KR101754490B1 - Marker composition for diagnosing asthama, kit for diagnosing asthama and method of providing data for diagnosising asthama - Google Patents

Abstract

The present invention provides an asthma diagnostic marker composition comprising a detection reagent for Claudin-4 (CLDN4), an asthma diagnostic kit containing the same, an information providing method for asthma diagnosis, and a screening method for asthma treatment or preventive active substance Which is useful for diagnosing asthma.

Description

TECHNICAL FIELD [0001] The present invention relates to a marker composition for asthma diagnosis, an asthma diagnostic kit containing the same, and a method for providing information for asthma diagnosis. BACKGROUND ART < RTI ID = 0.0 &

The present invention relates to a marker composition for asthma diagnosis.

Asthma is a chronic inflammatory disease that affects 300 million people worldwide. Symptoms of asthma include intermittent airway destruction, airway hyperresponsiveness (AHR), and reduced pulmonary function due to chronic airway inflammation and concomitant structural changes in the airway wall. Airway epithelium is continually exposed to a wide range of environmental substances including airborne dust, toxic gases such as gas and particles from automobile exhaust, tobacco smoke, pollen, animal dander and pathogens, and artificial and natural particles . A fully differentiated caudate mucosal ciliated epithelium and bronchial epithelium that protects the internal environment of the lungs from them by forming chemical barriers associated with the secretion of mucous and physical barriers associated with adhesive complexes that hold inhaled particles. It can be cleaned by an escalator. Bronchial epithelium, such as the initial cells in contact with the environment, plays an important role in immune surveillance in the presence of pathogens or other dangerous signals, leading to proper activation of immune effector cells and antigen presenting cells.

Claudin is a tight protein that controls the secondary cellular permeability of the epithelium and endothelium. Cladin4 (CLDN4) is reported to be one of the three major cladins expressed in pulmonary alveolar epithelial cells that function as a secondary cellular sodium barrier. However, the possible role of CLDN4 in bronchial asthma has not been studied yet.

1. Harkness LM, Ashton AW, Burgess JK. Pharmacol Ther. 2014 Nov 20. pii: S0163-7258 (14) 00210-1. 2. Ebina, M., Yaegashi, H., Chiba, R., Takahashi, T., Motomiya, M., & Tanemura, M. (1990).

Disclosure of Invention Technical Problem [8] The present invention provides a marker composition for detecting asthma including Claudin-4 (CLDN4) detection reagent, an asthma diagnostic kit containing the same, and a method for providing information for asthma diagnosis.

As means for solving the above problems, one embodiment of the present invention provides an asthma diagnostic marker composition comprising a detection reagent of Claudin-4 (CLDN4).

In one embodiment of the present disclosure, the detection reagent is capable of detecting the expression of the claudin 4 at the nucleic acid or protein level.

In one embodiment of the present disclosure, the detection at the nucleic acid level is performed using reverse transcription polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time RT-PCR, And may be one or more selected from the group consisting of RNase protection assay (RPA), Northern blotting and DNA chips.

In one embodiment of the present disclosure, the detection at the protein level comprises at least one selected from the group consisting of monoclonal antibody, polyclonal antibody, substrate, aptamer, receptor, ligand, cofactor and mass spectrometry detection reagent May include.

The asthma diagnostic marker composition may be a marker composition for asthma severity diagnosis.

One embodiment of the present disclosure provides an asthma diagnostic kit comprising the composition.

In one embodiment of the present disclosure, the kit comprises a T-PCR kit, a microarray chip kit, a biosensor, a DNA chip, an RNA chip, a protein chip, a cell chip, an immunoassay kit, an immunochromatography kit, Kit, an ELISA kit, or an immunological dot kit.

One embodiment of the present disclosure is directed to a method of detecting a protein comprising: (a) determining the level of expression of Claudin-4 (CLDN4) from a biological sample; And (b) comparing the expression level of the claudin 4 with a clodin4 expression level of a normal control sample.

In one embodiment of the present disclosure, the step of measuring the level of expression of claudin 4 may be at a nucleic acid or protein level.

In one embodiment of the present invention, the method for measuring the level of nucleic acid expression is selected from the group consisting of RT-PCR, Competitive RT-PCR, Realtime RT-PCR, , RNase protection assay (RPA), northern blotting, and DNA chip.

In one embodiment of the present invention, the method for measuring the expression level of the protein may be Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), and Protein Chip Protein (FACS) were used for immunoassay, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, chip) may be used.

In one embodiment of the present disclosure, the biological sample may be whole blood, serum, plasma, saliva, urine, sputum, lymph fluid or cell separated from a specimen.

In one embodiment of the present disclosure, the method of screening for an asthma treatment or prophylactic active comprises the step of ascertaining whether or not it modulates clad4 protein expression in alveolar epithelial cells.

The asthma treatment or prophylactic active substance may be a substance that inhibits or inhibits overexpression of clodin4 protein in alveolar epithelial cells.

Since the claudin 4 can serve as a marker for asthma diagnosis and asthma progression, the marker composition, diagnostic kit and information providing method of the present invention are useful for diagnosing asthma and its degree of severity. It is also useful as a drug screening target for asthma treatment.

