KR101769789B1 - Composition and method for measuring NAD(H) and uses thereof - Google Patents

Abstract

The present invention relates to a composition for quantitating NAD (H) using a mutant of a metagenome-derived blue fluorescent protein (mBFP) derived from a metagenome, which fluoresces in combination with NADPH, and with the present invention, it is possible to quantitate both the coenzyme NAD (H) and NADP (H), to solve problems existing in conventional coenzyme quantitative kit, and furthermore, it is possible to diagnose various diseases and construct a library of enzymes dependent on NAD (H) or NADP (H).

Description

Composition and method for measuring NAD (H) and uses thereof The present invention relates to a composition for quantifying NAD (H)

The present invention relates to a composition for quantification of NAD (H) using a metagenome-derived blue fluorescent protein (mBFP) mutant derived from a metagenome, which fluoresces in combination with NADPH, and a quantitative method and an invention applicable thereto.

Generally, the main metabolic system of biological system consists of the production of major precursors and energy by the oxidation and catabolism of exogenous nutrients from the outside, and the synthesis of biomolecules by using them. The forms of bioenergy that are generated during the oxidation and catabolism and are consumed in the synthesis process are electrons and proton, and coenzymes NADP (H) and NAD (H) are the main messengers of these. The coenzymes NADP (H) and NAD (H) are essential in vivo and are essential for the enzymatic reactions (dehydrogenase and oxidoreductase) and the salvage pathway (NADH), which can convert NAD +, NADH, NADP + ) Are known to maintain their balance properly.

The proportion of coenzyme in oxidation / reduction form in all cells of living organisms can be used as an important bioactivity indicator, and it is possible to know whether physiological maintenance is normal in living body by quantification of coenzyme NADP (H) and NAD (H). This can be a useful indicator for determining the presence of cells in a sample, water quality analysis, and the degree of food contamination, and there is a wide range of applications in various fields.

Much research is underway to develop a method for measuring coenzyme to utilize usefulness of quantitative determination of coenzyme. The most common method is to measure the absorbance or fluorescence using the intrinsic wavelength of NAD (P) H itself. However, since the absorbance and fluorescence value of the coenzyme itself is low, it is possible to measure a relatively accurate value only in pure reactant composition And it is difficult to apply directly to various living body or environmental samples. Other methods are currently in use, but it is difficult to distinguish between NAD +, NADH, NADP +, and NADPH, which are oxidation / reduction forms of coenzyme. It is also difficult to measure effectively when the concentration of the coenzyme is very small in a sample collected from inside and outside the living body. For example, since NAD (H) and NADP (H) have similar absorbance and fluorescence, it is difficult to distinguish them from each other due to low S / N ratio especially when there is a small amount in the sample. In addition, NADP +, which is oxidized form, has relatively poor optical properties and it is difficult to measure the coenzyme itself.

Coupling reactions involving dehydrogenases that use high performance liquid chromatography (HPLC) to induce the reduction of coenzyme through oxidation of specific substrates, or dehydrogenase (coupling reaction), or a method using a special artificial fluorescent substrate. However, the devices and enzymes used in these complementary methods are very expensive, and there is still a fundamental problem that can only quantify one type of coenzyme. Korean Patent Registration No. 0950064 discloses a method of quantitating NADPH using a blue fluorescent protein mBFP derived from a metagenome, but also discloses a method of quantitatively determining other forms of the coenzyme and quantifying each of the coenzyme separately not.

The present invention relates to a composition for quantitating coenzyme and a method for quantitatively determining coenzyme to solve the problems presented in the conventional coenzyme quantitation, and it is possible to efficiently quantify the coenzyme with high sensitivity even when a small amount of coenzyme is present in the sample.

Korean Patent No. 0950064

The present invention solves the conventional problem that only one coenzyme can be quantified from among NAD (H) or NADP (H), and even if the amount of coenzyme contained in the sample is very small, accurate quantitation can be performed with high sensitivity, And provides a rapid quantification method and composition.

The present invention provides a composition for quantitative determination of in vitro and ex vivo NADP (H) comprising mutants obtained by fusing a ramp tag to metagenome-derived blue fluorescent protein (mBFP), a blue fluorescent protein derived from a metagenome.

The present invention provides a composition for quantifying in vitro and ex vivo NADP (H) comprising a mutagen of mBFP (metagenome-derived blue fluorescent protein) of SEQ ID NO: 32.

The present invention relates to a method for the detection and quantification of an NAD (H) dependent oxidative / reductase, an NAD (H) phosphorylase and an NADP (H) (NADP (H) or NAD (H)) kit comprising a mutant of NADP (H) or fluorescent protein.

The present invention relates to a biomarker composition for the diagnosis of colorectal cancer or breast cancer by measuring NAD (H) -dependent oxidizing / reductase, NAD (H) phosphorylase or NADP (H) H) and metagenome-derived blue fluorescent protein (mBFP), which is a blue fluorescent protein derived from a metagenome.

The present invention relates to a method for the detection and quantification of one or more enzymes selected from the group consisting of NAD (H) dependent oxidase / reductase, NAD (H) phosphorylase and NADP (H) (H) or NAD (H) contained in an in vitro sample by fluorescence change measurement by adding a mutant of the fluorescent blue fluorescent protein.

The present invention relates to a method for producing a manganese-derived recombinant protein by adding a mutant of NADP (H) or NAD (H) and metagenome-derived blue fluorescent protein mBFP (metagenome-derived blue fluorescent protein) A method for quantifying at least one enzyme selected from the group consisting of NAD (H) -dependent oxidation / reductase, NAD (H) phosphorylase and NADP (H) -dependent oxidation / reductase contained in the sample.

The present invention relates to a method for detecting a change in fluorescence of an in vitro / ex vivo sample by adding a mutant of NAD (H) or NADP (H) and metagenome-derived blue fluorescent protein mBFP (metagenome-derived blue fluorescent protein) (H) dependent oxidative / reductase, NAD (H) phosphorylase, and NADP (H) dependent oxidase / reductase contained in an enzymatic library of one or more enzymes.

The method for quantifying coenzyme according to the present invention can quantify both coenzyme NAD (H) and NADP (H), quantify it under conditions of low temperature, acidic and basic conditions in which enzyme activity is lowered, Can be accurately and quickly quantified with a high sensitivity even at a low concentration. And it is possible to quantify in minutes, so it is very fast. In addition, both NADPH and NADP + as well as the different forms due to oxidation / reduction of NAD (H) and NADP (H) coenzyme can be selectively discriminated and quantified. In addition, by applying the coenzyme quantitation method according to the present invention, an enzyme library related to the production of coenzyme and the salvage pathway can be constructed, and the diagnosis of various metabolic diseases including cancer can be rapidly, accurately, . In addition, it can be widely used in observation of protein interaction, production of physiological activity kit and biosensor, probe and diagnosis by grafting with other systems using fluorescence.

FIG. 1 shows a salvage pathway showing all the coenzymes to be measured in the present invention and related enzymes.
FIG. 2 is a schematic diagram of an expression vector in which a gene is inserted into a vector containing poly-histidine as an affinity tag.
FIG. 3 is a schematic diagram of an expression vector in which a gene is inserted into a vector fused with poly-histidine as an affinity tag.
FIG. 4 is a graph showing the purity of protein separated by affinity chromatography using (A) SDS-PAGE after protein expression, wherein Lane M is a size marker, lane 1 is cibacron blue, His-mBFP separated by resin, lane 2 represents his-ppnk separated by Ni-NTA, lane 3 represents his-ZWF separated by his-mfnk, lane 4 and Ni-NTA separated by Ni-NTA Lane 2 is his-mBFP, lane 3 is R1-mBFP, lane 4 is R2-mBFP, lane 5 is R3 -mBFP, lane 6 represents R4-mBFP, lane 7 represents R5-mBFP, and lane 8 represents R6-mBFP.
FIG. 5 shows the results of measurement of the fluorescence activity of (A) fluorescence activity and (B) NADP + using purified Heptagene fusion mBFP and ramp tag fusion mBFP.
FIG. 6 shows the results of NADP + quantitation system measurement according to (A) enzyme concentration, (B) temperature, (C) pH and (D) coenzyme concentration using G6PDH.
FIG. 7 shows results of measurement of NADH quantitation system according to (A) enzyme concentration, (B) temperature, (C) pH and (D) coenzyme concentration using NADH kinase.
FIG. 8 shows the results of NAD + quantitation system measurement according to (A) enzyme concentration, (B) temperature, (C) pH and (D) coenzyme concentration using NAD + kinase.
FIG. 9 shows the result of NAD + quantitation system measurement according to (A) enzyme concentration, (B) temperature, (C) pH and (D) coenzyme concentration using NAD + dependent dehydrogenase and NADH kinase.
FIG. 10 shows the results of measuring the fluorescence activity of (A) R2-mBFP and the activity of (B) coupling enzymes with respect to the reaction time.
Fig. 11 shows the increase in the fluorescence activity of the coenzyme quantification depending on the surfactant (A and B) and metal ion addition (C and D).
FIG. 12 shows the results of measuring the activity of the protein according to the storage conditions, showing refrigeration (FIG. 12A) and freezing (FIG. 12B).
Figure 13 shows the result of measurement of the enzyme-dependent enzyme activity using a coupling reaction with R2-mBFP.
14 shows the result of measurement of the number of microbial cells by measuring the content of microbial coenzyme.
Fig. 15 shows the result of coenzyme measurement of a sample in which bacterial growth was induced by a potential contaminant (organic matter).
Fig. 16 shows the result of measurement of the amount of coenzyme in the urine sample. (A) NAD +, (B) NADH, (C) NADP +, (D) NADPH.
FIG. 17 shows the results of measurement of enzyme-dependent enzyme activity in a urine sample. The substrate used was 1: lactose, 2: glutamic acid, 3: maltose, 4: pyruvate pyruvate, 5: gluconate, 6: malic acid, 7: glucose-6-phospate, and 8: isocitric acid.
18 shows the lactate dehydrogenase activity standard curve (A) and the LDH activity results (B) in the blood sample.
FIG. 19 shows activity measurement of G6PDH (A), IDH (B), LDH (C) and NADHK (D) as a result of measurement of enzyme-dependent enzyme activity of cancer tissues and surrounding tissues (1: 2: colorectal cancer 2, 3: colorectal cancer 3, 4: breast cancer 1, 5: breast cancer 3.
FIG. 20 shows results of A: primary screening of Arabidol dehydrogenase from the metagenomic library, and B: blue clone of screening gene after secondary screening.
FIG. 21 shows the results of measurement of the active performance of the dry-form coenzyme quantitative reagent, wherein A: hydration after drying, B: optimum NaCl content in the drying / hydration process, C: reaction characteristics after hydration of the dry formulation, D: Response interval.

Hereinafter, the present invention will be described in detail. The terms used in the present specification should be construed as generally understood by a person having ordinary skill in the art unless otherwise defined. It is to be understood that the drawings and embodiments are not intended to limit the scope of the present invention, which is not intended to limit the scope of the present invention. It is not.

The present invention relates to a composition for quantifying in vitro and ex vivo NADP (H) comprising a mutant in which a ramp tag is fused to metagenome-derived blue fluorescent protein (mBFP), a blue fluorescent protein derived from a metagenome, Method.

According to the present invention, by applying a ramp tag technique to add an optimal codon by adding a gene sequence, it is possible to increase the expression rate of mBFP or to help functional folding of the protein, You can improve the character. This method is a method that can easily change the protein activity through the amino acid sequence change of protein itself such as gene mutation or codon optimization used for protein function change. In this way, mBFP can be expressed so that a ramp tag or a His-tag is fused to the N-terminal or C-terminal to easily obtain the mBFP fused with the tag. The lamp tag can be used to analyze the codon usage of E. coli strains, collect rare codons, and then combine them with the mBFP gene in combination with the lamp tag based on the analyzed rare codon.

According to the present invention, the variant of mBFP in which a lamp tag is fused to the mBFP gene at the N-terminus of the mBFP is highly sensitive to the coenzyme NADP (H). In particular, unlike mBFP or His-tagged fused His-mBFP, which have different sensitivities depending on the amount of coenzyme in an oxidized or reduced form, they are constantly sensitive regardless of the amount of coenzyme in the oxidized or reduced form. And, even if the lamp tag or the heath tag is fused, the activity is the same as that of the wild protein, so that the degradation of mBFP due to tag fusion does not appear. Furthermore, among various mBFP mutants in which different lamp tags are fused, the mBFP mutant having a specific sequence hardly receives interference from other coenzyme in a sample in which various coenzyme is mixed. According to one embodiment of the present invention, the mBFP mutant of SEQ ID NO: 32 shows the same level of activity as wild-type mBFP and is hardly affected by NADP + in the mutually competitive optical properties with other coenzyme. That is, even if the amount of NADP + in the coenzyme contained in the sample is larger than that of NADPH, the NADPH-dependent optical activity is not changed because it is not interfered with by NADP +. On the other hand, the wild-type mBFP or his-tag mBFP significantly decreases the NADPH-dependent optical activity as the amount of NADP + contained in the sample increases. Therefore, the mBFP variant of SEQ ID NO: 32 in which the lamp tag is fused can be used to quantify only the desired coenzyme even if the sample is mixed with various coenzyme (s) in the oxidation or reduction form of NADP (H) and NAD (H). Further, since the optical activity of the mutant is not affected by the interference of other coenzymes, the quantitative error can be minimized even if the desired coenzyme is present in a very small amount.

A kit for quantifying NADP (H) or NAD (H) in vitro or in vivo using mutants obtained by fusing a ramp tag to a metagenome-derived blue fluorescent protein (mBFP), a meta genome-derived blue fluorescent protein of the present invention Or a quantitative method can be provided.

When the amount of NADPH in the sample is large, NADPH can be quantified using wild-type mBFP. However, the quantification of NADPH may not be accurate if wild-type mBFP or his-mBFP is mixed with several coenzymes in the sample or the amount of NADPH is lower than that of other coenzymes.

In contrast, the mBFP variant fused with a lamp tag can be accurately quantified even when NADPH is very small or mixed with other coenzymes because the interference of other coenzymes is small as mentioned above. Thus, using the coupling reaction, It is possible to selectively quantify only the desired coenzyme. Specifically, the mBFP variant fused with the lamp tag of the present invention does not undergo interference with NADP +, and thus there is no change in optical properties due to NADP + increase due to phosphorylation of NAD + through coupling reaction and NADPH production by reduction of NADP +. The same is true for the oxidation of NADH through coupling reactions, the phosphorylation of NAD +, and the production of NADPH by reduction of NADP +. That is, in addition to NADPH, the concentration of various coenzymes can be precisely determined through the optical activity of the lamp tag-fused mBFP variant by reducing NADP +, NAD + and NADH contained in the sample to NADPH finally through coupling reaction. Conversely, the concentration of various coenzymes can be quantified by reduction, dephosphorylation and the like of NADPH. Therefore, the mBFP mutant of the present invention can fundamentally solve the problem of the quantification method or system in which only one of NAD +, NADH, NADP +, or NADPH could be quantified in the conventional coenzyme quantitation method.

In addition, it is possible to provide a biomarker composition for diagnosing various diseases by using the lamp tag-fused mBFP mutant of the present invention and to quantify NAD (H) or NADP (H) dependent oxidation / Enzyme libraries of NADP (H) -dependent oxidizing / reducing enzymes can also be constructed.

Hereinafter, a composition for quantification, a kit, a quantitative method, and an application method thereof containing the lamp tag-fused mBFP mutant of the present invention will be described in more detail.

