KR101699160B1 - Composition for inducing beige and brown fat cells and method of inducing the same - Google Patents

Abstract

The present invention relates to a composition for inducing differentiation from white adipocytes into beige adipocytes and a method thereof, comprising a butein or a butene derivative or a pharmaceutically acceptable salt thereof as an active ingredient. The increased expression of UCP-1 and PRDM4 was confirmed by using the active ingredient of the present invention, Butein or a butane derivative, and it is expected that the target treatment can be more fundamentally approached in the prevention or treatment of obesity.

Description

TECHNICAL FIELD The present invention relates to a composition for inducing the differentiation of beige and brown adipocytes and a method of inducing the same.

The present invention relates to a composition for inducing brown adipocytes and inducing differentiation from white adipocytes to beige adipocytes, comprising a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient, will be.

Obesity is caused by abnormal enlargement of subcutaneous fat tissue caused by accumulation of excess energy in the body when the metabolic process imbalance occurs due to endocrine factors, genetic factors, and socio - environmental factors. The hypertrophy of adipose tissue is a phenomenon that the size of adipocyte increases (adipocyte hypertrophy) and the number of adipocyte hyperplasia increases (adipocyte hyperplasia), which also affects the localization of the venous-lymphatic system, . Therefore, obesity is perceived as an independent disease in itself, and the World Health Organization treats obesity as a global nutritional problem and recognizes it as a disease to be treated rather than a simple risk factor that harms health.

The excessively accumulated triglyceride in obese patients is stored not only in adipose tissue but also in the liver or muscle, leading to insulin resistance. Therefore, the consumption of excessively stored triglycerides can be a preventive and therapeutic treatment of essential obesity and thus metabolic diseases. Fat cells are largely classified as white fat, brown fat cells and beige fat cells. White adipose cells are stored in large fat areas of triglycerides and are found mainly in the abdomen and are known to play a negative role in health. Brown fat contains more mitochondria and smaller fat globes than white adipocytes, and it can be induced by maintaining the body temperature through heat generation and proper exercise. The rats induced to induce high levels of brown fat cells were effective in obesity and metabolic diseases by inducing weight loss and increased caloric consumption relative to obesity induced by high fat diet. In brown fat, UCP-1 (uncoupling protein-1) protein is expressed in a large amount, which is known to play a crucial role in heat generation in calorie consumption rather than storage of calories in adipocytes. In addition to brown fat, beige fat cells are also recognized as important fat cells. Beige adipocytes are induced by exercise or cold stimuli in adulthood-deficient white adipocytes, and the white adipocyte traits are reduced, but they are characterized by brown adipocytes, leading to an increase in UCP-1 expression. These beige adipocytes are also known to be beneficial to obesity and metabolic disorders similar to brown fat cells found in rats. In addition, since the beneficial brown adipose cells found in humans are mostly known as beige adipocytes, there is a growing interest in inducing the conversion of white adipocytes, which are harmful to health, into beige adipocytes that are relatively beneficial to health, and inducing differentiation.

Thus, the regulation of UCP-1 protein activity and the production of beige (or brown) adipocytes have been the subject of major challenges and studies have been conducted (Korean Patent Publication No. 10-2012-0049214) .

Disclosure of the Invention The present invention has been conceived in order to solve the above-mentioned problems, and it is an object of the present invention to provide a method of inducing brown adipocytes and a method for producing brown adipocytes from white adipose cells, which comprises, as an active ingredient, a butein or a butane derivative or a pharmaceutically acceptable salt thereof, It is an object of the present invention to provide a composition for inducing differentiation into adipocytes.

It is another object of the present invention to provide a method for inducing differentiation from a white adipocyte to a beige adipocyte, which comprises treating a white adipocyte with a butane or a butane derivative or a pharmaceutically acceptable salt thereof do.

The present invention also provides a method of treating obesity, comprising the steps of: a) treating obesity treatment candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared with the non-treatment group.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a composition for inducing differentiation from white adipocytes into beige adipocytes, comprising a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the butane derivative is a compound represented by the following formula (1)

[Chemical Formula 1]

Wherein R ₁ is OH, or C ₁ -C ₆ alkyl, R ₂ is OH, halogen, or C ₁ -C ₆ alkoxy, R ₃ is OH, or C ₁ -C ₆ Alkoxy, R ₄ may be hydrogen or C ₁ -C ₆ alkyl.

In another embodiment of the present invention, the butane derivative is a compound represented by the following formula (2)

(2)

Wherein R _a , R _b and R _c may be the same or different and each is hydrogen or OH, R _d is OH or C ₁ -C ₆ alkoxy, and R _e is hydrogen, halogen, or C ₁ -C ₆ alkoxy may be.