Figure 1 shows plasma CLO4 levels between the steady state (STA) and the exacerbated state (EXA) of asthmatic patients.
Figure 2 shows the relationship between levels of plasma clad4 (CLDN4) and pulmonary function (FEV1 pred.) In asthmatic patients.
FIG. 3 shows the relationship between plasma level 4 (CLDN4) level and pulmonary function (FEV1 / FVC) in asthmatic patients.
FIG. 4 shows the relationship between CLD4 levels and eosinophils in asthmatic patients.
FIG. 5 shows the relationship between CLD4 level and total IgE in asthmatic patients.
Figure 6 shows AHR in ovalbumin (OVA) sensitized and challenged mice.
Figure 7 shows the inflammatory response in mice sensitized and challenged with ovalbumin (OVA).
Figure 8 shows cytokines in ovalbumin (OVA) sensitized and challenged mice.
Figure 9 shows that the integration of tight junction protein cludin 4 (CLDN4) in mice sensitized and challenged with lung gall bladder (OVA) was destroyed.
Figure 10 shows the expression of CLDN4.
Figure 11 shows the increase in CLDN4 transcript in the lung of OVA mice.
Figure 12 shows that CLDN4 protein levels detected by western blot in the lungs of OVA mice are increased.
Figure 13 shows CLDN4 protein determined by Western blot in NHBE treated with control or Der p1.
Figure 14 shows Der p1 in which the transmembrane endothelial electrical resistance (TEER) in the NHBE is reduced compared to the control.

Hereinafter, the present specification will be described in more detail.

As used herein, the term "diagnosis" is intended to include determining one object for a particular disease or disorder, i.e., the susceptibility of a test subject, determining whether an object currently has a particular disease or disorder, (E.g., identifying an asthmatic state, determining the stage of asthma) of an object that is caught in the body.

In the present specification, the term "diagnostic marker, marker for diagnosis or diagnostic marker" refers to a substance capable of distinguishing astrogenic individuals, tissues or cells from normal cells, It is a substance that shows an aspect. Therefore, it includes organic biomolecules such as polypeptides or nucleic acids (e.g., mRNA), lipids, glycolipids, glycoproteins or sugars (monosaccharides, disaccharides, oligosaccharides, etc.) which show an increase or decrease in the asthmatic group as compared with the normal control group do. The marker for diagnosing asthma is a clodin4 gene and a protein encoded by the gene, which express a specific high level in the tissue of the asthmatic group as compared with the tissue of the normal control group.

The "detection" includes both quantitative detection and detection at the level of presence, and can be an indicator of the onset and progression of asthma and can be used for diagnosis, progression of disease, diagnosis or prognosis of disease.

The detection also includes quantitative and / or qualitative analysis, including detection of presence, absence and expression level detection, which methods are well known in the art and can be performed using detection reagents as described below And those skilled in the art will be able to select the appropriate method for the practice of the present application.

In one embodiment of the present invention, the detection reagent contained in the composition is a substance capable of detecting the determination of Claudin 4 quantitatively or in the presence of nucleic acid, for example, DNA or mRNA level or protein level.

The term "nucleic acid" refers to deoxyribonucleotides (DNA) or ribonucleotides (RNA) in single- or double-stranded form. The term encompasses nucleic acids containing known analogs of natural nucleotides. The term nucleic acid is used interchangeably with genes, DNA, RNA, cDNA, mRNA, oligonucleotide primers, probes and amplification products. The term also includes DNA backbone analogues such as, for example, phosphodiester, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, alkylphosphotriesters, sulfamates, 3'-thio Acetal, methylene (methylimino), 3'-N-carbamate, morpholinocarbamate, and peptide nucleic acid (PNA). Oligonucleotide "generally refers to a nucleic acid molecule having less than 30 nucleotides.

In one embodiment of the present invention, the detection at the nucleic acid level is performed by measuring the amount of expression of the nucleic acid to diagnose asthma. For example, in order to confirm the degree of mRNA expression of claudin 4 in a biological sample, Can be measured. RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA) , Northern blotting, and DNA chips may be used. Such assays are well known and may also be performed using commercially available kits, and those skilled in the art will be able to select appropriate ones for the practice of the present application.

For example, a primer or a probe that specifically binds to mRNA of claudin 4 as a detection reagent in the method for measuring the presence and the expression amount or pattern of the mRNA by RT-PCR.

The term "primer" means a nucleic acid sequence having a free 3 'hydroxyl group capable of complementarily binding with a template and allowing the reverse transcriptase or DNA polymerase to initiate replication of the template.

One embodiment herein may comprise a set of primers having a complementary sequence specific for a gene encoding a claudin 4 protein according to the present invention as a detection reagent. The Claudin 4 protein and its nucleic acid sequence are known and include functional equivalents thereof. Those skilled in the art will be able to produce specific primers, probes, and the like for detection of each gene.

According to one embodiment of the present invention, PCR amplification is performed using a sense of mRNA of Claudin 4 gene and an antisense primer to diagnose asthma by measuring a production amount of a desired product. The PCR conditions, the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

The term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides that can specifically bind to mRNA. The presence or absence of a specific mRNA, the amount of expression can confirm. The probe may be prepared in the form of an oligonucleotide probe, a single strand DNA probe, a double strand DNA probe, or an RNA probe.

According to one embodiment of the present invention, hybridization is performed using a probe complementary to the polynucleotide mRNA of claudin 4, and the amount of mRNA expression is measured through the degree of hybridization, whereby the presence or absence of asthma and the degree of asthma can be measured. Selection of suitable probes and hybridization conditions can be appropriately selected according to techniques known in the art.

The primer or probe may be chemically synthesized using a phosphoramidite solid support synthesis method or other well-known methods. Such nucleic acid sequences may also be modified through a variety of methods known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate, carbamate Etc.) or charged conjugates (e.g., phosphorothioates, phosphorodithioates, etc.).

In one embodiment of the present disclosure, detection at the protein level comprises detecting one or more of the group consisting of monoclonal antibody, polyclonal antibody, substrate, aptamer, receptor, ligand, cofactor and mass spectrometry detection reagent . ≪ / RTI > Reagents or substances that specifically interact or bind to Claudin 4 may be used in conjunction with chip-based or nanoparticles. The detection reagent used in the present invention may be conjugated with a coloring material such as a fluorescent material for signal detection.

The term "antibody" refers to a specific protein molecule directed against an antigenic site. Specifically, the antibody refers to an antibody that specifically binds to the Claudin 4 protein, and includes both a polyclonal antibody, a monoclonal antibody, and a recombinant antibody.

