KR101735784B1 - Composition for Anti-inflammation Using an Extract of Trigonostemon reidioides - Google Patents

Abstract

The present invention discloses a composition for antiinflammation using Trigonostemmonadioides extract. The extract of Trigonostemmonadioides showed NO production inhibitory activity in LPS (lipopolyssaccharide) stimulated mouse macrophage line (RAW 264.7 cells), and the production of inflammatory cytokines (TNF-α, IL-1β, IL-6) Inhibitory activity.

Description

TECHNICAL FIELD The present invention relates to an anti-inflammatory composition using an extract of Trigonosynthomonadioides,

The present invention relates to the use of Trigonostemon reidioides extract of the present invention.

Inflammation is a local defense of the body that responds to pathological conditions caused by physical trauma, harmful chemicals, bacteria, fungi, viruses, or irritants in vivo metabolites. Inflammation is triggered by various inflammatory mediators produced from damaged tissues and migrating cells. During the inflammation reaction, plasma accumulates on the inflamed area, diluting the toxicities secreted by the bacteria, increasing the blood flow, accompanied by symptoms such as erythema, pain, edema and fever. In normal cases, the organism neutralizes or eliminates the cause of inflammation through the inflammation reaction, regenerates the upper tissue and regenerates the normal structure and function, but if not, the disease state such as chronic inflammation also proceeds.

Recent advances in molecular biology have resulted in a number of studies on the inflammatory response at the molecular level.

Although various biochemical phenomena are involved in the inflammatory reaction, macrophages are known to play an important role in the inflammatory reaction by producing NO (NO) and inflammatory cytokines by chemical stimulation (Ito T., et al Curr Drug Traget Inflamm Allergy, 2 (3): 257-265, 2003). Nitric oxide synthase (NOS) synthesizes nitric oxide from L-arginine. It is composed of three isomers: eNOS (endothelial NOS), nNOS (neurogenic NOS), and iNOS (inductive NOS) And iNOS is a transcription factor of macrophages such as cytokines such as TNF-α, IL-1β, IL-6, IL-8 and IL-12 and endotoxins such as LPS (lipopolysaccharide) It is expressed through activation of NF-κB and produces excess NO (NO). Nitric oxide, which is produced by iNOS in macrophages, reacts with superoxide to form peroxynitrite, which acts as a strong oxidizing agent and damages the cells, resulting in a variety of pathologies including inflammation and cancer (Gupta SC et al., Exp Biol Med., 236: 658-671, 2011; Riehemann et al., FEBS Lett., 442: 89-94, 1999; Stamler et al., Science, 258: 1898 -1902, 1992).

Lipopolysaccharide (LPS), one of the inducers of inflammatory response, is a type of endotoxin present in the outer membrane of gram-negative bacteria and binds to TLR4 (toll-like receptor 4) Activates iNOS expression in macrophages to induce NO production, as well as to activate inflammatory cytokines such as TNF-α, IL-1β and IL-6 (Dobrovolskaia MA, et. al., J Immunol., 170: 508-19, 2003; Ji Y, et al., Cell Physiol Biochem., 25: 631-640, 2010). In other studies, inflammatory cytokines such as TNF-α, IL-1β and IL-6 have been reported to be associated with rheumatoid arthritis (Jang CH et al., Rheumatology, 2006, 45 (6): 703-710), fibromyalgia (Hernandez ME et. (BMC Res. Notes., 2010, 3 (1): 156) and Sjögren's syndrome (Baturone R. et al., Scand J Rheumatol., 2009, 38 (5): 386-389) Which is known to be an important factor for induction.

These findings suggest that inhibition of NO production Drugs that inhibit the production of inflammatory cytokines such as TNF-α, IL-1β, and IL-6 suggest the possibility of being an effective anti-inflammatory agent (Karin M. et al., Cold Spring Harb Perspect Biol., 1, , 2009).

