KR101745504B1 - Method for Isolating of Vomifoliol and Stigmasterol Having Anti-cancer Activity from Silkworm Feces - Google Patents

Abstract

The present invention relates to an anticancer composition containing a subcutaneous extract having anticancer activity, more particularly to a subcutaneous extract, a subcutaneous fraction obtained by fractionation of a subcutaneous extract, and a compound obtained by separation from a subcutaneous fraction .
The vaginal extract according to the present invention, the subcutaneous fraction obtained by fractionation thereof, or the compounds obtained therefrom, vomifoliol and stigmasterol exhibit excellent cancer cell proliferation inhibitory ability, and thus can be used as a novel anticancer agent derived from natural products It is available.

Description

TECHNICAL FIELD [0001] The present invention relates to a method for isolating staphylococci from staphylococci,

The present invention relates to an anticancer composition containing a subcutaneous extract having anticancer activity, more particularly to a subcutaneous extract, a subcutaneous fraction obtained by fractionation of a subcutaneous extract, and a compound obtained by separation from a subcutaneous fraction .

Cancer occurs when mutations occur in genes due to environmental factors such as food, chemical contaminants, and the like. These mutations lead to uncontrolled cell proliferation, the formation of cell masses called tumors, and some of them penetrate into other tissues to cause metastasis, which makes malignant tumors, , Which is a group of diseases that can destroy the life of an individual.

According to the latest statistics from the World Health Organization, more than 10 million cancer cases occur annually worldwide, and about 1,300,000 new cases occur in the United States and about 550,000 people die from cancer. Even in Korea, the number of cancer patients is steadily increasing every year, and it accounts for the highest percentage of deaths caused by diseases. In addition, the incidence and patterns of various cancers are gradually changing to advanced countries.

In particular, lung cancer occurs when some normal cells grow abnormally and can not be controlled. Lung cancer cells are separated from the lungs and then invade other parts through the blood vessels. Lung cancer is not only the most commonly diagnosed cancer, it is also one of the highest cancer deaths among men, and the fourth most commonly diagnosed disease in women worldwide (Jemal, A., Bray, et al., Global cancer statics. CA Cancer J. Clin., 61: 69-90, 2011).

In Korea, the incidence and mortality rates of lung cancer are much lower than those of most western countries in the past centuries, but the incidence and mortality rates of lung cancer have increased due to various risk factors such as increased smoking, secondhand smoke, indoor air pollution and fine dust. .

Treatment of lung cancer is fundamentally based on radiotherapy, chemotherapy, and surgical surgery. Chemotherapy is the most effective method, but it may cause pharmacological resistance or other side effects. Therefore, it is necessary to develop therapeutic agents that replace these existing chemicals.

On the other hand, natural products contain a variety of physiologically active substances, are relatively safe, and their action points are complex and novel. Thus, they exhibit a function of delaying or reducing the generation of tolerance. Therefore, natural products It has emerged as an ideal alternative methods (Raskin, I., et al, Trends Biotechnol, 20:.... 522 ~ 531, 2002; Jassim, SA and Naji, MA J. Appl Microbiol, 95: 412 ~ 427, 2003 ).

Since silkworms generally discharge 60% of the consumed mulberry leaves without digesting it, the silkworm, which is silkworm excrement, contains various materials modified by enzymes and microorganisms in the silkworm, including mulberry leaves.

It is said that the immune system is used to strengthen the internal organs, to be used for the treatment of diabetes, and to prevent the hangover and paralysis symptoms in the HbMcN.

Recently, feces of Bombyx mori (L.) (Lepidoptera: Bombycidae) have been reported to have activities such as atopy suppression, anti-inflammation and antioxidant (Park, JH et al., J. Korean Soc. Appl Biol. Chem., 53: 734-739 , 2010; Costa-Neto, EM, J. Ethnobiol., 25: 93-114 , 2005).

(8E) -10-hydroxydec-8-enoic acid methyl ester), including β- carotene, 1-deoxynojirimycin, fagomine and 3-epifagomine (Park, JH et al., J. Korean Soc. Appl. Biol. Chem., 53: 734-739, 2010), and that lignans derived from 80% .

However, no study has yet been made on how to isolate compounds having anticancer activity from the silkworm moth, which is a silkworm moth, and how its mechanism is affected.

As a result, the inventors of the present invention have made efforts to solve the above problems, and as a result, it has been confirmed that vigorous extracts, vomifoliol and stigmasterol isolated therefrom have excellent anticancer activities, and thus completed the present invention .

It is an object of the present invention to provide an anticancer composition comprising an extract and a compound having excellent anticancer activity isolated from a natural product, silkworm mite (excipient).

In order to accomplish the above object, the present invention provides an anticancer composition containing a subcutaneous extract having anticancer activity.

In the present invention, the secretion extract is an extract obtained by extracting the crushed secretion with an organic solvent.

In the present invention, the drowning extract is an ethanol extract obtained by dipping undissolved impurities in ethanol, filtering and then filtering the filtrate under reduced pressure.

The present invention also provides an anticancer composition, which comprises, as an active ingredient, a subcutaneous fraction obtained by fractionation from said subcutaneous extract.

In the present invention, the subcutaneous fraction is characterized by being obtained by fractionating the subcutaneous extract sequentially with hexane, chloroform, ethyl acetate, butanol and water.

The present invention also provides an anticancer composition comprising, as an active ingredient, a compound obtained by separation from the above-mentioned subcutaneous fraction.

In the present invention, the compound is characterized by being at least one selected from the group consisting of bomipolol and stigmasterol.

