KR101734636B1 - Element involved in ALT in cells and its use - Google Patents

Abstract

This disclosure discloses T-ALT 1 and 2 elements and their uses that work in an alternative mechanism of telomer length maintenance. The element according to the present invention may be used as a marker for detecting intracellular ALT activity or may be useful for screening cancer therapeutic substances and the like.

Description

[0002] Elements involved in intracellular alternative telomeric retention activity and their uses,

The present invention relates to a mechanism involved in telomere length extension in a cell, involving nucleic acid sequences and uses thereof.

Linear chromosomes are not completely cloned, and their length gradually decreases as they are replicated. Telomere is a repeating sequence located at the end of a chromosome. Its length limits the number of cell divisions to an appropriate level. When the telomere length becomes shorter than the appropriate level, the cell stops dividing. Therefore, telomere prevents the continued division of normal cells, and eventually inhibits normal cells from developing into cancer cells.

Therefore, cancer cells have a mechanism to maintain sufficient telomere length to continue to divide beyond a limited number of divisions. Telomere synthesis through telomerase activity and Alternative Lengthening of Telomere, ALT). In the former case, there has been a lot of research to be awarded the Nobel Prize in 2009, but little is known about the latter, the alternative mechanism of telomeric retention and its activity.

J. D. Henson et al. (Nature biotechnology 27, 1181-1185 (2009)) discloses C-circle formation as an ALT in human cells.

This is an important target of cancer therapy because cancer cells undergo telomere ligation under certain conditions or by telomere maintenance mechanisms by ALT. Therefore, it is very important to determine whether the cancer cells are ALT or telomerase positive. In addition, it is necessary to develop a cancer treatment agent through identification of telomerase maintenance mechanism.

The present invention seeks to provide an alternative telomer length maintenance mechanism and its use.

In one embodiment, the polynucleotide of SEQ ID NO: 1 comprises three kinds of unit sequences of (TTAGGC) _x (TCAGGC) _y (TTAGGC) _z at 5 'and / or 3' of the polynucleotide of SEQ ID NO: 1, A polynucleotide comprising a first sequence (e.g., T-ALTl); Or 2 < nd &_gt; nucleotides comprising three kinds of unit sequences of (TTAGGC) _l (TTAGTA or TTAGTC) _m (TTAGGC) _n at 5 'and / or 3' of the polynucleotide of SEQ ID NO: Wherein the order of the three kinds of unit sequences in the first and second sequences is random, and the sequence of x, y, z, l, and z is selected from polynucleotides (e.g., T-ALT 2) m and n are 0 or integers of one or more, which are the same or different, respectively, in the presence of a nucleotide or element that acts on an Alternative Lengthening of Telomere ALT mechanism.

The T-ALT element according to the present invention exists in a proximal to telomere present in the chromosome of a nematode or a cell. In one embodiment, each of the three types of unit sequences may be absent or repeated. For example, the x, y, z, l, m, and n may be 0 or an integer of 1 to 100, respectively.

The element according to the present application can be applied to various biological samples and usefully used for the detection of ALT positive cancer. In this respect, the present invention provides a composition for detecting ALT positive cancer, comprising a substance for detecting a polynucleotide or an element according to the present invention do.

The present disclosure describes the mechanism of ALT and the elements involved therein, and in this respect also provides a method for the treatment of ALT comprising the steps of: providing a nematode; Exposing the small nematode to an environment capable of causing cancer; Treating the test substance expected to inhibit retention of telomere in the nematode before, after or after exposure to the cancer-inducing environment; And detecting a T-ALT (Template-Alternative Lengthening of Telomere) element in the control group not treated with the test substance and the nematode treated with the test substance, wherein in the control group, Wherein the test substance is selected as a candidate for cancer treatment when the amplified sequence length is shorter than the absence of T-ALT or the control group.

In another aspect, the present invention provides a method of measuring ALT activity of a small nematode, said method comprising the steps of: providing DNA derived from the nematode; Amplifying the T-ALT element from the DNA; And quantitatively or qualitatively detecting the amplified product, wherein the presence of the amplified product, i.e. ALT, exhibits ALT activity.

This disclosure discloses T-ALT elements and their uses that work in the alternative telomer length maintenance mechanism. The element according to the present invention can be used as a marker for detecting intracellular ALT activity, or can be useful for screening cancer therapeutic substances, etc. Also, it is possible to identify cancer cells that depend on ALT, develop customized therapies for the cancer cells, ALT mechanism research.