One or more enzymes selected from the group consisting of NAD (H) -dependent oxidizing / reducing enzymes, NAD (H) phosphorylating enzymes and NADP (H) dependent oxidizing / reducing enzymes and mGFP (metagenome-derived blue fluorescent protein) is added to a sample to provide a method for quantifying NAD (H) contained in an in vitro sample by measuring fluorescence change by mBFP. And at least one enzyme selected from the group consisting of metagenome-derived blue fluorescent protein (mBFP) mutants and NAD (H) -dependent oxidizing / reducing enzymes, NAD (H) phosphorylating enzymes and NADP (H). ≪ / RTI >

According to the present invention, in order to quantitate the coenzyme NAD (H), the activity of the NAD (H) -dependent phosphorylase is required unlike NADP (H), and the activity of the phosphorylating enzyme involved in the regeneration pathway, The present invention provides a novel method for directly or indirectly quantifying NAD (H) using an enzyme or a mixed enzyme thereof and an mBFP mutant. Specifically, in the determination of the coenzyme NAD (H) and NADP (H), in the case of NADPH, use is made of metagenome-derived blue fluorescent protein mBFP (metagenome-derived blue fluorescent protein) . However, other coenzymes, NAD +, NADH or NADP +, must be converted to NADPH by coupling reaction using enzymes involved in the regeneration pathway and quantified using mBFP mutants. First, the amount of coenzyme converted from NADP + to NADPH by measuring the amount of decrease in NADPH-dependent fluorescence in the case of NADP + or by using the activity of an NADP + dependent enzyme such as NADP + dependent dehydrogenase / oxidoreductase Can be measured and quantified. Next, in the case of NADH, the amount of coenzyme converted from NADH to NADPH can be measured and quantified using NADH kinase activity. Alternatively, NADH-dependent oxidative reductase activity may be converted to NAD + by NADH-dependent enzymatic activity, such as NADH-dependent dehydrogenase / oxidoreductase, followed by NAD + kinase and NADP + , The amount of coenzyme converted from NAD + to NADPH through NADP + can be measured and quantified. In the case of NAD +, the NAD + kinase enzyme activity was used to convert NAD + to NADP +, and then the activity of NADP + dependent enzymes, such as NADP + dependent dehydrogenase / oxidoreductase, The amount of coenzyme converted into NADPH can be measured and quantified. Alternatively, the NAD + -dependent dehydrogenase / oxidoreductase activity of NAD + -induced oxidoreductase activity was used to convert NAD + to NADH and NADH kinase enzymatic activity was used to convert NADH Can be quantified by measuring the amount of coenzyme with NADPH.

In the present invention, an oxidation-reduction or salvage pathway enzyme gene for quantifying NAD (H) or NADP (H) is an NAD (H) -dependent oxidizing / reductase, NAD (H) Oxidase / reductase genes can be found in a variety of species, and genes involved in the coupling reaction can directly or indirectly regulate the coenzyme redox and regeneration pathway. Examples of these enzymes and species capable of expressing and purifying these enzymes are as follows.

NAD + phosphorylase is an enzyme that regulates the salvage pathway of NADP + synthesis by using NAD + and has an activity dependent on polyphosphate or adenosine triphosphate (ATP). As the enzyme gene, There are ppnK1 gene of Streptococcus pneumonia, nadk gene of Escherichia coli, Nadk2 of Rattus norvegicus, ppnKA gene of Bacillus subtilis or ppnK gene of Corynebacterium glutamicum, They are not limited as they exhibit the same activity of phosphorylating NAD +, so that they can be arbitrarily selected and used.

The NADH phosphorylase involved in the coupling reaction regulates the regeneration pathway of NADPH synthesis using NADH and is an enzyme that has activity dependent on polyphosphate or adenosine triphosphate (ATP). As the enzyme gene, The POS5 and YEF1 genes of Saccharomyces cerevisiae, the NADK3 gene of Arabidopsis thaliana, the mfnk gene of Micrococcus luteus, the Nadk2 gene of Rattus norvegicus, Mycoplasma haemofelis, And the ZbPOS5 gene of Zygosaccharomyces bailii. However, the present invention is not limited thereto, and they are not limited as they exhibit the same activity of phosphorylating NADH, and can be arbitrarily selected and used.

NAD + dependent oxidoreductase, NAD + dependent dehydrogenase / oxidoreductase, regulates the NADH synthesis pathway by using NAD +. It is an enzyme which shows substrate dependent activity of the enzyme. But are not limited to, the yjjn gene of Streptococcus pneumonia, the gpsA gene of Bacillus subtilis, the preA gene of Escherichia coli, or the GAPCP1 gene of Arabidopsis thaliana, Is not limited as it exhibits the same activity, and can be arbitrarily selected and used.

The NADH-dependent oxidative reductase, NADH-dependent dehydrogenase / oxidoreductase, regulates the NAD + production pathway by using NADH. It is an enzyme that has activity dependent on the substrate of the enzyme. As the enzyme gene, But are not limited to, the GLT1 gene of Saccharomyces cerevisiae, the rocG gene of Bacillus subtilis, the lpdA gene of Mycobacterium tuberculosis or the gapN gene of Thermoproteus tenax, It is not limited as it exhibits the same activity of reduction, and can be selected and used arbitrarily.

NADP + dependent oxidative reductase, NADP + dependent dehydrogenase / oxidoreductase, regulates the NADPH synthesis pathway using NADP + and has an enzyme dependent substrate activity. But are not limited to, the nadp-mdh gene of Themeda quadrivalvis, the aldA gene of Mycobacterium bovis, the IDH2 gene of Saccharomyces cerevisiae or the ZWF gene of Escherichia coli, NADP + exhibits the same activity of dehydrogenating or reducing NADP +. In addition, enzymatic activity and expression of the enzymes can be arbitrarily increased by a molecular genetic engineering method.

According to the present invention, the mBFP protein and the regeneration pathway enzymes NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylating enzyme or NADP (H) A poly histidine tag capable of affinity chromatography can be attached to each enzyme gene to be expressed. This method is generally performed by density fractionation, salting out or dialysis, which is used for protein separation and purification, and ion exchange or gel filtration chromatography is performed in multiple stages It is possible to prevent an extreme decrease in the yield that occurs in the method of post-concentration.

According to one embodiment of the present invention, the mBFP mutant gene, the NAD + phosphorylase gene ppnk, the NADH phosphorylase gene mfnk, and the NADP + dependent oxidoreductase Glucose-6-phosphate dehydrogenase The ZWF gene can be used by expressing an enzyme by attaching a heat tag to each gene. Specifically, in the case of mBFP, the affinity column of the Cibacron blue series can be used because it naturally binds to the coenzyme. However, a high purity / large capacity separation and purification method has been established by fusing the polyhist tag in consideration of binding force and yield. This strategy offers the advantage of allowing sequential use of two affinity columns (Cibacron Blue and Ni-NTA) for the removal of impurities, as well as enabling the pure separation of proteins as a single process . Then, a gene is inserted into a plasmid in which a his-tag is attached, or a rib tag or a His-tag is inserted at the N-terminal or C-terminal MBFP, Rl-mBFP, Rl-mBFP, R5-mBFP, R6-mBFP, his-ppnk, his-mfnk and His-ZWF can be produced. Proteins overexpressed in the host transformed with the prepared gene can be separated and purified using affinity chromatography Ni-NTA. In the case of the thus isolated and purified heath-tag fusion proteins, NADPH-dependent fluorescence showing the same activity as the wild type protein and showing the quantification of each coenzyme appears, and the fused heath-tag and lamp tag have no influence on the enzyme activity or optical property .

It is possible to quantify NAD (H) by the NAD (H) quantitation method according to the present invention, and thus it is possible to quantify both NAD (H) and NADP (H) unlike the conventional coenzyme quantitation method, It is possible to quantify all the coenzymes with high efficiency and low cost. In addition, it is possible to quantify all coenzymes under low temperature, acidic and basic conditions, in which enzyme activity is generally lowered. Further, in the present invention, when performing the NAD (H) determination according to the present invention, Provide conditions that can be quickly quantified.

In the NAD (H) quantitation method of the present invention, the temperature is preferably 30 to 40, but NAD (H) can be quantified even in the range of 5 to 55. [ According to one embodiment of the present invention, the temperature at which the activity of each of the mBFP mutant and the regeneration pathway enzymes NAD (H) -dependent oxidase / reductase, NAD (H) phosphorylase and NADP (H) However, fluorescence by mBFP for quantifying NAD (H) and NADP (H) is conspicuously observed at a temperature within the range of 5 to 55 when the coenzyme is quantitatively analyzed. Generally, at low and high temperatures It is also possible to quantify NAD (H) under the conditions. That is, the method of quantifying NAD (H) and NADP (H) according to the present invention can be performed at a low temperature or a high temperature in which the activity of the enzyme is extremely low, unlike the optimum temperature condition required in the coarse determination method according to the existing methods And there is no need to use an antioxidant or a reagent to fix the coenzyme because the coenzyme is hardly naturally produced.

According to the method for quantifying NAD (H) of the present invention, NAD (H) can be quantified even under pH acidic and basic conditions. According to the present invention, NAD (H) can be quantified even in a pH range of preferably 5 to 10, more preferably 6 to 9, or 3 to 12. According to one embodiment of the present invention, the most excellent activity of the mBFP mutant and the regeneration pathway enzymes NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylating enzyme and NADP (H) (H) and NADP (H) can be quantified according to the present invention under most conditions except strongly acidic and strongly basic buffer. This feature allows all of the coenzymes of most biological samples with near neutral pH and salt concentrations as well as various natural samples with various pH and salt concentrations to be subjected to simple pretreatment such as dilution to remove all coenzymes Can be analyzed.

The time spent to quantify both NAD (H) and NADP (H) coenzyme through the NAD (H) quantification method of the present invention is dependent on the regeneration pathway enzymes NAD (H) dependent oxidase / reductase, NAD (H) Depending on the type and concentration of each NADP (H) dependent oxidizing / reducing enzyme. However, even if the kinds and concentrations of the enzymes are different, the time required for quantification can be rapidly reached within 1 minute, and all the coenzymes can be quantified within at least 10 minutes. This feature can solve the problem that a reaction time of at least 30 minutes is required when using a coenzyme assay kit that has been used previously and a problem in which a range of coenzyme concentration can not be measured in a kit containing a chemical catalyst, Further, it is not necessary to treat the coenzyme oxidation inhibitor or fix the reagent according to the measurement time delay.

The method of quantifying NAD (H) of the present invention is characterized in that the mBFP mutant used for the determination of the coenzyme contained in the sample and the NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) / Reductase is used in an extremely small amount, the concentration measurement of the coenzyme can exhibit sufficient reproducibility. According to one embodiment of the present invention, the concentration of coenzyme can be measured reproducibly in an enzyme activity interval of at least 0.05 muU. These characteristics are comparable to or higher sensitivity than conventional coenzyme quantitation kits and can be advantageous in the time required for the measurement or in the preprocessing process.

Although both the NAD (H) and NADP (H) coenzymes can be quantitatively determined by the NAD (H) assay method according to the present invention, a method capable of quantifying the coenzyme even when the sample contains an extremely small amount of coenzyme to provide. Specifically, the present invention relates to a method for producing a mBFP comprising the steps of treating a mBFP mutant with a surfactant to liberate a tetrameric mBFP as a monomer and a step of liberating a free monomer and an NAD (H) -dependent oxidizing / reducing enzyme, NAD ) -Dependent oxidative / reductase enzyme is added to a sample to provide a method for quantifying NAD (H) contained in an in vitro sample by measuring the fluorescence change by the mBFP mutant.

According to the present invention, the mBFP mutant, which is a tetrameric structure consisting of four monomers, is liberated as a monomer by the treatment of the surfactant, and NADPH bound to the liberated monomer binds to the tetrameric mBFP mutant Unlike other structural quenchins, fluorescence increases. The surfactant for the derivation of the monomer of the mBFP mutant may be one or more selected from the group consisting of SDS, Na-deoxycholate, Cetrimonium bromide (CTAB), dodecyl-trimethylammonium bromide (DTAB) and Triton X- Surfactants that can be used for monomer derivation in the field of the invention are freely usable. According to an embodiment of the present invention, when the surfactant is treated in a range where the tertiary structure of the mBFP mutant is not denatured, it can be liberated as a monomer, and the intensity of fluorescence can be improved by at least 2 times using a liberated monomer .

In the NAD (H) quantitation method according to the present invention, metal ions can be added to quantitate the coenzyme with higher sensitivity. Type of metal ions are ^{Li +, Hg 2 +, Co} 2 +, Mg 2 +, Mn 2+, Zn 2 +, K +, Ca 2 +, Al 3 +, Fe 3 +, Fe 2 +, Ag 3 + _, Ni ^{2 +} , Pb ^{2 +} and Cu ^{2 +} , but is not limited thereto. According to one embodiment of the present invention, the sensitivity can be increased more than two times when a metal salt containing a metal ion is added, in particular, in a method of quantitatively determining NAD (H) or quantifying NAD (H). In addition, when the metal ion and the surfactant are added together, the sensitivity can be increased by at least three times in the method of applying the NAD (H) quantitation or the NAD (H) quantification.

The present invention relates to a method for quantifying NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) -phosphorylating enzyme and NADP (H) -dependent oxidizing / reducing enzyme contained in an in vitro / A method for quantifying one or more enzymes selected from the group. Specifically, NAD (H) -dependent oxidizing / reducing enzyme, NAD (H), and NAD (H) contained in an in vitro sample were measured by measuring fluorescence change by mBFP mutant by adding NAD (H) or NADP A phosphorylating enzyme and a NADP (H) -dependent oxidizing / reducing enzyme. This enzyme determination method corresponds to a coupling assay applying the NAD (H) quantitation method according to the present invention. More specifically, the enzyme is activated by a coupling enzyme activity such that a substrate is added to an oxidoreductase having a coenzyme-dependent activity to induce the reaction and then oxidized or reversely reduced to NAD (P) H in NAD (P) The enzyme activity (nmol / min / mg protein) is calculated by measuring the amount of NADPH changed through the mBFP mutant and measuring fluorescence. This process is possible because the specific activity can be measured by the amount of changed coenzyme even if the substrate is not known because the oxidizing / reducing enzyme consumes both the substrate consumption and the coenzyme consumption at the same molar ratio. Thus, by measuring the activity of all enzymes used as coenzyme, the specific activity of the enzyme can be measured accurately and quickly by using the changed fluorescence value by adding the coupling enzyme and the mBFP mutant, and it is possible to measure the specific activity of the enzyme, Since it can be used under high temperature, acidic and basic conditions, it is possible to provide highly reliable and sensitive enzyme quantitation method for enzyme activity measurement.

NAD (H) -dependent oxidative / reductase, NAD (H) -dependent oxidase / reductase contained in the in vitro and in vivo samples by measurement of fluorescence change by mBFP mutant by coupling assay using the NAD (H) H) phosphorylase and NADP (H) -dependent oxidizing / reducting enzymes. More specifically, NAD (H) -dependent NAD (H) or NADP (H) and metagenome-derived blue fluorescent protein mutants were added to samples to measure fluorescence changes by mBFP mutants. A method for constructing an enzyme library of at least one enzyme selected from the group consisting of oxidase / reductase, NAD (H) phosphorylase and NADP (H) -dependent oxidation / reductase. After the whole genome (metagenome) in the environmental sample is extracted, a partial cleavage is performed using restriction enzymes, a library is prepared, and hosts having the prepared library are cultured. Thereafter, You can find clones in your library. Further, a dehydrogenase and an oxidoreductase of the selected library can be provided with a coenzyme-dependent redox inhibitor screening method corresponding to an antimicrobial agent. According to one embodiment of the present invention, the clones having the related enzymes are cultured through the enzyme library construction method, and the coupling reaction is induced in the environment where various substances are present after the addition of the substrate and the coenzyme, so that the change of NADPH The amount of the compound corresponding to the active inhibitor can be selected.

It is possible to provide a disease diagnosis composition using a coenzyme-dependent enzyme activity of microorganisms and tissue cells in a biological sample through other coupling assays using the NAD (H) assay method according to the present invention. Depending on the disease's characteristic enzymatic activity, various diseases such as heart disease, liver disease, blood disease can be diagnosed as well as various kinds of cancer. For example, it is possible to determine the existence of possible enzyme activity as a disease marker in a sample through measurement of coenzyme-dependent enzyme activity using a coenzyme determination method and composition of the present invention using a body fluid such as needle, urine, or blood as a subject of a biological sample Thereby providing a method for diagnosing and diagnosing diseases. According to one embodiment of the present invention, a NAD (H) -dependent oxidizing / reducing enzyme, a NAD (H) phosphorylating enzyme or a NADP (H) , G6PDH), isocitrate dehydrogenase (IDH), lactate dehydrogenase (LDH) or NADH kinase (NADHK) as markers for the diagnosis of colorectal cancer or breast cancer As the biomarker composition, it is possible to provide a biomarker composition for diagnosing colorectal cancer or breast cancer comprising NAD (H) or NADP (H) and mBFP mutants.

The presence or absence of microorganisms and the indirect quantitation method can be provided by using the coupling assay applying the NAD (H) quantitation method according to the present invention. The amount of coenzyme can be measured to determine the presence of indirect microorganisms based on the presence of the microorganism producing it and the NADPH content per bacterium. This is because the coenzyme is produced only in the environment where the organism exists or in the living body, and even if it exists in the sample, the form reduced by the natural oxidation disappears under the inanimate condition. The method of confirming the presence or indirect determination of the presence of microorganisms according to the present invention does not require a culture time for producing a colony and does not directly count the number of microorganisms, which is advantageous in that it can be rapidly pretreated and quantified easily. This method is an important indicator to judge the degree of environmental pollution. It is possible to confirm the existence of microorganisms in the sample as well as arbitrarily adding bacteria to the sample, and to check whether there is any potential pollutant by changing the coenzyme after culturing .