In another embodiment of the present invention, the butene derivative is 2- (3,4-dihydroxyphenyl) -7-hydrooxychromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-fluoro-4-hydroxyphenyl) prop-2-en-1-one; (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxyphenyl) prop-2-en-1-one; 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchromen-4-one; 2- (4-fluoro-3-methoxyphenyl) -7-hydroxychromen-4-one; (E) -3- (3,4-dihydroxyphenyl) -1- (4-hydroxyphenyl) prop-2-en-1-one; (E) -1,3-bis (3,4-dihydroxyphenyl) prop-2-en-1-one; And (E) -1,3-bis (4-hydroxyphenyl) prop-2-en-1-one.

In another embodiment of the present invention, the butane or the butane derivative may increase the activity of brown adipocytes.

In another embodiment of the present invention, the butene or butane derivative may increase the expression of UCP-1 (uncoupling protein-1).

In another embodiment of the present invention, the butene or butane derivative may increase the expression of PRDM4 gene.

The present invention provides a method for inducing differentiation from white adipocytes to beige adipocytes, comprising the step of treating white adipocytes with a butane or a butane derivative, or a pharmaceutically acceptable salt thereof.

In one embodiment of the present invention, the induction method may increase the activity of brown adipocytes.

The present invention provides a method of treating obesity in a subject, comprising the steps of: a) treating obesity treating candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared to the non-treatment group.

The present invention provides a method of treating obesity comprising the step of administering to a subject a composition for inducing differentiation.

The present invention provides a therapeutic use of a composition comprising a butane or a butane derivative, or a pharmaceutically acceptable salt thereof as an active ingredient, for the treatment of obesity.

The composition according to the present invention comprises a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient and as the concentration of the butane which is an active ingredient of the present invention is increased, , The composition can be used as a composition for inducing differentiation into beige adipocytes. Furthermore, the composition is expected to be useful for the prevention or treatment of obesity or metabolic diseases.