Figure 1 relates to the isolation of stable ALT survival from small nematodes with particular telomeric sequences. Fig. 1 (a) is a graphical representation of the experimental procedure for this. Fig. 1 (b) shows the results of quantitative analysis of telomere lengths of viable CB4856 trt-1, pot-2 (tm1400), CS1 and CS2 using FISH, DNA was counter-stained with DAPI (blue), and the upper panel represents a representative value for each survival organ. Statistical analysis was performed using a T-test (* P-value <0.0001), and the mean value was represented by a red bar. Figure 1c shows all of the cleaved pairs of restriction enzymes recognizing N2, CB4856, pot-1 (tm1620), pot-2 (tm1400) and NheI, DraI, ApaI, NdeI, XhoI, NcoI and SacI 6 nucleic acids (Tm1620) and pot-2 (tm1400) were used as positive controls for long telomere. Figure 1D shows the results of TRF analysis for CS survivors probed with CB4856, CB4856 trt-1, HinfI digested DIG-TTAGGC * 4.
Figure 2 shows the result that survivors used the T-ALT1 element as an ALT. Figure 2a shows the combined heat map of CB4856 SNVs retained after hybridization and the right panel is an enlarged view of the vicinity of the T-ALT locus of the V chromosome. Figure 2b shows the multiple folds from the mean lead depth plots of CS survivors (CS1x4-1, CS1x4-2 and CS2x4) crossed with CB4856 trt-1, N2 trt-1, CS1, CS2 and N2, In order to compensate for deviations due to changes in the average read depth of the CB4856 trt-1 (gray bar), we subtracted the changed multiple from the value of the ALT survivor, and the panel below is an extension of the T-ALT of chromosome V The internal telomere was represented by a black bar, and the gene structure on both sides of the T-ALT was represented by a purple bar. FIG. 2C shows the results of reconstruction from the readout results (red bars), aligning a pair with T-ALT 1 to determine the locus of the dielectric, and using Southern blotting and CB4856 T-ALT 1 probe, , And the CS1 survivor was analyzed using a primer amplifying the boundary between T-ALT and sub-telomeres (panel below). The asterisk indicates the BLAST predicted breakpoint (black) or the identified breakpoint (Red). FIG. 2D shows the results of FISH using a T-ALT 1 probe and a telomere probe at the embryonic stage, with a scale bar of 10 μm and DAPI; Green, T-ALT 1; Red, and telomere. FIG. 2E shows a TRF analysis using a T-ALT 1 probe and a telomere probe. The DNA was digested with restriction enzymes and hybridized with the indicated probe. The abbreviations were as follows: RE, restriction endonuclease; C, CB4856 trt-1; S, CS1 Survival entity; H, HindIII; B, BamHI; Nc, NcoI; Nd, Ndel; Nh, NheI; S, SacI; Mix, HindIII, BamHI, NcoI, NdeI, NheI and SacI.
Figure 3 shows the results of analysis of N2 survival organisms using T-ALT2 as an ALT. Figure 3A shows the results of TRF analysis of the telomeres of N2 survivors, in which the genomes of N2 trt-1 and NS survivors (NS1 to NS5) were truncated with the indicated restriction enzymes (TTAGGC) Gt; T-ALT &lt; / RTI &gt; Figure 3b shows the multiples varied in the mean lead depth plot of the N2 trt-1 and N2 survivors, and is the change in mean lead depth of the N2 trt-1 (gray bar) to compensate for deviations due to strain- Multiples were subtracted from the values of ALT survivors. The panel below was an enlargement of the T-ALT on the I chromosome, and the internal repeating telomeres were black. Figure 3c shows the result of TRF analysis of N2 survival telomeres. The DNA was cleaved with HinfI (TTAGGC) * 4 probe and hybridized with the T-ALT 2 specific probe after removing the probe against the same blot . Figure 3D shows FISH analysis using T-ALT and telomere probes in embryos of CB4856 trt-1, N2 trt-1 and all survivors, with a scale bar of 10 [mu] m; Blue, DAPI; Green, T-ALT; Red, and telomere.
FIG. 4 shows that the ALT mechanism involved the cis-replication of the T-ALT donor into proximal telomeres and subsequent trans-replication to other chromosome ends. FIG. 4A shows multiples from the average coverage of the SNVs (WBvar00067712 and WBvar00067717) derived from the WGS data of N2 trt-1, CB4856 trt-1, CS1 and CS2, and the N2 allele (blue) and the CB4856 (red) allele Were individually plotted, and due to large differences in the values, the Y axis was omitted and the middle was omitted. Figure 4b shows that CB4856-derived SNVs were located at the right end of chromosome V of CB4856, but not N2, and were designed to bind to the breakpoint PCR primer (chromosome V, cccaccggaaacgaataaat) and proximal telomeres of T-ALT 1 (Reverse 5'-AACAAGCTTCTGGCACGTCT-3 'SEQ ID NO: 4, Forward 5'-GAAGGATGGGATGGAACTGA-3' SEQ ID NO: 3), and the panel above shows the T- Asterisk indicates CB4856 SNVs, dotted lines indicate dielectric locations, and abbreviations are as follows: CB, CB4856; Rev, reverse primer; For, forward primer. Figure 4c shows the nucleotide changes of WBvar00067712 and WBvar00067717 of inner and telomeric T-ALT1, with the N2 allele in blue, the CB allele in red, and the nucleotide position in panel B. Figure 4d is a schematic representation of T-ALT2 on the N2 dielectric. The primers used in Figure 4e are shown with red arrows along with the size of the amplification product and also show unique repeat variants (asterisk) in the T-ALT donor and store . FIG. 4E shows that the CB4856 wild-type isolate lacks the T-ALT 2 reservoir. The PCR amplification product using the indicated primers was electrophoresed and stained with cidium bromide. The abbreviations are as follows: N2, N2; CB, CB4856. Figure 4f is the mutant read count value obtained from CB4856 trt-1, N2 trt-1 and WGS data of all NS survivors, and the value was normalized to the total sequence coverage for each sample. Figure 4g shows an executable model in which the inner genomic region with ITS can act as an ALT template for the nematode ALT survivor and the model is split off from the hypothetical ancestral ancestor and then transferred to the telomeric T- Indicates that cis-replication has already occurred independently of nature, and that, after telomere crysis, the T-ALT reservoir of the sub-telomer can be used as a template for telomere retention.
FIG. 5 shows the result of analysis of the locus of the T-ALT 2 element replicated to the chromosomal end in the NS 1 survivor. FIG. 5B shows the result of analysis of the T-ALT 2 element specific primer (cctgccaacctatatgctcc, SEQ ID NO: 7) and the chromosomal terminal specific primer The right arm of chromosome V: cccaccggaaacgaataaat, the right arm of chromosome X: tttccagcctccattacgtc, the left arm of chromosome II: cgacccgtcatcgtttaca). FIG. 5B shows a result of analyzing the sequence of the chromosome terminal and the T-ALT 2 element boundary. The upper panel is the right arm of chromosome V, the middle panel is the right arm of chromosome X, the lower panel is the left arm of chromosome II, T-ALT 2, yellow indicates telomere repeats, and blue indicates chromosomal end. 5B, it is considered that the existing telomere is preceded by a process of removing all of the existing telomere. However, after this mechanism, the structure of the nucleotide sequence is a chromosome terminal specific sequence T-ALT specific sequence telomer repeat sequence T-ALT specific sequence It is predicted that the T-ALT-specific sequence will be formed in the form of the T-ALT-specific sequence, that is, the T-ALT-specific sequence will be flanked by telomeres after the immediately preceding unit. 5C shows that the cloned T-ALT 2 has a tandem repeating pattern and was PCR amplified with the indicated primer (Forward 5'-cctgccaacctatatgctcc-3 'SEQ ID NO: 7, Reverse 5'-ggagcatataggttggcagg-3' SEQ ID NO: 8) Followed by Southern Blot. N: N2 NS1: NS Survival entity. FIG. 5D shows the results of quantitative PCR analysis of the number of copies using T-ALT 2 specific primer (Forward 5'-gttttcatgctaaattcaaaacg-3 'SEQ ID NO: 5 and Reverse 5'-aaacacaggagcatataggttgg-3' And the number of copies of T-ALT 2 in NS2 was increased, and the copy number was compared with the act-1 gene.
FIG. 6 shows the result of analysis of the gene set responsive to the increased gamma rays in all ALT survivors. As a result of the GSEA analysis of the CB4856 survivor A, the gamma-ray reaction gene set was increased in the CS1x4-1 and Cs1x4-2 survivors, These sets indicate an increase in the false discovery rate (FDR) q-value <0.005, and B is the GSEA result of N2 survivors, with a gamma-ray response gene set increased in NS1 and NS2 survivors, value &lt; 0.005.
FIG. 7 is a table and a schematic representation of each structure comparing features of T-ALT 1 and T-ALT 2 with T-ALT elements identified herein.