Non-steroidal anti-inflammatory drugs (NSAIDS), which are now widely used as anti-inflammatory drugs, are known to cause serious side effects such as gastrointestinal disorders, hepatic impairment, and renal failure (Rainsford KD., Subcell biochem., 42: 3 -27, 2007, Guruprasad P. Aithal., Rheumatology., 7: 139-150, 2011, Praveen PN Rao et al., Pharmaceuticals., 3: 1530-1549, 2010).

Therefore, it is still necessary to develop new drugs that have anti-inflammatory activity, have fewer side effects, and continue to be effective. Especially, natural products have the advantage of low toxicity.

Trigonostemon reidioides is a plant originating in Cambodia, Vietnam, Thailand, Myanmar and Laos. Root extracts have traditionally been used as expectorants and laxatives (Journal of Natural Products, 53 (5): 1148 -1151, 1990), and rediocides B to E isolated therefrom have been proposed as candidates for insecticides (J Nat Prod. 2004 Feb; 67 (2): 228-31). However, the anti-inflammatory activity of Trigonostemmonadioides has not been proposed to date.

The present invention discloses the anti-inflammatory activity of Trigonostemmonadioides extract.

It is an object of the present invention to provide a composition for anti-inflammation using Trigonostemnemalidioides extract.

It is a specific object of the present invention to provide a pharmaceutical composition for anti-inflammation using Trigonostemmonadioides extract.

Another specific object of the present invention is to provide an anti-inflammatory food composition using Trigonostemmonadioides extract.

It is another specific object of the present invention to provide a cosmetic composition for anti-inflammation using Trigonostemmonadioides extract.

As shown in the following Examples and Experimental Examples, the present inventors have found that the extract of Trigonostemmonoidesis shows NO production inhibitory activity in mouse macrophage cell line (RAW 264.7 cells) stimulated with LPS (lipopolysaccharide), and the inflammatory cytokine (TNF-α, IL-1β and IL-6).

In view of the foregoing, the present invention can be understood as an anti-inflammatory composition comprising Trigonostemal radiodi extract as an active ingredient.

In the present specification, the term " Trigonostomonadhiosidus extract "refers to an extract of Trigonostemmonadioides, a leaf, a fruit, a flower, a root and the like, which is a target to be extracted, with water, a lower alcohol having 1 to 4 carbon atoms such as methanol, ethanol, (DMF), dimethylsulfoxide (DMSO), 1,3-butylene glycol, propylene glycol, or a mixture thereof. The solvent is preferably selected from the group consisting of methylene chloride, ethylene, acetone, hexane, ether, chloroform, ethyl acetate, butyl acetate, Refers to an extract obtained by leaching using a mixed solvent, an extract obtained by using a supercritical extraction solvent such as carbon dioxide or pentane, or a fraction obtained by fractionating the extract, and the extraction method includes considering the polarity, extraction degree, and preservation degree of the active substance Any method such as cooling, reflux, heating, ultrasonic irradiation, supercritical extraction, and the like can be applied. In the case of the fractionated extract, the crude extract is suspended in a specific solvent, and the fractions obtained by mixing and leaving with a solvent having a different polarity are adsorbed on a column packed with silica gel or the like, and a hydrophobic solvent, a hydrophilic solvent or a mixture thereof Quot; means a fraction obtained by using a solvent as a mobile phase. Also, the meaning of the extract includes a concentrated liquid extract or a solid extract in which the extraction solvent is removed by a method such as freeze drying, vacuum drying, hot air drying, spray drying and the like. Preferably an extract obtained by using water, ethanol or a mixed solvent thereof as an extraction solvent, and more preferably an extract obtained by using a mixed solvent of water and ethanol as an extraction solvent.

In the present specification, the term " active ingredient "alone means an ingredient which exhibits the desired activity or which can exhibit activity together with a carrier which is itself inactive.

As used herein, "anti-inflammatory" is meant to include improvement of an inflammatory disease (alleviation of symptoms), treatment, inhibition or delay of onset of such a disease as defined below.