The term "specific binding" means a case where the antibody forms an antigen-antibody complex with clone 4, which is a target protein thereof, and does not substantially form such a complex with another protein. The term "specific binding" as used herein may be expressed as a binding in which the binding is determined by a specific structure of a protein, that is, an epitope which is a crystal region of an antigen. Means that a " substantially "less-than-nonspecific combination can be formed. These nonspecific binding can be eliminated in the analysis of specific binding and in the pretreatment process for quantification.

The term "epitope" refers to an amino acid region (antigenic determinant) of a portion having antigenicity or immunogenicity in claudin 4. The epitope will usually comprise at least 10 amino acids. Such epitopes can be identified by methods known in the art and accepted epitope analysis methods, such as phage display method, reverse immunogenetics, and the like.

In one embodiment of the present invention, the detection at the protein level is carried out by measuring the amount of protein, which is a process of confirming the presence and expression level of claudin 4 protein in a biological sample to diagnose asthma. Analysis methods include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay, fluorescence immunoassay, luminescence immunoassay, radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), or Protein Chip (Protein Chip Assay) are used for immunoassay, Ouchterlony immunoassay, rocket immunoelectrophoresis, tissue immuno staining, ), But are not limited thereto.

The enzymatic immunoassay may include enzymes such as peroxidase (POD), alkaline phosphatase,? -Galactosidase, urease, catalase, glucose oxidase, lactate dehydrogenase, amylase or biotin-avidin complex, In the case of the measurement method, it is possible to use fluorocarbons such as fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, substituted rhodamine isothiocyanate, dichlorotriazine isothiocyanate, Alexa or AlexaFluoro Fluorescent substances or fluorophores may be used. Examples of the radioimmunoassay include tritium, iodine ( ¹³¹ I, ¹²⁵ I, ¹²³ I, ¹²¹ I), phosphorus ( ³² P), sulfur ( ³⁵ S) Radioactive isotopes such as ⁶⁸ Ga, ⁶⁷ Ga, ⁶⁸ Ge, ⁵⁴ Mn, ⁹⁹ Mo, ⁹⁹ Tc and ¹³³ Xe can be used. In the luminescence immunoassay, the luciferase method, the luminol peroxidase POD method, It can be used together with a luminescent material of the compound or the like.

In the enzyme immunoassay, a method such as glutaraldehyde method, maleimide method, pyridyl disulfide method, periodic acid method and the like can be used for the binding of the labeling substance and the antibody. In the radioimmunoassay, the chloramine T method, Method can be used.

The polyclonal antibody can be produced by immunizing clozapine 4 in an animal such as algae (e.g., chicken), mammals (e.g., rabbit, goat, horse, sheep, rat, etc.). The antibody can be purified from the blood of an immunized animal using methods known or accepted in the art, such as ion exchange chromatography, affinity-chromatography, and the like.

The monoclonal antibody may be obtained by a hybridoma cell line producing a monoclonal antibody specific for claudin 4. As a method for producing such a hybridoma cell line, for example, an animal (for example, a mouse) is immunized with claudin 4, a spleen cell is collected from the immunized animal, the splenocyte is fused to a myeloma cell line, And a method of identifying a hybridoma cell line that produces the desired monoclonal antibody. Isolation and recovery of monoclonal antibodies from such cell lines is possible by publicly known and accepted techniques in the art.

In order to obtain a monoclonal antibody, it is necessary to administer the immunogen, claudin 4, to a mammal such as a rat, a mouse, a rabbit, a monkey, a chlorine, etc. in order to obtain a monoclonal antibody.

A single dose of the immunogen may be appropriately determined by a person skilled in the art within the scope of his or her ordinary skill in consideration of the kind of immunized animal, route of administration, and the like. Usually it will be about 50 to 200 [mu] g per animal. The administration can be usually carried out by diluting and suspending an appropriate amount of the immunogen with PBS (phospate-buffered saline), physiological saline or the like, mixing the emulsion with the usual adjuvant, and emulsifying it, followed by subcutaneous injection into the abdominal cavity. Such administration will take place over several days to several weeks, preferably three to four times, at intervals of several weeks, preferably at intervals of one to four weeks, at several days after the first administration. When the antibody level has reached the plateau of the immunized animal by measuring the antibody level in the serum of the immunized animal by continuing the administration of the immunogen, the immunogen is finally administered intravenously or intraperitoneally, and 2 To 5 days later. The antibody-producing cells include spleen cells, lymph node cells, peripheral blood cells, and the like, but spleen cells or lymph node cells are preferable. After harvesting the antibody-producing cells, a hybridoma cell line is produced which produces monoclonal antibodies specific for the administered immunogen, namely clad4. Such hybridomas can be produced and identified by publicly known and accepted techniques in the art. Generally, antibody producing cells are preferably prepared by collecting spleen cells from an immunized animal, fusing the splenocytes to a myeloma cell line to prepare hybridoma cells, and hybridizing with a hybridoma producing monoclonal antibody binding to an immunogen The cell line will be identified. A myeloma cell line used for fusion with an antibody producing cell can be a cell line derived from an animal such as a mouse, and such cell line is commercially available. A preferred myeloma cell line is derived from an animal of the same species as an immunological animal, has drug selectivity for antibiotics and the like, and survives in a HAT selection medium containing hippocactin, aminopterin and thymine in a state not fused with splenocytes And can survive only in the state of fusion with spleen cells. Specific examples of the myeloma cell line include P3X63 (ATCC TIB9), which is a hypoxanthine guanine phosporibosyl-transferase (HGPRT) deficient cell line derived from BALB / c mouse.