The present invention relates to a method for the treatment of a polynucleotide aka DNA signatures or T-ALT (Template-ALT) elements involved in alternative Lengthening of Telomere (ALT) mechanisms / processes important for uncontrolled continual cleavage of cells such as cancer cells It is based on the identification.

Linear chromosomes are not completely cloned, and their length gradually decreases as they are replicated. Telomere is a repeating sequence located at the end of a chromosome. Its length limits the number of cell divisions to an appropriate level. When the telomere length becomes shorter than the appropriate level, the cell stops dividing. Therefore, telomere prevents the continued division of normal cells, and eventually inhibits normal cells from developing into cancer cells. Thus, cancer cells have a mechanism to maintain sufficient telomere length to continue dividing beyond a limited number of divisions, one of which is ALT (Alternative Lengthening of Telomere).

Alternative Lengthening of Telomere (ALT) refers to the process of maintaining the telomere length at the chromosome end, including means, methods and / or mechanisms for maintaining the telomere length except telomere length maintenance through telomerase activity do.

As used herein, ALT-positive refers to a cell or an individual that is active in the presence of ALT, i.e., in the presence of ALT.

Thus, in one embodiment, the present invention provides a polynucleotide of SEQ ID NO: 1, wherein 5 '- (TTAGGC) _x (TCAGGC) _y (TTAGGC) _z -3' A polynucleotide comprising a first sequence comprising three repeats or unit sequences, or a polynucleotide having a sequence of 5 '- (TTAGGC) _l (SEQ ID NO: 2) at 5' and / or 3 'of the polynucleotide of SEQ ID NO: (TTAGTM) _m (TTAGTM) _n- 3 ', wherein M is A or C in the second sequence.

The order of TTAGGC, TCAGGC, and TTAGGC, which are repeat sequences of each of the three types of repeats or unit sequences, i.e., the first sequence, and TTAGGC, TTAGTM, and TTAGTM, which are repeat sequences of the second sequence, not limited to the order described above, that is random and, for example, _{(TTAGGC) x (TCAGGC) y} (TTAGGC) z, (TCAGGC) y (TTAGGC) z (TTAGGC) x, (TCAGGC) y (TTAGGC) x (TTAGGC) _z , (TTAGGC) _z (TTAGGC) _x (TCAGGC) _y, etc. The x, y, z, l, m and n are integers of 0 or 1, have.

The T-ALT according to the present invention is a polynucleotide present in the proximal to telomere present on the chromosome of a nematode or a cell. In one embodiment, each of the three types of unit sequences may be absent or repeated, For example, x, y, z, l, m and n may be 0 or an integer of 1 to 100, respectively, for example.

The T-ALT element herein refers to a polynucleotide acting on an alternative mechanism of telomere maintenance (ALT).

5, in one embodiment, a T-ALT element according to the present invention comprises a polynucleotide of SEQ ID NO: 1 flanked by a first sequence (i.e., first sequence-SEQ ID NO: 1-first sequence) And can be represented as a polynucleotide of the sequence of SEQ ID NO: 2 flanked by the second sequence (i.e., the second sequence - the sequence of SEQ ID NO: 2 - the second sequence), and is derived from the nematode.

The T-ALT element or polynucleotide according to the present invention can be usefully used for distinguishing ALT-positive cells, which is useful for discriminating cancer cells dependent on ALT, developing customized therapies for cancer cells, studying ALT positive cancer, and studying ALT mechanism Can be used.

In another embodiment, the present invention also relates to a vector comprising the polynucleotide or to a small nematode transformed with the vector. Such small nematodes can be usefully used for discriminating cancer cells that depend on ALT, developing customized therapies for cancer cells, studying ALT positive cancer, and studying ALT mechanism.

Accordingly, in another aspect, the present invention is also directed to a composition for detecting ALT positive cells, or a composition for detecting ALT positive cancers, comprising a substance for detecting a polynucleotide according to the present invention.

Detection herein includes quantitative and / or qualitative analysis of a polynucleotide according to the present invention and includes detection of the presence, absence and expression level of the polynucleotide, and such methods are well known in the art, and those skilled in the art You will be able to choose the appropriate method for

The term detection substance or detection reagent herein is a substance capable of detecting the polypeptide of the present invention quantitatively or for the determination of the presence thereof. Methods and reagents for detecting nucleic acid levels are well known and can include, for example, primers capable of specifically amplifying all or a portion of the above polypeptides, or specifically detectable probes, Or nanoparticles. &Lt; / RTI &gt;

As used herein, the term primer refers to an oligonucleotide having a sequence complementary to at least a portion of a polypeptide according to the present invention, which is specific for the polynucleotide detected herein, and refers to an oligonucleotide that is polymerized in a polymerization reaction using a polymerase such as a polymerase chain reaction . &Lt; / RTI &gt;

The primers herein also include those having high sequence similarity thereto. High sequence similarity can be determined by using at least 70% sequence similarity or similarity using GCG FastA (Genetics Computer Group, Madison, Wis. USA), MacVector 4.5 (Kodak / iBI software package) . The primers can be synthesized through known methods or synthetic companies in the art and are at least about 5 nucleotides in length.

Oligonucleotides comprising the primers herein can be labeled with suitable materials that can be visualized according to the method of detection. The labeling substance includes radioactive isotopes, polypeptide labeling substances, fluorescent substances, coloring substances and the like. Such a labeling substance may be introduced into the oligonucleotide itself when it is synthesized, and may be introduced in the polymerization process when PCR is used. Radiation agents include beta, gamma, and alpha ray emitters, including ³² P, ³⁵ S, and ¹²⁵ I. Fluorescent substances are examples of substances that are excited when they absorb energy, and substances that emit visible light while returning to the ground state in the excited state. Polypeptide labeling substances include enzymes such as biotin, digoxigenin, and enzymes such as horseradish peroxidase. The coloring material includes a chemiluminescent material that emits energy absorbed by a chemical reaction, such as oxiruminescence.

In one embodiment according to the present invention, detection means detecting the presence or absence of nucleic acid, if any, and includes, but is not limited to, nucleic acid-specific DNA-DNA, hybridization reaction, Such as amplification, including, but not limited to, PCR, in situ hybridization, Southern blot analysis, microchip analysis, PCR (including quantitative and qualitative PCR, real-time quantitative qualitative PCR).

In one embodiment, it is used in nucleic acid amplification, especially in PCR.

