KR101710745B1 - Composition for diagnosis of leukemia - Google Patents

Abstract

The present invention encompasses a leukemia diagnostic composition comprising an agent that measures the mRNA level of a gene encoding TrkC or the level of a protein expressed therefrom, measuring the mRNA level of the TrkC gene or the level of the protein expressed therefrom A method for screening a substance capable of lowering the mRNA level of the TrkC gene or a substance capable of lowering the level of the protein expressed therefrom, a method for screening an agent for preventing or treating leukemia, and a method for screening the TrkC gene Or inhibiting the activity of a protein expressed from the gene. The present invention also relates to a pharmaceutical composition for preventing or treating leukemia. The use of the TrkC gene of the present invention can not only diagnose various types of leukemia but also inhibit the onset of leukemia and thus can be widely used for prevention or treatment of leukemia.

Description

{Composition for diagnosis of leukemia}

The present invention relates to a composition for diagnosing leukemia, and more particularly, to a composition for diagnosing leukemia, which comprises an agent for measuring an mRNA level of a TrkC-encoding gene or a level of a protein expressed therefrom, A method for providing information for diagnosis of leukemia comprising the step of measuring the level of the protein expressed from the TrkC gene, a method for screening a substance capable of lowering the mRNA level of the TrkC gene or the level of the protein expressed therefrom, And a pharmaceutical composition for preventing or treating leukemia comprising an agent for inhibiting the expression of the TrkC gene or inhibiting the activity of a protein expressed from the gene.

Leukemia (leukemia) is a collective term for diseases in which white blood cells proliferate positively. The types of leukemia can be divided into myeloid leukemia and lymphocytic leukemia according to the leukemia originating from leukemia, and classified into acute leukemia and chronic leukemia according to the progression rate. The clinical manifestations of leukemia vary according to the type of disease and the nature of the affected cells. Lymphocytic leukemia is caused by lymphoid blood cells, myeloid leukemia is caused by bone marrow blood cells, and chronic myelogenous leukemia is caused by malignant clones of mature cells, that is, pluripotent hematopoietic stem cells, and acute myelogenous leukemia Leukemia is caused by disorders of myeloid cells that begin to differentiate during the relatively early stage of hematopoiesis.

In order to diagnose such leukemia, in the early stage, the number of leukocytes in the peripheral blood of the patient was measured and a method of doubling the occurrence of leukemia was used when the measured value exceeded the normal value. However, in diseases other than leukemia such as cold, The leukocyte count is increased due to the increase of the immune response of the leukocyte. Therefore, there is a disadvantage that only the measurement of the leukocyte count is likely to be false positive (pseudo-positive). Thus, studies for developing more reliable methods for diagnosing leukemia continued.

In recent years, molecular genetics has been developed, and leukemia-specific chromosomes and gene abnormalities have been identified in more than 80% to 90% of malignant blood diseases. In addition, molecular biologic diagnosis by chromosomal abnormality, high salt method, fluorescent in situ hybrid method hybridization, and polymerase chain reaction are used to improve the diagnostic success rate. In particular, in the case of acute lymphoblastic leukemia, a genetic mutation affecting tumor suppressor genes, oncogenes and some chromosomes is known to be the main cause of the disease, A method of judging whether or not the disease has occurred is being used. However, the use of this gene as a marker has not been used to detect the occurrence of leukemia in a reliable manner. However, it has been reported that CYP, GST, NAT, MTHFR, NQO1, XRCC1, MDR1, cyclin D1 and CCND1 Since the number of patients that can be detected is still only a small part, there is a great need to develop more genetic markers for diagnosis of leukemia.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop new gene markers for the diagnosis of leukemia. As a result, the TrkC gene specifically expressed in leukemia cell line not only promotes the growth of leukemia cell line but also inhibits apoptosis of leukemia cell line , Confirming that the TrkC gene can be used as a gene marker for the diagnosis of leukemia, thereby completing the present invention.

One object of the present invention is to provide a composition for diagnosing leukemia comprising an agent that measures the mRNA level of the TrkC gene or the level of the protein expressed therefrom.

It is another object of the present invention to provide a method for providing information for the diagnosis of leukemia comprising the step of measuring the mRNA level of the TrkC gene or the level of the protein expressed therefrom.

It is still another object of the present invention to provide a screening method for a prophylactic or therapeutic agent for leukemia comprising the step of screening a substance capable of lowering the mRNA level of the TrkC gene or the level of the protein expressed therefrom.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating leukemia comprising an agent for inhibiting expression of the TrkC gene or inhibiting the activity of a protein expressed from the gene.

As one embodiment for achieving the above object, the present invention provides a composition for diagnosing leukemia comprising an agent for measuring the mRNA level of a gene encoding TrkC or the level of a protein expressed therefrom.

The present inventors have focused on the TrkC gene while carrying out various studies in order to develop a gene marker for the diagnosis of a new leukemia. The TrkC gene has been used as a diagnostic marker for various cancers. However, it has not been studied whether it can be used for the diagnosis of leukemia. Therefore, it was examined whether the TrkC gene can be used for the diagnosis of leukemia.