The fusion of the splenocyte and the myeloma cell line, which is an antibody producing cell, is carried out in an appropriate ratio (about 1: 1 to 20: 1) of the antibody-producing cell and the myeloma cell line in an animal cell culture medium such as DMEM or RPMI- Ratio), and performing a fusion reaction in the presence of a cell fusion promoter. As the cell fusion promoter, polyethylene glycol having an average molecular weight of 1,500 to 4,000 daltons may be used at a concentration of about 10 to 80%. In some cases, an auxiliary agent such as dimethyl sulfoxide may be used in combination to increase the fusion efficiency. It may also be fused using a commercially available cell fusion device. After cell fusion treatment, the desired hybridomas should be screened. Usually, the cell suspension is appropriately diluted with RPMI-1640 medium containing fetal bovine serum or the like, and cells are dispensed on a microtiter plate to about 2,000 cells per well, and a selective medium is added to each well, And cultured in a fresh medium. The incubation temperature is usually 20 to 40 占 폚. When the myeloma cell line is a HGPRT deficient strain or a thymidine kinase deficient strain, only a hybridoma of an antibody-producing cell and a myeloma cell line is selectively grown by using a selective medium (HAT medium) containing hypoxanthine, aminopterin and thymidine Cultured and proliferated. Then, cells grown in the selective medium for about 14 days after the start of cultivation can be obtained as a hybridoma. The presence of the desired antibody is then screened in the supernatant of the propagated hybridoma. Screening of such hybridomas can be accomplished according to known, accepted techniques in the art. Such techniques include, for example, enzyme immunoassay (EIA) and radioimmunoassay (ELISA). Cloning of the fusion cell can be accomplished by a limiting dilution method or the like.

The cloned hybridomas are cultured in an animal cell culture medium such as RPMI-1640 medium containing 10% fetal bovine serum, DMEM medium or serum-free medium under normal culture conditions (for example, 37 ° C, 5% CO ₂ concentration) do. The incubation period is about 2 to 10 days. Monoclonal antibodies can be obtained from their supernatant. Monoclonal antibodies can be recovered using techniques well known in the art and common sense. As such known and accepted techniques of the art, there may be mentioned ammonium sulfate precipitation method, ion exchange chromatography, affinity chromatography, gel filtration chromatography and the like, or a combination thereof.

For the production of the monoclonal antibody, a gene recombinant technique may be used in which an antibody gene is cloned from a hybridoma, inserted into a suitable vector, and introduced into an appropriate host cell and expressed.

Specifically, an mRNA encoding a variable region of the antibody of the present invention is obtained from a hybridoma producing the antibody of the present invention. The mRNA can be obtained by obtaining a total RNA using known and accepted methods, for example, guanidine ultracentrifugation, AGPC, and the like, and using the mRNA Purification Kit (Pharmacia) mRNA. Alternatively, mRNA can be directly obtained by using QuickPrep mRNA Purification Kit (manufactured by Pharmacia). CDNA of the antibody V region is synthesized from the obtained mRNA using reverse transcriptase. If necessary, RACE PCR method or the like may be applied to cDNA synthesis and amplification. The cDNA encoding the thus obtained variable region is inserted into an expression vector containing DNA encoding the constant region (C region) of the antibody. Such an expression vector may include regulatory sequences such as a promoter, an enhancer, a cloning start point, a polyadenylation signal, a ribosome binding site, and the like, as described below with respect to a DNA recombinant production method of claudin 4. When the expression vector is transformed into a host cell, an antibody can be produced. Expression of the antibody gene may be carried out by recombining the DNA encoding the antibody heavy chain (H chain) or the light chain (L chain) into an expression vector to co-transform the host cell, or alternatively, the DNA encoding the heavy chain and the light chain Vector to transform the host cell.

On the other hand, Claudin 4 as an immunogen used for obtaining the antibody can be obtained by a known DNA recombinant technique known in the art. Generally, cDNA of Claudin 4 is prepared, the cDNA is inserted into an expression vector, the expression vector is transformed into prokaryotic or eukaryotic host cells, the transformed host cells are cultured in an appropriate medium, Lt; / RTI > The cDNA can be produced within the ordinary skill in the art based on the gene sequence provided by the gene / protein data base such as GenBank, RefSeq, Entrez Gene, UniProtKB, Swiss-Prot or the sequence provided by the present specification. For the production of such a cDNA, a DNA synthesizer using a phosphoamidite method, an RT-PCR method, a hybridization method for obtaining a desired cDNA from a cDNA library, and the like can be used. If necessary, the desired cDNA May be amplified.

In the above, the expression vector is expressed by a biotechnology company such as Novagen, Takara Shuzo, Qiagen, Stratagene, Promega, Roche Diagnostics, (Invitrogen), Genetics Institute, and the like.

Such an expression vector may contain a marker for facilitating the regulatory element such as a promoter, an enhancer, a polyadenylation signal, a ribosome, a binding site, a cloning start point, a terminator, a selection marker, A peptide sequence (for example, a nucleotide sequence encoding a histidine repeat sequence), and the like. The host cell can be a prokaryotic cell such as a bacterium (for example, Escherichia coli, Bacillus subtilis) and yeast (for example, Saccharomyces cerevisiae), insect cells (for example, Sf cells), mammalian cells Eosinophils such as COS, CHO, BHK) can be used. Purification of claudin 4 from host cells or cultures thereof can be carried out by methods such as ultrafiltration, gel filtration, ion exchange chromatography, affinity chromatography (when the labeled peptide is bound), HPLC, hydrophobic chromatography, isoelectric point chromatography, A combination method can be used.

In one embodiment of the present disclosure, claudin 4 as an immunogen for producing the antibody may be used as the fragment. Since antibodies obtained using fragments will also have the ability to specifically bind to claudin 4.

One embodiment of the present disclosure provides an asthma diagnostic kit comprising the composition.