In the present invention, the vomifoliol fraction is fractionated by silica gel column chromatography while sequentially adding methanol to the chloroform mobile phase. The fraction having the highest activity is isolated by confirming the inhibition of cancer cell growth, The fraction with the highest activity was isolated by confirming the inhibition of cancer cell growth, and then the mixture of methanol and water was used as a mobile phase, and the resulting mixture was subjected to preparative high performance liquid chromatography (HPLC), followed by isolation and purification of the compound having the highest activity through confirmation of inhibition of cancer cell growth.

In the present invention, the stigmasterol fraction is fractionated by silica gel column chromatography while sequentially adding methanol to the chloroform mobile phase. The fraction having the highest activity is isolated by confirming the inhibition of cancer cell growth, Then, methanol was sequentially added to the mobile phase of chloroform, and the fractions were fractionated by MPLC, and the fraction having the highest activity was isolated by confirming the inhibition of growth of cancer cells. Then, the mobile phase was subjected to reverse phase medium pressure chromatography (Reverse MPLC), and the compound having the highest activity was isolated and purified by confirming inhibition of cancer cell growth.

In the present invention, the step of isolating the fraction having the highest activity through fractionation through MPLC and inhibition of cancer cell growth is performed 1 to 6 times.

In the present invention, the cancer is characterized in that the cancer is selected from the group consisting of lung cancer, stomach cancer, prostate cancer, cervical cancer, colon cancer, breast cancer, liver cancer, esophageal cancer and ovarian cancer.

In the present invention, the anticancer composition inhibits the expression of anti -apoptotic Akt1 and Bcl-2 genes and is characterized by having anticancer activity.

The vaginal extract according to the present invention, the subcutaneous fraction obtained by fractionation thereof, or the compounds obtained therefrom, vomifoliol and stigmasterol exhibit excellent cancer cell proliferation inhibitory ability, and thus can be used as a novel anticancer agent derived from natural products It is available.

Fig. 1 is a process diagram showing the separation of the fraction derived from the solvent according to the present invention.
FIG. 2 is a view showing a process of separating an anticancer active compound from a subcutaneous fraction according to the present invention.
Figures 3 and 4 are HPLC chromatograms of isolated anti-cancer active compounds according to one embodiment of the present invention.
5 is a mass spectrum (EI-MS) of active body 1 separated according to one embodiment of the present invention.
Figure 6 is a DEPT spectrum of active body 1 isolated according to one embodiment of the present invention.
Figure 7 is a mass spectrum of the active body 2 separated according to one embodiment of the present invention (EI-MS).
Figure 8 is a DEPT spectrum of active body 2 separated according to one embodiment of the present invention.
FIG. 9 is a graph showing the inhibitory activity of Akt1 mRNA expression in A549 cells of an isolated active body according to an embodiment of the present invention.
FIG. 10 is a graph showing the inhibitory activity of Bcl-2 mRNA expression in A549 cells of an active body isolated according to an embodiment of the present invention.

The present invention aims to develop an anticancer active material derived from a natural material having a low risk of side effects and having excellent effects.

In the present invention, it was confirmed that the subcutaneous extract of Bombyx mori , which is a fecal matter produced by eating the mulberry leaves, has anticancer activity.

(A549 and NCI-H727), a gastric cancer cell line (AGS), a prostate cancer cell line (PC-3 and SNU-213), and the like. SK-Hep-1, an oesophageal cancer cell line (Hep-2) and an ovarian cancer cell line (SK-Hep-1) OV-3), indicating that it has strong cell proliferation inhibitory activity.

Accordingly, the present invention relates, in one aspect, to an anticancer composition containing a subcutaneous extract having anticancer activity.

The excrement may be used as silkworm excrement without any particular limitation as long as it is an excrement of the silkworm moth belonging to the common silkworm moth.

In the present invention, the immune extract may be obtained by pulverizing the immune complex and then extracting it with an organic solvent or water. Examples of the organic solvent include polar solvents such as ethanol, methanol, butanol, and propanol; Non-polar solvents such as hexane, ether, benzene, and toluene; Chloroform, ethyl acetate, acetone, methylene chloride and the like, but are not limited thereto.

The secretion extract may be extracted by immersion, bathing, distillation, extraction with an organic solvent such as ethanol or water, or extraction with supercritical extraction or microwave extraction, and may be obtained through filtration and concentration.

On the other hand, it was predicted that fractions containing the anticancer active ingredient could be separated when the subcutaneous extract was confirmed to have anticancer activity.

In one embodiment of the present invention, each fraction was sequentially fractionated with hexane, chloroform, ethyl acetate, butanol and water, and the obtained fractions were subjected to an anticancer activity test. As a result, it was confirmed that the chloroform fraction, the hexane fraction and the ethyl acetate fraction had excellent anticancer activity.

Accordingly, the present invention relates to an anticancer composition characterized by containing, as an active ingredient, a subcutaneous fraction obtained by fractionation from a subcutaneous extract in another aspect.

The scum extract may be obtained by a conventional method of isolating compounds that are dissolved according to the polarity of the organic solvent. In the present invention, the scum extract first extracted is sequentially fractionated with hexane, chloroform, ethyl acetate, butanol and water to obtain hexane fraction, Chloroform fraction, ethyl acetate fraction, butanol fraction and water fraction were obtained.

In the present invention, it was also predicted that the chromatographic fraction of chloroform fractions having the highest anticancer activity would be able to isolate and identify the anticancer activity body.

In one embodiment of the present invention, the body of the anticancer activity is separated by performing MPLC, thin layer chromatography (TLC) and high performance liquid chromatography (HPLC), and analyzed by electron impact mass spectrometry (EI-MS) It was confirmed that the main body of anticancer activity was vomifoliol and stigmasterol by performing magnetic resonance (NMR) and DEPT (Distortionless Enhancement by Polarization Transfer).