First, patients with acute lymphoblastic leukemia (ALL), patients with acute myeloid leukemia (AML), patients with chronic lymphocytic leukemia (CLL), patients with chronic myeloid leukemia (CML) The level of expression of TrkC in patients with myelodysplasic syndrome (MDS) was compared with that of normal subjects in ALL, AML, CLL and CML belonging to leukemia. However, in the case of MDS not belonging to leukemia, And TrkC expression levels, and the expression level of TrkC was increased in all immune-related cells of ALL patients compared to that of normal. The leukemia cell lines KG-1, HL-60, Meg01, KU812, CCRF-HSB2, NB4, K252, CCRF-SB, Jurkat, ML-1 and U937 showed high levels of TrkC. Thus, TrkC could be used as a diagnostic marker for leukemia.

Next, in the U937 cell line inhibiting the expression of TrkC, not only the expression level of TrkC decreased, but also the level of cell proliferation was decreased, and when Trk signal transduction inhibitor was treated, proliferation of leukemic cell line was remarkably decreased Respectively. In addition, in the U937 cell line inhibiting the expression of TrkC, the activity of caspase-3 related to apoptosis was increased, and the level of PARP, which is a substrate thereof, was decreased, which is also the same when treated with Trk signaling inhibitor Respectively. In addition, the U937 cell line inhibiting the expression of TrkC or the U937 cell line treated with the Trk signaling inhibitor inhibited the expression of PLK-1 and Twist-1, which are activated early in leukemia. Thus, TrkC could be used as a therapeutic target for leukemia.

The term "TrkC" of the present invention refers to a kind of tropomyosin-related kinase (Trk) of neurotrophin receptor, which binds to its ligand, NT-3, , Differentiation and survival, and it is known to be overexpressed in various tumor cells such as neuroblastoma medulloblastoma. The specific nucleotide sequence and protein information of the TrkC is known from NCBI (NCBI Reference Sequence: S62924.1).

The term "diagnosing" of the present invention means identifying the presence or characteristic of a pathological condition. In the present invention, the diagnosis can be interpreted as confirming whether leukemia has occurred or not.

The term "agent for measuring mRNA level of a gene " of the present invention means a preparation used for measuring the level of mRNA transcribed from the target gene in order to confirm the expression of the target gene contained in the sample (RT-PCR), competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), northern blotting, , A DNA chip analysis method, and the like, but the present invention is not limited thereto.

The term "primer" of the present invention refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and having a starting point for template strand copying ≪ / RTI > The primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

The term "probe" of the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or several hundreds of nucleotides capable of specifically binding to a gene or mRNA, including oligonucleotide probes, For example, in the form of a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, and may be labeled for easier detection.

The term "agent for measuring the level of protein " of the present invention means a preparation used for measuring the level of a target protein contained in a sample, preferably western blotting, enzyme linked immunosorbent assay, radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement An antibody used in a method such as Complement Fixation Assay, FACS and protein chip assay.

The term "antibody" of the present invention means a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such an antibody can be prepared by cloning each gene into an expression vector according to a conventional method, A protein encoded by the marker gene can be obtained and can be produced from the obtained protein by a conventional method. The form of the antibody is not particularly limited, and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention, and any immunoglobulin antibody may be included, Specific antibodies of the invention. In addition, the antibody comprises a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule means a fragment having at least an antigen-binding function, and can be Fab, F (ab ') 2, F (ab') 2, Fv and the like.

According to one embodiment of the present invention, there is provided a method of treating acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia The level of TrkC expression was increased in ALL, AML, CLL and CML belonging to leukemia compared with normal subjects. However, the level of TrkC expression was increased in patients with chronic myeloid leukemia (CML) and myelodysplasic syndrome (MDS) In the MDS not belonging to leukemia, there was no difference in the level of TrkC expression between normal and normal subjects (Fig. 1 A), and the mean expression level of TrkC was increased in all immune-related cells of ALL patients compared to normal subjects (Fig. 1B) TrkC was detected at a high level in KG-1, HL-60, Meg01, KU812, CCRF-HSB2, NB4, K252, CCRF-SB, Jurkat, ML- Of leukemia It can be used as a diagnostic marker.

Therefore, it has been found that the agent for measuring the mRNA level of the gene encoding TrkC of the present invention or the level of the protein expressed therefrom can effectively diagnose leukemia.

In another aspect of the present invention, the present invention provides a kit for the diagnosis of leukemia comprising the composition for diagnosing leukemia.

The kit of the present invention can be used to diagnose leukemia by detecting the level of mRNA of TrkC-encoding gene or the level of protein expressed therefrom from a sample of a patient suspected of having leukemia, thereby detecting leukemia. But are not limited to, primers, probes or antibodies for measuring the mRNA level of the gene or the level of the protein expressed therefrom, as well as one or more other component compositions, solutions or devices suitable for the assay method .