The present invention provides a kit formulation capable of measuring coenzyme or enzyme-dependent activity so that a coenzyme assay method and a coupling assay using the coenzyme assay according to the present invention can be used. According to one embodiment of the present invention, a dry formulation can be provided of the solution formulation of the present invention and the coupling-related enzyme and mBFP variant applicable to other formulations. Such kit formulations can have advantages such as small sample requirements, portability, and cost-effective performance.

Hereinafter, the present invention will be described in more detail with reference to the following examples, but the present invention is not construed as being limited thereto.

mBFP  Generation of Ramp-tag Fusion Mutation Gene for Increasing Expression and Activity

Metagenome-derived blue fluorescent protein To increase the mBFP expression rate or function folding of proteins and to increase the protein productivity to be expressed, a gene sequence is added at the N-terminus, Tag (ramp tag) technology was used.

The codon usage of E. coli strains was analyzed and rare codons were collected for lamp tag technology. The rare codons referred to here refer to the codons that are collected in the process described below, in addition to the concept of commonly known rare codons. The rate of translation is most influenced by how rapidly the aa-tRNA, in which the amino acid is bound, is released when the codon is decoded. Therefore, the rate of translation of aa-tRNA at a codon in which the amount of the aa-tRNA is sufficiently present in the cell is fast, while the lack of aa-tRNA decreases translation efficiency. Therefore, the gene copy of tRNA can be used as the first measure of the concentration of the corresponding tRNA in the cell. As is known, a typical codon optimization method reflects the codon frequency because it is known that the codon frequency is proportional to the number of tRNA copies. In this experiment, the codon frequency (100% standard) and the tRNA gene copy corresponding to each amino acid (AA) in Escherichia coli were used (http://gtrnadb.ucsc.edu/) 2014-0112888). Briefly, the codon pair frequency in each amino acid was 1.0% or less, and up to three codons were collected for one amino acid. The method of considering each codon frequency and the method of considering the gene copy number of isoacceptor tRNA were mixed. MBFP (SEQ ID NO: 2) and R2-mBFP (SEQ ID NO: 3), which are mutants of mBFP, were cloned so as to be fused to the N-terminus of the mBFP gene (SEQ ID NO: R3-mBFP (SEQ ID NO: 4), R4-mBFP (SEQ ID NO: 5, R5-mBFP (SEQ ID NO: 6), R6-mBFP (SEQ ID NO: 7).

Lamp tag sequence Mutant SEQ ID NO: Lamp tag sequence R1-mBFP SEQ ID NO: 8 CTCCGGCGAGGTTGCTTG R2-mBFP SEQ ID NO: 9 CATGGTCGAGTACACACG R3-mBFP SEQ ID NO: 10 CAATTGCTCGATAAGGTATGC R4-mBFP SEQ ID NO: 11 AGCGATCGGCAACTCCGATATACG R5-mBFP SEQ ID NO: 12 ACGGAGCATGGTCGGCTCCACGCACTCCGG R6-mBFP SEQ ID NO: 13 TGGAGCCTA GCTCGCTCCA ACGGCAATGC TCG

For this purpose, a primer containing a HindIII recognition site including a Nde I recognition site including a lamp-tag and a Heath-tag was prepared and PCR amplification was performed using the mBFP gene as a template. The amplified fragments were digested with restriction enzymes and inserted into the pET24a vector digested with the same enzymes to obtain pET24a-R1-mBFP, pET24a-R2-mBFP, pET24a-R3-mBFP, pET24a-R4-mBFP, pET24a-R5- mBFP, and pET24a-R6-mBFP. In addition to fusing the lamp-tag in the production of the lamp-tag fusion gene, reference can be made to Example 2 below.

heath - Production of His-tag fusion gene

Heath-tag fusion gene was constructed for induction of protein overexpression and efficient purification of pure water. PQE30-mBFP, pQE30-mfnk, pQE30-mfnk and pQE30 (mRNA) were inserted into the vector pQE30 (Clonetech, USA, GenBank No. AF485783) -ppnK. < / RTI > mBFP uses a primer 'mBFP-F' containing a Sph I recognition site and a start codon removed and a primer 'mBFP-R' having a Hind III recognition site, ZWF is Bam HI Comprises a recognition site, and using the start kodonreul removed primer 'ZWF-F' and Hind Ⅲ having a recognition site primer 'ZWF-R', and with mfnk the Bam include HI recognition site and start kodonreul removed primer 'mfnk-F' PpnK-R 'having a Hind III recognition site, ppnK using a primer' ppnk-F 'containing a Sma I recognition site and a start codon removed and a primer' ppnk-R 'having a Hind III recognition site PCR (Table 2). The amplified fragments were cut into restriction enzymes and inserted into the pQE30 vector digested with the same enzymes to obtain the vectors pQE30-mBFP, pQE30-ZWF, pQE30-ZWF, and pQE30-mBFP each having his-mBFP, his-ZWF, his- mfnk and pQE30-ppnK (Fig. 2). His-mBFP and ZWF produced by this process contain unnecessary amino acid residues in the vector at the heath-tag and protein coding regions. Since these structures may affect the expression or function of the protein, a recombinant protein was prepared by directly fusing six histidine residues to the primer in front of the protein coding region. For this purpose, primers containing Nde I recognition site, His - tag containing primer and Hind III site were constructed and PCR amplification was carried out using the cloned gene in pQE30 vector. The amplified fragments were digested with restriction enzymes and inserted into the pET24a vector digested with the same enzymes to produce pET24a-his-mBFP, pET24a-his-ZWF, pET24a-his-mfnk and pET24a-his-ppnk 3). The vector containing the genes was transformed with E. coli XL1-blue and BL21 as host. In order to facilitate secretion of the exogenous protein expressed by the construct of the present invention outside the host cell, preferably, the exogenous protein may further include a leader sequence (or a signal sequence). The leader sequence suitable for the present invention is not particularly limited and may additionally include leader sequences such as, for example, pelB, gene, ompA, ompB, ompC, ompD, ompE, ompF, ompT, phoA and phoE. In addition, the vector for expressing the desired protein includes a promoter capable of promoting transcription, a replication origin of host cells, and a selection marker, which are commonly used in the field to which the present invention belongs. But are not limited thereto. The host cell can be used in any known host cell capable of stably and continuously expressing a vector having the desired gene. For example, E. coli JM109, RR1, LE392 or W3110 can also be used as hosts. In the case of his-mBFP gene, eukaryotic yeast ( Saccharomyces ) or Phichia These cells can also be used as host cells because they are overexpressed stably. The target gene of the present invention may be contained in a recombinant vector, but may be inserted directly into the chromosome of the host cell. For chromosomal insertion, conventional homologous recombination methods, transposon-mediated gene insertion or Cre-LoxP recombination systems can be used.

Primer sequence name SEQ ID NO: order mBFP-F SEQ ID NO: 14 ATAGCATGCCAGAATCTGAACG mBFP-R SEQ ID NO: 15 ATAAAGCTTTCAAGCGGCGAAGCCG ppnK-F SEQ ID NO: 16 ATACCCGGGGACTGCACCCACGAACGCT ppnK-R SEQ ID NO: 17 ATAAAGCTTTTACCCCGCTGACCTGG mfnk-F SEQ ID NO: 18 ATAGGATCCCCCTACACCCCCGGAC mfnk-R SEQ ID NO: 19 ATAAAGCTTTTAGTTCGACGACGTCGGGA ZWF-F SEQ ID NO: 20 ATAGGATCCGCGGTAACGCAAACAG ZWF-R SEQ ID NO: 21 ATAAAGCTTCTCAAACTCATTCCA mBFP-F2 SEQ ID NO: 22 ATACATATG AGAGGATCGCATCACCA mBFP-R2 SEQ ID NO: 23 ATAAGCTTTTAAGCGGCGAAGCCGCCG ppnK-F2 SEQ ID NO: 24 ATACATATGACTGCACCCACGAACGCT ppnK-R2 SEQ ID NO: 25 ATAAAGCTTCCCCGCTGACCTGGG mFNK-F2 SEQ ID NO: 26 ATACATATGCCCTACACCCCCGGAC mfNK-R2 SEQ ID NO: 27 ATAAAGCTTGTTCGACGACGTCGGGAC ZWF-F2 SEQ ID NO: 28 ATACATATGGCGGTAACGCAAACAG ZWF-R2 SEQ ID NO: 29 ATAAAGCTTCTCAAACTCATTCCA

The method of delivering the recombinant vector of the present invention into a host cell may be a method commonly used in the field to which the present invention belongs. If the host cell is a prokaryotic cell, the CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA, 9: 2110-2114 163: 557-580 (1983)) and electroporation method (Dower, WJ et < RTI ID = 0.0 > al., Nucleic Acids Res., 16: 6127-6145 (1988)). In addition, when the host cell is a eukaryotic cell, microinjection (Capecchi, MR, Cell, 22: 479 (1980)), calcium phosphate precipitation (Graham, FL et al., Virology, 52: 456 (Wong, TK et al., Gene, 10: 87 (1980)), DEAE- (Yang et al., Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)) and dextran treatment (Gopal, Mol. Cell Biol., 5: 1188-1190 ) Or the like into the host cell.

heath - separation and purification of proteins with his-tag and Ramp-tag fusion

Example  3-1. Strain culture and protein expression

Single colonies transformed with the genes prepared according to Examples 1 and 2 were inoculated in 15 ml liquid medium (LB Broth + 50 mg / ml ampicillin) and pre-cultured at 37, 200 rpm for 12 hours. Absorbance of the culture solution (OD ₆₀₀₎ when the value is reached to 2.0, then the culture under the same conditions with 1% of the total volume inoculate 1L of liquid medium (LB + 50 mg / ㎖ ampicillin) absorbance of the culture solution (OD ₆₀₀ ) Value reached 0.5, 0.2 mM IPTG (isopropyl [beta] -D-1-thiogalactopyranoside) was added as a protein expression derivative. After 6 hours, the cells were recovered using a high-speed centrifuge. In this case, in the case of mBFP in which a His-tag or a ramp-tag is fused to the N-terminus or C-terminus, it is overexpressed without addition of a specific inducer, Chemical additives were not needed. mBFP (SEQ ID NO: 30), R3-mBFP (SEQ ID NO: 33) and R4-mBFP (SEQ ID NO: ), R5-mBFP (SEQ ID NO: 35), and R6-mBFP (SEQ ID NO: 36).

In addition, the method of increasing expression of a recombinant gene can be carried out through simultaneous expression of a chaperone or a disulfide bond-assisting protein that assists in protein folding or expression through gene insertion in a chromosome of a host cell, Or a method of additionally introducing a plasmid encoding a specific tRNA lacking the proteinase of the present invention into the host cell. It does not.

Example  3-2. Pure Isolation of Fusion Proteins Using Metal Ion Affinity Chromatography

Proteins can be purified by using the properties such as bonding force of the tertiary structure with a specific substrate, surface charge, hydrophobicity, or by fusion of an affinity tag. Among them, mBFP, in which his-tag or ramp-tag is fused, is known as a representative tag using affinity chromatography (Ni-NTA) having a metal-affinity ability and fusing with various proteins. Heath-tag and lamp tag were fused to proteins to separate proteins, and purified and purified by the following method.

The recovered cells were suspended in 50 ml of binding buffer (20 mM Tris-HCl, 300 mM NaCl, pH 7.5), sonicated for 10 seconds at low temperature using an ultrasonic grinder, and allowed to stand for 30 seconds. . The disrupted cells were centrifuged at high speed (15,000 rpm, 30 min) to remove insoluble precipitates, and the supernatant containing soluble proteins was recovered. The macromolecules such as chromosomes and polysaccharides remaining in the recovered supernatant were added with 1 g of CDR (cell debris remover) per 20 ml to induce the reaction. Then, centrifugation was carried out by the above method or a 0.45 μm syringe filter ) To remove impurities. The recovered supernatant was diluted by the addition of a 10-fold volume of binding buffer. The Ni-NTA resin to be used for affinity chromatography was sufficiently washed with 50 ml of binding buffer to reach equilibrium. The protein solution centrifuged at the equilibrium was flowed at a flow rate of 2 ml / min to induce adhesion. 100 ml of wash buffer (20 mM Tris-HCl, 300 mM NaCl, 10 mM Imidazole, pH 7.5) Ml / min to remove non-specifically bound weakly bound impurities with unbound protein. The elution of the protein was performed by flowing elution buffer (20 mM Tris-HCl, 300 mM NaCl, 250 mM Imidazole, pH 7.5) at 4 ml / min. Removal of sodium chloride added to reduce non-specific protein interactions with imidazole added as an eluting agent was confirmed by a fluorometer analysis and cut-off size ( cut-off size) 10 kDa. As shown in FIG. 4, more than 90% of pure proteins were confirmed by SDS-PAGE. In addition, R2-mBFP showed the highest expression, while R1-mBFP, R3-mBFP, R4-mBFP and R5-mBFP showed the highest expression The amount of protein expression was similar.

Example  3-3. NADPH Ability to bind  Protein separation

MBFP was purified by using cibacron blue, which is used for affinity chromatography of a protein binding to NADPH. Cibacron blue is a kind of chlorotriazine dye and has the ability to specifically bind to an enzyme using NAD (H) or NADP (H) as a coenzyme and is a ligand commonly used in protein purification. The cells recovered by the above method were suspended in 50 ml of binding buffer (20 mM Tris-HCl, pH 7.5), sonicated for 10 seconds at low temperature using an ultrasonic grinder, and allowed to stand for 30 seconds. And the cells were disrupted. The disrupted cells were removed from the insoluble precipitate using a high-speed centrifuge (15,000 rpm, 30 min), and the supernatant containing the soluble protein was recovered. To remove macromolecules such as chromosomes and polysaccharides remaining in the recovered supernatant, 1 g of CDR (cell debris remover) was added per 20 ml. After mixing for 10 minutes at low temperature, the mixture was centrifuged (15,000 rpm, 30 min) The remaining impurities were removed using a ㎛ syringe filter. The cells were then diluted by adding 10-fold volume of binding buffer to the pretreated cell lysate. From the diluted solution, his-mBFP, The process of purifying R1-mBFP, R2-mBFP, R3-mBFP, R4-mBFP and R5-mBFP is as follows. First, the affinity carrier was sufficiently washed with 50 ml of binding buffer to reach equilibrium. The cell lysate was then flowed at a flow rate of 2 ml / min to induce protein attachment, and 100 ml of washing buffer (20 mM Tris-HCl, pH 7.5) was flowed at a flow rate of 3 ml / min to bind the column Lt; RTI ID = 0.0 > non-specific < / RTI > weakly bound impurities. The eluted buffer (20 mM Tris-HCl, 2M NaCl, pH 7.5) was flowed through the prepared sample at the same flow rate to recover proteins adsorbed on the affinity resin. After confirming the fractional sections from which the his-mBFP, R1-mBFP, R2-mBFP, R3-mBFP, R4-mBFP and R5-mBFP were recovered by fluorometer analysis, the high concentration of sodium chloride contained in the elution solution The buffer was replaced with centriprep (cut-off size 10 kDa) for removal. The recovered solution was analyzed by SDS-PAGE. As can be seen from FIG. 4, his-mBFP, R1-mBFP, R2-mBFP (SEQ ID NO: 2), R3-mBFP, R4- mBFP could be isolated.