Accordingly, the present invention relates to an anticancer composition containing, as an active ingredient, a compound obtained separately from a subcutaneous fraction from a different viewpoint.

In the present invention, the anticancer activity compound is characterized by being at least one selected from the group consisting of vomifoliol and stigmasterol.

In the present invention, the isolated chloroform fraction, which has been confirmed to have excellent anticancer activity, is fractionated by silica gel column chromatography while sequentially adding methanol to the mobile phase of chloroform, and the activity of vomifoliol The fractions were separated and further fractionated by medium pressure chromatography (MPLC) while methanol was sequentially added to the mobile phase of chloroform. The fraction having the highest activity was isolated by confirming the inhibition of growth of cancer cells. Then, a mixture solution of methanol and water , Followed by separation by preparative high performance liquid chromatography (HPLC), and by isolating and purifying the compound having the highest activity through confirmation of inhibition of cancer cell growth, it can be obtained.

In addition, the stigmasterol fraction was fractionated by silica gel column chromatography while sequentially adding methanol to the chloroform mobile phase, and the fraction having the highest activity was isolated by confirming inhibition of cancer cell growth. Then, the fractions were separated by chloroform mobile phase (MPLC), and the fraction having the highest activity was isolated by confirming inhibition of growth of cancer cells. Then, the fraction having the highest activity was separated, and then, using a mixture of methanol and water as a mobile phase, reverse-phase medium pressure chromatography (Reverse MPLC ) And isolating and purifying the compound having the highest activity through confirmation of inhibition of cancer cell growth.

In carrying out the silica gel column chromatography and MPLC, it is preferable to use chloroform and methanol as the mobile phase, and it is more preferable that the ratio of chloroform: methanol is sequentially 0: 100 at 100: 0.

In the reverse MPLC, the mobile phase is preferably methanol and water, more preferably 0: 100 at a ratio of methanol: water of 100: 0.

To isolate the anticancer active substances, isolates obtained by medium pressure chromatography (MPLC) were subjected to thin-layer chromatography (TLC) to obtain isolates having a similar expansion value (Rf) (MPLC) is carried out again on the separated material which has been confirmed to be the most excellent, and then thin film chromatography (TLC) is carried out one to six times.

The anticancer composition according to the present invention has a cytotoxic effect on cancer cells and can be used for prevention and treatment of lung cancer, stomach cancer, prostate cancer, cervical cancer, colon cancer, breast cancer, liver cancer, oesophageal cancer and ovarian cancer.

The anticancer composition according to the present invention may be prepared by using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the active ingredient, the subcutaneous fraction, the vomifoliol or the stigmasterol, A disintegrant, a sweetener, a binder, a coating agent, a swelling agent, a lubricant, a lubricant, and a flavoring agent.

The anticancer composition may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the active ingredient described above for administration.

The pharmaceutical composition may be in the form of granules, powders, tablets, coated tablets, capsules, suppositories, liquids, syrups, juices, suspensions, emulsions, drops or injectable solutions. For example, for formulation into tablets or capsules, the active ingredient may be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, and the like. Also, if desired or necessary, suitable binders, lubricants, disintegrants and coloring agents may also be included as a mixture. Suitable binders include, but are not limited to, natural sugars such as starch, gelatin, glucose or beta-lactose, natural and synthetic gums such as corn sweeteners, acacia, tracker candles or sodium oleate, sodium stearate, magnesium stearate, sodium Benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include, but are not limited to, starch, methyl cellulose, agar, bentonite, xanthan gum and the like. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile water and sterile water suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.

[Example]

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1: Separate Extracts and Separate Fractions

The sample (SF-01) used in the invention was deposited with the Institute of Agronomy Science, Seoul National University.

First, 30.84 kg of the dried suspension was crushed finely, and then extracted with 155 L of ethanol three times at room temperature for 3 days after filtration. The filtrate was concentrated by using a rotary vacuum concentrator to obtain 662 g of distilled ethanol extract (yield: about 2.2%) .

The inhibitory activity of the acquired ethanol extract on cancer cells was confirmed by MTT [3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide] method, and the results are shown in Table 1 .

NCI-H727 (human lung carcinoma cell line), MRC-5 (human lung normal cell line), L-132 (human lung normal cell line), PC-3 (human prostate adenocarcinoma cell line) , Human colon adenocarcinoma cell line (HT-29), human stomach adenocarcinoma cell line (MCF-7), human ovarian adenocarcinoma cell line SK-OV-3, SNU-213 pancreas cancer), HEP-2 (human larynx adenocarcinoma cell line) and SK-HEP (human liver adenocarcinoma cell line) were purchased from Korean Cell Line Bank, Seoul, South Korea and HeLa (human cervix adenocarcinoma cell line) and A549 (human lung carcinoma cell line) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA).

NCI-H727, and PC-3, HT-29, AGS, MCF-7, SNU-213 and SK-OV-3 cell line are 37 ℃, 5% CO ₂ Were cultured in RPMI 1640 (Life Technologies, USA) containing 10% FBS and 1% antibiotic-antimycotic solution in 95% air condition. Hela, A549, SK-HEP and MRC-5 cell lines were incubated at 37 ° C in 5% CO ₂ (Life Technologies, USA) containing 95% air in 10% FBS (Life Technologies, USA) and 1% antibiotic-antimycotic solution and 1% glutamine. And HEP-2 and L-132 cell line is 37 ℃, 5% CO ₂ Were cultured in DMEM (Life Technologies, USA) containing 10% FBS and 1% antibiotic-antimycotic solution in 95% air. All cells were cultured in Petri dishes (2 * 10 ⁴ cm-Corning Costar, NY, USA).