As a specific example, the kit for measuring the mRNA expression level of the TrkC gene of the present invention may be a kit containing essential elements necessary for conducting RT-PCR. The RT-PCR kit can be used in combination with a test tube or other appropriate container, a reaction buffer (pH and magnesium concentration varies), deoxynucleotides (dNTPs), Taq polymerase and reverse transcriptase , DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. In addition, it may contain a primer pair specific to a gene used as a quantitative control.

As another example, the kit of the present invention may contain the necessary elements necessary for performing DNA chip analysis. The kit for DNA chip analysis may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and a reagent, a preparation, and an enzyme for producing a fluorescent-labeled probe. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

As another example, the kit of the present invention may be a kit for analyzing a protein chip for measuring the level of a protein expressed from TrkC gene. The kit may include, but is not limited to, A suitable buffer solution, a secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, a chromogenic substrate, and the like. The substrate is not particularly limited, but a nitrocellulose membrane, a 96-well plate synthesized with polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, and a glass slide glass can be used, and the coloring enzyme is not particularly limited The fluorescent substance may be FITC, RITC or the like, and the coloring substrate liquid is not particularly limited, but ABTS (2, 3, 4, 5, 2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) or OPD (o-phenylenediamine), TMB (tetramethylbenzidine).

In another aspect, the present invention provides a method for providing information for the diagnosis of leukemia using the diagnostic composition or kit as described above. Specifically, the present invention provides a method for diagnosing leukemia comprising the steps of: (a) Measuring the mRNA level of the gene or the level of the protein expressed therefrom; And (b) comparing the measured mRNA level or the level of the protein expressed therefrom with a level measured from a sample of a normal control, and determining that the leukemia has occurred if the level is significantly increased.

The leukemia may be, but is not limited to, acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML) The method of measuring the mRNA level of the gene or the level of the protein expressed therefrom is the same as described above.

In another aspect, the present invention provides a method for preventing leukemia, comprising administering a candidate substance which is expected to prevent or treat the onset of leukemia, measuring the mRNA level of the gene encoding TrkC or the level of the protein expressed therefrom, Of the present invention.

Specifically, the method for screening an agent for preventing or treating leukemia according to the present invention comprises the steps of: (a) measuring the expression level of a gene encoding TrkC or the level of a protein encoded by the gene from a sample of an animal having leukemia; ; (b) administering to said experimental animal a candidate agent expected to be able to treat leukemia; (c) measuring the expression level of the TrkC-encoding gene or the level of the protein encoded by the gene from the sample of the experimental animal to which the candidate substance is administered in the step (b); And (d) comparing the expression level of the TrkC gene measured in step (a) or the level of the protein encoded by the gene with the level measured in step (c), and comparing the level measured in step (a) , The candidate substance can be used as a prophylactic agent for preventing the onset of leukemia or a therapeutic agent for treating leukemia when the level measured in step (c) is lower than that of the candidate substance.

Measuring the level of expression of the gene of the present invention in the cell or the level of the protein encoded by the gene in the absence of a candidate substance capable of preventing or treating leukemia and measuring the level of the gene of the present invention in the presence of the candidate substance The level of expression of the gene of the present invention when the candidate substance is present or the level of the protein encoded by the gene when the candidate substance is present is determined by the absence of the candidate substance The amount of the substance to be reduced below the level under the control of leukemia can be predicted by the preparation.

According to another embodiment, the present invention provides a pharmaceutical composition for preventing or treating leukemia comprising an agent that inhibits the expression of the TrkC gene or inhibits the activity of a protein expressed from the TrkC gene.

Inhibiting the expression of the TrkC gene not only inhibits the growth and proliferation of leukemia cells but also promotes apoptosis of the leukemia cells, thereby preventing or treating the onset of leukemia. The agent for inhibiting the expression of the TrkC gene is not particularly limited, but is preferably a siRNA or shRNA capable of specifically binding to an mRNA derived from TrkC gene, or a protein specifically expressed in TrkC gene An antibody capable of binding to the polynucleotide of SEQ ID NO: 1 or 2, and more preferably an shRNA expressed from the polynucleotide of SEQ ID NO: 1 or 2.

According to one embodiment of the present invention, in the U937 cell line inhibiting the expression of TrkC, not only the expression level of TrkC was decreased (FIG. 2A), the cell proliferation level was decreased (FIG. 2B) It was confirmed that the proliferation of the leukemia cell line was significantly reduced when the delivery inhibitor was treated (Fig. 2C).

In addition, in the U937 cell line inhibiting the expression of TrkC, the activity of caspase-3 related to apoptosis was increased and the level of PARP, which is a substrate of the caspase-3, decreased (FIG. 3 A) (Fig. 3 (C)). In addition, the U937 cell line inhibiting the expression of TrkC or the U937 cell line treated with the Trk signal transduction inhibitor inhibited the expression of PLK-1 and Twist-1, which are activated at the early stage of leukemia (FIG. 5) Lt; RTI ID = 0.0 > of < / RTI >

Accordingly, the pharmaceutical composition comprising the agent for inhibiting the expression of the TrkC gene of the present invention can be used for preventing or treating the onset of leukemia by administering to a subject having or likely to develop leukemia.