FIG. 1 shows the results of the changes in the expression levels of PPARγ, aP2 and UCP-1 in the case of C3H10T1 / 2 cells induced to adipocytes and then treated with Butein.
FIG. 2 shows the result of comparing the expression levels of UCP-1, PRDM16, Cidea, and PGC-1a mRNA by Oil Red O staining and real time PCR in the case of treatment with Butein while differentiating T37i cells into brown fat.
FIG. 3 shows the results of comparing the expression levels of UCP-1 when C3H10T1 / 2 cells were differentiated into adipocytes and treated with sulfuretin, fisetin, butein, resveratrol or genistein.
FIG. 4 shows the results of measurement of UCP-1 expression in mouse embryonic fibroblast (MEF) cells treated with butein.
FIG. 5 shows the results of UCP-1 expression after 24 hours of treatment with various anti-obesity physiologically active substances and antimutagenic substances, which have been reported to have anti-obesity effect on C3H10T1 / 2 cells, compared with those of butein treatment.
Figure 6 shows the results of injecting butein and PBS into the peritoneal cavity of mice at a dose of 5 mg / kg for 14 days and then isolating epidydymal fat, which is abdominal adipose tissue, to detect adipocyte-specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, (N = 6), Butein (Butein), and Butein (N = 6) groups in the beef adipocytes.
Figure 7 shows that subcutaneous fat, which is subcutaneous fat tissue, was injected into the abdominal cavity of mice at a dose of 5 mg / kg for 14 days with butein and PBS, and then adipocyte specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, The results showed that UCP-1, PRDM16, Cox8b and Cidea were expressed in beige adipocytes.
Figure 8 shows that brown fat, which is a brown adipose tissue, was separated and injected into the abdominal cavity of mice at a dose of 5 mg / kg for 14 days with butein and PBS, and adipocyte specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, The results showed that UCP-1, PRDM16, Cox8b and Cidea were expressed in beige adipocytes.
FIG. 9 is a photograph showing changes in the appearance of mice for 8 weeks in the experiment in which Butein was administered to C57BL / 6 mice administered with high fat diet (ND, control group (N = 5) fed with normal chow diet, HFD, (n = 7), which received a high fat diet (n = 7) and 15 mg / kg / day of HFD + Butein and high fat diets.
FIG. 10 is a graph showing changes in body weight for 8 weeks in an experiment in which Butein was administered to C57BL / 6 mice administered with high fat diet.
FIG. 11 is a graph showing the effect of BUT on brown fat (BAT, brown Adipose Tissue), subcutaneous fat (FAT), abdominal fat (AF) and abdominal epididymal FAT ).
FIG. 12 is a graph comparing the weight of fat pad and liver in obesity-induced C57BL / 6 mice administered with high fat diet and 8-week-old Butein mice.
FIG. 13 is a graph showing changes in abdominal fat (AF), subcutaneous fat (SF) and brown fat (BAT) tissues in a mouse administered with a high fat diet and C57BL / 6 mice fed with obesity for 8 weeks, and Hematoxylin and eosin ), And compared them.
14 (a) is the result of glucose tolerance test and (b) insulin tolerance test in mice in which obese-induced C57BL / 6 mice and butein were administered for 8 weeks in a high fat diet.
FIG. 15 is a graph showing the effect of treatment with butein (5, 15 mg / kg) on obesity-induced C57BL / 6 mice in the subcutaneous fat, subcutaneous fat, fat cell specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, (HFD, obesity-induced control group (n = 7) consuming a high fat diet) compared with the UCP-1, PRDM16, Cox8b, PGC-1α, CIDEA, COX7a and Dio2 expression levels in beef fat cells. (HFD + Butein, high fat diet) were fed a dose of 5 mg / kg per day (n = 8) to a group taking HFD + Butein and high fat diets at a dose of 15 mg / kg Group (n = 7) administered by intraperitoneal injection at a dose of 1 mg / kg.
FIG. 16 is a graph showing the results of a comparison of adipocyte-specific PPARγ and aP2 in epididymal fat, which is abdominal adipose tissue, and UCP-1, which is specific for beige fat cells, in obese-induced C57BL / 6 mice treated with butein (5, 15 mg / kg) CIDEA, COX7a, and Dio2 in PRDM16, Cox8b, white adipocyte-specific resistin, Nnmt, and beige adipocytes.
FIG. 17 shows the results of treatment of obesity-induced C57BL / 6 mice treated with butein (5, 15 mg / kg), brown fat, brown fat, adipocyte-specific PPARγ, aP2 and UCP- CIDEA, COX7a, and Dio2 in PRDM16, Cox8b, white adipocyte-specific resistin, Nnmt, and beige adipocytes.
FIG. 18 shows changes in blood glucose, triglyceride, fatty acid, LDL, and cholesterol when treated with butein (5, 15 mg / kg) in obese-induced C57BL / 6 mice.
FIG. 19 is a schematic diagram of an experiment for confirming the obesity effect by treating butein or resveratrol with a high fat diet-induced obesity-induced mouse.
20 shows the results of comparing the effect of treating obesity with the treatment of butein or resveratrol with (a) 20-wk old or (b) 28-wk old mice induced by obesity and (c) a comparison of three groups of diets.
FIG. 21 is a graph showing the results of (a) temperature change of anus, (b) glucose tolerance test, and (c) insulin tolerance test by butein treatment in high fat diet-induced obesity-induced mice.
FIG. 22 shows (a) the degree of fat accumulation by treatment with PRDM4 siRNA (si # 1 and si # 2) in 3T3-L1 cells by Oil red O staining; (b) (Si # 1 and si # 2), and (c) the expression of the gene in t37i cells by treatment with PRDM4 siRNA (si # 1 and si # 2).
FIG. 23 shows the results of (a) weight change in mice and (b) organ weight changes in fat, spleen, kidney, liver and the like when injected with PRDM4 siRNA and a control group (scrambled RNA, scr) via ip injection.
FIG. 24 is a graph showing the results of (a) temperature change of anus, (b) glucose tolerance test, and (c) insulin tolerance test in mice to which PRDM4 siRNA was administered.
FIG. 25 shows the expression levels of UCP-1 and PRDM4 when treated with C3H10T1 / 2 cells differentiated from butein derivatives into adipocytes.

In the present invention, the expression of UCP-1 (uncoupling protein-1), a marker of beige adipocytes in C3H101 / 2 cell line, and the expression of UCP-1, a brown fat cell marker in T37i cells, 1, PRDM16, and Cidea. In addition, weight loss and glucose and insulin metabolism improvement by butein treatment in high fat diet induced mice was confirmed, and the present invention was completed based on this finding.

Hereinafter, the present invention will be described in detail.

The present invention provides a composition for inducing differentiation from white adipocytes into beige adipocytes, comprising a Butein or Butein derivative or a pharmaceutically acceptable salt thereof as an active ingredient.

In the present invention, the butane derivative is a compound represented by the following formula (1)

[Chemical Formula 1]

In Formula 1,

R ₁ is OH, or C ₁ -C ₆ alkyl, R ₂ is OH, halogen, or C ₁ -C ₆ alkoxy, R ₃ is OH, or C ₁ -C ₆ alkoxy, R ₄ can be hydrogen or C ₁ -C ₆ alkyl, and is prepared by reacting compound C with compound D under proline catalysis, as shown in Scheme 1 below The compound of formula (B) and the compound of formula (1) similar to the above formula (1) can be prepared.