In the present specification, the term "inflammatory disease" means an inflammatory reaction that is determined by an external physical or chemical stimulus or an infection of an external infectious source such as bacteria, fungi, viruses, various allergenic substances, or a local or systemic defense against autoimmunity Which can be defined as a pathological symptom. Such an inflammatory reaction may include activation of various inflammatory mediators and enzymes associated with immune cells (e.g., iNOS, COX-2, etc.), secretion of inflammatory mediators (e.g., secretion of NO, TNF-a, IL-6, IL- It involves a series of complex physiological responses such as fluid infiltration, cell migration, and tissue destruction, and is manifested externally by symptoms such as erythema, pain, edema, fever, loss or loss of specific function of the body. The inflammatory disease may be acute, chronic, ulcerative, allergic or necrotic, so long as it is included in the definition of inflammatory diseases as above, it may be acute, chronic, ulcerative, allergic, Whether it is necrotic or not. Specifically, the inflammatory diseases include asthma, allergic and non-allergic rhinitis, chronic and acute rhinitis, chronic and acute gastritis or enteritis, ulcerative gastritis, acute and chronic nephritis, acute and chronic hepatitis, chronic obstructive pulmonary disease, Inflammatory bowel syndrome, inflammatory pain, migraine headache, headache, back pain, fibromyalgia, fascia disease, viral infection (e.g., C type infection), bacterial infection, fungal infection, burn, wound due to surgical or dental surgery, Rheumatoid arthritis, ankylosing spondylitis, Hodgkin's disease, pancreatitis, conjunctivitis, iritis, scleritis, uveitis, dermatitis (including atopic dermatitis), eczema, multiple sclerosis, etc. Will be included.

The anti-inflammatory composition of the present invention may be contained in any amount (effective amount) as long as it can exhibit the improving activity of an inflammatory disease which is intended to be treated according to the purpose of use, formulation, blending purpose, etc., Will be determined within the range of 0.001 wt% to 15 wt% based on the total weight of the composition. As used herein, the term "effective amount" refers to the amount of active ingredient capable of inducing the improvement, treatment, or inhibition / delay of onset of an inflammatory disease or the onset of such pathological condition in a mammal, preferably a human, to which it is applied. Such effective amounts can be determined experimentally within the ordinary skill of those skilled in the art.

The composition for anti-inflammation of the present invention can be identified as a food composition in a specific embodiment.

The food composition of the present invention can be manufactured as health functional foods such as functional beverages, health supplements, special nutrition supplements, etc. The forms of foods include beverages such as tea, juice, carbonated beverage, ionic drink, milk, Food products such as processed oil, gum, rice cake, Korean lamb, bread, confectionery, cotton, etc., powders of health functional foods such as powders, tablets and capsules.

The food composition of the present invention may contain sweetening agents, flavoring agents, physiologically active ingredients, minerals and the like in addition to the active ingredients thereof.

Sweetening agents may be used in an amount that sweetens the food in a suitable manner, and may be natural or synthetic. Preferably, natural sweeteners are used. Examples of natural sweeteners include sugar sweeteners such as corn syrup solids, honey, sucrose, fructose, lactose and maltose.

Flavors may be used to enhance taste or flavor, both natural and synthetic. Preferably, a natural one is used. When using natural ones, the purpose of nutritional fortification can be performed in addition to the flavor. Examples of natural flavoring agents include those obtained from apples, lemons, citrus fruits, grapes, strawberries, peaches, and the like, or those obtained from green tea leaves, Asiatica, Daegu, Cinnamon, Chrysanthemum leaves and Jasmine. Also, those obtained from ginseng (red ginseng), bamboo shoots, aloe vera, banks and the like can be used. The natural flavoring agent may be a liquid concentrate or a solid form of extract. Synthetic flavors may be used depending on the case, and synthetic flavors such as esters, alcohols, aldehydes, terpenes and the like may be used.