Example  3-4. Pure Isolation of Fusion Proteins Using Affinity Chromatography Continuously

Affinity Chromatograph Although each method shows sufficient resolution, absolute purification close to 100% purity may be required if necessary. This purity is not easily obtained by each process in which the interfering substance exists in the living body, but it is known that the above process can be performed by successive processes. Therefore, in the case of two affinity chromatography, mBFP, Cibacron blue and Ni-NTA resin were successively subjected to pure purification of mBFP, and in the case of his-ZWF, his-mfnk and his-ppnK, Ni-NTA The resin and the anion exchange resin were sequentially subjected to pure purification of each protein. In the case of mBFP, the supernatant sample containing soluble protein was prepared in the same manner as described above, and attached to Ciba cron blue equilibrated with binding buffer (20 mM Tris-HCl, pH 7.5) at a flow rate of 2 ml / min And then 100 ml of washing buffer (20 mM Tris-HCl, pH 7.5) was flowed at a flow rate of 3 ml / min to remove impurities that were not bound to the column and nonspecifically weakly bound to the column. The attached protein was recovered using buffer (20 mM Tris-HCl, 2 M NaCl, pH 7.5) containing a high concentration of salt. SDS-PAGE analysis was performed to confirm the recovered fractions and purity of the mBFP, and then a metal-affinity resin column for the removal of contaminating proteins eluted together was performed. To this end, the recovered protein solution was diluted 4-fold and then the protein attachment was induced at a flow rate of 2 ml / min in a Ni-NTA resin equilibrated with 50 ml of binding buffer. Removal of the nonspecifically weakly bound impurities with the unbound protein was performed by flowing 100 ml of wash buffer (20 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, pH 7.5) at a flow rate of 3 ml / min. Proteins adsorbed on Ni-NTA resin were recovered using buffer (20 mM Tris-HCl, 300 mM NaCl, 250 mM Imidazole, pH 7.5). After confirming the fractional section using a fluorescence spectrophotometer, a desalting column was used to remove imidazole and sodium chloride present in the eluate.

In the case of his-ZWF, his-mfnk, and his-ppnK, the supernatant sample in which the soluble protein was present was prepared in the same manner as above and anion reached equilibrium with binding buffer (20 mM Tris-HCl, pH 7.5) After attachment of the protein to the anion exchange resin at a flow rate of 2 ml / min, 100 ml of washing buffer (20 mM Tris-HCl, pH 7.5) was flowed at a flow rate of 3 ml / min to bind the column Lt; RTI ID = 0.0 > non-specific < / RTI > weakly bound impurities. The attached protein was recovered using a buffer solution (20 mM Tris-HCl, 2M NaCl, pH 7.5) containing a high concentration of salt. After confirming the fraction and purity of the recovered fractions of each protein through SDS-PAGE analysis, a metal-affinity resin column for the removal of the contaminating proteins eluted together was performed. To this end, the recovered protein solution was diluted 4-fold and then the protein attachment was induced at a flow rate of 2 ml / min in a Ni-NTA resin equilibrated with 50 ml of a binding buffer. Removal of the nonspecifically weakly bound impurities with unbound protein was performed by flowing 100 ml of wash buffer (20 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, pH 7.5) at a flow rate of 3 ml / min. Proteins adsorbed on Ni-NTA resin were recovered using buffer (20 mM Tris-HCl, 300 mM NaCl, 250 mM imidazole, pH 7.5). After confirming the fractional section using a fluorescence spectrophotometer, a desalting column was used to remove the imidazole and sodium chloride present in the eluate.

The recovered solutions were confirmed by SDS-PAGE, and as shown in FIG. 4, a protein having a purity of at least 95% was confirmed. The fluorescence of recombinant mBFP with this purity was found to be no problem in the coenzyme determination process because the affinity tag did not differ from the wild type protein not fused. The enzymatic activity of his-ZWF, his-mfnk, and his- The tag was found to be similar in purity to wild-type protein (unseparated state), which is similar to the known specific activity (Table 3).

Activity measurement of coupling enzyme name Specific activity ^a
(Units / mg protein +/- SD) ZWF 23.4 ± 1.5 his-ZWF 1254.5 ± 15.4 mfnk 121.7 ± 4.6 his-mfnk 2251.8 ± 25.6 ppnk 56.2 ± 2.6 his-ppnk 1562.6 + 19.2 ^a : SD is the standard deviation

Tag fusion mutation mBFP  Identification of activity and property changes

mBFP, R2-mBFP, R2-mBFP, and R3-mBFP were added to 100 nM NADPH in a buffer solution of 50 mM Tris (pH 7.5) in order to determine whether the heat tag and ramp- mBFP, R4-mBFP, R5-mBFP, and R6-mBFP were added to measure fluorescence. As a result of removing the background value by subtracting the fluorescence value measured by the protein from the fluorescence value of the buffer solution not containing the protein, it was confirmed that fluorescence was enhanced depending on the coenzyme concentration, and the fluorescent difference due to the heath tag and the lamp tag I could not find it.

It is known that there is no significant difference in activity, but it is known that there is a possibility that the specificity or the degree of binding to coenzyme may be different due to a minute structural change. To confirm this, we compared NADPH fluorescence measured in the presence of other coenzyme (NAD +, NADH, NADP +). As a result of removing the background value as described above, the fluorescence value of his-mBFP was not changed by addition of NAD + and NADH to the NADPH solution, but the NADPH fluorescence value decreased as the concentration of NADP + increased. Most of the mBFPs with lamp tags showed the same results as his-mBFP, but R2-mBFP enhanced NADPH fluorescence with little interference by NADP + concentration (Fig. 5). This is due to the presence of NADP (H) binding sites in the mBFP protein structure, which means that NADP + and NADPH competitively affect fluorescence activity, indicating that the R2-mBFP containing the ramp tag resulted in a change in NADP + binding capacity . As shown in the results, if NADP + is not a high concentration, fluorescence measurement of NADPH using his-mBFP does not have a significant effect. However, in a case where a relatively small amount of NADPH is measured or in the presence of all four redox coenzyme species, NADP + It is preferable to use R2-mBFP which does not cause interference due to interference.

By introducing a coupling system NADP + Establish measurement system

Example  5-1. G6PDH  Used NADP + Establish quantitative optimum reaction conditions

In order to confirm the reaction conditions of R2-mBFP fluorescence in NADP + quantitation using NADP + dependent enzyme activity, 0.2 mM NADP +, 0.5 mM MgCl ₂ , 1 mM glucose-6-phosphate in 50 mM Tris (pH 7.5) phosphate was added to each well, and then 0.05, 0.25, 0.75, and 1 mUU his-ZWF (G6PDH) were mixed and reacted at 30 for each hour. Then, R2-mBFP was added to measure fluorescence. The fluorescence values measured by enzyme concentration were subtracted from the fluorescence values of the buffer solution not containing the enzyme and the background values were removed. As a result, it was found that 0.05mU G6PDH Enzyme activity was clearly identified using mBFP (Fig. 6A). In order to confirm the dependence on the reaction temperature, a pure water separated his-ZWF solution (0.25 mU, 50 mM Tris-HCl buffer, pH 7.5) was added to a water bath adjusted to each temperature (4-55) After incubation for one hour, 0.2 mM NADP +, 0.5 mM MgCl ₂ , and 1 mM glucose-6-phosphate were mixed and reacted in the buffer solution, followed by addition of R2-mBFP to measure fluorescence. As a result, as shown in FIG. 6B, it was confirmed that the fluorescence intensity according to each temperature was optimal at 37 ° C. More specifically, the range in which the linear response characteristics according to NADP + concentration can be confirmed was 10 to 20 to 30 nM to 5 μM, 20 to 37 to 20 nM to 5 μM, 45 to 50 nM to 3 μM, and 55 to 200 nM to 1 μM. In addition, we analyzed fluorescence variation and intensity according to the buffer solution to analyze whether the limitation problem of the existing buffer solution can be solved. In detail, the fluorescence was measured after G6PDH and mBFP were placed in various buffers to induce equilibrium. The final concentration of the buffer used was as follows: 50 mM Tris-HCl (pH 7.5), 50 mM sodium phosphate , pH 6.01), 50 mM carbonate-bicarbonate, pH 10.37, 50 mM PBS, 50 mM glycine-NaOH, pH 9.0, 50 mM citric acid- sodium citrate, pH 4.71), 50 mM acetic acid-sodium acetate (pH 3.95), and 50 mM citric acid-phosphate buffer (pH 2.65). As a result, as shown in FIG. 6C, the fluorescence intensities of the respective buffers were the highest in 50 mM Tris-HCl (pH 7.5), and the measured values were significantly dependent on the NADP + concentration over a wide range from the weakly acidic buffer solution to the basic buffer solution. The linear response interval under these conditions showed a clear sign. The fluorescence was decreased in the acidic buffer solution, but the slope of the linear section decreased.

Example  5-2. Pure sample NADP + Concentration assay

In order to quantitate NADP + in pure samples, 0.5mM MgCl ₂ , 1mM glucose-6-phosphate and 0.5mU G6PDH were added to the buffer solution (50mM, Tris pH 7.5) After incubation at 37 for 10 min with NADP + concentration, mBFP was added to measure fluorescence. After removing the background value, the standard curve was measured, and it was confirmed that the NADP + analysis system could be applied with an r2 value of 0.998 or more (FIG. 6D). This means that NADP + reduced by G6PDH activity (NADPH) can be quantified close to real time efficiently.

By introducing a coupling system NADH  Establishment of measurement system

Example  6-1. NADH kinase  Used NADH  Establish quantitative optimum reaction conditions

In order to confirm the reaction conditions of R2-mBFP fluorescence for NADH determination using NADH-dependent enzyme activity, 0.5 mM NADH, 0.3 mM ATP, and 0.25 mM MgCl ₂ were added to a buffer solution of 50 mM Tris (pH 7.5) , 0.75, and 1 mU his-mfnk (NADH kinase) were mixed and reacted at 30 for each hour. Then, R2-mBFP was added to measure fluorescence. The fluorescence values measured by enzyme concentration were subtracted from the fluorescence values of the buffer solution without enzyme and the background was removed. As a result, it was difficult to confirm the measurement using the absorbance, and 0.05mU NADH kinase enzyme activity was clearly confirmed using mBFP (Fig. 7A). To confirm the dependence on the reaction temperature, a purely separated his-mfnk solution (0.25 mU, 50 mM Tris-HCl buffer, pH 7.5) was added to a water bath adjusted at 4 to 55 ° C After incubation, the mixture was reacted with 0.3 mM ATP, 0.25 mM MgCl ₂ and NADH in the buffer solution, and then fluorescence was measured by adding R2-mBFP. As a result, as shown in FIG. 7B, it was confirmed that the fluorescence intensity according to each temperature was optimal at 45 ° C. More specifically, the range in which the linear response characteristics according to the NADH concentration can be confirmed was 10 to 20 to 30 nM to 8 μM, 20 to 37 to 30 nM to 5 μM, 45 to 50 nM to 5 μM, and 55 to 200 nM to 5 μM. In addition, we analyzed fluorescence variation and intensity according to the buffer solution to analyze whether the limitation problem of the existing buffer solution can be solved. More specifically, the fluorescence was measured after NADH kinase and R2-mBFP were placed in various buffers and equilibrium was induced. The final concentration of the buffer used was as follows: 50 mM Tris-HCl (pH 7.5), 50 mM sodium phosphate sodium phosphate, pH 6.01), 50 mM carbonate-bicarbonate, pH 10.37, 50 mM PBS, 50 mM glycine-NaOH, pH 9.0, 50 mM citric acid- sodium citrate, pH 4.71), 50 mM acetic acid-sodium acetate (pH 3.95), and 50 mM citric acid-phosphate buffer (pH 2.65). As a result, as shown in FIG. 7C, the fluorescence intensity according to each buffer was the highest in 50 mM glycine-NaOH (pH 9.0), and the measured values showed a wide range from the weak acid buffer to the basic buffer depending on the NADH concentration, We confirmed that the response interval is clear. The fluorescence was decreased in the acidic buffer solution, but the slope of the linear section decreased.

By introducing a coupling system NADH  Establishment of measurement system

Example  6-1. NADH kinase  Used NADH  Establish quantitative optimum reaction conditions

In order to confirm the reaction conditions of R2-mBFP fluorescence for NADH determination using NADH-dependent enzyme activity, 0.5 mM NADH, 0.3 mM ATP, and 0.25 mM MgCl ₂ were added to a buffer solution of 50 mM Tris (pH 7.5) , 0.75, and 1 mU his-mfnk (NADH kinase) were mixed and reacted at 30 for each hour. Then, R2-mBFP was added to measure fluorescence. The fluorescence values measured by enzyme concentration were subtracted from the fluorescence values of the buffer solution without enzyme and the background was removed. As a result, it was difficult to confirm the measurement using the absorbance, and 0.05mU NADH kinase enzyme activity was clearly confirmed using mBFP (Fig. 7A). To confirm the dependence on the reaction temperature, a purely separated his-mfnk solution (0.25 mU, 50 mM Tris-HCl buffer, pH 7.5) was added to a water bath adjusted at 4 to 55 ° C After incubation, the mixture was reacted with 0.3 mM ATP, 0.25 mM MgCl ₂ and NADH in the buffer solution, and then fluorescence was measured by adding R2-mBFP. As a result, as shown in FIG. 7B, it was confirmed that the fluorescence intensity according to each temperature was optimal at 45 ° C. More specifically, the range in which the linear response characteristics according to the NADH concentration can be confirmed was 10 to 20 to 30 nM to 8 μM, 20 to 37 to 30 nM to 5 μM, 45 to 50 nM to 5 μM, and 55 to 200 nM to 5 μM. In addition, we analyzed fluorescence variation and intensity according to the buffer solution to analyze whether the limitation problem of the existing buffer solution can be solved. More specifically, the fluorescence was measured after NADH kinase and R2-mBFP were placed in various buffers and equilibrium was induced. The final concentration of the buffer used was as follows: 50 mM Tris-HCl (pH 7.5), 50 mM sodium phosphate sodium phosphate, pH 6.01), 50 mM carbonate-bicarbonate, pH 10.37, 50 mM PBS, 50 mM glycine-NaOH, pH 9.0, 50 mM citric acid- sodium citrate, pH 4.71), 50 mM acetic acid-sodium acetate (pH 3.95), and 50 mM citric acid-phosphate buffer (pH 2.65). As a result, as shown in FIG. 7C, the fluorescence intensity according to each buffer was the highest in 50 mM glycine-NaOH (pH 9.0), and the measured values showed a wide range from the weak acid buffer to the basic buffer depending on the NADH concentration, We confirmed that the response interval is clear. The fluorescence was decreased in the acidic buffer solution, but the slope of the linear section decreased.

By introducing a coupling system NAD + Establish measurement system

Example  7-1. NAD + kinase  Used NAD + Establish quantitative optimum reaction conditions

Using NAD + dependent enzyme activity, NAD + To confirm the reaction conditions of R2-mBFP fluorescence for quantification, 0.5 mM NAD +, 0.3 mM ATP, 0.25 mM MgCl ₂ , 1 mM glucose-6-phosphate (pH 7.5) was added to the buffer solution (50 mM Tris, ), 0.5mU his-ZWF (G6PDH), 0.05, 0.25, 0.75, 1mU his-ppnk (NAD + kianse) were mixed and reacted with each other at 30 for 30 hours. Then, R2-mBFP was added to measure fluorescence. As a result of removing the background value by subtracting the fluorescence value measured by the enzyme concentration from the fluorescence value of the buffer solution not containing the enzyme, it was difficult to confirm the measurement using the absorbance and the fluorescence value of the coenzyme itself was not significantly different from 0.05mu The NAD + kinase enzyme activity was clearly confirmed using R2-mBFP (Fig. 8A). To confirm the dependence on the reaction temperature, purely separated his-ppnk solution (0.25 mU, 50 mM Tris-HCl buffer, pH 7.5) was added to a water bath adjusted at 4-55 at each temperature After the reaction was completed, the reaction mixture was mixed with 0.3 mM ATP, 0.25 mM MgCl ₂ , 1 mM glucose-6-phosphate, 0.5 mUU his-ZWF (G6PDH) and NAD + -mBFP was added to measure fluorescence. As a result, as shown in FIG. 8B, it was confirmed that the fluorescence intensity according to each temperature was optimal at 37 ° C. More specifically, the range in which the linear response characteristics according to the NAD + concentration can be confirmed was 10 to 20 to 30 nM to 5 μM, 20 to 37 to 20 nM to 5 μM, 45 to 100 nM to 5 μM, and 55 to 200 nM to 5 μM. In addition, we analyzed fluorescence variation and intensity according to the buffer solution to analyze whether the limitation problem of the existing buffer solution can be solved. More specifically, fluorescence was measured after NAD + kinase and mBFP were placed in various buffers to induce equilibrium. The final concentrations of the buffers used were as follows: 50 mM Tris-HCl (pH 7.5), 50 mM sodium phosphate- phosphate, pH 6.01), 50 mM carbonate-bicarbonate (pH 10.37), 50 mM PBS (pH 7.2), 50 mM glycine-NaOH, pH 9.0, 50 mM citric acid- sodium citrate , pH 4.71), 50 mM acetic acid-sodium acetate (pH 3.95), and 50 mM citric acid-phosphate buffer (pH 2.65). As a result, as shown in FIG. 8C, the fluorescence intensities according to each buffer were the highest in 50 mM PBS (pH 7.2) and showed a clear measurement value depending on the NAD + concentration over a wide range from weakly acidic buffer solution to basic buffer solution. The fluorescence was decreased in the acidic buffer solution, but the slope of the linear section decreased.

