KR101699160B1 - Composition for inducing beige and brown fat cells and method of inducing the same - Google Patents
Composition for inducing beige and brown fat cells and method of inducing the same Download PDFInfo
- Publication number
- KR101699160B1 KR101699160B1 KR1020150071581A KR20150071581A KR101699160B1 KR 101699160 B1 KR101699160 B1 KR 101699160B1 KR 1020150071581 A KR1020150071581 A KR 1020150071581A KR 20150071581 A KR20150071581 A KR 20150071581A KR 101699160 B1 KR101699160 B1 KR 101699160B1
- Authority
- KR
- South Korea
- Prior art keywords
- adipocytes
- butein
- obesity
- expression
- fat
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/12—Ketones
- A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
- A61K31/05—Phenols
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
- A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
- A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
본 발명은 뷰테인(Butein) 또는 뷰테인 유도체, 또는 이들의 약학적으로 허용 가능한 염을 유효성분으로 포함하는, 백색 지방세포로부터 베이지 지방세포로의 분화 유도용 조성물 및 이의 방법에 관한 것이다. 본 발명의 유효성분인 Butein 또는 뷰테인 유도체를 이용하여 UCP-1 및 PRDM4의 발현 증가를 확인하였는바, 비만의 예방 또는 치료에 있어서, 보다 근본적으로 접근하여 타겟치료를 할 수 있을 것으로 기대된다.The present invention relates to a composition for inducing differentiation from white adipocytes into beige adipocytes and a method thereof, comprising a butein or a butene derivative or a pharmaceutically acceptable salt thereof as an active ingredient. The increased expression of UCP-1 and PRDM4 was confirmed by using the active ingredient of the present invention, Butein or a butane derivative, and it is expected that the target treatment can be more fundamentally approached in the prevention or treatment of obesity.
Description
본 발명은 뷰테인(Butein) 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하는, 갈색 지방세포 유도와 백색 지방세포로부터 베이지 지방세포로의 분화 유도용 조성물 및 이의 방법에 관한 것이다.The present invention relates to a composition for inducing brown adipocytes and inducing differentiation from white adipocytes to beige adipocytes, comprising a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient, will be.
비만은 내분비적 요인, 유전적 요인, 사회 환경적 요인 등에 의해 대사 과정의 불균형이 발생하는 경우, 체내에 과잉된 에너지가 지방으로 축적됨으로써 야기되는 피하지방 조직의 이상 비대화에 기인한다. 지방조직의 비대화는 지방세포의 크기가 커지거나(지방세포 비대화) 그 수가 증가하는(지방세포 과형성) 현상으로, 이는 국소 정맥-림프 체계의 정체에도 영향을 미쳐 진피-피하 조직의 혈관조직 질환도 유발할 수 있다. 따라서, 비만은 그 자체로서 독립된 질병으로 인식되며, 세계보건기구에서는 비만을 세계적인 영양문제로 다루어 건강을 해치는 단순 위험인자가 아닌 치료해야 할 질병으로 인식하고 있다.Obesity is caused by abnormal enlargement of subcutaneous fat tissue caused by accumulation of excess energy in the body when the metabolic process imbalance occurs due to endocrine factors, genetic factors, and socio - environmental factors. The hypertrophy of adipose tissue is a phenomenon that the size of adipocyte increases (adipocyte hypertrophy) and the number of adipocyte hyperplasia increases (adipocyte hyperplasia), which also affects the localization of the venous-lymphatic system, . Therefore, obesity is perceived as an independent disease in itself, and the World Health Organization treats obesity as a global nutritional problem and recognizes it as a disease to be treated rather than a simple risk factor that harms health.