As used herein, the term PCR (Polymerase Chain Reaction) refers to a method of amplifying an initiating nucleic acid material in an exponential manner by chain-synthesizing nucleic acids using a polymerase, and is a method widely known in the art. The presence or absence of a specific nucleic acid It is a concept that includes qualitative analysis PCR to confirm, quantitative PCR to measure the amount of specific nucleic acid, and real-time PCR that enables qualitative and quantitative analysis by real-time tracking. The amplicons amplified by PCR have sequences corresponding to the molecules used as templates and can be analyzed by a variety of methods known in the art. Such methods are well known in the art and include, for example, gel electrophoresis, real time PCR analysis, quantitative PCR, single strand conformational polymorphism (SSCP), restriction fragment length polymorphism (RFLP), capillary zone electrophoresis (CZE) based nucleic acid analyzing technology, and microchips.

Without wishing to be bound by theory, the ALT mechanism involved in polypeptides according to the present invention in one embodiment is as described in FIG. According to Figure 4, T-ALT D (donor) is cis-replicated to proximal to telomere and then trans-replicated to other chromosome ends to generate T-ALT R Is used as a mold for holding the telomer.

Accordingly, in one aspect, the present invention provides a method of treating a nematode comprising: providing a small nematode; Exposing the small nematode to an environment capable of causing cancer; Treating the test substance expected to inhibit retention of telomere in the nematode before, after or after exposure to the cancer-inducing environment; And detecting a T-ALT (Template-Alternative Lengthening of Telomere) element in the control group not treated with the test substance and the nematode treated with the test substance, wherein in the control group, Wherein the test substance is selected as a candidate for cancer treatment when the absence of the T-ALT or the degree of repetition of the T-ALT is shorter than that of the T-ALT.

The absence of the T-ALT or the degree of repetition of the T-ALT in the method according to the present invention can be detected using known techniques, as described above. For example, TRF (Terminal Restriction Fragment) analysis, PCR, quantitative PCR, in situ hybridization, Southern blotting, or sequencing method can be used.

The T-ALT element in the method according to the present invention comprises a T-ALT donor present in the chromosome acting as a donor and a T-ALT reservoir (R) generated by replicating the donor proximal to the cis or trans telomer, You can refer to the description. In one embodiment according to the present invention, the detection refers to a T-ALT reservoir present in the proximal to telomere, and the proximal column refers to a position within 10,000 bp from the telomere.

The C.elegans according to the present invention can be maintained in a known manner. An environment capable of causing cancer in the method according to the present invention may be irradiated with the radiation of the above-mentioned nematode, for example, a gamma ray of 60 gy, or may refer to those described in the following documents (Meier et al. Genome Res. 2014. 24: 1624-1636; and Subramaniam et al. Current Biology 2003. 13: 134-139).

Short nematodes are treated with test substances that are expected to inhibit telomere length maintenance before, during, or after cancer-induced environmental exposure.

The amount and kind of the test substance used in the present method depends on the specific experimental method to be used and the kind of the test substance, and a person skilled in the art will be able to select an appropriate amount. As a result of the experiment, it was found that the decrease of the activity of ALT activity in the presence of the test substance as compared with the control group which was not in contact with the test substance, that is, the absence of T-ALT or the T-ALT, especially the T-ALT reservoir If so, select it as a candidate. Less than about 99%, less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70% less, less than about 65% , About 55% reduction, about 50% reduction, about 45% reduction, about 40% reduction, about 30% reduction, about 20% reduction or less.

Refers to a substance that is expected to inhibit retention of telomere length and may be a low molecular weight compound, a high molecular weight compound, a mixture of compounds (e.g., a natural extract or a cell or tissue culture), or a biologic , Proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzymes and DNAzymes) or sugars and lipids. The test substance may be a polypeptide having two or more amino acid residues, such as six, ten, twelve, twenty or fewer or more than twenty such as 50 amino acid residues. The test materials can be obtained from libraries of synthetic or natural compounds, and methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, " 1-bead 1-compound " library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

For example, for screening purposes according to the present application, a compound having a therapeutic effect of a low molecular weight may be used. For example, compounds having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may constitute a part of a library of compounds, and the number of compounds constituting the library may vary from several tens to several millions. Such a library of compounds can be prepared by reacting peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on a template, such as benzodiazepines, hydantoins, biaryls, carbocycles, and polycycle compounds such as naphthalene, Carbodihydrate and amino acid derivatives, dihydropyridines, benzhydryls and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is merely exemplary It is not limited thereto.

Particularly, the present invention includes a substance capable of inhibiting ALT activity among such low molecular compounds.

For example, biologics can also be used for screening. Biologics refers to a cell or a biomolecule, which refers to a substance produced using biomolecules, proteins, nucleic acids, carbohydrates, lipids, or in vivo and in vitro cell systems. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, proteins or biological organic materials found in polynucleotides, peptides, antibodies, or other plasma.

The method according to the present invention further comprises detecting the location of the telomer. Because the T-ALT element detected in the method according to the invention is in particular a T-ALT reservoir, which is located proximal to the telomeric, it is necessary to analyze the sequence of the telomeric proximal for detection of the T-ALT element.

Other detection methods used in the method according to the present application may be mentioned above.

In another embodiment, the disclosure also relates to a method of measuring ALT activity of a nematode. In one embodiment, the method comprises the steps of: providing DNA derived from the nematode; Amplifying the T-ALT element from the DNA; And quantitatively or qualitatively detecting the amplified product, wherein the presence of the ALT is indicative of ALT activity.

In this method, the DNA derived from the short-nematode means a genomic DNA, and the T-ALT element, other amplification and detection methods can be referred to above.

The above method can be used not only as a research tool in the field of telomere basic research, cancer research, etc., but also in the field of diagnosing cancer and establishing an anti-cancer strategy, by measuring the activity of ALT.

Hereinafter, embodiments are provided to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited to the following examples.

The present invention may be practiced using conventional techniques within the skill of those skilled in the art of cell biology, cell culture, molecular biology, gene transformation techniques, microbiology, DNA recombinant techniques, unless otherwise indicated. In addition, a more detailed description of common techniques can be found in Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al., Eds., John Wiley & Sons 1999); DNA Cloning, Volumes I and II (Glover ed., 1985).

Example

Experimental Methods and Materials

Caenorhabditis elegans and culture

Short nematodes were incubated at 20 ° C in standard conditions (see Brenner, Genetics 1974. 77 (1): 71-94). The strains used in the present invention are as follows: Bristol N2 wild state, Hawaiian CB4856 wild type isolate, trt-1 (ok410) I. N2 trt-1 (ok410) was crossed with Hawaiian CB4856 to produce CB4856 trt-1 (ok410). In order to maximize the effect of crossbreeding, SNPs of all chromosome markers were confirmed. The trt-1 (ok410) mutation was confirmed by PCR, and the trt-1 (ok410) gene produced an early generation of N2 trt-1 (ok410) by crossing with wild type N2.