In order to quantitate NAD + using a dehydrogenase dependent on NAD + as one of the methods for converting NAD + to NADH, a buffer solution (50 mM Tris, pH 7.5) was added with 0.5 mM NAD +, 0.3 mM ATP, 0.25 mM After incubation at 30 for 30 hrs with the addition of MgCl ₂ and 0.01% ethanol, 0.05, 0.25, 0.75, and 1 mU ADH (alcohol dehydrogenase, Sigma) were added and fluorescence was measured by adding NADH kinase and his-mBFP. The fluorescence values measured by enzyme concentration were subtracted from the fluorescence values of the unfilled buffer solution to remove the background. As a result, it was difficult to confirm the measurement using the absorbance, and 0.05mU ADH Enzyme activity was clearly confirmed using mBFP (Fig. 9A). In order to confirm the dependence on the reaction temperature, a buffer (50 mM Tris-HCl buffer, pH 7.5, 0.25 mU ADH) was added to the water bath adjusted to the respective temperature within the range of 4 to 55, Then, the buffer solution was mixed with 0.3 mM ATP, 0.25 mM MgCl ₂ , 0.01% ethanol, NADH kinase, and NAD +, and then the fluorescence was measured by adding R2-mBFP. As a result, as shown in FIG. 9B, it was confirmed that the fluorescence intensity according to each temperature was optimal at 37 ° C. More specifically, the range in which the linear response characteristics according to the NAD + concentration can be confirmed was 10 to 20 to 50 nM to 5 μM, 20 to 37 to 30 nM to 10 μM, 45 to 100 nM to 3 μM, and 55 to 200 nM to 1 μM. In addition, we analyzed fluorescence variation and intensity according to the buffer solution to analyze whether the limitation problem of the existing buffer solution can be solved. More specifically, fluorescence was measured after the equilibrium was induced by standing the ADH and R2-mBFP in various buffers, and the final concentration of the buffer used was the same as the above buffer solution. As a result, as shown in FIG. 9C, the fluorescence intensities of the respective buffers were the highest in 50 mM Tris-HCl (pH 7.5), and the measured values were significantly dependent on the NAD + concentration over a wide range from the weakly acidic buffer solution to the basic buffer solution. The fluorescence was decreased in the acidic buffer solution, but the slope of the linear section decreased.

Example  7-2. Pure sample NAD + Concentration assay

To determine the amount of NAD + in the pure sample, 0.5mM NAD +, 0.3mM ATP, 0.25mM MgCl ₂ , 1mM glucose-6-phosphate (50 mM Tris, pH 7.5) ), 0.5mU his-ZWF (G6PDH) and 0.5mU his-ppnk (NAD + kinase) were added at 37 for 10 min, and mBFP was added to measure the fluorescence. After removing the background value, the standard curve was measured and it was confirmed that the NAD + analysis system could be applied with r2 value of 0.995 or more (FIG. 8D). This implies that NAD + kinase activity can be incorporated and the NAD + can be quantified efficiently close to real time.

In order to quantitate NAD + in a pure sample using a dehydrogenase dependent on NAD +, 0.5 mM NAD +, 0.3 mM ATP, 0.25 mM MgCl ₂ , 0.01% ethanol, After incubation at 37 for 10 min with 1mU ADH buffer, fluorescence was measured by adding NADH kinase and mBFP. After removing the background value, the standard curve was measured and it was confirmed that the NAD + analysis system could be applied with an r2 value of 0.998 or more (FIG. 9D). This implies that NAD + dehydrogenase and NADH kinase activity can be effectively combined with real - time quantification of NAD +.

Coupling system according to reaction time Fluorescence ability  Measure

To measure the maximum fluorescence time of R2-mBFP due to the binding of the coenzyme NADPH, 90 μl of purely isolated R2-mBFP solution (5 μM, 20 mM Tris-HCl, pH 7.5) was placed in a 30-well water bath After reaching equilibrium, 10 별로 of NADPH concentration was added to measure the fluorescence intensity according to the reaction time. As a result, as shown in FIG. 10A, it was confirmed that the reaction time required to induce the maximum fluorescence was sufficient between 30 seconds to 1 minute, and the reproducibility was measured stably for about 5 minutes or less. And the absolute value tends to decrease with the passage of time. These characteristics are associated with the natural oxidation of coenzyme with low chemical stability as the reaction time elapses. This result is considered to be a result of explaining the advantages of the rapid measurement method of the present invention. The decrease in fluorescence intensity over time has the effect of lowering the sensitivity, but the linear linear values at a given time are significantly confirmed. Therefore, although the method of the present invention has the maximum sensitivity within about 1 minute, it can be confirmed that the method can be utilized significantly in other time ranges. As a result, when a predetermined standard curve is determined after defining the reaction time determined according to the amount of the sample, it means that there is no difference in the quantitative value with time when the experiment is used. We also measured the coupling reaction time with addition of coenzyme. 2 μM coenzyme was added to each reaction mixture to change the coupling reaction time. Then, R2-mBFP was added to measure the increased fluorescence. As a result, the fluorescence intensities dependent on the coenzyme concentration were observed at the reaction time within 5 minutes, and the linearity values at the predetermined time were able to measure the coenzyme concentration (30 nM to 5 μM) Confirming the fact that treatment with NADPH antioxidant or addition of a fixed reagent does not need to be carried out according to the measurement time delay (Fig. 10B).

How to increase measurement sensitivity in low coenzyme concentration samples

In the case of R2-mBFP, it was confirmed that the coupled enzyme can accurately measure up to a concentration of NADPH of at least 30 nM in various concentration ranges. However, when measuring the enzyme-dependent enzyme activity with a limited amount of sample or low activity, a method of sensitively measuring a smaller amount of the coenzyme may be required. In the case of the R2-mBFP of the present invention, a method of increasing the sensitivity by considering a tetramer structure having four subunits (monomers) was devised. In other words, when four subunits are dissociated in a manner that does not induce deformation of the coenzyme binding site, four molecular structures, each of which is bound to each coenzyme, may be generated. Interference and quenching are reduced, resulting in an increase in fluorescence intensity. To confirm this, a small amount of SDS (0.01%) capable of separating the protein tetramer was added to the purified mBFP solution (5 μM, 20 mM Tris-HCl, pH 7.5) and mixed with the crude enzyme measurement method of the present invention . As a result, as shown in FIG. 11A, it was confirmed that the addition of SDS resulted in 2.4 ~ 3.1 times higher fluorescence value than the control group having the same amount of protein and coenzyme. More specifically, fluorescence intensities of NAD +, NADH, and NADP + were increased by 2.1 times, 2.4 times, and 2.3 times, respectively, compared with the fluorescence of the control group without surfactant. It was confirmed that the increase of fluorescence led to the extension of the measurement range and the measurement of the coenzyme at a concentration of at least 5 nM at the same protein concentration when the surfactant was treated. Surfactants that can be used in this process include ionic detergent represented by SDS and nonionic detergent represented by Triton X-100 or Tween 20 in an appropriate concentration range (0.01 to 0.5%) All have similar effects (Fig. 11B).

In order to investigate whether the enzymes used in the coupling reaction increase the sensitivity by increasing the activity of metal ions, the metal salts containing different metal ions were added to quantitate the coenzyme. The concentration of the metal ions (0.1 mM to 5 mM) and the kind (LiCl, HgCl ₂ , CoCl ₂ , MgCl ₂ , MnCl ₂ , ZnCl ₂ , KCl, CaCl ₂ , Al ₂ (SO 4) ₃ , FeCl ₃ , FeCl ₂ , AgNO _{3 ,} NiSO ₄ , PbCl ₂ , and CuCl ₂ ), the activity of the metal ion was small and the activity of some metal ions was inhibited. However, at the concentration of 0.5 mM to 5 mM, ^{Mg 2 +, Mn 2 +,} Zn 2 + is was found that increasing the activity over 2-fold (Fig. 11C). Therefore, in order to examine whether the sensitivity of the coenzyme can be improved by adding the surfactant and the metal ion to the coenzyme measurement condition of the present invention, 0.25 mM metal ion was added to the coupling reaction, and then 0.005% SDS-added mBFP solution And fluorescence was measured. As a result, it was confirmed that the fluorescence activity was increased 3 to 5 times or more as compared with the control group without addition of surfactant and metal ion (FIG. 11D).

Confirmation of preservation of protein activity by storage method

In order to examine the crude enzyme dependent enzymes and vital structures maintain the necessary long-term storage of R2-mBFP how the fluorescence activity were appropriate protein retention method. The degree of decrease in activity over time was determined by varying the storage conditions at the temperature (4, -20, -80) and the storage additive concentration (5% trehalose, 25% glycerol, and 50% glycerol at final concentration). In the case of protein samples stored under the respective conditions, the frozen samples were sufficiently hydrated in the refrigeration buffer for 5 to 45 minutes in consideration of the time required for reconstruction and restoration before use, and then used in the experiment. As a result, as shown in Fig. 12, it was confirmed that the fluorescence of the stored protein was maintained at about 80% or more even after 6 months in both the refrigeration (Fig. 12A) and the freezing (Fig. 12B) Dependent enzyme (G6PDH, NAD + kinase, NADH kinase, and ADH) was found to maintain more than 70% activity. More specifically, the activity of the protein was maintained at about 95% when stored for 2 months in a solution state in 4 refrigerated chambers without storage additive, and 80% to 85% when stored for 2 months at -20 to -80 under the storage additive And it can be observed that it is maintained. In the case of 6 months old samples, 80% or more of additives were added (25 ~ 50% glycerol), but it was decreased to 65 ~ 70% in refrigerated samples. These results show that refrigeration is effective for short - term storage within 2 months, and freezing with additives is advantageous for long - term storage. Therefore, the storage method can be changed depending on whether the measurement kit to be produced is composed of a solution or a lyophilized product. In the case of the lyophilized sample, it can be stored for about 2 months after hydration and can be reused for coarse measurement I could. It was confirmed that EDTA, NaCl, KCl, cysteine, dithiothreitol (DTT) and the like had partial effects in addition to the above additives. There was no significant variation in the storage container or buffer solution.

Example  11-1. Biological sample preparation

In order to confirm whether the coenzyme content in the biological sample can be accurately measured under the optimal reaction conditions according to the preceding examples, Escherichia coli coli XLI-blue) and yeast ( Candida albicans NUM678) and multicellular tissues such as lettuce leaves and rabbit tissues were prepared to induce disruption. Then, the supernatant containing the coenzyme was separated by centrifugation and R2-mBFP was added to determine the amount of coenzyme. More specifically, in the case of Escherichia coli and yeast, the bacteria were cultured as described in the previous example, rapidly frozen with liquefied nitrogen, and thawed in ice three times. The cells were disrupted using a sonicator and centrifuged at high speed And the supernatant was separated (15,000 rpm, 30 min). To the pretreated cell lysate, 3-fold volume of Buffer 20 mM Tris-HCl (pH 7.5) was added to dilute and used as a test sample.

In the case of tissues of plants and animals, which are other biological samples, the tissues are finely cut and rapidly frozen in liquid nitrogen, and 1 ml of homogenization buffer (10 mM phosphate buffer, pH 7.4) is added per 30 mg of each tissue, ) For 1 to 5 minutes to induce fracture. The supernatant was collected by high speed centrifugation (15,000 rpm, 30 min) and used as a sample.

Example  11-2. Within the biological sample NADP + Concentration assay

In order to quantify NADP + in a biological sample using the method of the present invention, impurities of the biological sample were first removed. As a general method for identifying NADP +, a biological sample is added to 250 μl of 0.3 M HCl, mixed with 50 μl of tricine-NaOH (pH 8.0), and left at 60 for 10 minutes. For neutralization, add 250 μl of 0.3 M NaOH and centrifuge at low temperature (4, 30 min, 6000 rpm). After addition of 0.5 mM MgCl ₂ , 1 mM glucose-6-phosphate and 0.5 mU G6PDH to the buffer solution (50 mM Tris, pH 7.5) and incubation of the biological sample at 37 for 10 min, R2-mBFP was added And fluorescence was measured.

Example  11-3. Within the biological sample NADH  Concentration test method

In order to quantify NADH in the biological sample using the measuring method of the present invention, the impurities of the biological sample were first removed. As a general method for identifying NADH, a biological sample is added to 250 μl of 0.3 M NaOH and allowed to stand at 60 ° C. for 10 minutes. Neutralization is carried out by adding 250 μl of 0.3 M HCl, mixing with 50 μl of tricine-NaOH (pH 8.0), and performing low-temperature centrifugation (4 ° C., 30 min, 6000 rpm). After addition of 0.3 mM ATP, 0.25 mM MgCl ₂ and 0.5 mU NADH kinase to the buffer (50 mM Tris, pH 7.5), the reaction mixture was incubated at 37 for 10 minutes and the fluorescence was measured by adding R2-mBFP.

Example  11-4. Within the biological sample NAD + Concentration assay

Impurities of the biological sample were first removed to quantify NAD + in the biological sample using the method of the present invention. As a general method for identifying NAD +, a biological sample is added to 250 μl of 0.3 M HCl, mixed with 50 μl of tricine-NaOH (pH 8.0), and left at 60 ° C. for 10 minutes. For neutralization, add 250 μl of 0.3 M NaOH and centrifuge at 4 ° C for 30 min at 6000 rpm. After adding 0.3 mM ATP, 0.25 mM MgCl ₂ , 1 mM glucose-6-phosphate, 0.5 mU G6PDH and 0.5 mU NAD + kinase to a buffer solution (50 mM Tris, pH 7.5) For 10 minutes, and fluorescence was measured by adding R2-mBFP.

In order to quantitate NAD + in a biological sample using dehydrogenase dependent on NAD +, a buffer solution (50 mM Tris, pH 7.5) was added with 0.5 mM NAD +, 0.3 mM ATP, 0.25 mM MgCl ₂ , 0.01% , 0.5mU ADH, and 0.5 mU NADH kinase were added to the buffer solution at 37 for 10 min. Then, R2-mBFP was added to measure the fluorescence.

For all samples, dilution or concentration was used for the measurement based on the coenzyme estimates known in the literature and the measured values were calculated as moles per dry weight. As a result, as shown in Table 4, the coarse amount per dry weight was similar to or higher than the existing estimates. These results not only assure the reliability of the method of the present invention but also show the difference from the existing values due to quick measurement (measurement in a rapid time that no natural oxidation is induced).

Result of coenzyme content measurement in sample sample NADPH (nmol / g _DCW ) NADP + NADH NAD + Escherichia coli 181.5 ± 3.1 125.4 ± 3.4 143.4 ± 8.1 109.4 ± 2.1 leaven 133.1 ± 4.5 111.2 ± 5.5 121.4 ± 1.5 81.9 ± 1.1 Lettuce 232.6 ± 12.4 164.7 ± 9.4 166.6 ± 2.1 78.7 ± 1.9 Rabbit tissue 176.1 + - 4.3 134.6 ± 4.7 135.1 ± 3.1 98.8 ± 2.1 ^a ± is the standard deviation

Commercially available and commercially available coenzyme measurement Kit with  Reliability vs. response time

In order to compare the coenzyme quantitation method using R2-mBFP and the commercially available coenzyme quantitation kit, the supernatant containing the coenzyme was extracted using E. coli and yeast as a sample, and the activity measuring ability was compared. Two commercially available coenzyme quantitation kits, Catalog # 600480 (NAD +) from Cayman, Catalog ab65348 (NADH) and ab65349 (NADP +) from Abcam, were used for comparison. Bacteria were cultured as described in Example 2, and then bacterial samples were collected by centrifugation in an assay buffer according to the manual provided by Cayman, and then washed in a 96-well plate And the assay buffer is removed, and 100 μl of permeabilization buffer is added to each well. The sample is incubated for 30 minutes at room temperature with stirring, and centrifuged at 4 캜 for 10 minutes. 100 μl of the supernatant was mixed with 100 μl of the reaction solution, and the reaction was induced at room temperature for 1.5 hours. The absorbance of the reaction solution was measured with a spectrophotometer in the light of a specific wavelength (OD 450 nm).

For the NADH kit supplied by Abcam, extract the sample containing the coenzyme from bacteria as in the previous method, add 400 μl of extraction buffer, freeze / thaw 2 times, centrifuge and use supernatant Heat treatment at 60 占 폚 for 30 minutes. Thereafter, the mixture was reacted for 5 minutes with a reaction mix, and the developer was added thereto. The reaction was allowed to proceed at room temperature for 1 to 4 hours, and the absorbance was measured with a spectral sensitivity meter at a specific wavelength (OD450 nm) .