비만환자에게 과도하게 축적된 중성지방은 지방조직뿐 아니라, 간이나 근육에 저장되어 인슐린 저항성을 유도한다. 따라서, 과도하게 저장된 중성지방의 소모가 근본적인 비만과 이에 따른 대사질환의 예방 및 치료가 될 수 있다. 지방세포는 크게 백색지방, 갈색 지방세포 및 베이지 지방세포로 분류된다. 백색지방세포는 중성지방의 큰 지방구에 저장되어 주로 복부에서 많이 발견되며, 건강에 부정적인 역할을 하는 것으로 알려져 있다. 갈색지방은 백색 지방세포에 비해 많은 미토콘드리아와 작은 크기의 지방구를 함유하고 있으며 열 발생을 통한 체온 유지와 적절한 운동에 의해 유도 될 수 있다고 보고되고 있다. 갈색 지방세포가 많이 함유되도록 유도한 쥐는 고지방식이에 의한 비만에 대해 상대적으로 몸무게 감소와 열량 소모의 증가를 유도하여 비만과 대사질환에 효과적이었다. 또한, 갈색지방에서는 UCP-1(uncoupling protein-1) 단백질이 많이 발현되며, 이는 지방세포에서 열량의 저장이 아닌 열량 소모로 열 발생에 결정적인 역할을 하는 것으로 알려져 있다. 갈색 지방과 더불어 베이지 지방세포 또한 중요한 지방세포로 인식되고 있다. 베이지 지방세포는 건강에 유해한 백색지방세포에서 운동이나 추위 등의 자극에 의해 유도되며 백색지방세포의 형질은 감소되나 갈색지방세포의 특징을 갖게 되어 UCP-1의 발현을 증가를 나타나게 된다. 이들의 베이지 지방세포 또한 쥐에게서 발견되는 갈색 지방세포와 유사하게 비만 및 대사 질환에 유익한 것으로 알려져 있다. 게다가, 인간에게서 발견되는 유익한 갈색지방세포는 대부분 베이지지방세포로 알려짐에 따라 건강에 해로운 백색 지방세포를 건강에 상대적으로 유익한 베이지 지방세포로의 전환 또는 분화 유도에 대한 관심이 높아지고 있는 실정이다.The excessively accumulated triglyceride in obese patients is stored not only in adipose tissue but also in the liver or muscle, leading to insulin resistance. Therefore, the consumption of excessively stored triglycerides can be a preventive and therapeutic treatment of essential obesity and thus metabolic diseases. Fat cells are largely classified as white fat, brown fat cells and beige fat cells. White adipose cells are stored in large fat areas of triglycerides and are found mainly in the abdomen and are known to play a negative role in health. Brown fat contains more mitochondria and smaller fat globes than white adipocytes, and it can be induced by maintaining the body temperature through heat generation and proper exercise. The rats induced to induce high levels of brown fat cells were effective in obesity and metabolic diseases by inducing weight loss and increased caloric consumption relative to obesity induced by high fat diet. In brown fat, UCP-1 (uncoupling protein-1) protein is expressed in a large amount, which is known to play a crucial role in heat generation in calorie consumption rather than storage of calories in adipocytes. In addition to brown fat, beige fat cells are also recognized as important fat cells. Beige adipocytes are induced by exercise or cold stimuli in adulthood-deficient white adipocytes, and the white adipocyte traits are reduced, but they are characterized by brown adipocytes, leading to an increase in UCP-1 expression. These beige adipocytes are also known to be beneficial to obesity and metabolic disorders similar to brown fat cells found in rats. In addition, since the beneficial brown adipose cells found in humans are mostly known as beige adipocytes, there is a growing interest in inducing the conversion of white adipocytes, which are harmful to health, into beige adipocytes that are relatively beneficial to health, and inducing differentiation.
따라서, UCP-1 단백질 활성 조절과 베이지 (혹은 갈색) 지방세포의 생성이 주요한 과제의 대상이 되고 있고, 이에 대한 연구가 이루어지고 있으나(한국 특허공개번호 10-2012-0049214), 아직 미비한 실정이다.Thus, the regulation of UCP-1 protein activity and the production of beige (or brown) adipocytes have been the subject of major challenges and studies have been conducted (Korean Patent Publication No. 10-2012-0049214) .
본 발명은 상기와 같은 문제점을 해결하기 위해서 안출된 것으로서, 뷰테인(Butein) 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하는, 갈색지방세포 유도와 백색 지방세포로부터 베이지 지방세포로의 분화 유도용 조성물을 제공하는 것을 목적으로 한다.Disclosure of the Invention The present invention has been conceived in order to solve the above-mentioned problems, and it is an object of the present invention to provide a method of inducing brown adipocytes and a method for producing brown adipocytes from white adipose cells, which comprises, as an active ingredient, a butein or a butane derivative or a pharmaceutically acceptable salt thereof, It is an object of the present invention to provide a composition for inducing differentiation into adipocytes.