The kit can be used as a kit including an RT-PCR kit, a microarray chip kit, a biosensor, a DNA chip, an RNA chip, a protein chip, a cell chip, an immunoassay kit, an immunochromatography kit, a luminex assay kit, A kit, or an immunological dot kit.

The kit can diagnose asthma by confirming the expression level of the protein of claudin 4. The kit may further comprise one or more other component compositions, solutions, or devices suitable for the assay, as well as primers, probes, and antibodies for the diagnosis of asthma.

The term "array" or "microarray" or "biochip" or "chip" refers to an article of manufacture or device comprising a plurality of fixed target elements, each target element comprising a specific composition immobilized on a solid surface, Quot; feature, "spot," or defined region, including biological molecules such as nucleic acid molecules or polypeptides.

The kit may include a secondary antibody (for example, an antibody against claudin 4 labeled with a fluorescent dye or the like capable of detecting the expression level of claudin 4) used in an immunological method to quantitatively or qualitatively confirm the expression amount of claudin 4, , A carrier, a washing buffer, a sample diluting solution, an enzyme substrate, a reaction stopping solution, and the like. The kit may preferably include instructions for teaching the determination of the presence or absence of asthma, the progress of asthma, and the course of treatment of asthma from the expression level of clathrin 4, which is quantitatively or qualitatively detected.

The kit for measuring the level of mRNA expression of claudin 4 may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits contain enzymes such as test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC Water (DEPC-water), sterile water, and the like.

The kit may be a kit containing essential elements necessary for performing the microarray. The microarray chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof, And can be easily produced by a commonly used production method. In order to fabricate a microarray, a micropipetting method using a piezo electric method or a micropipetting method using a pin-shaped method to immobilize the detected marker on a substrate of a DNA chip using the probe as a probe DNA molecule A method using a spotter or the like is preferably used, but the present invention is not limited thereto. The substrate of the microarray chip is preferably coated with an activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto. In addition, the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose membrane, but is not limited thereto.

In addition, the kit may be a kit containing essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. The substrate may also comprise a cDNA or oligonucleotide corresponding to a control gene or fragment thereof.

The probe can be immobilized on a solid support (substrate), wherein the "substrate" is a material, structure, surface or material, abiotic, synthetic, inanimate, planar, spherical or specific binding, , A hybridization or enzyme recognition site or a number of other recognition sites or a number of other recognition sites beyond a number of other molecular species composed of surfaces, structures or materials. The substrate can be, for example, a semiconductor, an (organic) synthetic metal, a synthetic semiconductor, an insulator and a dopant; Metals, alloys, elements, compounds and minerals; Assembled, disintegrated, etched, lithographed, printed and microfabricated slides, devices, structures and surfaces; Industrial, polymers, plastics, membranes, silicones, silicates, glasses, metals and ceramics; But are not limited to, wood, paper, cardboard, cotton, wool, cloth, woven and nonwoven fibers, materials and fabrics.

One embodiment of the present disclosure is directed to a method of detecting a protein comprising: (a) determining the level of expression of Claudin-4 (CLDN4) from a biological sample; And (b) comparing the expression level of the claudin 4 with a clodin4 expression level of a normal control sample.

In one embodiment of the present disclosure, the step of measuring the level of expression of claudin 4 may be at a nucleic acid or protein level.

In one embodiment of the present invention, the method for measuring the level of nucleic acid expression is selected from the group consisting of RT-PCR, Competitive RT-PCR, Realtime RT-PCR, , RNase protection assay (RPA), Northern blotting, and DNA chip.

In one embodiment of the present invention, the method for measuring the expression level of the protein may be Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, Immunoprecipitation Assay, Complement Fixation Assay, Fluorescence Activated Cell Sorter (FACS), and Protein Chip Protein (FACS) were used for immunoassay, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, chip) may be used.

In one embodiment of the present invention, the biological sample may be whole blood, serum, plasma, saliva, urine, sputum, lymph fluid or cell separated from the specimen, specifically, plasma, serum, whole blood.

For the comparative analysis, the specimen may be a normal control or a specimen from a control group having a specific disease, as well as a specimen of a specimen requiring diagnosis.

In one embodiment of the present disclosure, the method of screening for an asthma treatment or prophylactic active comprises the step of ascertaining whether or not it modulates clad4 protein expression in alveolar epithelial cells.

The asthma treatment or prophylactic active substance may be a substance that inhibits or inhibits overexpression of clodin4 protein in alveolar epithelial cells.

By using the above screening method, it is possible to search for a substance that is effective for treating or preventing asthma by confirming the expression of claudin 4 protein.

Hereinafter, the present specification will be described in detail by the following Production Examples, Examples and Experimental Examples. It is to be understood, however, that the following Preparation Examples, Examples and Experimental Examples are merely illustrative of the present disclosure and that the present specification is not to be construed as being limited to the following Examples, And to provide a complete disclosure of the scope of the specification to those skilled in the art to which the present disclosure belongs.

<Experimental Example>

1. Recruitment of asthma patients

Fifty asthmatic patients were recruited, and they were sick for 6.6 ± 3.6 years. Plasma claudin 4 levels were determined in stable and deteriorated states. Eight BALB / c mice were exposed to saline (control) or OVA. Lung CLDN4 mRNA and protein, lung history, and bronchoalveolar lavage (BAL). Additional testing was performed with cell lines from normal human bronchial epithelium (NHBE) cells. The study of patients was approved by the Institutional Review Committee of Soonchunhyang University. Animal studies were approved by the Institutional Animal Care and Use Committee at Soonchunhyang University.