EMS processing

The synchronized L4 nematode was treated with 50 mM EMS in M9 buffer for 4 hours. The treated P0 nematode was then allowed to lay eggs for 12 hours. The P0 nematode was then removed to isolate the F1 nematode. Initially, about 100 F1 eggs were transferred to a new plate, and then 10 to 15 nematodes were transferred manually from generation F2 to each generation.

RNA interference

E. coli HT115 expressing DsRNA was incubated overnight at 37 [deg.] C in LB containing 1 mM ampicillin and seeded onto NGM plates containing 1 mM IPTG and 1 mM ampicillin. In each generation, 10-15 L1 larvae were transferred to fresh RNAi medium plates.

Telomeric fluorescence, cytocyte hybridization (FISH)

The adult nematodes were blotted to isolate the eggs. The isolated eggs were fixed with 2% paraformaldehyde. The test tube containing eggs was frozen in liquid nitrogen and dissolved in hot water to break eggs. After placing the eggs on a slide coated with polylysine, the remaining PFA was removed by washing three times with phosphate buffer (PBST) containing 0.1% Tween-20. The slides were then placed in acetone and methanol at -20 ° C for 5 minutes, respectively, and rehydrated in 2 × SSC (0.3 M NaCl, 0.03 M sodium citrate) containing 0.1% Tween-20. The slides were incubated at 37 ° C for 1 hour in a total challenge solution (3 × SSC, 50% formamide, 10% dextran sulfate, 50 μg / ml heparin, 100 μg / ml yeast tRNA, 100 μg / ml salmon sperm DNA) Respectively. The PNA- (TTAGGC) 3 probe was incubated in a humid chamber at 37 ° C for 16 hours and then washed twice with a washing solution (2X SSC and 50% formamide) at 37 ° C for 15 minutes each. After three washes with PBS-T, the slides were counter-stained with DAPI, mounted with anti-decolorization reagent Vectashield (Vector Laboratory) and photographed with a conical microscope (LSM200, Zeiss).

The T-ALT1 probe was labeled with digoxigenin (DIG) and fluorescence was analyzed by FISH. After FISH analysis, the slides were blocked with PBS-T solution containing 5% BSA for 1 hour at room temperature and then treated with a rhodamine-conjugated anti-DIG antibody for 3 hours. After washing twice with PBS-T, the slides were mounted and analyzed as described above. Telomeric signals were analyzed using TFL-TELO software (Dr. Peter Lansdorp, Terry Fox Laboratory, Vancouver). The probe used for in situ hybridization is the same as SEQ ID NO: 9 (T-ALT 1) and SEQ ID NO: 10 (T-ALT 2).

Telomir Southern Blot

To obtain the genomic DNA, the nematode was harvested and washed 5 times with M9 buffer. The nematode was then melted for 8 hours in a fusion buffer (100 μg / ml proteinase K, 50 mM KCL, 10 mM Tris pH 8.3, 2.5 mM MgCl 2, 0.45% NP-40, 0.45% Tween-20, 1% beta-mercaptoethanol) . The DNA was then extracted with phenol-chloroform and ethanol precipitated. The DNA was dissolved in TE buffer, treated with RNAase (10 μg / ml) for 2 hours, extracted again and dissolved in buffer TE (Tris EDTA).

For Southern blotting, 5 μg of DNA was treated with 1 unit of restriction enzyme, followed by separation using a pulse field electrophoresis apparatus and DNA was blotted overnight with a Zeta probe membrane (Bio-Rad). The membrane was then cross-linked with UV and then hybridized with the probe in DIG Easy Hybridization Buffer at 42 ° C for 16 hours. The membrane was then washed twice with 2x SSC, 0.1% SDS at room temperature and twice with 0.2x SSC, 0.1% SDS at 42 ° C. DIG-labeled probes were detected using anti-DIG-AP antibody chemiluminescence detection kit (Roche) and ImageQuant LAS-4000 biomolecular imager (GE healthcare). The probe (TTAGGC) ₃₀ probe was labeled with DIG-UTP using the PCR amplified telomeric sequence cloned into the T-easy vector. The T-ALT I and T-ALT II probes were labeled with DIG-UTP using a primer targeting a region specific to T-ALTs. The probe used in the Southern blot is the same as SEQ ID NO: 11 (T-ALT 1) and SEQ ID NO: 12 (T-ALT 2).

BAL 31 exonuclease treatment

5 μg of DNA was treated with 10 units of BAL 31 at 30 ° C. in 1 × BAL 31 buffer. The reaction was stopped by treatment with EGTA at a final concentration of 25 mM. The treated DNA was recovered by ethanol precipitation and treated with BamHI.

Telomere - Sequence analysis of subtelomir boundary

Sequence analysis of the telomere-subtelomir boundary amplified the boundary region by PCR. For this, the forward primer was designed for telomere-proximal DNA to extend into telomeres and the reverse primer was designed from the T-ALT 1 specific sequence (the first exon of T26H2.5). CS1 genomic DNA and N2 genomic DNA were used as templates. A total of 30 cycles of PCR were performed and the conditions were as follows: Annealing for 3 minutes total at 60 ° C and height. After the products were electrophoresed, the CS1-specific bands were cut out and DNA was extracted and sequenced using the same primers as the primers used for PCR.

Whole genome sequence analysis

The DNA was cut into 300 bp size and analyzed by using a Hiseq 2000 platform (Illumina, USA) after making a 430 bp sequence analysis library with an average insert size.

Discovery of mutants

For mutant detection using EMS and CB4856 related mutants, WS243 C. elegans genome and tinctor as a reference genome were obtained from the Wormbase website (www.wormbase.org). For raw sequencing data processing, trimmomatics was applied to remove the illumina adapter sequence (AM Bolger, et al., Bioinformatics, btu170 (2014)). The inaccurate 3 'and 5' end of the data was removed. The preprocessed results were aligned using Burrows-Wheeler Aligner software (version 0.7.5a) aligned with the reference dielectric (H. Li, et al., Bioinformatics 25, 1754-1760 (2009)). The readout results were aligned for reference di- mensions using the BWA-MEM algorithm using the coefficients. Picard's SortSam and MarkDuplicates and GATK's indel realignment (McKenna et al., Genome research 20, 1297-1303 (2010)) and BQSR (base quality score recalibration) were applied before invoking variants (A. McKenna, et al. , Genome research 20, 1297-1303 (2010)). In the case of indel alignment, very strict coefficients were used due to the considerable genetic difference between the reference genome and the surviving organism. From the tin of the reference genome, SNP and Indel were selected and used in the BQSR. According to the GATK best practice, mutant digestion and genotyping were performed simultaneously on all samples using a GATK haploid analyzer. Next, standard hard filtering was applied with a minimum depth of coverage of 4.