A solution of MTT (Sigma-Aldrich) 5 mg / mL substrate in PBS (pH 7.4) was sterile filtered and stored frozen at -20 ° C until used. Cell lines were prepared at 5 * 10 ^-3 cells per well in 96-well plates containing 100 μL complete culture medium and materials prepared at different concentrations. Each test sample was dissolved in DMSO Hybri-Max to a final concentration of 0.1% or less. The culture plates were incubated for 2 days at 37 ° C in a humidified 5% CO 2 atmosphere and washed once with 100 μL PBS. 100 [mu] L of medium containing 0.05% MTT was dispensed into each well and cultured for 4 hours under the same conditions. The MTT solution was removed after 4 hours of incubation and 200 μL DMSO was added to each well and finally shaken for 10 minutes to dissolve the purple formazan crystals formed on the plate.

Cisplatin (Sigma-Aldrich, USA), widely used as an anticancer drug, was used as a positive control and DMSO solution was used as a negative control. Optical density (OD) values were measured at 560 nm and 670 nm using a Molecular Devices VersaMax microplate reader (Sunnyvale, CA, USA), and the control values were extracted from the measured values. All tests were performed in 3 replicates.

The cancer cell growth inhibitory activity was shown as a 50% inhibitory concentration (IC ₅₀ ) of the substance which reduces cell viability by 50% as compared to the control well. The IC ₅₀ values of the test materials were calculated using the Prism 5 software program (GraphPad Software, La Jolla, CA, USA). Percent growth inhibitory power was calculated by the following equation.

[Expression]% growth inhibition = A / B x 100, A; The OD value of the material-treated well cells, B; OD values of control well cells.

Statistical analysis was performed using the SAS 9.13 program (SAS Institute, Cary, NC) and the mean comparison was made by ANOVA (P = 0.05).

^a cell growth inhibitory concentration of 50%.

^b Positive control.

^c Relative toxicity (RT), jambun IC ₅₀ value / IC ₅₀ value of the ethanol extract of cisplatin.

As shown in Table 1, the inhibitory ethanol extract showed an anticancer activity (IC ₅₀ , 9.25-58.78 g / mL) in all cancer cell lines. The IC ₅₀ of the ethanol extract showed an anticancer activity at a concentration of about 1.69 to 37.06 times based on the cisplatin IC ₅₀ for all cancer cell lines.

However, it did not show any toxicity to normal human lung cell lines (L-132, MRC-5) (IC ₅₀ ,> 100 g / mL).

As shown in FIG. 1, in order to isolate the active substance from the distant ethanol extract having inhibited cancer cell growth inhibition activity, 660 g of the distilled ethanol extract was sequentially fractionated with hexane, chloroform, ethyl acetate, butanol and water to obtain 418.44 g, 51.48 g, 8.58 g, 60.39 g, and 121.11 g were obtained, and the inhibitory activity against cancer cell growth of each fraction was evaluated for the A549 lung cancer cell line by the same method. The results are shown in Table 2.

Fraction IC ₅₀ , ^a μg / mL (95% CL ^b ) Slope ± SE χ ^2c P-value Ethanol fraction 15.71 (13.53-18.23) 1.50 ± 0.92 4.00 0.9720 Hexane-soluble fr. 30.34 (27.29-99.74) 1.08 ± 0.88 1.61 0.9964 Chloroform-soluble fr. 9.70 (8.28-11.37) 1.06 ± 0.91 2.51 0.9662 Ethyl acetate-soluble fr. 34.63 (27.27 to 43.98) 3.42 ± 0.86 7.82 0.9700 Butanol-soluble fr. 91.94 (75.18-112.4) 1.06 + - 0.82 3.56 0.9874 Water-soluble fr. > 100 - - -

^a cell growth inhibitory concentration of 50%.

^b CL means confidence limit.

^c Pearson's square value (χ ² ) for fitness tests.

As shown in Table 2, the chloroform fraction showed the strongest inhibitory activity against cancer cell growth on the basis of the IC ₅₀ value, and the hexane fraction and the ethyl acetate fraction showed moderate cancer cell growth inhibitory activity. On the other hand, the butanol fraction and the water fraction did not show any activity at all.

Example 2: Separation and purification of anticancer active substances

2-1: Isolation and purification of active body 1

As shown in Fig. 2, the chloroform fraction, which was confirmed to have the best inhibitory activity against cancer cell growth in Example 1, was loaded on a column chromatography (5.5 cm id x 70 cm, filled with 600 g silica gel), followed by elution with chloroform and methanol (1 L), 95: 5 (2 L), 90:10 (1 L), 80:20 (1 L), 70:30 (1 L) L), 0: 100 (1 L), v / v] to obtain 37 fractions (180 mL each).

The obtained fractions were analyzed by TLC (chloroform: methanol = 95: 5, v / v), and those having the same expansion value were regarded as the same fraction and mixed. Of fractions 23 ~ 36 (C4, 14.86g) a chromatographic medium pressure for Photography ^{(MPLC) (Isolera one Biotage ®} medium-pressure liquid chromatograph, Uppsala, Sweden) was further fractionated. The fractions were added to the chloroform mobile phase sequentially with methanol (100: 0 (847 mL), 98: 2 (657 mL), 97: 3 (382 mL), 95: ), 90:10 (281 mL), 86:14 (127 mL), 85:15 (369 mL), 80:20 (335 mL), 0: 100 (800 mL), v / v]. A total of 190 fractions (about 22 mL each) were obtained at a flow rate of 25 mL / min per minute. The column fractions were analyzed by TLC (chloroform: methanol = 95: 5, v / v). The fractions with similar expansion values (Rf) on TLC were sprayed with 5% sulfuric acid solution, and after heating, they were combined into one.