Examples of the physiologically active substance include catechins such as catechin, epicatechin, gallocatechin and epigallocatechin, and vitamins such as retinol, ascorbic acid, tocopherol, calciferol, thiamine and riboflavin.

As the mineral, calcium, magnesium, chromium, cobalt, copper, fluoride, germanium, iodine, iron, lithium, magnesium, manganese, molybdenum, phosphorus, potassium, selenium, silicon, sodium, sulfur, vanadium and zinc can be used.

In addition, the food composition of the present invention may contain preservatives, emulsifiers, acidifiers, thickeners and the like as needed in addition to the above sweeteners.

Such preservatives, emulsifiers and the like are preferably added in a very small amount as long as they can attain an application to which they are added. The term " trace amount " means, when expressed numerically, in the range of 0.0005% by weight to about 0.5% by weight based on the total weight of the food composition.

Examples of the preservative which can be used include calcium sodium sorbate, sodium sorbate, potassium sorbate, calcium benzoate, sodium benzoate, potassium benzoate and EDTA (ethylenediaminetetraacetic acid).

Examples of the emulsifier which can be used include acacia gum, carboxymethyl cellulose, xanthan gum, pectin and the like.

Examples of the acidulant that can be used include acid, malic acid, fumaric acid, adipic acid, phosphoric acid, gluconic acid, tartaric acid, ascorbic acid, acetic acid, and phosphoric acid. Such an acidulant may be added so that the food composition has a proper acidity for the purpose of inhibiting the growth of microorganisms other than the purpose of enhancing the taste.

Agents that may be used include suspending agents, sedimentation agents, gel formers, bulking agents and the like.

In addition, the food composition of the present invention may contain a powder or extract derived from a natural product in order to improve flavor or palatability and to impart other functionalities, and may be a pregelatinized powder or extract, a soybean powder or extract, a shell powder or extract, Extracts, juice or extracts of ginseng, extracts of ginseng, extracts of ginseng, extracts of ginseng, extracts of ginseng, extracts of ginseng, extracts of ginseng, extracts of ginseng juice or extracts, extracts of ginseng juice or extracts, extracts of ginseng juice or extracts, extracts of spinach juice or extracts, lotus juice or extracts, Powder or extract, licorice powder or extract, granular powder or extract, granular powder or extract, sine powder or extract, pistachio powder or extract, ginger powder or extract, jujube powder or extract, Water-based powder or extract, dried powder or extract, Or extract, dermis (crustacea bark) powder or extract, ginger powder or extract, green tea powder or extract, omija powder or extract, hinoki powder or extract, dirt powder or extract, egg yolk powder or extract, cinnamon powder or extract, Cyano and the like can be exemplified. Such an extract may be obtained by mixing the object to be extracted.

In another specific embodiment, the composition for anti-inflammation of the present invention can be identified as a cosmetic composition.

The cosmetic composition of the present invention may contain, in addition to its active ingredient, conventional additives and carriers such as stabilizers, solubilizers, surfactants, vitamins, pigments and antioxidants, which are commonly used in cosmetic compositions.

The cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.

When the formulation of the present invention is a paste, cream or gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in the case of spray, additionally chlorofluorohydrocarbons, propane / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

When the formulation of the present invention is an interfacial active agent-containing cleansing, the carrier component is selected from aliphatic alcohol sulfates, aliphatic alcohol ether sulfates, sulfosuccinic acid monoesters, isethionates, imidazolinium derivatives, methyltaurate, sarcosinate, fatty acid amides Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters.

The cosmetic composition of the present invention can be produced according to a method for producing a cosmetic composition which is conventionally performed in the art, except that it contains an active ingredient exhibiting anti-inflammatory activity.

The anti-inflammatory composition of the present invention can be identified as a pharmaceutical composition in another specific embodiment.