Generate T-ALT 1 Contig

Since T-ALT 1 was amplified from the CB4856 allele (T-ALT 1 reservoir), which is not present in the N2 genome, the T-ALT 1 reservoir was constructed from the CB4856 trt-1 sequence analysis data using the CLC workbench 7 (Qiagen) Newly built. Using BWA, CS1 readout results were collected only if at least one of the pair was mapped to a reconstructed T-ALT 1 repository. The contig sequence was generated using the collected results, and the result was aligned with the N2 genome using BLAST search.

Total genomic sequence analysis for telomere read analysis

The entire genomic sequence data was aligned to the ce10 / WBcel215 reference assembly using BWA (H. Li, et al, ibid ) and used by SAMtools (H. Li, et al., Bioinformatics 25, 2078-2079 And converted it into a bam file. The Bam file, which differs from Sun Chung-Joo, is described in the previously described software (http://sourceforge.net/projects/motifcounter/) (D. Conomos, et al., The Journal of cell biology 199, 893-906 And analyzed for leads predicted to be derived from telomere. In summary, a readout containing at least six canonical telomere repeats (TTAGGC) was extracted and stored as a separate file. The number of readings was counted and the telomere length was deduced by normalizing the density of the total readings. The stored files were then used to retrieve the split-pair regions and variants.

T-ALT bioinformatics analysis

 To identify the area associated with telomeres, a pair of related ends were extracted using a file containing the telomer reading results. The readout results when all pairs were telomere were excluded, leaving only the readout results in which only one pair was mapped to the dielectric. In addition to the left surroundings surrounding the subtelomic region and the telomeres, most read results were mapped to T-ALT1 for CS1 and CS2, and to T-ALT2 for NS1 and NS2.

The average dielectric coverage across the dielectrics was calculated using the SAMtools program, a program of the BedTools package (AR Quinlan, et al., Bioinformatics 26, 841-842 (2010)) after removing redundant and low mapping quality (q < genomecov. Lead Depths were evaluated for the nucleotides of the dielectrics, divided by the average coverage, normalized and expressed as a multiple of the lead depth. Considering the strain-specific changes across the genome, the change in lead depth compared to parent strain was subtracted from the ALT survivor. A linear plot for the dielectric span and the left-hand specific lead depth change was generated with R.

Import telomere variant

The telomere mutants were analyzed using a file containing telomere reading results. The number of each variant type was counted within the reading results of a subset of each library as previously described (D. Conomos et al., Ibid ). The presence or absence of each repeat variant was analyzed within each subset reading, their frequency was calculated and a pie chart was generated.

mRNA sequencing

The results of RNA-Seq readings preprocessed using the Tuxedo pipeline (C. Trapnell, et al., Nature protocols 7, 562-578 (2012)) were aligned to the reference genome and the degree of expression of the transcript was measured To summarize, first, RNA-Seq readings were mapped to C. elegans genome using Tophat2 using given transcript annotations (D. Kim, G et al., Genome Biol 14, R36 (2013) The number of known transcripts was measured in the normalized RPKM over the entire sample using the cuffquant and cuffnorm software of the package (C. Trapnell, et al., Nature biotechnology 28, 511-515 (2010)).

Gene set enrichment analysis (GSEA)

Gene ontology (G0) annotation data for C. elegans was obtained on the Wormbase website (www.wormbase.org). A set of genes that change upon exposure is obtained in the reference (S. Greiss, et al., BMC genomics 9, 334 (2008)). For each pair of ALT and wild-type samples, GSEA was performed using the data obtained above (A. Subramanian, et al., PNAS 102, 15545-15550 (2005)).

Example 1 Screening and Characterization of Short Nematodes Without Telomerase Gene trt-1, trt-1 (ok410)

Wild-type nematode N2 and CB4856 strains described in the experimental method were treated with DNA alkylating agent, ethyl methanesulfonate (EMS), and viable individuals were selected. The results are shown in FIG. Two NS of all six selected (CS 1 to CS6) and five of NS (NS1 to NS5) were maintained for at least 300 generations in a manner that delivered 10-15 individuals in each generation without gross phenotypes, Indicating that the ALT strain is stably maintained.

FISH, end restriction fragment (TRF) and total genome sequence analysis of the CS survivor revealed that the length of the telomeres was longer than that of the parent (see FIGS. 1B and 1C). These telomeres disappeared by treatment with BAL31 exonuclease, indicating that telomeres are present at the chromosome end. Furthermore, as shown in Fig. 1d, the standard nematode telomeres were cleaved as a result of cleavage with the non-cleaved HinfI enzyme, indicating that the surviving organism contained additional sequences in the telomeres, Lt; RTI ID = 0.0 &gt; telomere length &lt; / RTI &gt;

Example 2: Identification and characteristic of T-ALT element

In order to identify the ALT-related genomic regions observed in the above-mentioned living organisms, two linkage mapping analyzes were carried out. As a result, two CB4856 trt-1-derived SNVs (Single Nucleotide Variation) , Indicating that this site is highly associated with ALT induction in CS1 and CS2 survivors (see Figure 2a).

As shown in Figure 2b, the entire genomic sequence of CS1 and CS2 was analyzed to identify genomic regions covering 2 SNVs associated with the ALT phenotype of 1,446 bp (chrV: 19,229,654-19,231,100), which were compared with the average sequence depth (T-ALT 1), which is the most amplified sequence after considerable cross-breeding.

The T-ALT 1 element comprises a unique mapped sequence (SEQ ID NO: 1) comprising the first exon of the coding gene of the nematocide T26H2.5 and a promoter, and two interstitial telomere-like sequences (ITS)) is flanking, and the structure and sequence are as shown in Fig. T-ALT 1 was found in all survivors. To determine the location of T-ALT 1, all pair-terminal sequence leads mapped to the T-ALT 1 element were extracted, and 200 bp to 1.7 kb-length contiguous fragments were constructed, and five contigs aligned on both the T-ALT 1 element and the chromosome end were identified. (Right arm of chromosome I: 5'-TGTGCGGGGAGGGAGTATTA-3 '), a right arm of chromosome II: 5'-AACAAGCTTCTGGCACGTCT-3' 5'-CGATGCGAAGAGATGGGAGT-3 ', left arm of chromosome III: 5'-GCCTAAAAGCGCGAAATCCT-3') was amplified only in survivor as shown in FIG. 2C. Subsequent FISH experiments revealed that the T-ALT 1 element probe and the telomere probe were located at the same place (see FIG. 2d). As a result of performing TRF analysis using a restriction enzyme cleaving a site not present in the T-ALT 1 element and a restriction enzyme cleaving the element, the TRF analysis was performed when the T-ALT 1 element was not truncated as shown in FIG. One telomere length was shown to be longer, indicating that the T-ALT 1 element has multiple copies of the surviving entity.