The resulting fractions 82 to 165 (C43, 5.40 g) were further fractionated by medium pressure chromatography (MPLC). The fractions were added to the chloroform mobile phase sequentially with methanol [99: 1 (992 mL), 98: 2 (46.2 mL), 95: 5 (396 mL), 93: ), 90:10 (1379.4 mL), 85:15 (508.2 mL), 83:17 (481.8 mL), 80:20 (323.4 mL), 0: 100 (800 mL), v / v]. A total of 175 fractions (25 ml each) were obtained at a flow rate of 25 mL / min per minute. The column fractions were analyzed by TLC (chloroform: methanol = 90:10, v / v).

The obtained 17-40 fractions (C432, 2.13 g) were further fractionated by medium pressure chromatography (MPLC). The fractions were successively added to the chloroform mobile phase with methanol sequentially (100: 0 (699.6 mL), 97: 3 (59.4 mL), 95: 5 (1023 mL), 90:10 (910.8 mL), 85:15 ), 80:20 (699.6 ml), 70:30 (330 ml), 0: 100 (800 ml), v / v] The flow rate of the mobile phase per minute was 25 ml / min. The column fractions were analyzed by TLC (chloroform: methanol = 90:10, v / v).

The resulting 13-50 fractions (C4322, 0.84 g) were further fractionated by medium pressure chromatography (MPLC). The fractions were sequentially added to the chloroform mobile phase with methanol sequentially (100: 0 (580.8 mL), 99: 1 (165 mL), 98: 2 (132 mL), 97: ), 95: 5 (534.6 ml), 94: 6 (316.8 ml), 93: 7 (415.8 ml), 92: 8 (330 ml), 91: 9 (297 ml) and 0: 100 (800 mL)]. A total of 165 fractions (22 ml each) were obtained at a flow rate of 25 mL / min per minute. The column fractions were analyzed by TLC (chloroform: methanol = 90:10, v / v).

The resulting fractions 1 to 20 (C43221, 6.0 mg) were further fractionated by preparative HPLC to obtain C432212 (retention time 28.83 min) as the active substance 1 of the active layer (FIG. 3). The column used for preparative HPLC was μBondapak C ₁₈ (7.8 mm id * 300 mm; Waters, Milford, Mass., USA) and the mobile phase was eluted with methanol and water at a fixed ratio of 50:50 (v / v) to 1.0 ml per minute. The UV detector was fixed at 244 nm.

2-2: Isolation and purification of active body 2

The fraction (C43224, 0.76 g) obtained by further fractionation of the fraction (C4322, 0.84 g) by medium pressure chromatography (MPLC) in the same manner as in 2-1 was further fractionated by medium pressure chromatography (MPLC) . The fractions were successively added to the chloroform mobile phase with methanol sequentially [100: 0 (448.8 mL), 99: 1 (59.4 mL), 98: 2 (52.8 mL), 95: ), 90:10 (257.4 mL), 89:11 (85.8 mL), 88:12 (158.4 mL), 85:15 (237.6 mL), 83:17 (237.6 mL), 80:20 (198 mL) 0: 100 (800 mL), v / v]. A total of 65 fractions (22 ml each) were obtained at a flow rate of 25 mL / min per minute. The column fractions were analyzed by TLC (chloroform: methanol = 90:10, v / v).

The resulting 45-50 fractions (C432242, 9.5 mg) were further fractionated by reverse phase medium pressure chromatography (Reverse MPLC) to obtain C4322426 (retention time 44.84 min) as the active layer 2 active substance 2 (FIG. 4). The mobile phase was eluted with 1.0 mL / min of methanol and water at 80:20 (v / v), and the UV detector was fixed at 214 nm.

As to the fraction layers separated by the medium pressure chromatography (MPLC) and the thin layer chromatography (TLC) and finally the fraction layers separated by HPLC, the A549 lung cancer cell line was evaluated for inhibiting cancer cell growth by the same method as in Example 1 And the results are shown in Table 3.

Fraction IC ₅₀ , ^a mg / mL (95% CL ^b ) Slope ± SE χ ^2c P -value C1 > 100 - - - C2 > 100 - - - C3 35.19 0.9 ± 0.71 3.32 0.9845 C4 8.64 0.9 ± 0.73 2.82 0.9677 C5 50.95 1.5 ± 0.52 9.85 0.9399 C41 > 100 - - - C42 > 100 - - - C43 7.90 1.0 ± 0.71 1.84 0.9849 C44 9.14 0.9 ± 0.39 3.92 0.9463 C45 > 100 - - - C431 10.21 1.6 ± 0.93 1.35 0.9929 C432 2.72 0.8 ± 0.34 2.02 0.9479 C433 3.40 0.8 ± 0.21 1.29 0.9639 C434 37.10 1.7 ± 0.96 5.40 0.9807 C435 > 100 - - - C4321 23.84 1.6 ± 0.32 8.44 0.9311 C4322 1.12 0.5 ± 1.87 3.15 0.9244 C4323 2.87 0.8 ± 0.54 1.22 0.9760 C4324 > 100 - - - C4325 > 100 - - - C4326 > 100 - - - C43221 2.01 0.5 ± 0.36 2.56 0.9119 C43222 3.52 0.5 ± 0.27 1.44 0.9781 C43223 4.65 0.6 ± 0.40 1.46 0.9827 C43224 1.63 0.5 ± 0.40 0.80 0.9898 C43225 1.84 0.5 ± 0.40 0.49 0.9964 C43226 54.46 1.0 ± 1.07 7.99 0.9337 C432211 - - - - C432212 - - - - C432213 - - - - C432241 8.80 0.9 ± 0.69 1.38 0.9921 C432242 1.41 0.5 ± 0.20 2.11 0.9321 C432243 61.01 1.2 ± 0.82 3.74 0.9862 C432244 51.14 1.5 ± 0.13 8.99 0.9354 C432245 > 100 - - - C432251 34.36 0.9 ± 0.46 5.69 0.9522 C432252 > 100 - - - C432253 5.75 0.7 ± 0.46 1.80 0.9789 C432254 2.41 0.7 ± 0.28 2.22 0.9393 C432255 1.73 0.4 ± 0.31 0.93 0.9867 C4322421 51.68 1.2 ± 0.93 2.70 0.9927 C4322422 > 100 - - - C4322423 26.80 1.4 ± 0.82 4.65 0.9782 C4322424 2.56 0.9 ± 0.42 1.06 0.9815 C4322425 2.23 0.9 ± 0.01 1.70 0.9387 C4322426 2.19 0.7 ± 0.55 0.82 0.9888 C4322427 26.63 1.2 ± 0.63 5.32 0.9639