As for the NADP + kit, extract the sample containing the coenzyme from the bacteria as described above, add 200 μl of extraction buffer, freeze / thaw 2 times, centrifuge and put the supernatant into a 96-well plate Mix with NADP cycling mix (98 μl of buffer and 2 μl of enzyme) and incubate for 5 minutes. The developer was added to the reaction solution, and the reaction was induced at room temperature for 1 to 4 hours, and the absorbance was measured with light of a specific wavelength (OD450 nm) using a spectrophotometer.

According to the assay method of the present invention, only the R2-mBFP was added after the coupling reaction according to the above-described coenzyme measurement condition (addition of R2-mBFP after each kinase reaction), and the fluorescence value was measured immediately without further reaction time (<1 min) . As a result, as shown in Table 5, the conventional kits repeatedly showed fluorescence values as high as 115-125% as compared with the quantitative values shown on average. This is because the advantage of the method of the present invention is that it can be quickly measured, does not require complicated pre / post treatment, does not require addition of catalytic enzyme and does not require time for reaction induction, The result is that the loss of coenzyme does not occur. This means that the disadvantages of the conventional commercially available kits that can not be directly quantified of coenzyme present at the beginning of the sample are solved by the method of the present invention, and it is shown that quantitative values close to actual values can be realized. The degree of realization of the actual value of the result is determined by spiking assay (comparison of the ability to accurately measure the amount of added coenzyme by re-measuring the amount of known coenzyme added to a certain amount of sample, ).

Comparison of measurements with commercial kit sample mBFP kit (nmol / g _DCW )
^a Conventional coenzyme kit (nmol / g _DCW ) NADPH 176.26 ± 15 154.62 ± 12 NADP + 35.02 ± 3 30.35 ± 4 NADH 117.46 ± 15 103.62 ± 12 NAD + 120.02 ± 23 98.35 ± 7 ^a Display the average and standard deviation of the measured values of the three commercial kits.
Each commercial kit has similar measurements at around 10%.

Using an increase in the coenzyme-dependent fluorescence intensity of R2-mBFP, these coenzymes can be used as active cofactors (reduced fluorescence when using NADH and NADPH as electron donors, increased fluorescence when using NAD + and NADP + as electron acceptors) The activity measurement method was used to measure the physiological activities of useful enzymes and biologic enzymes. To this end, a substrate is added to an oxidoreductase having an activity dependent on each coenzyme to induce the reaction, and then the enzyme activity is changed (oxidized to NAD (P) + at NAD (P) Enzyme activity (nmol / min / mg protein) was measured by measuring coenzyme amount. At the same time, R2-mBFP and an appropriate amount of coenzyme were added to the sample by the confirmation of the presence or absence of the specific substrate in the reaction solution, and the amount of the changed coenzyme was calculated by inducing the reaction of the oxidoreductase, And a method for quantifying the amount of water. This is based on the fact that the molar ratios of the substrate and the coenzyme are the same for all the kinetic properties of the coenzyme-dependent oxidoreductase. Construction and reliability evaluation of these assay methods were verified using the following commercially available enzymes. The reaction rate was calculated using the slope of the fluorescence reduction observed at a certain point of time (5 to 20 minutes). As an example of a typical reaction, 0.02 units of glutathione reductase was reacted with 50 mM potassium phosphate buffer (pH 7.5) containing 0.5 mM oxidized glutathione (GSSG) and 0.2 mM NADPH at room temperature. In addition, 0.03 unit isocitrate dehydrogenase was reacted with 50 mM phosphate buffer (pH 7.2) containing ₁ mM isocitrate, 0.2 mM MgCl ₂ and 0.5 mM NADP + at room temperature. The 0.02 unit fumarate reductase was reacted with 50 mM buffer (Tris-HCl, pH 7.5) containing ₁ mM fumarate, 0.2 mM MgCl ₂ and 0.5 mM NADH at room temperature. The 0.04 unit malate dehydrogenase enzyme was reacted with 50 mM Tris buffer (Tris-HCl, pH 7.5) containing 1 mM L-malate, 0.2 mM MgCl ₂ and 0.5 mM NAD + at room temperature. One unit of these enzymes is the amount of enzyme that can oxidize or otherwise reduce 1 μnmole NAD (P) H to 25 ° C by NAD (P) +. Thereafter, the amount of fluorescence change was measured by the coenzyme measurement method of the present invention. As a result, the increase or decrease in fluorescence corresponding to the activity of all the enzymes initially added in all the experimental procedures was accurately measured (Fig. 13). Finally, the activity of the unknown enzyme was measured by converting the fluorescence value of the enzyme into the rate of oxidation of the substrate. The activity of the substrate was determined by HPLC and MS, And the activity values measured by the changes of the substrate were the same. Therefore, it has been verified that measuring the activity of all enzymes used as coenzyme can measure the specific activity of the enzyme accurately and quickly by measuring the fluorescence value changed by adding the coupling enzyme and R2-mBFP. In addition to NQO (quinone oxidoreductase), NQO (nitric oxide synthase), thioredoxin reductase, glutathione dependent oxidoreductase, NADPH dehydrogenase, succinate ubiquinone oxidoreductase (SQR), plasma membrane oxidoreductase, cytochrome c oxidoreductase, oxoglutarate oxidoreductase, NADP + reductase, D-xylulose reductase, Glycerol-3-phosphate dehydrogenase, aldose reductase, , p450 reductase, alcohol dehydrogenase, glucose-fructose oxidoreductase, 2,5-DGK reductase, 2,5-DGK reductase, Sorbitol dehydrogenase has been identified and various enzyme-dependent enzyme activities can be measured.

Indirect measurement of microorganisms by measurement of coenzyme concentration in sample Pollution  And disease prognosis measurement method

Example  14-1. Intracellular  By analyzing the coenzyme Cell volume  How to quantify indirectly

In the presence of cells in various environmental ecological samples, the presence of coenzyme, a physiological activity indicator, is essential. In the absence or death of cells, the amount of coenzyme that can be measured is measured to be lower than the basal level. Therefore, the use of R2-mBFP, which is able to quantify the presence of microorganisms or the contamination level, which has been made up of the total bacterial counts by the conventional sample dilution, solid culture smear, bacterial count observation, Respectively. More specifically, eco-environmental samples (soil, seawater, fresh water, etc.) and specimens (such as daily necessities that are easily contaminated) are sterilized and collected in a sterilized container and quickly frozen or refrigerated, Within 1 hour). Specimens dried and not corroded or decayed, such as grain or powdered milk, need not be transported in a frozen state, but are sealed or sealed to prevent secondary contamination. When the sample is ice or ice, it is dissolved in a sterilized glass container and treated in the same manner as the liquid sample. It is important to note that if the sample is cooled for more than 1 day, it will result in the increase of low-temperature bacteria in the sample and the death of thermophilic bacteria or high temperature bacteria. When ice is used for refrigeration, ice or its melted water should not come into direct contact with the specimen to prevent secondary contamination. The sampling device was used beforehand in dry heat and sterilization after flame sterilization.

Various ecological environmental samples and specimens prepared by the above method were diluted with sterilized water under sterile conditions and then subjected to homogenization for 2 to 10 minutes. A more detailed test solution may be prepared by mixing a liquid sample (a sample obtained by mixing the sample with vigorous shaking), a sample of an anti-freeze sample (the collected sample is thoroughly mixed with a sterilized glass rod and a sterilized water bath, (A sample obtained by homogenizing and recovering the supernatant), a solid sample (obtained by finely pulverizing a predetermined amount of the collected sample, adding sterilized physiological saline and pulverizing it with a homogenizer and recovering the supernatant), a powdery sample After mixing with sterilized physiological saline, homogenizing and separating the supernatant, butter and oil (dissolved in hot water of 65 or less within 15 minutes, sterilized physiological saline was added, homogenized and supernatant was taken But are not limited thereto. The amount of coenzyme present in the sample can be quantified by measuring the coenzyme using the coupling enzyme and R2-mBFP in the supernatant of the prepared sample. If the fluorescence value is measured, the amount of the coenzyme present in the sample can be quantified and divided into the coenzyme content of the microbe as a typical contamination source. (Fig. 14). There are a wide variety of species as pollutants, but microbes do not require standard curves or validation tables for all species because the concentration variance of interspecies coenzymes is not large. In this method, the degree of microbial contamination can be determined by measuring the amount of all the coenzyme, and it is advantageous in comparison with the conventional plate culture method and microscopic observation method because it can be confirmed at a short time. Further, it was confirmed that the enzyme activity of the microorganisms present in the sample was measured using the coenzyme-dependent enzyme activity measurement method, and that the degree of relative contamination can be easily determined by dividing the enzyme activity as a typical pollutant source by the enzyme activity of the microorganism.

Example  14-2. Measuring contamination with coenzyme in cultured microorganisms by adding samples with potential contaminants

Various organic substances and salts present in the sample can be used as nutrients of various organisms, especially microorganisms, and are recognized as potential contaminants. Eutrophication caused by these pollutants and food corruption / corruption need to be managed as potential pollutants based on clear indicators. A test method that can be provided using R2-mBFP for this management was devised. More specifically, when a microorganism is cultured, a certain amount of a sample (drinking water, fresh water, sea water, milk, soil, wastewater, etc.) is added using a minimal medium (lacking organic C and N-source) Induce sufficient culture to induce growth (1-2 days). The same conditions as in the above-mentioned examples are used so that growth of mesophilic bacteria such as Escherichia coli is advantageous for the culture conditions. A certain amount of the culture medium was recovered during the culturing process, and the sample was treated according to the above-described method to monitor changes in the coenzyme concentration with time. Based on the obtained measurements, the presence of possible organic substances as potential contaminants in the sample was determined. In this process, E. coli transformed with the recombinant vector pQE-mBFP of the present invention can be used to confirm the growth of bacteria by fluorescence measurement of the culture itself without using the above procedure. As shown in FIG. 15, the contaminants present in the medium are used as nutrients to induce the growth of the recombinant cells, resulting in an increase in the amount of protein expressed in the cytoplasm, thereby greatly increasing the degree of fluorescence. In this process, any method of measuring fluorescence of the supernatant by pulverizing or recovering the fluorescence value of the cell itself can be used.

Example  14-3. Diagnosis of disease using enzyme-dependent enzyme activity of microorganisms and tissue cells in biological sample

Oxidized / reduced coenzyme is an important indicator of bioactivity in all cells. In particular, it provides a basis for diagnosing nephrogenic kidney disease, hematuria and metabolic abnormality as a biopsy specimen such as acupuncture or urine, , And infection-specific enzyme-dependent enzymes are diagnostic markers or have been reported to be relevant. Therefore, a rapid and accurate coenzyme measurement system related to these diseases is required, and a test method capable of providing the basis of disease judgment using R2-mBFP has been devised. More specifically, 82 healthy volunteers (high school students) were voluntarily donated to 82 needle and urine samples and 30 suspected disease samples, and the sample was treated according to the above-mentioned method to monitor the change of the coenzyme concentration with time Respectively. In addition, cofactor-dependent markers include alcohol dehydrogenase, isocitrate dehydrogenase, glucose-6-phosphate dehydrogenase, glutamate dehydrogenase, malate dehydrogenase (malate dehydrogenase) were measured. Based on the obtained measurement values, the presence or absence of possible factors as disease markers in the sample was judged. As a result, as shown in FIG. 16, there was no evidence of a small or distinct disease marker factor in the amount of coenzyme present in healthy adolescent specimens. However, coenzyme-dependent enzyme activity could be confirmed, and coenzyme-dependent enzyme activity present in suspected disease specimens was low (FIG. 17). These results are the result of confirming the advantages of the rapid and precise measurement method of coenzyme according to the present invention by measuring the coenzyme and enzyme activity in a biological sample which can not be confirmed by the conventional measurement method.

We also confirmed the possibility of diagnosing related diseases by measuring enzyme - dependent enzyme activity as a biomarker for a specific disease. For example, it is one of the enzymes that acts when the sugar in the body breaks down into energy and is contained in various tissue cells. When cells are destroyed, the activity of the enzyme in the blood increases and the activity is high in malignant tumors, liver diseases, heart diseases and blood diseases Lactate dehydrogenase (LDH), a biomarker useful for screening of these diseases, was measured. 1 [mu] l of blood was diluted 10-fold and placed in a 96-well plate. LDH activity in the blood was measured by indirectly measuring the coenzyme produced by reacting with 1 mM lactate and 0.2 mM NAD &lt; + &gt; As a result, a linear standard curve for LDH was measured, and it was confirmed that the enzyme activity in the blood of the general person was 195 to 290 IU / L (FIG. 18). This is a result of reaffirming the advantage of the method of measuring the precision / sensitive coenzyme according to the present invention which can measure the enzyme-dependent enzyme activity even with a very small blood sample.

In addition, we confirmed the possibility of measuring cancer metabolic activity as another target for expanding the application scope of disease diagnosis. In the case of cancer cells, since the regulation of the cell cycle and the apoptosis function are lost and the division and growth of the cells are continued, the specific cancer metabolism reaction is about 8 times higher than that of normal cells, and there is a fundamental difference in energy balance. Since the difference in enzyme activity involved in the energy balance factor is clearly different from that of normal cells, it is highly likely to be used as a cancer diagnostic marker. Therefore, we investigated the possibility of implementing the diagnostic system for cancer metabolic disease by measuring the change of coenzyme concentration according to the metabolic activation of cancer cells. The sample of colon cancer, breast cancer tissue and surrounding tissue was obtained from the cancer center of Chonnam National University Hospital, After rapid freezing with nitrogen, it was disrupted by homogenizer, centrifuged, and the supernatant was recovered and used as a measurement sample. The target enzyme for measuring the activity of the tissue was 1 mM of the corresponding substrate and added at 37 to 10 mM for glucose-6-phosphate dehydrogenase (G6PDH), isocitrate dehydrogenase (IDH), lactate dehydrogenase (LDH) and NADH kinase Minute, and the changed coenzyme fluorescence value was measured using the coenzyme measurement method of the present invention. As a result, G6PDH showed higher activity in colorectal cancer tissue than that of normal colon tissue, indicating that there was a difference in glucose metabolism (Fig. 19A). On the other hand, LDH activity showed a negative value in the change of colorectal cancer tissue compared to normal colon tissue, and it was confirmed that lactate was involved in other metabolism of colon cancer (Fig. 19C). IDH showed high activity in all tissues except normal breast tissue. This suggests that IDH is highly active in the intestinal cells composed of muscle cells because of its large distribution in muscle cells, and that the activity of the breast cells with low IDH is low due to the relatively high number of adipocytes. However, the IDH enzyme activity was highly measured in breast cancer cells, thereby confirming the possibility as a marker for early diagnosis of breast cancer (Fig. 19). Therefore, it was confirmed that the application point can be extended to various cancer through establishment of early cancer diagnosis system through detection of coenzyme - dependent cancer metabolic marker enzyme. The coenzyme-dependent enzymes and cancer cells used in the experiments were used only to establish early cancer diagnostic systems and do not limit the applicable coenzyme-dependent enzymes and cancer cells. For example, the cancer cell may be any one selected from the group consisting of liver cancer, colon cancer, cervical cancer, kidney cancer, gastric cancer, prostate cancer, breast cancer, brain cancer, lung cancer, uterine cancer, colon cancer, bladder cancer, blood cancer and pancreatic cancer. In addition, applicable enzyme-dependent enzyme activity can be measured in various enzyme activities as in Example 13, in addition to the enzyme.

Enzymes dependent on coenzyme ( dehydrogenase  Wow 산화도 도  Series) from the library

The HTS (High Throughput Screening) system was established as a useful enzyme discovery search system using the coarse enzyme determination method of the present invention. More specifically, the entire genome (metagenome) in the environmental sample was extracted using a DNA extraction kit (genomic DNA isolation kit, promega), and partial cleavage was performed using Sau3A 1, which cleaves restriction enzymes BamH 1 or GATC. The library was constructed by introducing the cleaved DNA fragment into a typical cloning vector (pBluscript II SK) and introducing it into the E. coli host. Transformation was carried out by electrophoresis according to a typical procedure. The hosts having the prepared library were plated on LB solid medium containing 50 μl / ml of ampicillin and cultured for 16 hours at 37 ° C. The colonies were transferred to a 96-well plate having the same composition of 200 μl Incubate at 804 rpm with O ₂ (23%) at 37 for a fixed time (24 to 48 hr). After culturing, 100 μl of the strain cultured using a robot dispense and 2 × lysis solution (2 × lysis solution: 20 mM Tris, 0.2% (v / v) triton X-100, 0.05% (v / v) tween 20, pH 7.5) are mixed in a new well. (1 ~ 10 μM) and R2-mBFP (1 ~ 5 μM) were added to determine the amount of coenzyme, and the fluorescence And the amount of change of the coenzyme is calculated to select the sample whose enzyme activity has been confirmed. By repeating the above analysis method, the number of library clones is reduced.