The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions. Specifically, the pharmaceutical composition may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method . In the present invention, the carrier, excipient and diluent which may be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, Calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use may include various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are simple diluents commonly used in suspension, liquid solutions, emulsions and syrups have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The content of the formulation in the pharmaceutical composition according to an embodiment of the present invention is not particularly limited, but may be in the range of 0.0001 to 50% by weight, more preferably 0.01 to 10% by weight, based on the total weight of the final composition .

The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount " of the present invention means a therapeutic or prophylactic treatment of a disease at a reasonable benefit / risk ratio applicable to medical treatment or prevention And the effective dose level refers to the level of the disease to be treated, the severity of the disease, the activity of the drug, the age, body weight, health, sex, sensitivity of the patient to the drug, Duration, duration of administration, factors involved in combination with or contemporaneously with the composition of the present invention, and other factors well known in the medical arts. The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with another therapeutic agent, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be administered singly or multiply. It is important to take into account all of the above factors and administer an amount that will achieve the maximum effect in the least amount without side effects.

The dosage of the pharmaceutical composition of the present invention can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction to the disease, the age, body weight, sex, history, or kind of the substance used as the active ingredient. For example, the pharmaceutical composition of the present invention can be administered to a mammal including a human at a dose of 10 to 100 mg / kg, more preferably 10 to 30 mg / kg, and the administration frequency of the composition of the present invention It may be administered once to three times a day, or may be administered several times in divided doses.

As another embodiment for achieving the above object, the present invention provides a method for preventing or treating leukemia comprising administering the above pharmaceutical composition to a subject in which the leukemia is likely to be or does occur in a pharmaceutically effective amount .

The term "individual" of the present invention means all animals, including humans, who have or are at risk of developing the leukemia. By administering the composition of the present invention to an individual, leukemia can be alleviated or treated.

The term "alleviation" of the present invention refers to any action that alleviates or alleviates leukemia upon administration of the composition according to the present invention.

The term "administering " of the present invention means introducing the pharmaceutical composition of the present invention to a subject by any appropriate method, and the administration route can be administered through various routes of oral or parenteral administration as long as it can reach the target tissues.

In the method of treating leukemia of the present invention, the administration route of the pharmaceutical composition may be administered through any ordinary route as long as it can reach the target tissue. The pharmaceutical composition of the present invention may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, intranasally, intracorporally, or rectally, as desired, though not particularly limited thereto. In addition, the composition may be administered by any device capable of transferring the active agent to the target cell.

The use of the TrkC gene of the present invention can not only diagnose various types of leukemia but also inhibit the onset of leukemia and thus can be widely used for prevention or treatment of leukemia.

Fig. 1 shows that TrkC is overexpressed in human leukemia cells. Fig. 1 (A) shows the average expression level of TrkC expressed in bone marrow cells of normal (n = 74) and the average expression level of TrkC expressed in bone marrow cells ≪ / RTI > Figure 1B shows the mean expression level of TrkC expressed in normal (n = 74) bone marrow cells and in the B-cell, B-cell childhood, Pro-B and T-cell of ALL patients (n = 174) Lt; RTI ID = 0.0 > TrkC < / RTI >; Figure 1C shows the expression levels of TrkC expressed from various types of leukemic cell lines and the level of expression of TrkC expressed in normal bone marrow samples (NBM) using immunoassay, and the results were compared It is a photograph which shows.
FIG. 2 shows that inhibition of TrkC expression induces the inhibition of proliferation of leukemia cells. FIG. 2A shows the expression level of TrkC expressed by the TrkC # 1-shRNA and TrkC # 2-shRNA in the control group introduced into the U937 cell line. Young Dong photo; FIG. 2B is a graph showing the results of measurement of the cell number changes of the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # 2-shRNA were introduced, with the passage of time; FIG. 2C is a graph showing the results of measurement of the change in the level of proliferation of the leukemia cell line by the treatment of the Trk signal transduction inhibitor with the passage of time. FIG.
FIG. 3 shows that inhibition of TrkC expression induces a decrease in the survival rate of leukemia cells. In FIG. 3, A shows the expression of caspase-3 and PARP in the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # ≪ RTI ID = 0.0 > 1 < / RTI > FIG. 3B is a graph showing the results of measurement of changes in the survival rate of a leukemia cell line by treatment with a Trk signal transduction inhibitor; FIG. 3C is a photograph showing the results of comparing levels of caspase-3 and PARP in a leukemia cell line treated with a Trk signal transduction inhibitor; FIG. 3D is a graph showing the results of comparing cell apoptosis levels of leukemia cell lines by treatment with a Trk signal transduction inhibitor; FIG. 3E is a graph showing the results of comparing cell apoptosis levels of leukemic cell lines by shRNA treatment inhibiting the expression of TrkC.
Fig. 4 shows that TrkC regulates Akt activity and directly regulates mTOR, the target of the lower region of TrkC. Fig. 4B shows the mRNA level of mTOR produced in leukemia cell line treated with shRNA inhibiting TrkC expression ≪ / RTI > FIG. 4C is a photograph showing protein levels of phosphorylated or non-phosphorylated mTOR and Akt produced in a leukemia cell line treated with a Trk signaling inhibitor; FIG. FIG. 4D is a photograph showing the mRNA level of mTOR produced in a leukemia cell line treated with a Trk signal transduction inhibitor.
FIG. 5 shows that TrkC induces leukemogenesis by up-regulating the expression of PLK-1 and Twist-1. FIG. 5A shows the expression of PLK-1 and Twist-1 in U937 cell line transfected with TrkC- photographs and graphs showing changes in mRNA levels; FIG. 5B is a photograph and a graph showing changes in mRNA levels of PLK-1 and Twist-1 in the U937 cell line treated with the inhibitor of Trk tyrosine kinase; FIG. 5C is a photograph and a graph showing changes in mRNA levels of PLK-1 and Twist-1 in U937 cell line treated with the Akt inhibitor.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1: Leukemia and TrkC  Correlation analysis of expression level