[Reaction Scheme 1]

In the present invention, the butane derivative is a compound represented by the following general formula (2)

(2)

In Formula 2,

R _a , R _b and R _c may be the same or different and each is hydrogen or OH, R _d is OH or C ₁ -C ₆ alkoxy and R _e is hydrogen, halogen, or C ₁ -C ₆ alkoxy And compound E can be prepared by reacting compound E with compound F under acid catalysis, as shown in Reaction Scheme 2 below.

[Reaction Scheme 2]

Particularly, the compound of formula (1) or (2) is preferably 2- (3,4-dihydroxyphenyl) -7-hydroxyhydrochroman- -4-one); (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop- , 4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop-2-en-1-one); 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chroman-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; ((E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chroman-4-one; (E) -1- (2-fluoro-4-hydroxyphenyl) prop-2-en- , 4-dihydroxyphenyl) -3- (3-fluoro-4-hydroxyphenyl) prop-2-en-1-one); (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxyphenyl) prop- -3- (4-hydroxyphenyl) prop-2-en-1-one); 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchroman-4-one ; 2- (4-Fluoro-3-methoxyphenyl) -7-hydroxychroman-4-one; (E) -3- (3,4-dihydroxyphenyl) -1- (4-hydroxyphenyl) prop- -1- (4-hydroxyphenyl) prop-2-en-1-one); (E) -1,3-bis (3,4-dihydroxyphenyl) prop-2-ene- en-1-one); And (E) -1,3-bis (4-hydroxyphenyl) prop-2-en-1- one, but is not limited thereto.

The term "pharmaceutically acceptable salt thereof" used in the present invention refers to a salt that can be prepared by a conventional method in the art, for example, hydrochloric acid, hydrogen bromide, sulfuric acid, sodium hydrogen sulfate, Or an organic acid such as formic acid, acetic acid, oxalic acid, benzoic acid, citric acid, tartaric acid, gluconic acid, gestic acid, fumaric acid, lactobionic acid, salicylic acid or acetylsalicylic acid (aspirin) Or by reacting with an alkali metal ion such as sodium, potassium or the like to form a metal salt thereof or reacting with an ammonium ion to form another form of a pharmaceutically acceptable salt thereof, .

As used herein, the term "white adipocyte" is a neutral fat, a cell having a function of accumulating a large amount of fat energy in the body. It is a cell that proliferates at the end of pregnancy, infancy and puberty and blooms up to 15 times, And the term "adipocyte" generally means "white adipocyte ".

As used herein, the term "beige adipocytes" may be derived from white adipose tissue and is a beige-colored cell with iron present in the mitochondria. Brown adipocytes are fat cells that can generate heat by consuming energy compared to white adipocytes, and have the ability to convert beef adipocyte fat into energy, and are capable of producing UCP-1 in response to cold temperatures or specific hormones. Production.

The term "differentiation" used in the present invention refers to a phenomenon in which a structure or function is specialized with each other while cells are growing by proliferation and proliferation, that is, cells, tissues, Is changing. In general, a relatively simple system is separated into two or more qualitatively different systems. For example, there is a qualitative difference between the parts of a biological system that were almost homogeneous at first, such as the distinction of heads or trunks between the eggs that were homogeneous at first in the development of an individual, or the distinction of cells such as muscle cells or nerve cells The state in which there is a difference or as a result is divided into qualitative or inferior parts or partial systems is called differentiation.

The composition of the present invention is characterized by increasing the activity of brown adipocytes or increasing the expression of UCP-1 or PRDM4.

As used herein, the term "brown adipocyte" is a cell having a function of converting fat into energy, similar to beige adipocytes, and has a tan to reddish brown color visually. The more brown fat cells, the lower the body fat, and the more adult the brown fat cells are reduced. Brown adipocytes are produced in stem cells differentiated into muscle cells, whereas beige adipocytes are produced in white adipocyte layers.

As used herein, the term "differentiation inducing composition" refers to a composition capable of inducing a process in which cells in an initial stage have characteristics as respective tissues. For the purpose of the present invention, white adipocytes are differentiated into beige fat cells Means a composition capable of induction.

The beige adipocyte differentiation inducing composition of the present invention may be present in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, based on the total weight of the total composition of butene or butane derivatives, but is not limited thereto .