As a preliminary experiment to be applied to the actual HTS system, L-arabitol dehydrogenase (L-arabitol dehydrogenase), which is a natural five-sugar alcohol, xylitol, 100 μl of the strain cultured using the robot dispensing method and 1 mM NAD + and 10 mM L-arabinose as the enzyme activity reagent were cultured using the above-described culture method using the genome library (soil in the vicinity of the final discharge outlet of Jeongeupseong sewage treatment plant, Jeonbuk Province) 100 占 퐇 of a 2X lysing solution (20 mM Tris, 0.2% (v / v) triton X-100, 0.05% (v / v) tween 20, pH 7.5) containing L-arabinose was added to a new well (30 min), and the amount of coenzyme was measured to confirm the activity of L-arabitol dehydrogenase enzyme. As a result, it was possible to easily and rapidly obtain a clone which increased more than the initial fluorescence value among 25,516 clones. Among them, samples with large fluorescence change were re-distributed in a 96 well plate and the amount of substrate was adjusted (0.5 mM NAD + , 2 mM L-arabitol) (FIG. 20A). The plasmids were isolated from the selected strains (plasmid DNA isolation kit, promega), and the presence of genes to be screened was checked by sequencing. , And selection of positive clones was confirmed at a ratio of 85% or more (Fig. 20B). The present invention includes, but is not limited to, suitable vectors, selectable markers, host cells, and methods for delivering into a host cell, which can be used for constructing library vectors as in the above embodiments.

In addition, after the library of the aforementioned procedures was restricted to a clone having an oxidizing / reducing enzyme family, specific compounds other than the substrate were added to the enzyme activity measurement procedure, and the change amount of the coenzyme was calculated, ), The active inhibitor can be selectively screened. This process involves culturing clones with related enzymatic activity, adding substrates and coenzyme, and then inducing the reaction in the presence of various compounds and quantifying the amount of coenzyme change. More specifically, a compound capable of acting as an activity inhibitor in an oxidoreductase reaction solution dependent on the coenzyme such as the above example was added to the reaction solution at a concentration (0.01 to 1 mM). During the course of the reaction, the amount of coenzyme produced by the addition of each compound was determined, and the degree of inhibition of the specific enzyme activity was confirmed by comparing the amount of coenzyme produced when the compound was added (test group) or not (control group) . After measuring the coenzyme generated (decrease) the reaction rate according to the change in concentration of the primary one selected compound, was calculated the IC ₅₀ value for each compound using the Sigma Plot program (sigma plot program), the result is shown in Table 6 . The above examples are designed with the aim of the reliability evaluation of the present invention, and the active inhibitor is included in the above examples, but not limited thereto.

Enzyme activity inhibitor concentration enzyme Inhibitor IC50 (uM) Isocitrate dehydrogenase Oxalomalic acid 68.26 + - 6.4 Methylisocitric acid 108.53 + - 8.5 Glucose-6-phosphate dehydrogenase Gallocatechin gallate 220.32 ± 32.1 Epicatechin gallate 245.24 + - 36.6 pyruvate dehydrogenase CPI-613 14.3 ± 2.5 Aldehyde dehydrogenase Disulfiram 0.21 ± 0.05 Lactate dehydrogenase Oxamate 621 ± 15.5 HMG-CoA reductase Pravastatin 0.09 ± 0.01 Inosine dehydrogenase Mycophenolate Mofetil 0.05 ± 0.005 L-Alanine dehydrogenase Methacrylate 895 ± 51 Succinate dehydrogenase Methylmalonate 682 ± 75 ^a : ± is the standard deviation

Coenzyme and Coenzyme-Dependent Useful Enzymes ( dehydrogenase  Wow 산화도 도 ) Establishment of active measurement kit formulation

Using the rapid / accurate coarse assay method of the present invention, a kit formulation capable of measuring the site / autologous enzyme activity without further pretreatment was established. More specifically, it was experimentally examined whether the coupling enzyme and the R2-mBFP were dried and rehydrated again in order to apply to the formulation other than the solution formulation of the present invention. The purified proteins were mixed with buffer solution (50 mM Tris, 0.1 to 1.5 M NaCl, pH 7.5) having different salt concentrations using a dialysis tubing membrane for 4 days, After 1 week of lyophilization and refrigerated drying, moisture was removed from each sample. After 1 week, salt-free buffer solution (50 mM Tris, pH 7.5) was added to hydrate the proteins to measure their activity. As a result, the proteins dried with the buffer solution containing 0.2 M NaCl were well hydrated (FIG. 21A) and similar to the pre-drying activity (FIG. 21B). In order to establish a mass spectrometry formulation, a reaction reagent (50 mM tris, 200 mM NaCl, 1 mM target enzyme substrate, coenzyme of 0.5 mM target enzyme, 0.5 mM coupling enzyme substrate, 0.3 mM ATP , 0.25 mM MgCl ₂ , 10 μM coupling enzyme, 10 μM R 2 -mBFP, 0.1% (v / v) triton X-100, pH 7.5) were placed in a 96-well plate and refrigerated and dried for one week, Enzyme was added to measure the activity. As an example of a typical reaction, enzymatic activity measurement reaction reagent was dried after measuring the activity of pyruvate dehydrogenase enzyme by adding enzyme. As a result, it was confirmed that the enzyme activity could be measured with a fluorescence value changed with time, and in particular, it was measured reproducibly even at a low concentration (0.01 mU) at which activity can not be confirmed by a general fluorescence measurement method (FIG. These dry formulations are easy to store and transport and are convenient to carry, so they can be used as a metabolic / disease diagnosis system using enzyme-dependent enzyme activity. For example, G6PDH activity can be used for G6PDH deficiency, malaria treatment, and cytological hemolytic disease diagnosis kit. In addition, G6PDH deficiency is a hereditary disease, and NADP is not reduced to NADPH, so that the molecular reduction of glutakin is also reduced, leading to hemolysis of red blood cells, which develops as acute anemia. It is possible to perform a quick and easy diagnosis by quantitative analysis of the coenzyme in blood without performing the test (including the immune reaction test).