또한, 본 발명은 뷰테인 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 백색 지방세포에 처리하는 단계를 포함하는, 백색 지방세포로부터 베이지 지방세포로의 분화 유도방법을 제공하는 것을 다른 목적으로 한다.It is another object of the present invention to provide a method for inducing differentiation from a white adipocyte to a beige adipocyte, which comprises treating a white adipocyte with a butane or a butane derivative or a pharmaceutically acceptable salt thereof do.
또한, 본 발명은 a) in vitro 상에서 지방세포에 비만 치료 후보 물질을 처리하는 단계; b) 상기 지방 세포의 PRDM4의 유전자의 발현을 측정하는 단계; 및 c) 비처리군에 비해 PRDM4의 유전자의 발현을 증진시키는 물질을 비만 치료물질로 선정하는 단계를 포함하는 비만 치료물질 스크리닝 방법을 제공하는 것을 다른 목적으로 한다.
The present invention also provides a method of treating obesity, comprising the steps of: a) treating obesity treatment candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared with the non-treatment group.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.
본 발명은 뷰테인(Butein) 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하는, 백색 지방세포로부터 베이지 지방세포로의 분화 유도용 조성물을 제공한다. The present invention provides a composition for inducing differentiation from white adipocytes into beige adipocytes, comprising a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 일구현 예로서, 상기 뷰테인 유도체는 하기 화학식 1로 표시되는 화합물로서, In one embodiment of the present invention, the butane derivative is a compound represented by the following formula (1)
[화학식 1][Chemical Formula 1]
상기 화학식 1에서, R1은 OH, 또는 C1-C6 알킬이고, R2는 OH, 할로젠, 또는 C1-C6 알콕시이고, R3는 OH, 또는 C1-C6 알콕시이고, R4는 수소 또는 C1-C6 알킬일 수 있다. Wherein R 1 is OH, or C 1 -C 6 alkyl, R 2 is OH, halogen, or C 1 -C 6 alkoxy, R 3 is OH, or C 1 -C 6 Alkoxy, R 4 may be hydrogen or C 1 -C 6 alkyl.
본 발명의 다른 구현예로서, 상기 뷰테인 유도체는 하기 화학식 2로 표시되는 화합물로서, In another embodiment of the present invention, the butane derivative is a compound represented by the following formula (2)
[화학식 2](2)
상기 화학식 2에서, Ra, Rb, 및 Rc는 각각 동일하거나 다를 수 있으며, 수소 또는 OH이고, Rd는 OH 또는 C1-C6 알콕시이고, Re는 수소, 할로젠, 또는 C1-C6 알콕시일 수 있다. Wherein R a , R b and R c may be the same or different and each is hydrogen or OH, R d is OH or C 1 -C 6 alkoxy, and R e is hydrogen, halogen, or C 1 -C 6 alkoxy may be.
본 발명의 또 다른 구현예로서, 상기 뷰테인 유도체는 2-(3,4-다이하이드록시페닐)-7-하이드로록시크로멘-4-온; (E)-1-(2,4-다이하이드록시페닐)-3-(4-하이드록시-3-메톡시페닐)프로프-2-엔-1-온; 7-하이드록시-2-(4-하이드록시-3-메톡시페닐)크로멘-4-온; (E)-1-(2,4-다이하이드록시페닐)-3-(3-하이드록시-4-메톡시페닐)프로프-2-엔-1-온; 7-하이드록시-2-(3-하이드록시-4-메톡시페닐)크로멘-4-온; (E)-1-(2,4-다이하이드록시페닐)-3-(3-플루오로-4-하이드록시페닐)프로프-2-엔-1-온; (E)-1-(2,4-다이하이드록시페닐)-3-(4-하이드록시페닐)프로프-2-엔-1-온; 2-(3,4-다이하이드록시페닐)-7-하이드록시-3-메틸크로멘-4-온; 2-(4-플루오로-3-메톡시페닐)-7-하이드록시크로멘-4-온; (E)-3-(3,4-다이하이드록시페닐)-1-(4-하이드록시페닐)프로프-2-엔-1-온; (E)-1,3-비스(3,4-다이하이드록시페닐)프로프-2-엔-1-온; 및 (E)-1,3-비스(4-하이드록시페닐)프로프-2-엔-1-온일 수 있다. In another embodiment of the present invention, the butene derivative is 2- (3,4-dihydroxyphenyl) -7-hydrooxychromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chromen-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-fluoro-4-hydroxyphenyl) prop-2-en-1-one; (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxyphenyl) prop-2-en-1-one; 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchromen-4-one; 2- (4-fluoro-3-methoxyphenyl) -7-hydroxychromen-4-one; (E) -3- (3,4-dihydroxyphenyl) -1- (4-hydroxyphenyl) prop-2-en-1-one; (E) -1,3-bis (3,4-dihydroxyphenyl) prop-2-en-1-one; And (E) -1,3-bis (4-hydroxyphenyl) prop-2-en-1-one.