The pharmaceutical composition of the present invention may be in a form suitable for oral use (tablets, suspensions, granules, emulsions, capsules, syrups, etc.), parenteral formulations (sterile injectable aqueous or non- Ointments, ointments, solutions, creams, ointments, gels, lotions, patches, and the like).

The term "pharmaceutically acceptable" as used herein means that the application (subject) does not have the above-mentioned toxicity that is adaptable without inhibiting the activity of the active ingredient.

Examples of the pharmaceutically acceptable carrier include lactose, glucose, sucrose, starch (e.g., corn starch, potato starch, etc.), cellulose, derivatives thereof (e.g., sodium carboxymethyl cellulose, ethylcellulose), malt, gelatin, talc, (E.g., peanut oil, cottonseed oil, sesame oil, olive oil, etc.), polyols (e.g., propylene glycol, glycerin and the like), alginic acid, and the like. Depending on the formulation of the pharmaceutical composition of the present invention, one or more suitable ones may be selected and used. For suitable pharmaceutically acceptable carriers and formulations see Remington ' s Pharmaceutical Sciences (19th ed., 1995). The pharmaceutical composition of the present invention may further comprise an emulsifier (e.g., TWEENS), a wetting agent (e.g., sodium lauryl sulfate), a coloring agent, a flavoring agent, a stabilizer, a preservative, water, saline, a phosphate buffer solution and the like.

The excipient may be selected according to the formulation of the pharmaceutical composition of the present invention. For example, suspending agents such as sodium carboxymethyl cellulose, methyl cellulose, hydropropyl methyl cellulose, sodium alginate, polyvinyl pyrrolidone, .

The pharmaceutical composition of the present invention can be administered orally or parenterally, and its daily dose is usually in the range of 0.001 to 150 mg / kg body weight, and can be administered once or several times. However, since the dosage of the pharmaceutical composition of the present invention is determined in view of various related factors such as route of administration, age, sex, weight, and patient's severity of the patient, the dose is limited in any aspect to the scope of the present invention It should not be understood.

As described above, according to the present invention, it is possible to provide an anti-inflammatory composition using Trigonostemmonadioides extract.

The anti-inflammatory composition of the present invention can be commercialized into foods, cosmetics, medicines, etc. for the purpose of improving inflammatory diseases and the like.

Fig. 1 shows the results of the inhibition of NO production in LPS-stimulated mouse macrophage line (RAW 264.7 cells) of Trigonostomonadhiides extract.
Figure 2 shows the results of cytotoxicity of LPS-stimulated mouse macrophage cell line (RAW 264.7 cells) of Trigonostomene radiosides extract.
FIG. 3 shows the results showing the activity of inhibiting the production of inflammatory cytokines (TNF-α, IL-1β and IL-6) in LPS-stimulated mouse macrophage cell line (RAW 264.7 cells) of Trigonostomonadhiides extract.

Hereinafter, the present invention will be described with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to these examples and experimental examples.

< Example > Trigo Nostemona Lady O'Deis  Preparation of extract

1 L of 70% ethanol was added to 100 g of leaf ground powder of Trigonostemon reidioides , and the mixture was repeatedly extracted once at room temperature for 24 hours and then filtered with a filter paper. The resulting 70% ethanol filtrate was concentrated under pressure, and then lyophilized to obtain a trinhosynthomonadioides extract.

< Experimental Example > Trigo Nostemona Lady O'Deis  Anti-inflammatory activity of extracts

Experimental Example 1 NO assay and cytotoxicity assay ( MTT assay)

Mouse macrophages RAW 264.7 cells were cultured in a 10% FBS DMEM medium at 37 ° C and 5% CO ₂ . RAW 264.7 macrophages were seeded at a density of 5 × 10 ⁴ cells / well in a 96-well plate. After 24 hours, the samples of the present invention were first treated for 1 hour at 37 ° C. and 5% CO ₂ concentration and then treated with lipopolyssaccharide ) And cultured for 24 hours.