In one embodiment of the present invention, the expression of UCP-1, a marker of beige fat cells by butein treatment, was observed (see Example 1), and the expression of PRDM16 and Cidea, which are brown adipocyte markers, (See Example 2). In addition, significant effects on UCP-1 expression by the butane treatment were confirmed (see Example 3), compared with other anti-obesity physiologically active compounds, and in vivo experiments and in an obesity- Increase in beige or brown adipocytes and improvement in obesity (see Examples 4 and 5). In another embodiment of the present invention, PRDM4 was found as a gene that induces physiological activity of Butein, and weight gain and inhibition of glucose insulin metabolism by inhibition of PRDM4 expression were confirmed (see Examples 6 and 7). In addition, the butane derivatives were prepared, and the expression amounts of UCP-1 and PRDM4 were increased by administration of the butane derivatives. As a result, the beige adipocyte differentiation inducing composition of the present invention is useful as a pharmaceutical composition for preventing or treating obesity (See Examples 8 and 9).

The term "obesity ", which is a disease to be prevented or treated by the composition of the present invention, refers to a state in which fat cells multiply and multiply in the body due to metabolic disturbance and, as a result, fat accumulates excessively. , The number of adipocytes and the volume of the adipocytes increase, resulting in an increase in the mass of the adipose tissue. Obesity at the cellular level means an increase in the number and volume of adipocytes due to promotion of proliferation and differentiation of adipocytes.

The compositions of the present invention may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, physiological saline, polyethylene glycol, ethanol, vegetable oil, and isopropyl myristate. Further, it may further include a culture medium for known stem cell culture, a differentiation inducing agent, and the like.

The composition of the present invention may be prepared as an aqueous solution for parenteral administration, and preferably a buffer solution such as Hank's solution, Ringer's solution or physically buffered saline can be used . Aqueous injection suspensions may contain a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or desran.

In addition, preferred embodiments of the compositions of the present invention may be in the form of sterile injectable preparations of sterile injectable aqueous or oily suspensions. The suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (ex. Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Vehicles and solvents that may be used in the present invention include mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, nonvolatile oils are conventionally used as a solvent or suspending medium. Any non-volatile oil that is irritating, including synthetic mono- or diglycerides, may be used for this purpose.

As another aspect of the present invention, there is provided a method of inducing differentiation from a white fat to a beige adipocyte, comprising treating white adipocytes with a Butein or Butein derivative, or a pharmaceutically acceptable salt thereof, . In the present invention, the term "individual" means a subject in need of treatment for a disease, and more specifically, a human or non-human primate , Mice, rats, dogs, cats, horses, and cows.

In another aspect of the present invention, there is provided a method of treating obesity in a subject, comprising: a) treating obesity treatment candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared to the non-treatment group.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

Example  1. Viewtain ( Butein )On by Beige  Identification of induction of differentiation

In order to confirm induction of differentiation into beige adipocytes by butein treatment, C3H10T1 / 2 cell line, a pluripotent stem cell line derived from mouse embryonic fibroblasts, was used. The C3H10T1 / 2 cell line was cultured in a 6 well plate at a concentration of 2.5 × 10 4 / ml containing 1 μM dexamethasone, 5 μg / ml insulin, 20 nM 3-isobutyl-1-methylxanthine (IBMX) and PPARγ ligand (GW7845) Differentiation was induced in adipocytes for about 7-10 days using the medium. The expression of UCP-1 found in beige adipocytes was confirmed by real-time PCR after treatment with different concentrations of butein (5, 10, 20 μM) for 24 h in differentiated adipocytes.

As shown in FIG. 1, the expression of UCP-1 was increased as the concentration of butein increased, thereby confirming an increase in differentiation into beige adipocytes.

Example 2. Confirmation of Increase of Brown Adipocytes by Butein

In order to confirm the increase of brown adipocytes by butein treatment, T37i cells, a brown lipid precursor cell, were used. T37i cells were cultured for 2 days in medium containing 5 ug / ml insulin and 1 nM T3 (triiodothyronine), and then differentiated into adipocytes for 6 to 8 days using medium containing 5 ug / ml insulin. The differentiation-induced adipocytes were treated with Butein (5, 10, 20 μM) for 6 days and stained with Oil Red O. The PPARγ, aP2, and brown adipocyte markers UCP-1, PRDM16, The mRNA expression level of Cidea gene was confirmed by realtime PCR.

As shown in FIG. 2, the expression of UCP-1 and the expression of PRDM16 and Cidea, which are markers of brown adipocytes, were increased as the concentration of butein increased.

Example 3. Confirmation of Increased Expression of UCP-1 Specific to Butein

The increase of UCP-1 expression by butein treatment was compared with that of sulfuretin, fisetin, and resveratrol genistein, which are known to affect adipocytes, using C3H10T1 / 2 cells. Mouse embryonic fibroblast (MEF) cells , The increase in the expression level of UCP-1 by treatment with Butein was compared with that of the control group, DMSO treatment.