본 발명의 또 다른 구현예로서, 상기 뷰테인 또는 뷰테인 유도체는 갈색 지방세포의 활성을 증가시킬 수 있다. In another embodiment of the present invention, the butane or the butane derivative may increase the activity of brown adipocytes.
본 발명의 또 다른 구현예로서, 상기 뷰테인 또는 뷰테인 유도체는 UCP-1(uncoupling protein-1)의 발현을 증가시킬 수 있다.In another embodiment of the present invention, the butene or butane derivative may increase the expression of UCP-1 (uncoupling protein-1).
본 발명의 또 다른 구현 예로서, 상기 뷰테인 또는 뷰테인 유도체는 PRDM4의 유전자의 발현을 증가시킬 수 있다. In another embodiment of the present invention, the butene or butane derivative may increase the expression of PRDM4 gene.
본 발명은 뷰테인 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 백색 지방세포에 처리하는 단계를 포함하는, 백색 지방세포로부터 베이지 지방세포로의 분화 유도방법을 제공한다.The present invention provides a method for inducing differentiation from white adipocytes to beige adipocytes, comprising the step of treating white adipocytes with a butane or a butane derivative, or a pharmaceutically acceptable salt thereof.
본 발명의 일 구현예로서, 상기 유도 방법은 갈색 지방세포의 활성을 증가시킬 수 있다.In one embodiment of the present invention, the induction method may increase the activity of brown adipocytes.
본 발명은 a) in vitro 상에서 지방세포에 비만 치료 후보 물질을 처리하는 단계; b) 상기 지방 세포의 PRDM4의 유전자의 발현을 측정하는 단계; 및 c) 비처리군에 비해 PRDM4의 유전자의 발현을 증진시키는 물질을 비만 치료물질로 선정하는 단계를 포함하는 비만 치료물질 스크리닝 방법을 제공한다.The present invention provides a method of treating obesity in a subject, comprising the steps of: a) treating obesity treating candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared to the non-treatment group.
본 발명은 분화 유도용 조성물을 개체에 투여하는 단계를 포함하는 비만의 치료방법을 제공한다.The present invention provides a method of treating obesity comprising the step of administering to a subject a composition for inducing differentiation.
본 발명은 뷰테인 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하는 조성물의 비만의 치료용도를 제공한다. The present invention provides a therapeutic use of a composition comprising a butane or a butane derivative, or a pharmaceutically acceptable salt thereof as an active ingredient, for the treatment of obesity.
본 발명에 따른 조성물은 뷰테인(Butein) 또는 뷰테인 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하고, 본 발명의 유효성분인 뷰테인의 농도가 증가함에 따라 베이지 지방세포의 마커인 UCP-1의 발현 증가를 확인하였는바, 베이지 지방세포로의 분화 유도용 조성물로 사용될 수 있으며, 더 나아가 상기 조성물은 비만 또는 대사 질환의 예방 또는 치료에 유용하게 이용될 수 있을 것으로 기대된다.The composition according to the present invention comprises a butein or a butane derivative or a pharmaceutically acceptable salt thereof as an active ingredient and as the concentration of the butane which is an active ingredient of the present invention is increased, , The composition can be used as a composition for inducing differentiation into beige adipocytes. Furthermore, the composition is expected to be useful for the prevention or treatment of obesity or metabolic diseases.
도 1은 C3H10T1/2 세포를 지방세포로 유도한 후, Butein을 처리한 경우에서, PPARγ, aP2와 UCP-1의 발현량의 변화를 나타낸 결과이다.