delete

- Nitric Oxide (NO) method: 1M NaNO ₂ (sodium nitrite) was diluted to 0, 1.56uM, 3.12uM, 6.25uM, 12.5uM, 25uM, 50uM, and 100uM using standard curves. After 1: 1 mixture of 0.1% N- (1-naphtyl) ethylenediamine dihydrochloride reagent and 1: 1 mixture of 1: 1 reagent and culture supernatant for 24 hours after sample treatment, the mixture was kept at room temperature for 10 minutes Absorbance was measured at 540 nm and the inhibitory effect of NO production on the control group was measured. N-monomethyl-L-arginine (L-NMMA) was used as a positive control.

- Cytotoxicity assay (MTT assay): 5 μl of MTT solution was added to the medium at 100 μl / well and incubated at 37 ° C in a 5% CO ₂ incubator for 2 hours. The medium was removed and DMSO was added at 100 μl / well . Shaker for 15 minutes and absorbance was measured at 540 nm using an ELISA reader.

The NO production inhibition results are shown in Fig. 1, and the MTT assay results are shown in Fig.

The sample of the Example (Trigonostemmonadioides extract, NIBR No. 87) exhibited a concentration-dependent inhibition of NO production and showed almost no cytotoxicity.

Experimental Example 2: Inhibitory activity against the production of inflammatory cytokines ( RT - PCR )

Mouse macrophages RAW 264.7 cells are seeded on a 60 mm plate at a cell number of 1.6 × 10 ⁶ cells / well and incubated for 24 hours at 37 ° C and 5% CO ₂ . The sample of the example (NIBR No. 87) was pretreated for 1 hour by concentration, treated with LPS (lipopolysaccharide), washed with PBS (phosphate buffered saline) for 24 hours, and treated with Trizol and chloroform to isolate RNA. CDNA was synthesized by reverse transcription polymerase chain reaction using Superscript III (Invitrogen), a reverse transcriptase. Using the synthesized cDNA as a template, DNA was amplified by 35 cycles of PCR under the conditions of 94 ° C. for 45 seconds, 55 ° C. for 45 seconds, and 72 ° C. for 1 minute and 30 seconds through a polymerase chain reaction. The gene expression inhibitory effect was compared on agarose gel. The primers used were shown in Table 1 below and the control gene was GAPDH. As a positive control, dexamethasone was used.

primer TNF- F: 5 'CACCACGCTCTTCTGTCTACTGAAC 3' (SEQ ID NO: 1) R: 5 'CCGGACTCCGTGATGTCTAAGTACT 3' (SEQ ID NO: 2) IL-4 F: 5 'ACCTTGCTTCACCCTGTTC 3' (SEQ ID NO: 3) R: 5 'TTGTGAGCGTGGACTCATTC 3' (SEQ ID NO: 4) IL-10 F: 5 'TAGAAGTGATGCCCCAGG 3' (SEQ ID NO: 5) R: 5 'TCATCCTCCACCTGCTCCACTGC 3' (SEQ ID NO: 6) GAPDH F- GAGTCAACGGATTTGGTCGT (SEQ ID NO: 7) R-GACAAGCTTCCCGTTCTCAG (SEQ ID NO: 8)

The results are shown in Fig. 3, it can be seen that the sample of the example (NIBR No. 87) inhibits the production of inflammatory cytokines (TNF-α, IL-1β, IL-6) in a concentration-dependent manner.

Claims (6)

Trigonosynthostatic extracts containing an extract of Leiden oides as an active ingredient,
Wherein the Trigonostemmoniaeidis leaf extract is obtained by extracting Trigonostemmonadioides leaf with a mixed solvent of water and ethanol
Composition for antiinflammation.
delete delete The method according to claim 1,
Wherein the composition is a pharmaceutical composition.
The method according to claim 1,
Wherein the composition is a food composition.
The method according to claim 1,
Wherein the composition is a cosmetic composition.

Images