In addition, the amount of UCP-1 expression after 24 hours treatment of various anti-obesity physiologically active substances and natural substance-derived monoclonal antibodies reported to have anti-obesity effect on differentiated C3H10T1 / 2 cells was compared with that of butein treatment .

As shown in FIG. 3 to FIG. 4, in the case of C3H10T1 / 2 cells, the expression of UCP-1 was increased 3 times or more as compared with the case of treatment with sulfuretin, fisetin and resveratrol genistein, , And UCP-1 expression by Butein treatment was 10 times or more higher than that of the control group. In addition, as shown in FIG. 5, when the conventional antiobesity physiologically active substances were treated, the expression level of UCP-1 was not increased. On the other hand, when Butein treatment was performed, the expression level of UCP-1 was specifically Respectively.

Example 4. In vivo inhibition of white adipocytes and increase in beige and brown adipocytes

In order to examine the increase of beige and brown adipose cells and the inhibitory activity of white adipocytes in vivo, the expression of markers in adipose tissue was measured by administration to mice for a total of 14 days. Six rats were dosed intraperitoneally with a dose of 5 mg / kg. As a control group, only 6 mice were administered intraperitoneally. After 14 days, the expression levels of white fat and beige (brown) fat markers in epididymal fat, subcutaneous fat and brown fat were confirmed by realtime PCR.

As shown in FIGS. 6 to 8, the increase in the brown fat cell markers UCP-1, PRDM16 Cox8b, Cidea and the fat cell markers PPARg, aP2, and white fat cell markers similar to those in C3H10T1 / 2 and T37i cells resistin and Nnmt (nicotinamide N-methyltransferase).

Example 5: Obesity improvement effect in obese mice induced by high fat diet

5.1. Comparison with PBS-treated group

To confirm the anti-obesity effect of buitane, high fat diet was induced in C57BL6 / J mice by intraperitoneal injection. Obesity was induced by high-fat diet (60% fat, purchased from Research Diet) for 8 weeks after 7 weeks of mouse adaptation for 1 week. Butane was administered at a dose of 5 mg / kg and 15 mg / kg for 7 Lt; / RTI > Control group was fed normal diet (5 rats) and PBS diet (7 rats).

The glucose tolerance test (GTT) and the insulin tolerance test (ITT) were performed 8 weeks later. Tissue and hematological analysis were performed simultaneously.

As shown in FIG. 9 to FIG. 18, the body weight and liver and visceral fat tissue weights were increased in the control group compared to the control group in a dose-dependent manner by the administration of butaine. In GTT and ITT, the metabolism of glucose and insulin by obesity was significantly improved in the group treated with 15 mg / kg. UCP-1, PRDM16, Cox8b, PGC-1α , CIDEA, COX7a, and Dio2. In blood analysis, glucose, cholesterol, triglyceride, HDL, LDL and fatty acid showed significant difference in the high dose of butein.

5.2. PBS  or Rezveratrol  ( Resveratrol ) Group  Comparative experiment

In order to confirm the anti - obesity effect of buitane, high fat diet was induced in C57BL6 / J mouse, and then the body weight was changed by treatment with butein. Specifically, obesity was induced by high-fat diet (60% fat, purchased from Research Diet) for 12 weeks after 7 weeks of mouse adaptation for 1 week. Thereafter, the obesity-induced mice were administered Butein at a dose of 30 mg / kg per day for 8 weeks for 8 weeks. As a control group, PBS group (7 rats) and Resveratrol group (8 rats), which is known to have excellent anti - obesity efficacy, were used.

The glucose tolerance test (GTT) and the insulin tolerance test (ITT) were performed 8 weeks later. Hematological analysis was also performed.

As shown in FIG. 20, the body weight was reduced by about 10% in the butane-treated group compared to the PBS-administered group, and the weight loss effect was remarkably superior to that of the conventional anti-obesity drug Resveratrol Respectively. Specifically, in the resveratrol-treated group in 28-week-old mice, there was no change in body weight compared to the control group, while in the butein-treated group, the body weight was significantly decreased.

In addition, as shown in Fig. 21, the temperature of the anal increases in the group administered with butane (HFD-But), and the metabolism of glucose and insulin by obesity in the group treated with Butein was increased (High insulin sensitivity).