We studied clinical data on 50 asthmatic patients enrolled in the asthma cohort of the Genome Research Center for Allergy and Respiratory Disease in Korea. All patients were recruited from Soonchunhyang University Bucheon Hospital. Asthma diagnosis was based on the GINA guidelines. All subjects with a clinical diagnosis of asthma were supported by one or more of the following criteria:

1) maximum peak daily respiratory flow variability that exceeds 20% over 14 days

2) FEV1 increased by more than 15% after 200-400 μg of albuterol was inhaled

3) 20% reduction in FEV1 in response to inhaled methacholine (PC20 methacholine) stimulation concentrations of less than 10 mg per milliliter

All subjects underwent normalized measurements, including analysis of saliva samples, differential counting with pre-eclampsia, IgE measurement, posteroanterior radiography, allergy skin stiffness test, and spirometry. All data were collected at the time of pre-prescription diagnosis of asthma medication. Of the hospital asthma cohorts, age, sex, and BMI were selected for asthma patient studies that matched normal controls. The normal control subjects were asked to respond to screening questions about their spouse or respiratory symptoms, screening questions about FEV1> 80%, PC20 methacholine> 10 mg / mL, or other allergic diseases with normal outcomes in simple chest radiographs Group. Of the subjects who underwent regular follow-up for more than 2 years, 50 patients were diagnosed with GINA guidelines.

Asthma exacerbation is accompanied by a gradual increase in the severity of respiratory distress, coughing, panting, chest compressions, or combined symptoms of these and decreased respiratory flow, and when systemic corticosteroids are required in hospitals and emergency personnel visits, (GINA: Global Guideline for Asthma), either systematically using corticosteroids in the form of injections, suspensions or injections, or increasing the level to a stable level for at least 3 days. This study was approved by the Institutional Review Committee of Soonchunhyang University.

2. Cell culture

Early NHBE cells (Lonza, Basel, Switzerland) (seeding density 3000 cells / cm ² ) were incubated at 37 ^° C in T-flasks with BEGM ™ BulletKit ™ (Lonza) And cultured at 5% CO ₂ . The medium was changed every 48 hours until the cells reached 90% fusion. The cells were seeded in 6-well plates. Twenty-four hours prior to the experiment, the cells were replaced with EBM-2 basal medium with 0.1% bovine serum (FBS) treated with 10 μg / ml of Dermatophagoides pteronyssinus Product 1 (Der p1) for 4, 8 or 24 hours.

3. Transmembrane - Endothelial electrical resistance ( TEER ) Measure

Tight junction formation in HLMVE cells first seeded at 8 x 10 ³ cells / ml was measured using TEER. They were treated with Der p1 for 4, 8, or 24 hours. TEER was measured weekly using an EVOM meter (World Precision Instruments, FL).

4. Experimental animal

50 μg of V-grade chicken egg OVA (Sigma-Aldrich, St Louis, MO) emulsified by adding 100 μl of Delbecco's phosphate buffered saline (D-PBS) to 10 mg of aluminum hydroxide was intraperitoneally injected (IP) Female BALB / c mice were sensitized. From day 21 to day 23 all mice underwent intranasal challenge (I.N) in 50 μl of D-PBS with 150 μg of grade III OVA (Sigma-Aldrich). Control mice were sensitized and suffered difficulty in salinity. Bronchial alveolar lavage fluid (BALF) was collected and lung tissue was treated with protein, RNA, hematoxylin and H & E stain and confocal imaging at 24 days. 50 μg of V-grade chicken egg OVA (Sigma-Aldrich, St Louis, MO) emulsified by addition of 100 μl of phosphate-buffered saline (D-PBS) was intraperitoneally injected (IP) at 0 and 14 days into 6-week-old female BALB / c mice Made sensitive. From day 21 to day 23 all mice underwent intranasal challenge (I.N) in 50 μl of D-PBS with 150 μg of grade III OVA (Sigma-Aldrich). Control mice were sensitized and suffered difficulty in salinity. At 24 days, bronchial hyperresponsiveness was measured and bronchoalveolar lavage fluid (BALF) was collected and lung tissue was treated with protein, RNA, hematoxylin and eosin staining (H & E stain) and confocal imaging.

5. AHR, BALF, morphometry

2.5 mg / kg tiletamine and xylazine Zoletil and lumpum; Bayer Korea Co., Seoul, Korea) and treated with methacholine 0, 5, 20, or 100 mg / ml to determine AHR. The next day BALF was obtained and centrifuged to store the supernatant. Cell pellets were resuspended during cell count and cell centrifuge slides were made during cell differentiation (500 cells / mouse, Diff-Quick-staining). Lung tissue was fixed in 4% phosphoric acid buffered paraformaldehyde, embedded in paraffin, sectioned to 4 μm and stained with H & E stain.

6. RNA extraction and quantitative real-time PCR  ( qRT - PCR )

RNA was identified using TRI REAGENT (Molecular Research Center, Cincinnati, Ohio). For mouse lung RNA, cDNA was prepared from 3 μg RNA with Superscript III and first strand synthesis superMix (Invitrogen). qRT-PCR was performed using the Power SYBR Green PCR Master Mix with the qRT-PCR System (StepOne, Life Technologies). Primers were used for expansion as follows. Mouse CLDN4 (forward: GGAGGGCCTCTGGATGAACT, reverse GATGCTGATGACCATAAGGGC), mouse beta-actin (forward: ACGTTGACATCCGTAAAGA, reverse: GCCACGTTGACATCCGTAAAGA). The relevant CLDN4 transcript levels were calculated according to the 2-ΔΔCt method normalized with β-actin.

Forward primer Reverse primer mouse
CLDN4 GGAGGGCCTCTGGATGAACT GATGCTGATGACCATAAGGGC mouse
Beta-actin ACGTTGACATCCGTAAAGA GCCACGTTGACATCCGTAAAGA

7. Immunofluorescence  dyeing

The mouse lung sections were removed of paraffin and rehydrated in an ethanol series. (1: 400, Abcam Inc., Cambridge, MA) with Alexa Fluor 488 conjugated Donkey polyclonal anti-Rabbit IgG (1: 1000 Abcam Inc., Cambridge, Mass.) And blocked by non-specific binding to 1.5% ), And the nuclei were contrasted with DAPI (1: 1000, Invitrogen). Confocal laser scanning microscopy Confocal laser microscopy was performed using a fluorescence microscope at LSM 510 META with a 40 objective lens using a microscope camera and 6400 (Carl Zeiss Microsystems, Thornwood, NY) with a x20. The sections were observed using a confocal laser scanning microscope and images were generated using the Jays LSM image browser.