^a cell growth inhibitory concentration of 50%.

^b CL means confidence limit.

^c Pearson's square value (χ ² ) for fitness tests.

Example 3: Identification of antitumor active substance

¹ H-NMR (600 MHz, Rheinstetten, Baden-Württemberg, Germany), ¹³ C-NMR (150 MHz, Rheinstetten, Baden, Germany) to identify the C432212 fraction and the C4322426 fraction of the colorless powder isolated in Example 2 -Wurttemberg, Germany) and DEPT analysis were commissioned to NICEM (National Institute of Agronomy Science, Seoul National University).

3-1: Identification of active body 1 (C432212)

5, the mass spectrum of C432212 showed the strongest peak [M] ⁺ at 124 m / z (EI-MS (70 eV), relative intensity: 124 [M] ] ⁺ (100), 55 (10), 59 (10), 95 (10), 111 (15), 124 (100), 135 (11), 150 (11), 168 (13).

¹ H-NMR (MeOD, 600 MHz) and ¹³ C-NMR (MeOD, 150 MHz) data of C432212 are shown in Table 4.

Position Partial
structure ? _C (ppm) [delta] _H (ppm) ? _C (ppm) [delta] _H (ppm)
Xiaoxi et al. (1999) One C 162.6 162.5 2 CH 127.2 6.11, s 126.9 5.91, s 3 C 198.9 198.1 4 CH ₂ 50.1 2.42, d
( J = 18.0 Hz) 49.8 2.45, d
( J = 17.0 Hz) 5 C 42.2 41.2 6 C 79.8 79.0 7 CH 135.7 5.88, d
( J = 16.2 Hz) 135.7 5.79, d
( J = 15.5 Hz) 8 CH 134.2 5.88, dd
( J = 16.2, 6.2 Hz) 134.7 5.86, dd
( J = 15.5, 6.0 Hz) 9 CH 69.0 4.08, m 68.1 4.42, m 10 CH ₃ 23.6 1.27, d
( J = 1.8 Hz) 22.9 1.30, d
( J = 1.5 Hz) 11 CH ₃ 21.1 1.82, s 19.9 1.90, s 12 CH ₃ 24.1 0.99, s 23.7 1.02, s 13 CH ₃ 24.1 0.99, s 23.7 1.02, s

As shown in Table 4, it was confirmed that C432212 was basically a material composed of 13 carbons through NMR spectrum, and it was confirmed from the DEPT data of FIG. 6 that it had four methyl groups, two hydroxyl groups, and one ketone group .

The above results are compared with those of the conventional literature (Liua X., Tiana F., Zhanga HB, Pilarinoub E., and McLaughlina JL, Biologically Active Blumenol from the Leaves of Annona Glabra. Natural Product Letters, 14 (1): 77-81, 1999 ), It was confirmed that C432212 had a C ₁₃ H ₂₀ O ₃ molecular formula and was a vomifoliol (blumenol A) represented by the general formula (1).

3-2: Identification of active body 2 (C4322426)

7, the mass spectrum of C4322426 showed the strongest peak [M] ⁺ at 69 m / z (EI-MS (70 eV), m / z (% relative intensity): 69 [ M] ⁺ (100), 55 (71), 69 (100), 251 (65), 269 (40), 379 (73), 383 (50), 395 (67), 412 (88).

¹ H-NMR (MeOD, 600 MHz) and ¹³ C-NMR (MeOD, 150 MHz) data of C4322426 are shown in Table 5.

