm the expression level of Mmp3 and Mmp13. QRT-PCR was performed using the conditions and the primers shown in Table 1, and Western blotting was performed to determine the expression of Mmp3 and Mmp13 increased by IL-1? In chondrocytes in a concentration-dependent manner by 3'-sialyllactose (Figs. 5C and 5D). This indicates that joint inflammation and cartilage tissue destruction can be alleviated and inhibited by 3'-sialyllactose.

Example 5: 3 '- To sialyl lactose  Suppression of cartilage destruction signaling

MMP3, Mmp13, which is an increased cartilage destruction factor for IL-1β, is activated through various signaling pathways in chondrocytes. Thus, we confirmed that 3'-sialyllactose can block various signal transduction pathways regulated by IL-1 [beta].

Erk activation was confirmed by Erk (extarcellular-signal regulated kinase) phosphorylation by treating mouse knee articular cartilage cells with 5 ng / ml IL-1β for 10 minutes.

Thus, chondrocyte cells were treated with 5 ng / ml IL-1 beta and 3'-sialyllactose 0, 50, 100, and 250 μM together to determine whether Erk phosphorylation increased by 3'-sialyllactose (Fig. 6). In other words, it was confirmed by Western blotting and densitometry that 3'-sialyllactose inhibited the Erk signaling pathway among the signal transduction pathways that can activate Mmp3 and Mmp13 in IL-1β, thereby inhibiting Mmp3 and Mmp13.

In this study, we investigated the effects of 3'-sialyllactose (3'-sialyllactose) on the cartilage destruction signal transduction system, which is the most involved in degenerative arthritis patients (Yang et al. It can be strongly suppressed.

Statistical analysis

The results of all embodiments of the present invention were analyzed using non-parametric statistical methods with quantified data based on an ordinal grade system such as the Mankin score. QRT-PCR data, represented by relative fold changes, were first identified using a Shapiro-wilk test to determine the normal distribution, followed by pair-wisecomparisons and multi-comparisons ) Were used for analysis of variance (ANOVA) including Student's t-test and post hoc test, respectively. Statistically significant significance was accepted at a 0.05 level of probability (P <0.05).

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> AJOU UNIVERSITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Composition for Preventing or Treating Osteoarthritis Comprising          3'-Siallylactose or Derivatives Thereof &Lt; 130 > P16-B347 <160> 8 <170> KoPatentin 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Col2a1-S <400> 1 cacactggta agtggggcaa ga 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Col2a1-AS <400> 2 ggattgtgtt gtttcagggt tcg 23 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Gapdh-S <400> 3 tcactgccac ccagaagac 19 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Gapdh-AS <400> 4 tgtaggccat gaggtccac 19 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mmp3-S <400> 5 tcctgatgtt ggtggcttca g 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mmp3-AS <400> 6 tgtcttggca aatccggtgt a 21 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Mmp13-S <400> 7 tgatggacct tctggtcttc tgg 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Mmp13-AS <400> 8 catccacatg gttgggaagt tct 23

Claims (6)

A pharmaceutical composition for the prevention or treatment of osteoarthritis comprising 3'-sialyllactose or a pharmaceutically acceptable salt thereof as an active ingredient.
The pharmaceutical composition according to claim 1, wherein the salt of 3'-sialyllactose has a structure represented by the following formula (1):
(I)

.
The pharmaceutical composition according to claim 1, having at least one of the following characteristics:
1) increased expression of type II collagen (Col2a1);
2) decreased expression of matrix metalloproteinase 3 (Mmp3) or matrix metalloproteinase 13 (Mmp13);
3) increased Sox-9 activity; And
4) Increased inactivation of p-ERK.
The pharmaceutical composition according to claim 1, further comprising a pharmaceutically acceptable carrier, excipient or diluent.
Food for preventing or ameliorating osteoarthritis comprising 3'-sialyllactose or a pharmaceutically acceptable salt thereof as an active ingredient.
6. The food according to claim 5, wherein the salt of 3'-sialyllactose has a structure represented by the following formula (1):
(I)

.

Images