8. Immunohistochemistry

Paraffin was removed from the mouse lung sections and rehydrated with an ethanol series. The sections were treated with 1.4% hydrogen peroxide in methanol for 30 minutes to block the endogenin peroxidase, blocked with non-specific binding to 1.5% horse serum and incubated with anti-rabbit CLDN4 (1: 200, Abcam Inc.) . The following day, sections were cultured in ABC kit (Vector Laboratories, Burlingame, Calif.). And stained with a liquid DAB + substrate kit (Golden Bridge International Inc, Mukilteo, WA) to effect a color reaction. After immunohistochemical staining, slides were stained contrastively with Herris's hematoxylin for 1 minute.

9. Western Blat

The lung tissues extracted from the protein lysis solution containing 50 mM Tris-HCl (pH 7.4), 50 mM NaCl, 0.1% SDS, 1% Triton X-100, 0.5 mM EDTA and 100 mM PMSF were homogenized in distilled water, C for 30 minutes at 14000 rpm, and insoluble material was collected. The 30 ug protein from each sample was loaded on 15% sodium dodecyl sulfate-polyacrylamide gel. The separated proteins were transferred to a nitrocellulose membrane at 80 V for 2 hours. Membranes were blocked for 1 hour at room temperature and then incubated with CLDN4 (1: 100, abcam, UK) as primary specific antibodies at 4 ° C overnight in the appropriate diluent. Membranes were incubated at room temperature with goat anti-rabbit antibody for 1 hour and then blots were detected with ECL plus Chemiluminescence reagent (GE Healthcare Bio-Sciences, Piscataway, NJ, USA). The relative amount of protein determined by quantitative densitometer data was normalized to beta-actin (Sigma-Aldrich).

10. ELISA (enzyme-linked immunosorbent assay)

Inflammatory mediators such as interleukin-4 (IL-4), interleukin-5 (IL-5) and interleukin-13 (IL-13) in patients with CLDN4 (USCN) and BALF were measured in ELISA (R & D System, Minneapolis, MN) . To compare the results obtained from different plates, test sample ODs were adjusted compared to the positive and negative control samples supplied in each kit. The average OD of duplicate wells was calculated. The index value of each tested serum was confined to the following formula: Index = (OD of negative control of test serum / OD of negative control of positive control x 100). The lower detection limits were set at 2 or 7 pg / ml, 0.066 ng / ml for IL-4 or IL-5 or IL-13 or CLDN4, respectively, based on the manufacturer's recommendation.

11. Statistical analysis

Data are expressed as mean ± standard error (SEM) and Mann-Whitney U test was used to determine significant differences between groups. A value of p < 0.05 was considered to indicate statistical significance.

< Example  1> asthma In patients Claudin  4 alteration

Fifty asthmatic patients (mean age ± SD, 54.9 ± 14.1 yr) and 25 control subjects (mean age ± SD, 58.3 ± 6.2 yr) were recruited in Table 1. The initial FEV1% pred., FVC% pred., And FEV1 / FVC of asthmatic patients were significantly lower than those of the control subjects. The total IgE, atpoy, and blood eosinophil ratios in asthmatic patients were significantly higher than those of the control subjects. Body mass index did not differ between asthmatic and control subjects. The duration of asthma was 6.63 ± 3.60 yr, and the rate of deterioration during follow-up was 3.38 ± 3.24 (rate / yr) per year.

FEV1% pred., FVC% pred., And FEV1 / FVC of patients with exacerbated asthma were lower than those of control asthmatics. Blood neutrophil ratios in patients with exacerbated asthma were significantly higher than those in control asthmatics.

Mean plasma CLDN4 levels in bronchial asthma patients were 0.041 ± 0.005 ng / ml and 0.022 ± 0.003 ng / ml in healthy controls (Fig. 1). Mean plasma CLDN4 levels in aggravated asthma patients were 0.057 ± 0.007 ng / ml and 0.041 ± 0.005 ng / ml in control patients with bronchial asthma (Fig. 1). Plasma CLDN4 levels were much higher in patients who were exacerbated compared to control subjects in bronchial asthma (Fig. 1, P <0.001). Plasma CLDN4 levels in control subjects with bronchial asthma were much higher than in healthy controls (Figure 1, P <0? 001). Figure 1 depicts the level of plasma clad4 (CLDN4) between the steady state and the worsened state of asthmatic patients. (* p <0.001, control vs. stable, # p <0.001 Stable vs. exacerbated state.)

Figures 2 and 3 show the relationship between plasma levels of CLDN4 and pulmonary function (FEV1 pred. And FEV1 / FVC) in asthmatic patients (* p <0.001, control vs. stable, p <0.001) vs. exacerbated state.) Plasma CLDN4 levels were associated with FEV1% pred. (r = -0.245, P = 0.006, Fig. 2) and FEV1 / FVC (r = -0.251, P = 0.005, Fig.

Figures 4 and 5 show the relationship of CLDN4 levels, eosinophils, and total IgE in asthmatic patients. Plasma CLDN4 levels were associated with eosinophils (r = 0.213, P = 0.035, Fig. 4) and total IgE (r = 0.284, P = 0.001, Fig.

< Example  2> OVA-induced inflammation in mice, cytokines, AHR

OVA-sensitized and challenged mice had increased AHR compared to control mice (Figure 6). OVA-sensitized and challenged mice increased inflammatory cells in BALF compared to control mice (Figure 7). IL-4 and IL-13 were increased in BALF of OVA-sensitized and challenged mice compared to control mice (Figure 8). Figures 6, 7, and 8 show AHR, inflammation, and cytokine in ovalbumin (OVA) -sensitive and challenged mice.