Position Partial
structure ? _C (ppm) [delta] _H (ppm) ? _C (ppm) [delta] _H (ppm)
Peter and Katalin (2004) One CH ₂ 37.2 1.38, 1.13, m 37.6 1.54, 1.08, m 2 CH ₂ 31.7 1.56, 1.31, m 31.9 1.51, 1.31, m 3 CH 71.6 3.25, m 72.0 3.51, m 4 CH ₂ 41.8 2.23, 1.98, m 42.5 2.23, 2.30, m 5 C 140.8 140.8 6 CH 121.8 5.37, m 121.8 5.34, m 7 CH ₂ 32.0 2.04, 1.79, m 32.1 1.97, 1.50, m 8 CH 31.8 1.45, m 32.2 1.46, m 9 CH 50.8 1.44, m 50.5 1.46, m 10 C 37.7 36.5 11 CH ₂ 21.1 1.52, 1.27, m 21.2 1.50, 1.20, m 12 CH ₂ 39.9 1.56, 1.31, m 40.0 1.51, 1.18, m 13 C 43.0 42.2 14 CH 56.6 1.40, m 57.1 1.20, m 15 CH ₂ 26.4 1.60, 1.35, m 26.5 1.56, 1.28, m 16 CH ₂ 28.6 1.60, 1.35, m 28.9 1.56, 1.28, m 17 CH 56.4 1.51, q 56.3 1.50, q 18 CH ₃ 12.3 1.04, s 12.2 1.06, s 19 CH ₃ 19.3 1.30, s 19.5 1.24, s 20 CH 40.1 2.33, m 40.4 2.06, m 21 CH ₃ 20.2 1.11, d 21.4 1.06, d 22 CH 138.3 5.48, dd
( J = 15.8 Hz) 138.3 5.18, dd
( J = 15.2 Hz) 23 CH 129.5 5.48, dd
( J = 9.2 Hz) 129.7 5.04, dd
( J = 8.6 Hz) 24 CH 52.2 2.15, m 51.5 2.18, m 25 CH 31.9 1.86, m 32.0 1.55, m 26 CH ₃ 21.1 0.91, d 21.2 0.85, d 27 CH ₃ 21.1 0.91, d 21.2 0.85, d 28 CH ₂ 25.4 1.44, m 25.4 1.43, m 29 CH ₃ 12.3 0.90, m 12.2 0.81, m

As shown in Table 5, the C4322426 was basically a substance consisting of 20 hydrogen atoms and 29 carbon atoms, and it was found from the DEPT data of FIG. 8 that the 10 carbon atoms having a steroid skeleton attached at the C-17 position It was confirmed that the phytosterol group of one side chain was present.

The above results are compared with those of the existing literature (Forgo P. & Kover KE, Gradient enhanced selective experiments in the 1 H-NMR chemical shift assignment of the skeleton and side-chain resonances of stigmasterol, a phytosterol derivative. Steroids, 69 , 2004), it was confirmed that C4322426 had a molecular formula of C ₂₉ H ₄₈ O and was a stigmasterol represented by the formula (2).

Experimental Example 1: Confirmation of anticancer cell growth inhibitory activity of bamipolol and stigmasterol

1-1: A549 lung cancer cell line

The cell growth inhibitory activity of bupivir polyol, stigmasterol and anticancer agent cisplatin (Sigma-Aldrich, USA) isolated in Example 2 and identified in Example 3 on A549 lung cancer cell line was evaluated by the MTT method described in Example 1 , And the results are shown in Table 6.

Compound IC ₅₀ , ^a μM (95% CL ^b ) Slope ± SE χ ^2c P-value RT ^d Vomifoliol 51.66 (42.47-62.86) 0.03 ± 0.51 1.59 0.991 3.1 Stigmasterol 48.41 (42.43 - 55.25) 0.04 0.71 1.62 0.995 2.9 Cisplatin 16.53 (14.20 to 19.26) 0.63 + - 0.55 0.52 0.998 1.0

^a 50% cell growth inhibitory concentration

^b CL means trust limit

^c Pearson's square value (χ ² ) for fitness tests

^d IC ₅₀ value of biphasic polyol or stigmasterol relative to cisplatin IC ₅₀ value

As shown in Table 6, the natural Bomi polyol and stigmasterol isolated from jambun the A549 as an IC ₅₀ value of each of 51.66 and 48.41 for the lung cancer cell line, a cell proliferation inhibitory effect rather natatjiman than cisplatin, to determine the possible use as an anticancer agent there was.

1-2: NCI-H727 lung cancer cell line

The cell growth inhibitory activity of the bumipolol, stigmasterol and anticancer agent cisplatin (Sigma-Aldrich, USA) isolated in Example 2 and identified in Example 3 on the NCI-H727 lung cancer cell line was measured by the MTT method described in Example 1 The results are shown in Table 7.

Compound IC ₅₀ , ^a μM (95% CL ^b ) Slope ± SE χ ^2c P-value RT ^d Vomifoliol 51.84 (46.18-58.13) 0.01 ± 0.41 0.70 0.997 3.9 Stigmasterol 46.21 (38.75-55.13) 0.03 ± 0.45 1.60 0.991 3.4 Cisplatin 13.40 (9.87-18.16) 0.02 0.34 0.70 0.996 1.0

^a 50% cell growth inhibitory concentration

^b CL means trust limit

^c Pearson's square value (χ ² ) for fitness tests

^d IC ₅₀ value of biphasic polyol or stigmasterol relative to cisplatin IC ₅₀ value

As shown in Table 7, this is possible using a natural Bomi polyol and stigmasterol are slightly NCI-H727 as an IC ₅₀ value of each of 51.84 and 46.21 for the lung cancer cell lines, cell growth inhibitory effect than cisplatin natatjiman, anticancer agents isolated from jambun I could confirm.

Experimental Example 2: Preparation of Bream Polyol and Stigmasterol Akt1  And Bcl-2  Evaluation of effect on gene expression

Time-resolved quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was used to evaluate the inhibition of Akt1 and Bcl- 2 gene expression of bamipolol and stigmasterol isolated in Example 2 and identified in Example 3.

Real-time qRT-PCR was performed using SYBR Green dye to assess gene expression levels. A549 cell lines cultured in a cell culture flask (25 cm ² , Corning Costar, NY, USA) were treated with 12.5, 25 and 50 μg / mL of each test compound (bamipholol, stigmasterol).

After 2 days of treatment, total RNA was extracted with RNeasy kit (Qiagen, Hilden, Germany), and the contaminated genomic DNA was removed with RQ1 RNeas-free DNAase (Promega, Madison, WI, USA) (Invitrogen, Carlsbad, Calif.).