The present inventors sought to investigate the effect of TrkC expression upon the onset of leukemia. For this, TrkC expression levels were measured in samples obtained from 2143 patients, and the results were compared according to the symptom, tissue, and carcinoma of the patient (FIG. 1). 1 is a graph and a photograph showing that the level of expression of TrkC is abnormally increased in leukemia cells.

FIG. 1A is a graph showing the results of comparing the average expression level of TrkC expressed in normal bone marrow cells (n = 74) and the average expression level of TrkC expressed in bone marrow cells of each symptom patient. At this time, each symptom was associated with acute lymphoblastic leukemia (ALL) (n = 750), acute myeloid leukemia (AML) (n = 542), chronic lymphocytic leukemia ) Patients (n = 448), chronic myeloid leukemia (CML) patients (n = 76) and myelodysplasic syndrome (MDS) patients (n = 76) As shown in FIG. 1 (A), TrkC expression level was increased in ALL, AML, CLL and CML belonging to leukemia than normal, but it was confirmed that there was no difference in TrkC expression level between normal and non-leukemic MDS.

Figure 1B shows the mean expression level of TrkC expressed in normal (n = 74) bone marrow cells and in the B-cell, B-cell childhood, Pro-B and T-cell of ALL patients (n = 174) Lt; RTI ID = 0.0 > TrkC < / RTI > As shown in Fig. 1B, it was confirmed that the average expression level of TrkC was increased in all immune-related cells of ALL patients compared with normal individuals.

Figure 1C shows the expression levels of TrkC expressed from various types of leukemic cell lines and the level of expression of TrkC expressed in normal bone marrow samples (NBM) using immunoassay, and the results were compared It is a photograph which shows. In this case, human leukemia cells mainly used KG-1, HL-60, Meg01, KU812, CCRF-HSB2, NB4, K252, CCRF-SB, Jurkat, ML- - Inactivated RPMI 1640 (Gibco) medium supplemented with fetal bovine serum was incubated in a 37 ° C CO ₂ incubator maintained at 5% humidity. As can be seen from FIG. 1C, TrkC was not detected in NBM, but TrkC was detected at high levels in various blood cell lines.

Therefore, as shown in the results of A to C in Fig. 1, it was found that the expression level of TrkC was abnormally increased in the leukemia cells.

Example  2: Growth of leukemia cells TrkC Correlation analysis

Example  2-1: TrkC of shRNA In leukemia cells TrkC Of the expression level of

From the results of Example 1, it was found that the expression level of TrkC was abnormally increased in leukemia cells. Therefore, the effect of inhibiting TrkC expression on leukemia cells was examined.

For this purpose, oligonucleotides encoding two shRNAs for human TrkC were designed as follows.

TrkC # 1 5'-CCGGCTGGGTGAGGGAGCCTTTG CTCGAG CAAAGGCTCCCTCACCCAGTTTTTG-3 '(SEQ ID NO: 1)

TrkC # 2 5'- CCGGATGCTCCACATTGCCAGTC CTCGAG GACTGGCAATGTGGAGCATTTTTTG-3 '(SEQ ID NO: 2)

Then, each of the designed oligonucleotides was inserted into the pLKO lentivirus vector and cloned. As a control, oligonucleotides that did not match any of the known human coding cDNAs were inserted into the pLKO lentivirus vector and cloned.