Analysis of the elements derived from N2 trt-1-derived ALT survivors showed that telomere lengths longer in NS1 and NS2 of viable individuals were observed, and standard telomere showed a distinct band in TRF analysis using restriction enzymes that did not cut (See Fig. 3A). These bands are very different in the outcome of CB4856-derived survivors. WGS analysis of NS1 & NS2 identified a specific genomic element close to telomere 5 'of chromosome I (see FIG. 3b) (T-ALT 2) element. The probe specific for the T-ALT 2 element was found to be located in the telomeres in TRF and FISH analysis (FIGS. 3C and 3D). This indicates that the T-ALT 2 element is present at the chromosome end of the NS1 & NS2 surviving individual, which is also consistent with the result of FIG. The structure of the T-ALT 2 element is similar to that of the T-ALT 1 element structure as shown in FIG. 7, that is, the sequence (sequence of SEQ ID NO: 2) is centered and the repeated sequence is located in the same direction on both sides.

In the case of small nematodes lacking the telomere gene, it is known that the sterility is overcome without maintaining the telomere length through maintenance of a large population (C. Cheng, et al., PNAS 109, 7805-7810 (2012)). In contrast, survivors of the present invention were able to maintain a stable manner by introducing a T-ALT structure into the telomeres and transferring a few plates to each new generation for cultivation.

The reason for this is that EMS is considered to have elevated the DNA damage response, and RNA-seq analysis of surviving organisms has shown that genes that are significantly altered in ALT survival individuals are correlated with gene changes induced by gamma irradiation 6). These results indicate that the double strand break (DSB) response has been altered in human nude mice as well as in human ALT cells.

Example 3: Mechanism of T-ALT element action in ALT

Two SNV analyzes involving CS survivors revealed that both parent CB4856 and CS survivors were heterozygous for the CB4856 derived SNV. In addition, the CB4856-derived SNV was found to be abundant in N2-derived mutants (Fig. 4A). For CS1, the leads containing N2-derived variants were shown to have a dielectric average sequence depth of 0.9 fold, and the leads containing CB4856-derived variants were 76 fold more than the average depth. Likewise, CS2 containing N2-derived variants was shown at an average level (1.2-fold), while leads containing CB4856-derived variants were significantly increased (122-fold) (Fig. 4A). PCR and sequencing revealed that the SNV sequence of the internal T-ALT 1 of the chromosome V region was homozygous for the N2-type SNV. In addition, the region was duplicated in parent CB4856. These results indicate that the SNV named from CB4856 is actually located in another part of the CB4856 genome. Further analysis showed that the CB4856-derived SNV was located at the right end of chromosome V in the CB4856 individual and survivor but not in N2 (Fig. 4b, c). In the chromosome, T-ATL 1 is located in two regions: T-ALT 1 donor (T-ALT 1 D) located inside the chromosome and T-ALT 1 R located in the proximal telomere Is located.

Similar to the T-ALT1 element replicating in the telomeres proximal to the distal end in the internal region, the T-ALT2 element was also replicated from the internal locus (T-ALT2D locus) to the proximal locus of the left arm of chromosome I (Figure 4d) Which was not detected in the CB4856 genome (Fig. 4e). These results indicate that CB4856 and N2 evolved into different T-ALT reservoirs by the mechanism of ALT. During ALT activation, mutant repeat sequences of T-ALT2R locus, rather than T-ALT2D, were found in the NS survivor, indicating that T-ALT2R served as a template for ALT (FIG. 4E).

While the present invention has been described in connection with what is presently considered to be the preferred embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, .

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. The contents of all publications referred to herein are incorporated herein by reference.

<110> SNU R & DB Foundation <120> Element involved in ALT in cells and its use <130> DP201412012P <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 1446 <212> DNA <213> Caenorhabditis elegans T-ALT 1 <400> 1 ttatgaaaaa tagaaaaatc ttacttatcc cccacgtatt ctccactctg ctcaagaaaa 60 gttctttagc cagctccttt aattgttcca gcgcctttga atgatccaaa gcaaccagaa 120 taactttttt cccagacttg tgaataaacg tcacagaaac cagatcggtt ccgtcgtctc 180 tacgaccaca tgctccacga actccatcaa tccactggtc tagggaacgg tgctcattct 240 tcttattgtg ttcgaagaca agtttgaaat cggctggcag tagatcgatt tcttcatata 300 gtctaagagg tccttcgtga atgattcgat tgatttctgg atcaatgtcg gtgtcaggtc 360 cagacattct gccgatagaa aatgaatgag ggagaatgag aatacagcag ggcttggcat 420 gaagttttat attaaccttt ttggaactcg caaaactgat aagacttgcg gaatgataaa 480 actgataagc aagactccgc taaaatttgt aaccagtttc ccggaattca actgaggaac 540 ggagttcgac gccgaaaaaa gctatccaag acatttatgt ataaagtgac atattctgac 600 gacaaaaact gtcactttct cactcgaaaa gcgatttttc actgcaaagt ggacaacgaa 660 ataaaaaata aaaaactgct ctcccttttt tccaacattt ttcactggaa aatgcaattg 720 ttaagcccaa aactgctttt tcagacgctc tttcaaacaa agacccaaaa actgctctca 780 tacgtggtta tcaagttgcg actaaaattt gacgtcgaaa actgctcttt cagccaattt 840 ttcttcgaaa aacgagataa atcgctaatg acaatgtaga aacgtccaag aatcaaaact 900 gaaacttccg ccttatctaa aatgtttact accttttcac gaatttcggt cacgtggtaa 960 tactccgaag cgttaggtgt gataaggatc acaaactaga agaagttgtt tgtaaggcaa 1020 aattcaaaca tccgcaggtc ttatcaccaa actctgtata aaacgaagga tgggatggaa 1080 ctgaagcata aagtttctac taactttctc caatttctcc aattccatca atggaagccc 1140 gtgagccatc aagtcttgcc gaggagctgg agctggtgcc acccgagctt cgatcgaact 1200 tcgagaacaa atcaagctcc atcataccac tttatctttc ttctaataca tctcactctg 1260 cgtcgagcta cacccgtacg gtctatgtca ctttccacaa gacttttgag aagaaagttg 1320 tgtcaatgga ttttagtgag tctactgctt tcgaggatat ctctagacgt gccagaagct 1380 tgtttcccgg atctgattgg agaatttttt caggtaagct ttttttagac caatagcaaa 1440 ttcata 1446 <210> 2 <211> 135 <212> DNA <213> Caenorhabditis elegans T-ALT 2 <400> 2 aaaattgaga taagaaaaca ttttactttt tcaaaattgt tttcatgcta aattcaaaac 60 gttttttttt tagtgaagct tctagatatt tggcgggtac ctctaatttt gcctgcctgc 120 caacctatat gctcc 135 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying T-ALT 1 <400> 3 gaaggatggg atggaactga 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying T-ALT 1 <400> 4 aacaagcttc tggcacgtct 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying T-ALT 2 <400> 5 gttttcatgc taaattcaaa acg 23 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying T-ALT 2 <400> 6 aaacacagga gcatataggt tgg 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplifying T-ALT 2 <400> 7 cctgccaacc tatatgctcc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplifying T-ALT 2 <400> 8 ggagcatata ggttggcagg 20 <210> 9 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> probe for in situ hybridization detecting T-ALT-1 <400> 9 ggatgggatg gaactgaagc ataaagtttc tactaacttt ctccaatttc tccaattcca 60 tcaatggaag cccgtgagcc atcaagtctt gccgaggagc tggagctggt gccacccgag 120 cttcgatcga acttcgagaa caaatcaagc tccatcatac cactttatct ttcttctaat 180 acatctcact ctgcgtcgag ctacacccgt acggtctatg tcactttcca caagactttt 240 gagaagaaag ttgtgtcaat ggattttagt gagtctactg ctttcgagga tatctctaga 300 cgtgccagaa gcttgttt 318 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for in situ hybridization detecting T-ALT-2 <400> 10 cctgccaacc tatatgctcc 20 <210> 11 <211> 318 <212> DNA <213> Artificial Sequence <220> <223> probe for in southern blot detecting T-ALT-1 <400> 11 ggatgggatg gaactgaagc ataaagtttc tactaacttt ctccaatttc tccaattcca 60 tcaatggaag cccgtgagcc atcaagtctt gccgaggagc tggagctggt gccacccgag 120 cttcgatcga acttcgagaa caaatcaagc tccatcatac cactttatct ttcttctaat 180 acatctcact ctgcgtcgag ctacacccgt acggtctatg tcactttcca caagactttt 240 gagaagaaag ttgtgtcaat ggattttagt gagtctactg ctttcgagga tatctctaga 300 cgtgccagaa gcttgttt 318 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for in southern blot detecting T-ALT-2 <400> 12 cctgccaacc tatatgctcc 20