Example 6 Identification and Expression Suppression of Gene Inducing Biological Activity of Butein

A microarray was performed to identify the genes that induce the bioactivity of butein, and PRDM4 (PR domain-containing protein 4) gene, which is expressed more than twice as much as these genes, was identified. Specifically, the expression of PRDM4 gene was inhibited by siRNA (small interfering RNA), and the degree of white adipocyte and beige cell differentiation was compared to confirm the induction of physiological activity of butein.

The siRNA sequences of the two PRDM4s used in the above example are as follows.

PRDM4 siRNA

Sense 5 'GAAUUACGCUCAACAGAUAUU 3' (SEQ ID NO: 1)

Antisense 5 'UAUCUGUUGAGCGUAAUUCUU 3' (SEQ ID NO: 2)

As shown in FIG. 22, when the differentiated adipocyte C3H10T1 / 2 was treated with PRDM4 siRNA, the decrease in the expression level of UCP-1 and the induction and promotion of differentiation into white adipocytes were confirmed. Specifically, PRDM4 siRNA increased Nnmt and resistin, which are white adipocyte markers in C3H10T1 / 2 cells, and inhibited UCP-1 and Dio2, which are brown adipocyte markers. In addition, PRDM4 siRNA reduced expression of brown adipocyte markers UCP-1, Cidea, Cox7a1, and Dio2 in t37i cells, a brown fat adipocyte. These results indicate that the PRDM gene is associated with the induction of brown adipocytes and inhibition of white adipocytes by administration of butein.

Example 7. Confirmation of changes in body weight and the like through suppression of PRDM4 gene expression

In order to confirm the in vivo function of PRDM4, PRDM4 siRNA and scrambled RNA were injected at 25 mg / kg twice a week for 6 weeks while high-fat diet was administered. The glucose tolerance test (GTT) and insulin tolerance test (ITT) were performed 6 weeks after the administration of PRDM4 siRNA (PRDM4) and control group Scrambled RNA (Scr) Respectively.

As shown in FIG. 23 to FIG. 24, PRDM4 siRNA administration group showed a significant weight increase after 4 weeks from the control group. The weight of visceral fat was also increased, and liver was also increased. The increase in body weight in the PRDM4 siRNA group interfered with glucose and insulin metabolism in GTT and ITT, and body temperature was significantly reduced compared to Butein group.

Example 8. Preparation of Butein and Butane Derivatives

Representative examples corresponding to the respective steps of preparing the compounds are described below. Compounds having different substituents were actually prepared through steps similar to those described below, and the compounds prepared are specifically shown in Table 1.

[Table 1]

8.1. Manufacture of Butane

The butene compound represented by formula (1-1) according to the present invention was prepared according to the reaction scheme (3).

[Reaction Scheme 3]

The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows; (a) Reaction conditions and materials: Compound 2 (152 mg, 1 mmol) and Compound 3 (138 mg, 1 mmol) were placed in a reaction vessel and EtOH (0.1 ml) and aqueous KOH solution (60% w / And the temperature was raised to 100 占 폚 and allowed to react for 3 hours. The temperature was gradually lowered to room temperature, and the solution was dropped to pH 3 with HCl. The reaction solution was diluted with ethyl acetate (10 ml), washed with water (3 ml, twice), and the collected organic layer was dried over anhydrous magnesium sulfate, filtered and purified by column chromatography (ethyl acetate: hexane = 1: To obtain Compound (1-1) (102 mg, yield 40%) as a yellow solid. NMR data for this was as follows; (1H, d, J = 8.9 Hz, H-6 '), 7.70 (1H, d, J = 15.3 Hz, H- ), 7.40 (1H, d, J = 15.3 Hz, H-?), 7.15 (1H, d, J = 1.8 Hz, H- ), 6.82 (1H, d, J = 8.2 Hz, H-5), 6.40 (1H, dd, J = 8.9, 2.4 Hz, H- 3 '), LRMS (ESI) m / z = 273.1 (M + H) < + >.

8.2. Preparation of the compound of the formula 1-2

The butene derivative compound represented by formula 1-2 according to the present invention was prepared according to the reaction scheme 4.

[Reaction Scheme 4]

The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows;