To verify PCR efficiency (100 ng to 10 pg per reaction), cDNA for each RNA was diluted (5 sections) with log10-fold and then subjected to qRT-PCR (Applied Biosystem StepOne-plus real-time PCR system, Applied Biosystems, Foster, CA USA).

First, each reaction mixture of 10 μL Maxima SYBR Green / ROX qPCR Master Mix (2x), 2 μL forward and reverse primers (5 pmol each) (see Table 8), 1 μL cDNA (8 ng) and 7 μL diethylpyrocarbonate- 20 μL total) was prepared and then subjected to 50 cycles of 50 minutes at 50 ° C. for 2 minutes, 95 ° C. for 10 minutes, and 95 ° C. for 15 seconds, followed by qRT-PCR of GAPDH, Akt1 and Bcl-2 at 60 ° C. for 30 seconds.

The mRNA expression level of the target gene was adjusted to the level of the housekeeping gene GAPDH mRNA and analyzed using StepOne Software v2.1 / DataAssist Software (Applied Biosystems). The results are shown in Figs. 9 and 10. Each graph was presented with mean and standard error (mean ± SE) of 3 replicates, and the mean liver comparisons were using the ferroni (P = 0.05, ***: p <0.001, **: p <0.01, *: p < 0.05, ns = no significant).

Gene name RefSeq ID Forward primer
and Reverse primer sequence cDNA amplicon size GAPDH M32599 F: TGCACCACCAACTGCTTAG
R: GGATGCAGGGATGATGTTCTG 177 Akt1 NM_005163.2 F: CAAGCCCAAGCACCGC
R: GGATCACCTTGCCGAAAGTG 80 Bcl-2 NM_000657 F: ATTGGGAAGTTTCAAATCAGC
R: TGCATTCTTGGACGAGGG 301

As shown in Fig. 9, the expression level of Akt1 gene in A549 cells was significantly decreased after treatment with bamipolol or stigmasterol. In particular, it was confirmed that the treatment with bomipolol decreased more than 2.85 times when treated with 12.5 μg / mL or more, and decreased about 1.22 times or more with stigmasterol.

In addition, as shown in Fig. 10, the expression amount of bcl-2 gene in A549 cells was significantly decreased after treatment with bamipolol or stigmasterol. In particular, it was confirmed that the treatment with bomipolol decreased more than 1.27 times when treated with 12.5 μg / mL or more, and decreased more than 14.3 times with stigmasterol.

That is, the bamipolol and stigmasterol extracted from the immune cells inhibit the expression of anti-apoptosis genes Akt1 and bcl - 2 , thereby promoting apoptosis of cancer cells and killing cancer cells.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereto will be. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Claims (12)

delete delete delete delete delete delete The isolated chloroform fraction obtained by adding chloroform to the remaining ethanol extract fraction was fractionated by silica gel column chromatography while sequentially adding methanol to the mobile phase of chloroform. The fraction having the highest activity was isolated by confirming inhibition of cancer cell growth, After fractionation by MPLC, the highest activity fraction was isolated by confirmation of the inhibition of cancer cell growth, followed by separation by preparative high performance liquid chromatography (HPLC) A method for separating a vomifoliol having anticancer activity from an immobilizing agent, which comprises separating and purifying a high compound.
[8] The method according to claim 7, wherein the step of separating the fraction having the highest activity through fractionation through MPLC and inhibiting the growth of cancer cells comprises the steps of (i) sequentially adding methanol to the chloroform mobile phase, Separating the fractions; (Ii) separating the fraction having the highest activity by sequentially adding methanol to the chloroform mobile phase in the fraction separated in the step (i); (Iii) separating the fraction having the highest activity by sequentially adding methanol to the chloroform mobile phase in the fraction separated in the step (ii); (Iv) sequentially adding methanol to the chloroform mobile phase to separate the fractions separated in step (iii), thereby separating the fraction having the highest activity, wherein the mobile phase of the preparative high performance liquid chromatography (HPLC) Water (50: 50 (v / v)). The method of separating the vomifoliol having anticancer activity from the immobilization.
The isolated chloroform fraction obtained by adding chloroform to the remaining ethanol extract fraction was fractionated by silica gel column chromatography while sequentially adding methanol to the mobile phase of chloroform. The fraction having the highest activity was isolated by confirming inhibition of cancer cell growth, The fractions with the highest activity were separated by reverse transcription chromatography (MPLC) to confirm the inhibition of cancer cell growth. Then, the fractions were separated by reversed-phase medium pressure chromatography (reverse MPLC) A method for separating stigmasterol having anticancer activity from a suspension comprising separating and purifying a high compound.
10. The method according to claim 9, wherein the step of separating the fraction having the highest activity through fractionation through MPLC and inhibiting the growth of cancer cells comprises the steps of (i) sequentially adding methanol to the chloroform mobile phase, Separating the fractions; (Ii) separating the fraction having the highest activity by sequentially adding methanol to the chloroform mobile phase in the fraction separated in the step (i); (Iii) separating the fraction having the highest activity by sequentially adding methanol to the chloroform mobile phase in the fraction separated in the step (ii); (Iv) separating the fraction having the highest activity by sequentially adding methanol to the chloroform mobile phase in the step (iii); (V) separating the fractions having the highest activity by sequentially adding methanol to the chloroform mobile phase in the fraction separated in step (iv), wherein the mobile phase of the reverse MPLC is methanol Water (80: 20 (v / v)). The method of isolating stigmasterol having anticancer activity from the immune system. delete delete

Images