Claims (11)

A polynucleotide that acts on Alternative Lengthening of Telomere (ALT) machinery,
The polynucleotide of the polynucleotide of SEQ ID NO: 1, a polynucleotide of SEQ ID NO: 1 5 'or 3', or 5 'and 3' 5 'on each _{- (TTAGGC) x (TCAGGC)} y (TTAGGC) z -3 A polynucleotide to which a first sequence containing three kinds of unit sequences of &quot; or
The polynucleotide of SEQ ID NO: 2 contains 3 kinds of 5 'or 3', or 5 '- (TTAGGC) _l (TTAGTM) _m (TTAGGC) _n -3'Lt; RTI ID = 0.0 &gt; of SEQ ID NO: &lt; / RTI &gt; is a linked polynucleotide
Wherein the order of the three kinds of unit sequences in each of the first and second sequences is random, M in the second sequence is A or C,
Wherein each of x, y, z, l, m, and n is 1, each of which acts on an Alternative Lengthening of Telomere ALT mechanism.
A method for measuring ALT activity of a small nematode,
Providing DNA derived from the nematode;
Amplifying a Template-Alternative Lengthening of Telomere (T-ALT) element from the DNA; And
Quantitatively or qualitatively detecting the amplified product,
(TTAGGC) _x (TCAGGC) _y (TTAGGC) _z (SEQ ID NO: 1) to the polynucleotide of SEQ ID NO: 1 to the 5 'or 3', or 5 ' 3 ', or 5' - (TTAGGC (SEQ ID NO: 2)) to the polynucleotide of SEQ ID NO: 2 or the polynucleotide of SEQ ID NO: ) _l (TTAGTM) _m (TTAGGC) _n- 3 'is the polynucleotide to which the polynucleotide of the second sequence is linked,
The order of the three kinds of unit sequences in each of the first and second sequences is random,
Wherein in the second sequence, M is A or C, wherein x, y, z, l, m and n are each 1 and the presence of the T-ALT element indicates ALT activity. How to measure
3. The method of claim 2,
Wherein said detection is performed by TRF (Terminal Restriction Fragment) analysis, PCR, quantitative PCR, in situ hybridization, Southern blot, or sequencing.
The method of claim 3,
The PCR is carried out using the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 6 or the primer set of SEQ ID NO: 7 and SEQ ID NO:
The in situ hybridization is performed using the probe of SEQ ID NO: 9 or SEQ ID NO: 10,
Wherein the Southern blot is performed using the probe of SEQ ID NO: 11 or SEQ ID NO: 12.
Providing a small nematode;
Exposing the small nematode to an environment capable of causing cancer;
Treating the test substance expected to inhibit retention of telomere in the nematode before, after or after exposure to the cancer-inducing environment; And
Detecting an element acting on a T-ALT (Template-Alternative Lengthening of Telomere) mechanism in a control nodule treated with the test substance and a control group not treated with the test substance,
(TTAGGC) _x (TCAGGC) _y (SEQ ID NO: 1) at the 5 'or 3', or 5 'and 3', respectively, of the polynucleotide of SEQ ID NO: 1 is added to the polynucleotide of SEQ ID NO: (TTAGGC) _z -3 ', or 5' or 3 ', or 5' and 3 ', respectively, of the polynucleotide of SEQ ID NO: 2 to the polynucleotide of SEQ ID NO: 2 to which the polynucleotide of the first sequence is linked. the second polynucleotide is a polynucleotide associated with the sequence of _{- '(TTAGGC) l (TTAGTM} ) m (TTAGGC) n -3', and the x, y, z, l, m and n are each 1,
Wherein the test substance is selected as a candidate for cancer treatment when the T-ALT length is short in comparison with the absence or absence of T-ALT as compared with the control group in the nematode treated with the test substance, Screening method of therapeutic agent.
6. The method of claim 5,
Wherein the method further comprises detecting telomeres.
6. The method of claim 5,
Wherein said detection is performed by TRF (Terminal Restriction Fragment) analysis, PCR, quantitative PCR, in situ hybridization, Southern blot, or sequencing.
8. The method of claim 7,
The PCR is carried out using the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, the primer set of SEQ ID NO: 5 and SEQ ID NO: 6 or the primer set of SEQ ID NO: 7 and SEQ ID NO:
The in situ hybridization is performed using the probe of SEQ ID NO: 9 or SEQ ID NO: 10,
Wherein the Southern blot is performed using the probe of SEQ ID NO: 11 or SEQ ID NO: 12.
A composition for detecting an ALT positive cancer, comprising a polynucleotide detecting substance according to claim 1.
delete delete

Images