The cloned control group, TrkC # 1-shRNA and TrkC # 2-shRNA were introduced into the U937 cell line, a leukemic cell line, and the expression level of TrkC expressed in each U937 cell line was compared using RT-PCR method A). At this time, the RT-PCR method was carried out by obtaining total RNA from each cell line, performing reverse transcription PCR on the obtained total RNA, obtaining respective cDNAs, and then performing PCR using the obtained cDNA and the following primers . At this time, the expression level of GAPDH was used as an internal control, and the sequence of the primers used was as follows.

TrkC F: 5'-CTCTCCCAAATGCTCCACAT-3 '(SEQ ID NO: 3)

TrkC R: 5'-TCCGGTACATGATGCTTTCA-3 '(SEQ ID NO: 4)

GAPDH F: 5'-GACCCCTTCATTGACCTCAAC-3 '(SEQ ID NO: 5)

GAPDH R: 5'-CTTCTCCATGGTGGTGAAGA -3 '(SEQ ID NO: 6)

FIG. 2A is an electrophoresis image showing the expression level of TrkC changed by the control group, TrkC # 1-shRNA and TrkC # 2-shRNA introduced into U937 cell line. As shown in FIG. 2 A, the level of TrkC expression in the U937 cell line transfected with TrkC shRNA was markedly decreased compared to the control group.

Example  2-2: TrkC of shRNA Of Leukemia Cells in the Lymphocytes

The cell numbers of the U937 cell line into which the TrkC # 1-shRNA and TrkC # 2-shRNA were introduced in the control group used in Example 2-1 were measured (FIG. 2B).

FIG. 2B is a graph showing the results of measurement of the cell number change of the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # 2-shRNA were introduced, with the passage of time. As shown in FIG. 2B, the level of cell proliferation was decreased in the U937 cell line into which TrkC shRNA was introduced, compared to the U937 cell line into which the control group was introduced.

Therefore, the expression of TrkC in leukemia cells has a direct effect on the proliferation of leukemia cells.

Example  2-3: On the level of proliferation of leukemia cells Trk  Effect of signal transduction inhibitor

From the results of Example 2-2, it was confirmed that when the expression level of TrkC decreases, the proliferation of the leukemic cell line is inhibited. Therefore, whether this effect is due to a decrease in the expression level of TrkC or a decrease in the level of signal transduction of TrkC , The Trk signaling inhibitor was treated with a leukemia cell line and the change in the level of proliferation of the leukemia cell line was analyzed.

Specifically, K252a, an inhibitor of tyrosine kinase involved in Trk signal transduction, was treated with a dose of 100 nM in U937 cell line and cultured for 5 days, and its proliferation level was compared with that of untreated K252a U937 cell line 2 of C). At this time, U937 cell line not treated with K252a was treated with DMSO instead of K252a.

FIG. 2C is a graph showing the results of measurement of the change in the level of proliferation of the leukemia cell line by the treatment of the Trk signal transduction inhibitor with the passage of time. FIG. As shown in FIG. 2C, it was confirmed that the proliferation of the leukemia cell line was significantly reduced when K252a, which is a Trk signal transduction inhibitor, was treated.

Therefore, when the expression level of TrkC is decreased in leukemic cells, the signal transduction level of TrkC is decreased and the proliferation of leukemia is inhibited.

Example  3: Leukemia cells Cell apoptosis and TrkC Correlation analysis

The levels of PARP used as caspase-3 and its substrate were compared in the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # 2-shRNA used in Example 2-1 were introduced (Figure 3 A) .

FIG. 3A is a photograph showing the results of comparing levels of caspase-3 and PARP in the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # 2-shRNA were introduced. As shown in FIG. 3 A, caspase-3 was activated to a high level in the U937 cell line into which TrkC shRNA was introduced, compared with the U937 cell line into which the control group was introduced, and it was confirmed that the level of PARP, which is its substrate, decreased.

In order to confirm whether or not the same effect was obtained when the Trk signal transduction inhibitor was treated, K252a, an inhibitor of tyrosine kinase involved in the Trk signal transduction process, was treated with a dose of 100 nM in the U937 cell line and the survival rate of the U937 cell line was measured by MTT (B in FIG. 3), and the level of PARP used as caspase-3 and its substrate in each of the above cell lines was compared (FIG. 3C) to the K252a-treated U937 cell line . At this time, U937 cell line not treated with K252a was treated with DMSO instead of K252a.

FIG. 3B is a graph showing the results of measurement of the change in the survival rate of a leukemia cell line by treatment with a Trk signal transduction inhibitor. As shown in FIG. 3B, it was confirmed that the survival rate of the leukemia cell line was remarkably reduced when K252a, which is a Trk signal transduction inhibitor, was treated.

FIG. 3C is a photograph showing the results of comparing levels of caspase-3 and PARP in a leukemia cell line treated with a Trk signal transduction inhibitor. As shown in FIG. 3C, caspase-3 was activated to a high level in the U937 cell line treated with the Trk signaling inhibitor, compared with the U937 cell line not treated with the Trk signal transduction inhibitor, and the level of its PARP Respectively.

In addition, flow cytometric analysis using annexin V was performed to characterize the inhibition of apoptosis of the leukemia cell line by TrkC.