Figure 6 shows the AHR of OVA-induced mice. Increase of airway closure (Penh) was measured as the amount of methacholine increased. The lower the amount of methacholine, the more airflow obstruction of OVA - induced mice was increased. Values are mean ± SEM. (n = 8 mice / group)

Figure 7 shows inflammatory cells of OVA-induced mice. On day 25, BALF was collected and cell gaps were determined. OVA-induced mice increased total cell number, macrophage, eosinophil, neutrophils, and lymphocytes.

Figure 8 shows the cytokine of OVA-induced mice in bronchoalaveolar washes (* p < 0.05 OVA vs. Sham.).

< Example 3> Mouse  OVA-induced inflammatory infiltration in the lungs and CLDN4  Expression

In biopsies, OVA-sensitized and challenged mice had a number of concentrating areas with inflammatory cell infiltration and exuding peripheral bronchial and intramural areas (FIG. 5A). Semi-quantitative values of inflammatory indexes from H & E-stained images were increased in OVA-sensitized and challenged mice. In mice sensitized and challenged with OVA, CLDN4 immunohistochemical staining increased in mononuclear inflammatory cells, endothelial cells and epithelial cells. The pattern of CLDN4 staining was altered in epithelial cells of OVA-sensitized and challenged mice (Figs. 9 and 10).

Figure 9 shows that the integration of tight junction protein cludin 4 (CLDN4) in mice sensitized and challenged with lung gall bladder (OVA) was destroyed. Figure 10 shows the expression of CLDN4. In FIG. 9, the left column shows nuclear dsDNA stained with blue fluorescence using 4 ', 6-diamidino-2-phenylindole (DAPI) as a blood vessel and surrounding lung tissue. The middle column shows CLDN4 contrasted with anti-CLDN4 antibody in green fluorescence using Alexa Flour 488. The right column shows the tissue integration in the left and middle columns. The CLDN4 staining pattern was sensitized to OVA versus sham control treated mice and was altered in NBEC of challenged mice. Adherent synapses more clearly formed a continuous ring surrounding each cell, but were destroyed in the veins of OVA-sensitized and challenged mice.

< Example 4> Mouse  OVA-induced pulmonary CLDN4 Transcript  And protein

Normally, tight junctions form a continuous ring surrounding each cell. The close-coupled rings were sensitized with OVA and destroyed in challenged mice. Confocal image analysis showed a significant increase in tight junction cleavage and a significant increase in the density of CLDN4 staining, showing the disruption of TJ protein integration (Figure 11). The pulmonary CLDN4 transcript (Figure 11) and protein (Figure 12) were sensitized with OVA versus saline treated mice and increased in challenged mice.

Figures 11 and 12 show increased levels of lung clad4 (CLDN4) transcript and protein in mice sensitized and challenged with ovalbumin (OVA). Densitometry was determined by three immunoblots and normalized with beta-actin. The values normalized with beta-actin are mean ± SEM. (* p < 0.05 OVA vs. Sham.) Figure 11 shows that the CLDN4 transcript increased in the lung of OVA mice. Transcripts determined by qRT-PCR were normalized to beta-actin. Figure 12 shows that CLDN4 protein levels detected by western blot in the lungs of OVA mice are increased.

< Example  5> Der  p1 and TEER

Der p1 increases the CLDN4 transcript and increases TEER in human lung epithelial cells. Dermatophagoides pteronissinus produces air allergen Der p1 with protein activity. To test whether Der p1 could alter normal airway cells, NHBE cells were treated with 10 g / ml Der p1 for 4, 8, or 24 hours and CLDN4 transcript levels were measured. CLDN4 transcripts were increased in NHBE cells 4, 8, and 24 hours after exposure to Der p1 (Figure 13). This increase was accompanied by a gentle increase in TEER (Fig. 14), indicating that Der p1 could affect the epithelial close association CLDN4.

Figures 13 and 14 show CLDN4 transcripts in normal human bronchial epithelium (NHBE) cells exposed to the house dust mite peptidase Der p1. (* p < 0.05, derp1 vs. control.) Figure 13 shows the CLDN4 protein in the NHBE treated with the control or Der p1 as determined by Western blot. Figure 14 shows Der p1 in which the transmembrane endothelial electrical resistance (TEER) in the NHBE is reduced compared to the control.

The role of CLDN4 in the onset of asthma is not yet known. Clumped Adjuvant CLDN4 was one of the structural molecules of the tight junction, which increased in patients with asthma as compared to the control subjects, so the data in this specification show that CLDN4 can play a role in the development of asthma. Claudin 4 can enhance alveolar fluid removal and provide specific information on the alveolar epithelial barrier function that enhances the link between histological changes and physiologic impairment in the amount of claudin-4 expressed in the human lung. In addition, our data show that claudin 4 is associated with IgE, eosinophilia, and pulmonary function, and may be a marker used to provide information for the diagnosis of asthma inflammation and asthma severity. Thus, increased expression of claudin-4 in asthma represents a mechanism for the threshold of asthma onset, and modulation of alveolar epithelial clad4 expression may be a novel target for asthma.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, Of the right.

Claims (4)

delete delete (a) measuring the level of expression of Claudin-4 (CLDN4) from a plasma sample isolated from an individual; And
(b) comparing the expression level of claudin 4 with the level of expression of claudin 4 in a normal control sample, and diagnosing asthma when the expression level of claudin 4 is increased as compared to a normal control sample; Delivery method. A method for screening for an asthma treatment or prophylactic active substance, comprising the step of determining whether or not it inhibits expression of claudin 4 protein in human bronchial epithelial cell line (NHBE).

Images