In addition, coenzyme was measured by introducing test strips (test strips) to improve the portability of diagnostic formulations and enable field diagnosis. More specifically, an enzyme activity measuring reaction reagent containing the coupling enzyme and the R2-mBFP is immobilized on a test strip (test strip) test line, and an aqueous liquid sample flow is induced by capillary phenomenon through a porous membrane Fluorescence values were measured by reducing the enzymatic activity error by polymer (red blood cell, protein, etc.). Results similar to the measured enzyme activity were obtained (FIG. 21D), which has the advantages of small sample requirements, portability, and cost-effective performance.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Composition and method for measuring NAD (H) and uses thereof <130> P16021540323 <160> 36 <170> KoPatentin 3.0 <210> 1 <211> 747 <212> DNA <213> Unknown <220> <223> metagenome-derived blue fluorescent protein mBFP DNA seq <400> 1 atgcagaatc tgaacggcaa agtggctttc gtgaccggcg gcagccgcgg catcggcgcg 60 gcgatcgtcc gccgcttggc ggcggacggc gccgacatcg cgttcaccta tgtcagcgcc 120 tcgtcgaaaa acgtggccac cgccctggtg caagaactcg aggccaaggg ccgccgcgct 180 cgcgccatcc aggcggactc ggcggatccg gcccaggtgc ggcaggcggt cgagcaggcc 240 atcgtgcaac tggggccggt ggacgtgctg gtgaacaacg ccggcatctt cctggccggc 300 cccttgggcg aggtgacgct ggacgactac gaacgcacga tgaacatcaa tgtgcgcgcg 360 cctttcgtgg ccatccaggc cgcgcaggcc tcgatgccgg acggcggccg catcatcaac 420 atcggcagct gcctggcgga acgcgccggc cgagccgggg taacgctgta tgccgccagc 480 aagtcggcgc tgctgggcat gacgcgcggc ctggcgcgcg acctgggcgc gcgcggcatc 540 accgccaacg tcgtgcaccc gggcccgatc gacaccgaca tgaatcccgc agatggcgaa 600 cgctcgggcg aactggtggc cgtgctgtcc ttgcctcatt acggcgaggt gcgcgacatc 660 gccggcatgg tggctttcct ggccgggccg gatgggcgct acgtgaccgg tgcgagtctg 720 gcggtggacg gcggcttcgc cgcttga 747 <210> 2 <211> 765 <212> DNA <213> Unknown <220> <223> Metagenome-derived blue fluorescent protein R1-mBFP DNA seq <400> 2 atgctccggc gaggttgctt gcagaatctg aacggcaaag tggctttcgt gaccggcggc 60 agccgcggca tcggcgcggc gatcgtccgc cgcttggcgg cggacggcgc cgacatcgcg 120 ttcacctatg tcagcgcctc gtcgaaaaac gtggccaccg ccctggtgca agaactcgag 180 gccaagggcc gccgcgctcg cgccatccag gcggactcgg cggatccggc ccaggtgcgg 240 caggcggtcg agcaggccat cgtgcaactg gggccggtgg acgtgctggt gaacaacgcc 300 ggcatcttcc tggccggccc cttgggcgag gtgacgctgg acgactacga acgcacgatg 360 aacatcaatg tgcgcgcgcc tttcgtggcc atccaggccg cgcaggcctc gatgccggac 420 ggcggccgca tcatcaacat cggcagctgc ctggcggaac gcgccggccg agccggggta 480 acgctgtatg ccgccagcaa gtcggcgctg ctgggcatga cgcgcggcct ggcgcgcgac 540 ctgggcgcgc gcggcatcac cgccaacgtc gtgcacccgg gcccgatcga caccgacatg 600 aatcccgcag atggcgaacg ctcgggcgaa ctggtggccg tgctgtcctt gcctcattac 660 ggcgaggtgc gcgacatcgc cggcatggtg gctttcctgg ccgggccgga tgggcgctac 720 gtgaccggtg cgagtctggc ggtggacggc ggcttcgccg cttga 765 <210> 3 <211> 765 <212> DNA <213> Unknown <220> Metagenome-derived blue fluorescent protein R2-mBFP DNA seq <400> 3 atgcatggtc gagtacacac gcagaatctg aacggcaaag tggctttcgt gaccggcggc 60 agccgcggca tcggcgcggc gatcgtccgc cgcttggcgg cggacggcgc cgacatcgcg 120 ttcacctatg tcagcgcctc gtcgaaaaac gtggccaccg ccctggtgca agaactcgag 180 gccaagggcc gccgcgctcg cgccatccag gcggactcgg cggatccggc ccaggtgcgg 240 caggcggtcg agcaggccat cgtgcaactg gggccggtgg acgtgctggt gaacaacgcc 300 ggcatcttcc tggccggccc cttgggcgag gtgacgctgg acgactacga acgcacgatg 360 aacatcaatg tgcgcgcgcc tttcgtggcc atccaggccg cgcaggcctc gatgccggac 420 ggcggccgca tcatcaacat cggcagctgc ctggcggaac gcgccggccg agccggggta 480 acgctgtatg ccgccagcaa gtcggcgctg ctgggcatga cgcgcggcct ggcgcgcgac 540 ctgggcgcgc gcggcatcac cgccaacgtc gtgcacccgg gcccgatcga caccgacatg 600 aatcccgcag atggcgaacg ctcgggcgaa ctggtggccg tgctgtcctt gcctcattac 660 ggcgaggtgc gcgacatcgc cggcatggtg gctttcctgg ccgggccgga tgggcgctac 720 gtgaccggtg cgagtctggc ggtggacggc ggcttcgccg cttga 765 <210> 4 <211> 768 <212> DNA <213> Unknown <220> Metagenome-derived blue fluorescent protein R3-mBFP DNA seq <400> 4 atgcaattgc tcgataaggt atgccagaat ctgaacggca aagtggcttt cgtgaccggc 60 ggcagccgcg gcatcggcgc ggcgatcgtc cgccgcttgg cggcggacgg cgccgacatc 120 gcgttcacct atgtcagcgc ctcgtcgaaa aacgtggcca ccgccctggt gcaagaactc 180 gaggccaagg gccgccgcgc tcgcgccatc caggcggact cggcggatcc ggcccaggtg 240 cggcaggcgg tcgagcaggc catcgtgcaa ctggggccgg tggacgtgct ggtgaacaac 300 gccggcatct tcctggccgg ccccttgggc gaggtgacgc tggacgacta cgaacgcacg 360 atgaacatca atgtgcgcgc gcctttcgtg gccatccagg ccgcgcaggc ctcgatgccg 420 gacggcggcc gcatcatcaa catcggcagc tgcctggcgg aacgcgccgg ccgagccggg 480 gtaacgctgt atgccgccag caagtcggcg ctgctgggca tgacgcgcgg cctggcgcgc 540 gacctgggcg cgcgcggcat caccgccaac gtcgtgcacc cgggcccgat cgacaccgac 600 atgaatcccg cagatggcga acgctcgggc gaactggtgg ccgtgctgtc cttgcctcat 660 tcggcgagg tgcgcgacat cgccggcatg gtggctttcc tggccgggcc ggatgggcgc 720 tacgtgaccg gtgcgagtct ggcggtggac ggcggcttcg ccgcttga 768 <210> 5 <211> 771 <212> DNA <213> Unknown <220> Metagenome-derived blue fluorescent protein R4-mBFP DNA seq <400> 5 atgagcgatc ggcaactccg atatacgcag aatctgaacg gcaaagtggc tttcgtgacc 60 ggcggcagcc gcggcatcgg cgcggcgatc gtccgccgct tggcggcgga cggcgccgac 120 atcgcgttca cctatgtcag cgcctcgtcg aaaaacgtgg ccaccgccct ggtgcaagaa 180 ctcgaggcca agggccgccg cgctcgcgcc atccaggcgg actcggcgga tccggcccag 240 gtgcggcagg cggtcgagca ggccatcgtg caactggggc cggtggacgt gctggtgaac 300 aacgccggca tcttcctggc cggccccttg ggcgaggtga cgctggacga ctacgaacgc 360 acgatgaaca tcaatgtgcg cgcgcctttc gtggccatcc aggccgcgca ggcctcgatg 420 ccggacggcg gccgcatcat caacatcggc agctgcctgg cggaacgcgc cggccgagcc 480 ggggtaacgc tgtatgccgc cagcaagtcg gcgctgctgg gcatgacgcg cggcctggcg 540 cgcgacctgg gcgcgcgcgg catcaccgcc aacgtcgtgc acccgggccc gatcgacacc 600 gacatgaatc ccgcagatgg cgaacgctcg ggcgaactgg tggccgtgct gtccttgcct 660 cattacggcg aggtgcgcga catcgccggc atggtggctt tcctggccgg gccggatggg 720 cgctacgtga ccggtgcgag tctggcggtg gacggcggct tcgccgcttg a 771 <210> 6 <211> 777 <212> DNA <213> Unknown <220> <223> Metagenome-derived blue fluorescent protein R5-mBFP DNA seq <400> 6 atgacggagc atggtcggct ccacgcactc cggcagaatc tgaacggcaa agtggctttc 60 gtgaccggcg gcagccgcgg catcggcgcg gcgatcgtcc gccgcttggc ggcggacggc 120 gccgacatcg cgttcaccta tgtcagcgcc tcgtcgaaaa acgtggccac cgccctggtg 180 caagaactcg aggccaaggg ccgccgcgct cgcgccatcc aggcggactc ggcggatccg 240 gcccaggtgc ggcaggcggt cgagcaggcc atcgtgcaac tggggccggt ggacgtgctg 300 gtgaacaacg ccggcatctt cctggccggc cccttgggcg aggtgacgct ggacgactac 360 gaacgcacga tgaacatcaa tgtgcgcgcg cctttcgtgg ccatccaggc cgcgcaggcc 420 tcgatgccgg acggcggccg catcatcaac atcggcagct gcctggcgga acgcgccggc 480 cgagccgggg taacgctgta tgccgccagc aagtcggcgc tgctgggcat gacgcgcggc 540 ctggcgcgcg acctgggcgc gcgcggcatc accgccaacg tcgtgcaccc gggcccgatc 600 gacaccgaca tgaatcccgc agatggcgaa cgctcgggcg aactggtggc cgtgctgtcc 660 ttgcctcatt acggcgaggt gcgcgacatc gccggcatgg tggctttcct ggccgggccg 720 gatgggcgct acgtgaccgg tgcgagtctg gcggtggacg gcggcttcgc cgcttga 777 <210> 7 <211> 777 <212> DNA <213> Unknown <220> <223> Metagenome-derived blue fluorescent protein R6-mBFP DNA seq <400> 7 atggagccta gctcgctcca acggcaatgc tcgcagaatc tgaacggcaa agtggctttc 60 gtgaccggcg gcagccgcgg catcggcgcg gcgatcgtcc gccgcttggc ggcggacggc 120 gccgacatcg cgttcaccta tgtcagcgcc tcgtcgaaaa acgtggccac cgccctggtg 180 caagaactcg aggccaaggg ccgccgcgct cgcgccatcc aggcggactc ggcggatccg 240 gcccaggtgc ggcaggcggt cgagcaggcc atcgtgcaac tggggccggt ggacgtgctg 300 gtgaacaacg ccggcatctt cctggccggc cccttgggcg aggtgacgct ggacgactac 360 gaacgcacga tgaacatcaa tgtgcgcgcg cctttcgtgg ccatccaggc cgcgcaggcc 420 tcgatgccgg acggcggccg catcatcaac atcggcagct gcctggcgga acgcgccggc 480 cgagccgggg taacgctgta tgccgccagc aagtcggcgc tgctgggcat gacgcgcggc 540 ctggcgcgcg acctgggcgc gcgcggcatc accgccaacg tcgtgcaccc gggcccgatc 600 gacaccgaca tgaatcccgc agatggcgaa cgctcgggcg aactggtggc cgtgctgtcc 660 ttgcctcatt acggcgaggt gcgcgacatc gccggcatgg tggctttcct ggccgggccg 720 gatgggcgct acgtgaccgg tgcgagtctg gcggtggacg gcggcttcgc cgcttga 777 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> R1-mBFP ramp-tag seq <400> 8 ctccggcgag gttgcttg 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> R2-mBFP ramp-tag seq <400> 9 catggtcgag tacacacg 18 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <213> R3-mBFP ramp-tag seq <400> 10 caattgctcg ataaggtatg c 21 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> R4-mBFP ramp-tag seq <400> 11 agcgatcggc aactccgata tacg 24 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> R5-mBFP ramp-tag seq <400> 12 acggagcatg gtcggctcca cgcactccgg 30 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R6-mBFP ramp-tag seq <400> 13 tggagcctag ctcgctccaa cggcaatgct cg 32 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mBFP-forward primer <400> 14 atagcatgcc agaatctgaa cg 22 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mBFP-reverse primer <400> 15 ataaagcttt caagcggcga agccg 25 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> ppnk-forward primer <400> 16 atacccgggg actgcaccca cgaacgct 28 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> ppnk-reverse primer <400> 17 ataaagcttt taccccgctg acctgg 26 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mfnk-forward primer <400> 18 ataggatccc cctacacccc cggac 25 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> mfnk-reverse primer <400> 19 ataaagcttt tagttcgacg acgtcggga 29 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> zwf-forward primer <400> 20 ataggatccg cggtaacgca aacag 25 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> zwf-reverse primer <400> 21 ataaagcttc tcaaactcat tcca 24 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> mBFP-forward primer2 <400> 22 atacatatga gaggatcgca tcacca 26 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mBFP-reverse primer2 <400> 23 ataagctttt aagcggcgaa gccgccg 27 <210> 24 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ppnk-forward primer2 <400> 24 atacatatga ctgcacccac gaacgct 27 <210> 25 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ppnk-reverse primer2 <400> 25 ataaagcttc cccgctgacc tggg 24 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> mfnk-forward primer2 <400> 26 atacatatgc cctacacccc cggac 25 <210> 27 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> mfnk-reverse primer2 <400> 27 ataaagcttg ttcgacgacg tcgggac 27 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> zwf-forward primer2 <400> 28 atacatatgg cggtaacgca aacag 25 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> zwf-reverse primer2 <400> 29 ataaagcttc tcaaactcat tcca 24 <210> 30 <211> 248 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein mBFP PRT seq <400> 30 Met Gln Asn Leu Asn Gly Lys Val Ala Phe Val Thr Gly Gly Ser Arg   1 5 10 15 Gly Ile Gly Ala Ala Ile Val Arg Arg Leu Ala Ala Asp Gly Ala Asp              20 25 30 Ile Ala Phe Thr Tyr Val Ser Ala Ser Ser Lys Asn Val Ala Thr Ala          35 40 45 Leu Val Gln Glu Leu Glu Ala Lys Gly Arg Arg Ala Arg Ala Ile Gln      50 55 60 Ala Asp Ser Ala Asp Pro Ala Gln Val Arg Gln Ala Val Glu Gln Ala  65 70 75 80 Ile Val Gln Leu Gly Pro Val Asp Val Leu Val Asn Asn Ala Gly Ile                  85 90 95 Phe Leu Ala Gly Pro Leu Gly Glu Val Thr Leu Asp Asp Tyr Glu Arg             100 105 110 Thr Met Asn Ile Asn Val Arg Ala Pro Phe Val Ala Ile Gln Ala Ala         115 120 125 Gln Ala Ser Met Pro Asp Gly Gly Arg Ile Ile Asn Ile Gly Ser Cys     130 135 140 Leu Ala Glu Arg Ala Gly Arg Ala Gly Val Thr Leu Tyr Ala Ala Ser 145 150 155 160 Lys Ser Ala Leu Leu Gly Met Thr Arg Gly Leu Ala Arg Asp Leu Gly                 165 170 175 Ala Arg Gly Ile Thr Ala Asn Val Val His Pro Gly Pro Ile Asp Thr             180 185 190 Asp Met Asn Pro Ala Asp Gly Glu Arg Ser Gly Glu Leu Val Ala Val         195 200 205 Leu Ser Leu Pro His Tyr Gly Glu Val Arg Asp Ile Ala Gly Met Val     210 215 220 Ala Phe Leu Ala Gly As Asp Gly As Tyr Val Thr Gly Ala Ser Leu 225 230 235 240 Ala Val Asp Gly Gly Phe Ala Ala                 245 <210> 31 <211> 254 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein R1-mBFP PRT seq <400> 31 Met Leu Arg Arg Gly Cys Leu Gln Asn Leu Asn Gly Lys Val Ala Phe   1 5 10 15 Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ile Val Arg Arg Leu              20 25 30 Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val Ser Ala Ser Ser          35 40 45 Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu Ala Lys Gly Arg      50 55 60 Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro Ala Gln Val Arg  65 70 75 80 Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro Val Asp Val Leu                  85 90 95 Val Asn Asn Aly Gly Ile Phe Leu Ala Gly Pro Leu Gly Glu Val Thr             100 105 110 Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val Arg Ala Pro Phe         115 120 125 Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp Gly Gly Arg Ile     130 135 140 Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly Arg Ala Gly Val 145 150 155 160 Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly Met Thr Arg Gly                 165 170 175 Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala Asn Val Val His             180 185 190 Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp Gly Glu Arg Ser         195 200 205 Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr Gly Glu Val Arg     210 215 220 Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro Asp Gly Arg Tyr 225 230 235 240 Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe Ala Ala                 245 250 <210> 32 <211> 254 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein R2-mBFP PRT seq <400> 32 Met His Gly Arg Val His Thr Gln Asn Leu Asn Gly Lys Val Ala Phe   1 5 10 15 Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ile Val Arg Arg Leu              20 25 30 Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val Ser Ala Ser Ser          35 40 45 Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu Ala Lys Gly Arg      50 55 60 Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro Ala Gln Val Arg  65 70 75 80 Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro Val Asp Val Leu                  85 90 95 Val Asn Asn Aly Gly Ile Phe Leu Ala Gly Pro Leu Gly Glu Val Thr             100 105 110 Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val Arg Ala Pro Phe         115 120 125 Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp Gly Gly Arg Ile     130 135 140 Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly Arg Ala Gly Val 145 150 155 160 Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly Met Thr Arg Gly                 165 170 175 Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala Asn Val Val His             180 185 190 Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp Gly Glu Arg Ser         195 200 205 Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr Gly Glu Val Arg     210 215 220 Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro Asp Gly Arg Tyr 225 230 235 240 Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe Ala Ala                 245 250 <210> 33 <211> 255 <212> PRT <213> Unknown <220> Metagenome-derived blue fluorescent protein R3-mBFP PRT seq <400> 33 Met Gln Leu Leu Asp Lys Val Cys Gln Asn Leu Asn Gly Lys Val Ala   1 5 10 15 Phe Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ala Ile Val Arg Arg              20 25 30 Leu Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val Ser Ala Ser          35 40 45 Ser Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu Ala Lys Gly      50 55 60 Arg Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro Ala Gln Val  65 70 75 80 Arg Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro Val Asp Val                  85 90 95 Leu Val Asn Ale Gly Ile Phe Leu Ala Gly Pro Leu Gly Glu Val             100 105 110 Thr Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val Arg Ala Pro         115 120 125 Phe Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp Gly Gly Arg     130 135 140 Ile Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly Arg Ala Gly 145 150 155 160 Val Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly Met Thr Arg                 165 170 175 Gly Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala Asn Val Val             180 185 190 His Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp Gly Glu Arg         195 200 205 Ser Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr Gly Glu Val     210 215 220 Arg Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro Asp Gly Arg 225 230 235 240 Tyr Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe Ala Ala                 245 250 255 <210> 34 <211> 256 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein R4-mBFP PRT seq <400> 34 Met Ser Asp Arg Gln Leu Arg Tyr Thr Gln Asn Leu Asn Gly Lys Val   1 5 10 15 Ala Phe Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ala Ile Val Arg              20 25 30 Arg Leu Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val Ser Ala          35 40 45 Ser Ser Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu Ala Lys      50 55 60 Gly Arg Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro Ala Gln  65 70 75 80 Val Arg Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro Val Asp                  85 90 95 Val Leu Val Asn Ale Gly Ile Phe Leu Ala Gly Pro Leu Gly Glu             100 105 110 Val Thr Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val Arg Ala         115 120 125 Pro Phe Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp Gly Gly     130 135 140 Arg Ile Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly Arg Ala 145 150 155 160 Gly Val Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly Met Thr                 165 170 175 Arg Gly Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala Asn Val             180 185 190 Val His Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp Gly Glu         195 200 205 Arg Ser Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr Gly Glu     210 215 220 Val Arg Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro Asp Gly 225 230 235 240 Arg Tyr Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe Ala Ala                 245 250 255 <210> 35 <211> 258 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein R5-mBFP PRT seq <400> 35 Met Thr Glu His Gly Arg Leu His Ala Leu Arg Gln Asn Leu Asn Gly   1 5 10 15 Lys Val Ala Phe Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ala Ile              20 25 30 Val Arg Arg Leu Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val          35 40 45 Ser Ala Ser Ser Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu      50 55 60 Ala Lys Gly Arg Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro  65 70 75 80 Ala Gln Val Arg Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro                  85 90 95 Val Asp Val Leu Val Asn Ale Gly Ile Phe Leu Ala Gly Pro Leu             100 105 110 Gly Glu Val Thr Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val         115 120 125 Arg Ala Pro Phe Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp     130 135 140 Gly Gly Arg Ile Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly 145 150 155 160 Arg Ala Gly Val Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly                 165 170 175 Met Thr Arg Gly Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala             180 185 190 Asn Val Val His Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp         195 200 205 Gly Glu Arg Ser Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr     210 215 220 Gly Glu Val Arg Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro 225 230 235 240 Asp Gly Arg Tyr Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe                 245 250 255 Ala Ala         <210> 36 <211> 258 <212> PRT <213> Unknown <220> <223> metagenome-derived blue fluorescent protein R6-mBFP PRT seq <400> 36 Met Glu Pro Ser Ser Leu Gln Arg Gln Cys Ser Gln Asn Leu Asn Gly   1 5 10 15 Lys Val Ala Phe Val Thr Gly Gly Ser Arg Gly Ile Gly Ala Ala Ile              20 25 30 Val Arg Arg Leu Ala Ala Asp Gly Ala Asp Ile Ala Phe Thr Tyr Val          35 40 45 Ser Ala Ser Ser Lys Asn Val Ala Thr Ala Leu Val Gln Glu Leu Glu      50 55 60 Ala Lys Gly Arg Arg Ala Arg Ala Ile Gln Ala Asp Ser Ala Asp Pro  65 70 75 80 Ala Gln Val Arg Gln Ala Val Glu Gln Ala Ile Val Gln Leu Gly Pro                  85 90 95 Val Asp Val Leu Val Asn Ale Gly Ile Phe Leu Ala Gly Pro Leu             100 105 110 Gly Glu Val Thr Leu Asp Asp Tyr Glu Arg Thr Met Asn Ile Asn Val         115 120 125 Arg Ala Pro Phe Val Ala Ile Gln Ala Ala Gln Ala Ser Met Pro Asp     130 135 140 Gly Gly Arg Ile Ile Asn Ile Gly Ser Cys Leu Ala Glu Arg Ala Gly 145 150 155 160 Arg Ala Gly Val Thr Leu Tyr Ala Ala Ser Lys Ser Ala Leu Leu Gly                 165 170 175 Met Thr Arg Gly Leu Ala Arg Asp Leu Gly Ala Arg Gly Ile Thr Ala             180 185 190 Asn Val Val His Pro Gly Pro Ile Asp Thr Asp Met Asn Pro Ala Asp         195 200 205 Gly Glu Arg Ser Gly Glu Leu Val Ala Val Leu Ser Leu Pro His Tyr     210 215 220 Gly Glu Val Arg Asp Ile Ala Gly Met Val Ala Phe Leu Ala Gly Pro 225 230 235 240 Asp Gly Arg Tyr Val Thr Gly Ala Ser Leu Ala Val Asp Gly Gly Phe                 245 250 255 Ala Ala        

Claims (11)

A composition for quantifying human NADP (H) comprising a mutant of metagenome-derived blue fluorescent protein (mBFP) comprising SEQ ID NO: 32.
One or more enzymes selected from the group consisting of NAD (H) -dependent oxidase / reductase, NAD (H) phosphorylase and NADP (H) (H) or NAD (H).
3. The method of claim 2,
A kit further comprising a surfactant and a metal ion.
The method of claim 3,
The metal ions ^{Li +, Hg 2 +, Co} 2 +, Mg 2 +, Mn 2 +, Zn 2 +, K +, Ca 2 +, Al 3 +, Fe 3 +, Fe 2 +, Ag 3+, Ni ^2+, Pb ^2+, and one or more metal ions, the kit is selected from the group consisting of Cu ^2+.
A biomarker composition for the diagnosis of colorectal cancer or breast cancer by measuring NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylating enzyme or NADP (H)
NADP (H) or NAD (H) and;
32. A biomarker composition for colon cancer or breast cancer, comprising a variant of metagenome-derived blue fluorescent protein (mBFP) comprising SEQ ID NO: 32.
One or more enzymes selected from the group consisting of NAD (H) -dependent oxidase / reductase, NAD (H) phosphorylase and NADP (H) (H) or NAD (H) by adding a mutant of NADP (H) to the sample and measuring fluorescence change.
a) liberating a variant of mBFP (metagenome-derived blue fluorescent protein) of SEQ ID NO: 32 as a monomer; And b) adding to the sample at least one enzyme selected from the group consisting of NAD (H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylating enzyme and NADP (H) And determining the NADP (H) or NAD (H) concentration of the sample by measuring fluorescence changes.
8. The method of claim 7,
A method for quantifying NADP (H) or NAD (H) in which a metal ion is further added in the step b).
9. The method of claim 8,
The metal ions ^{Li +, Hg 2 +, Co} 2 +, Mg 2 +, Mn 2 +, Zn 2 +, K +, Ca 2 +, Al 3 +, Fe 3 +, Fe 2 +, Ag 3+, (H) or NAD (H) which is at least one metal ion selected from the group consisting of Ni ^{2 +} , Pb ^{2 +} and Cu ^{2 +} .
NADP (H) or NAD (H); And
(H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylase, which is contained in the sample by adding a mutant of metagenome-derived blue fluorescent protein (mBFP) of SEQ ID NO: 32 to the sample and measuring fluorescence change And NADP (H) -dependent oxidizing / reducing enzymes.
NAD (H) or NADP (H); And
(H) -dependent oxidizing / reducing enzyme, NAD (H) phosphorylase, which is contained in the sample by adding a mutant of metagenome-derived blue fluorescent protein (mBFP) of SEQ ID NO: 32 to the sample and measuring fluorescence change And NADP (H) -dependent oxidizing / reducing enzymes.

Images