Specifically, a U937 cell line and a U937 cell line treated with K252a were dispensed into a 60 mm culture container at a density of 1 × 10 ⁶ cells / ml and cultured in a CO ₂ incubator for 24 hours. Then, an Annexin-V apoptosis screening kit BD Pharmingen ™), and flow cytometry data was obtained using a FACS Calibur system (Becton Dickinson, Calif., USA) and the data were analyzed by applying the computer program Win MDI 2.8 3, D).

FIG. 3D is a graph showing the results of comparing cell apoptosis levels of leukemia cell lines by treatment with a Trk signal transduction inhibitor. As shown in FIG. 3 D, when the Trk signal transduction inhibitor was treated, apoptosis of leukemia cells was dramatically increased.

In addition, U937 cell line and U937 cell line into which TrkC # 1-shRNA and TrkC # 2-shRNA were introduced were used to perform flow cytometry using annexin V (FIG. 3E).

FIG. 3E is a graph showing the results of comparing cell apoptosis levels of leukemic cell lines by shRNA treatment inhibiting the expression of TrkC. As shown in FIG. 3E, when shRNA inhibiting the expression of TrkC was treated, apoptosis of leukemia cells was rapidly increased.

Taken together, these results indicate that TrkC plays a role in suppressing apoptosis in leukemia cells, and this is an effect of TrkC signaling.

Example  4: Leukemia cells On cell apoptosis  Affection TrkC Effect of

To investigate the effect of TrkC on apoptosis of leukemia cells, we examined whether TrkC expression affects PI3K / Akt / mTOR pathway.

To this end, protein levels of phosphorylated mTOR (P-mTOR), mTOR, phosphorylated Akt and Akt in the U937 cell line transfected with TrkC # 1-shRNA and TrkC # 2-shRNA were measured by immunoblot assay (Fig. 4A).

Fig. 4A is a photograph showing the protein levels of phosphorylated or non-phosphorylated mTOR and Akt produced in a leukemia cell line treated with shRNA that inhibits the expression of TrkC. As shown in FIG. 4A, it was confirmed that the level of phosphorylated protein decreased in the shRNA-treated leukemia cell line inhibiting the expression of TrkC, and decreased to the level of the non-phosphorylated protein in the mTOR.

In order to confirm whether the decrease in the level of mTOR was induced at the transcription level, total RNA was obtained from each cell and RT-PCR analysis was performed to compare the mRNA levels of mTOR (Fig. 4B). Here, the primers used are as follows.

mTOR F: 5'-GCACATTGACTTTGGGGACT-3 '(SEQ ID NO: 7)

mTOR R: 5'-ACTGGCCAGCAGAGTAGGA-3 '(SEQ ID NO: 8)

FIG. 4B is a photograph showing the mRNA level of mTOR produced in a leukemia cell line treated with shRNA which inhibits the expression of TrkC. As shown in Fig. 4B, when the expression of TrkC was suppressed, mTOR expression was suppressed at the transcription level.

To determine whether the same effect could be obtained in the leukemia cell line treated with the Trk signaling inhibitor, phosphorylated mTOR (P-mTOR), mTOR, phosphorylated Akt and Akt were used in U937 cell line and K252a treated U937 cell line. Were measured using immunoblot analysis (Fig. 4C).

FIG. 4C is a photograph showing protein levels of phosphorylated or non-phosphorylated mTOR and Akt produced in a leukemia cell line treated with a Trk signal transduction inhibitor. As shown in FIG. 4C, it was confirmed that the level of phosphorylated protein was decreased in the leukemia cell line treated with the Trk signaling inhibitor, and the level of the non-phosphorylated protein was also decreased in the mTOR.

In order to confirm whether the decrease in mTOR level was induced at the transcription level, total RNA was obtained from each cell and RT-PCR analysis was performed to compare the mRNA levels of mTOR (Fig. 4D) .

FIG. 4D is a photograph showing the mRNA level of mTOR produced in a leukemia cell line treated with a Trk signal transduction inhibitor. As shown in FIG. 4D, when the signal transduction of TrkC was suppressed, the expression of mTOR was suppressed at the transcription level.

Example  5: PLK -1 and Twist -1 for expression TrkC Effect of

Among the regulatory factors activated early in the onset of leukemia, the effect of TrkC on the expression level of Twist-1 overexpressed in AML-overexpressed PLK-1 and CML was analyzed.

Example  5-1: TrkC - shRNA In a leukemia cell line introduced PLK -1 and Twist -1 expression level change

MRNA levels of PLK-1 and Twist-1 were measured in the U937 cell line into which the control, TrkC # 1-shRNA and TrkC # 2-shRNA were introduced (FIG.

FIG. 5A is a photograph and a graph showing changes in mRNA levels of PLK-1 and Twist-1 in U937 cell line into which TrkC-shRNA was introduced. As shown in Fig. 5A, it was confirmed that mRNA levels of PLK-1 and Twist-1 were decreased in the U937 cell line into which TrkC-shRNA was introduced.