(a) Reaction conditions and materials: Compound 4 (152 mg, 1 mmol) and compound 5 (152 mg, 1 mmol) were dissolved in anhydrous methanol (5 ml) and proline (0.5 eq, 0.5 mmol) was added. After gradually raising the temperature to 80 占 폚, stirring was performed for 3 days. After confirming that all of the compounds 3 and 6 were consumed, it was diluted with ethyl acetate and washed with water. The collected organic layer was dried over anhydrous magnesium sulfate, concentrated, and then purified by column chromatography (ethyl acetate: hexane = 1: 2). As a result, a yellow solid compound 1-1 (114 mg, yield 36%) and a yellow solid compound 1-2 (85 mg, yield 33%) were obtained, respectively. Compound 1-1 thus obtained was the same as the product of the above reaction. NMR data for Compound 1-2 was as follows; (1H, d, J = 1.8 Hz, H-2 '), 6.77 (1H, d, J = 8.7 Hz, (1H, d, J = 8.2 Hz, H-5 '), 6.74 (1H, dd, J = 8.2, 1.8 Hz, H- Dd, J = 13.2, 17.0 Hz, H-2), 6.32 (1H, d, J = 2.2 Hz, H-3a), 2.65 (1H, dd, J = 17.0, 2.8 Hz, H-3b); Ms (ESI) m / z = 273.1 (M + H) <+>.

8.3. Preparation of the compound of formula 1-9

The butene derivative compound represented by the general formula 1-9 according to the present invention was prepared according to the reaction scheme 5.

[Reaction Scheme 5]

The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows;

(a) Reaction conditions and materials: Compound 1-1 (272 mg, 1 mmol) was dissolved in anhydrous methanol (5 ml) and Pd / C (14 mg, 5% g / g) The mixture was reacted at room temperature for 5 hours to confirm that Compound 1-1 had been consumed. After filtration using cellite, the filtrate was concentrated and purified by column chromatography (ethyl acetate: hexane = 1: 6). As a result, a yellow solid Compound 1-9 (250 mg, yield 91%) was obtained. NMR data for Compound 1-9 thus obtained are as follows; (1H, d, J = 8.0 Hz), 6.85 (1H, d, J = 8.0 Hz) (1H, d, J = 2.4, 8.8 Hz), 6.26 (1H, d, J = 2.4 Hz), 3.17 (2H, t, J = 8.0 Hz), 2.86 (2H, J = 8.0 Hz). Ms (ESI) m / z = 275.1 (M + H) &lt; + &gt;.

Example 9. Confirmation of Anti-obesity Effect of Butein Derivatives

In order to confirm the anti-obesity effect of the butane derivatives, changes in the amounts of UCP-1 and PRDM4 expression by treatment with butein derivatives (Formulas 1-1 to 1-8, 1-10 to 1-14) were measured. The expression levels of UCP-1 and PRDM4 were measured by real time PCR after differentiation of C3H10T1 / 2 adipocytes with butane and derivative compounds for 24 hours.

As a result, as shown in Fig. 25, the expression levels of UCP-1 and PRDM4 significantly increased in not only butene butane derivative compounds. In particular, in the case of the group to which the butane derivative 1-11 (BD-10) and 1-12 (BD-11) were administered, the amount of UCP-1 and PRDM4 expression was significantly higher than that of the group administered with butaine (BFI) .

It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> Composition for inducing beige and brown fat cells and method of          inducing the same <130> R-2013-0079-KR-2_MP15-009 <150> 2014/0078275 <151> 2014-06-25 <160> 2 <170> KoPatentin <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_sense <400> 1 gaauuacgcu caacagauau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_antisense <400> 2 uaucuguuga gcguaauucu u 21

Claims (10)

A pharmaceutical composition for preventing or treating obesity, which comprises a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]

In Formula 1,
R ₁ is OH, or C ₁ -C ₆ alkyl, R ₂ is OH, halogen, or C ₁ -C ₆ alkoxy, R ₃ is OH, or C ₁ -C ₆ alkoxy, and R ₄ is hydrogen or C ₁ -C ₆ alkyl.
delete delete The method according to claim 1,
The compound represented by Formula 1 is 2- (3,4-dihydroxyphenyl) -7-hydrooxychromen-4-one; 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chromen-4-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chromen-4-one; 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchromen-4-one; And 2- (4-fluoro-3-methoxyphenyl) -7-hydroxychromen-4-one.
The method according to claim 1,
Wherein said composition increases the activity of brown adipocytes.
The method according to claim 1,
Wherein the composition increases the expression of UCP-1 (uncoupling protein-1).
The method according to claim 1,
Wherein the composition increases the expression of PRDM4 (PR domain-containing protein 4) gene.
A method for inducing differentiation from a white adipocyte into a beige adipocyte, comprising the step of treating the white adipocytes with the composition of claim 1 or 4 in vitro .
9. The method of claim 8,
Wherein said induction method increases the activity of brown adipocytes.
A method for screening obesity treating substances comprising the steps of:
a) treating obesity treating candidate substances in fat cells in vitro;
b) measuring the expression of PRDM4 (PR domain-containing protein 4) gene of said adipocyte; And
c) selecting a substance that promotes the expression of PRDM4 gene as a therapeutic substance for obesity compared to the non-treatment group.

Images