Example  5-2: Trk Tyrosine Kinase  In inhibitor-treated leukemia cell lines, PLK-1 and Twist -1 expression level change

MRNA levels of PLK-1 and Twist-1 were measured in the U937 cell line and the U937 cell line treated with K252a, an inhibitor of Trk tyrosine kinase (FIG. 5B).

FIG. 5B is a photograph and a graph showing changes in mRNA levels of PLK-1 and Twist-1 in the U937 cell line treated with the inhibitor of Trk tyrosine kinase. As shown in Fig. 5B, it was confirmed that mRNA levels of PLK-1 and Twist-1 were decreased in the U937 cell line treated with the inhibitor of Trk tyrosine kinase.

Example  5-3: Akt  In inhibitor-treated leukemia cell lines PLK -1 and Twist -1 expression level change

MRNA levels of PLK-1 and Twist-1 were measured in U937 cell line and U937 cell line treated with Akt inhibitor LY294002 (FIG. 5C).

FIG. 5C is a photograph and a graph showing changes in mRNA levels of PLK-1 and Twist-1 in U937 cell line treated with the Akt inhibitor. As shown in FIG. 5C, it was confirmed that mRNA levels of PLK-1 and Twist-1 were decreased in the U937 cell line treated with the Akt inhibitor.

Taken together, the results of Examples 5-1 to 5-3 show that TrkC promotes the expression of PLK-1 and Twist-1 at the transcription level.

<110> Gachon University of Industry-Academic cooperation Foundation <120> Composition for diagnosis of leukemia <130> PA130496 / KR <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 1 ccggctgggt gagggagcct ttgctcgagc aaaggctccc tcacccagtt tttg 54 <210> 2 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> shRNA <400> 2 ccggatgctc cacattgcca gtcctcgagg actggcaatg tggagcattt tttg 54 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ctctcccaaa tgctccacat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tccggtacat gatgctttca 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gaccccttca ttgacctcaa c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cttctccatg gtggtgaaga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gcacattgac tttggggact 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 actggccagc agagtagga 19

Claims (15)

A composition for diagnosing leukemia, comprising an agent that measures the level of mRNA of a gene encoding TrkC or the level of a protein expressed therefrom compared with a level of a normal control,
Wherein the leukemia is a disease selected from the group consisting of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), and combinations thereof.
The method according to claim 1,
Wherein the agent for measuring the level of the gene mRNA comprises a primer or a probe specifically binding to the gene.
The method according to claim 1,
Wherein the agent for measuring the level of the protein comprises an antibody specific for the protein.
The method according to claim 1,
Wherein the leukemia is acute lymphoblastic leukemia (ALL).
A kit for the diagnosis of leukemia, comprising a composition according to any one of claims 1 to 4.
6. The method of claim 5,
Wherein the kit is an RT-PCR kit, a DNA chip kit or a protein chip kit.
(a) measuring the mRNA level of a gene encoding TrkC or the level of a protein expressed therefrom from a biological sample isolated from a patient suspected of having leukemia; And
(b) comparing the measured mRNA level or the level of the protein expressed therefrom with a level determined from a sample of a normal control, and determining that the leukemia is increased if it is increased, As a method of providing,
Wherein the leukemia is a disease selected from the group consisting of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), and combinations thereof.
8. The method of claim 7,
Wherein said leukemia is acute lymphocytic leukemia (ALL).
8. The method of claim 7,
The mRNA level of the gene may be determined by RT-PCR, competitive RT-PCR, real-time quantitative RT-PCR, RNase protection assay (RNase protection method, Northern blotting or DNA chip technology assay.
8. The method of claim 7,
The level of the protein may be determined by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radial immunodiffusion, Ouchterlony immunodiffusion, Immunohistochemical staining, immunoprecipitation assays, complement fixation assays, immunofluorescence, immunochromatography, FACS (Immunohistochemical staining), immunofluorescence (immunohistochemical staining), immunoprecipitation assays a fluorescence activated cell sorter analysis and a protein chip technology assay.
(a) measuring the level of expression of a gene encoding TrkC or the level of a protein encoded by the gene from a sample of an experimental animal in which leukemia has occurred;
(b) administering to said experimental animal a candidate agent expected to be able to treat leukemia;
(c) measuring the expression level of the TrkC-encoding gene or the level of the protein encoded by the gene from the sample of the experimental animal to which the candidate substance is administered in the step (b); And
(d) comparing the expression level of the TrkC gene measured in the step (a) or the level of the protein encoded by the gene with the level measured in the step (c) determining that the candidate substance can be used as a prophylactic agent for preventing the onset of leukemia or a therapeutic agent for treating leukemia when the level measured in the step (c) indicates a low level, prevention of leukemia Or a therapeutic agent,
Wherein the leukemia is a disease selected from the group consisting of acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), and combinations thereof.
delete delete delete delete

Images