도 2는 T37i 세포를 갈색지방으로 분화시키면서 Butein을 처리한 경우에서, Oil Red O 염색결과 및 real time PCR을 통한 UCP-1, PRDM16, Cidea,PGC-1a 의 mRNA 발현량을 비교한 결과이다.
도 3은 C3H10T1/2 세포를 지방세포로 분화 시킨 후, sulfuretin, fisetin, Butein, resveratrol 또는 genistein을 처리한 경우에서, UCP-1의 발현량을 비교한 결과이다.
도 4는 mouse embryonic fibroblast (MEF)세포에 Butein을 처리한 경우에서, UCP-1의 발현량을 측정한 결과이다.
도 5는 C3H10T1/2 세포에 항비만 효능이 보고된 다양한 항비만 생리활성 물질 및 천연물 유래 단일 물질 등을 24시간 동안 처리한 후의 UCP-1 발현량을 Butein 처리의 경우와 비교한 결과이다.
도 6은 Butein과 PBS를 14일 동안 5mg/kg의 용량으로 마우스의 복강에 주사한 후, 복부지방조직인 epidydymal fat을 분리하여 지방세포 특이적인 PPARγ, aP2, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, Cidea의 발현량을 비교한 결과이다 (Ctrl; PBS를 투여한 그룹 (N=6), Butein; Butein 투여 그룹 (N=6)).
도 7은 Butein과 PBS를 14일 동안 5mg/kg의 용량으로 마우스의 복강에 주사한 후, 피하지방조직인 subcutaneous fat을 분리하여 지방세포 특이적인 PPARγ, aP2, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, Cidea의 발현량을 비교한 결과이다.
도 8은 Butein과 PBS를 14일 동안 5mg/kg의 용량으로 마우스의 복강에 주사한 후, 갈색지방조직인 brown fat을 분리하여 지방세포 특이적인 PPARγ, aP2, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, Cidea의 발현량을 비교한 결과이다 .
도 9는 고지방식이를 투여한 C57BL/6 mice에 Butein을 투여한 실험에서 8주 간의 마우스의 외관상의 변화를 나타낸 사진이다 (ND, normal chow diet를 섭취한 대조군 (N=5), HFD, high fat diet를 섭취한 비만 유도 대조군 그룹 (n= 7); 15, HFD + Butein, high fat diet를 섭취한 그룹에 하루에 15mg/kg 용량으로 복강 주사하여 투여한 그룹 (n= 7)).
도 10은 고지방식이를 투여한 C57BL/6 mice에 Butein을 투여한 실험에서 8주 간의 체중 (body weight) 변화를 나타낸 그래프이다.
도 11은 고지방식이를 투여한 C57BL/6 mice에 Butein을 8주 간 투여한 마우스에서 갈색지방 (BAT, brown Adipose Tissue), 피하지방 (SF, subcutaneous FAT), 복부지방 (AF, abdominal epididymal FAT)의 크기를 비교한 사진이다.
도 12는 고지방식이를 투여하여 비만 유도된 C57BL/6 mice와 Butein을 8주 간 투여한 마우스에서 복부 지방(fat pad)과 간 (liver)의 무게를 비교한 그래프이다.
도 13은 고지방식이를 투여하여 비만 유도된 C57BL/6 mice와 Butein을 8주 간 투여한 마우스에서 복부 지방(AF)과 피하지방 (SF), 갈색지방 (BAT) 조직을 H&E (Hematoxylin and eosin) 염색을 하여 비교한 그림이다.
도 14의 (a)는 고지방식이를 투여하여 비만 유도된 C57BL/6 mice와 Butein을 8주 간 투여한 마우스에서 glucose tolerance test 및 (b) insulin tolerance test의 결과이다.
도 15는 비만 유도된 C57BL/6 mice를 대상으로 Butein을 처리(5, 15mg/kg)한 경우, 피하지방조직인 subcutaneous fat에서 지방세포 특이적인 PPARγ, aP2, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, PGC-1α, CIDEA, COX7a, Dio2의 발현량을 비교한 결과이다( HFD, high fat diet를 섭취한 비만 유도 대조군 그룹 (n= 7); 15, HFD + Butein, high fat diet를 섭취한 그룹에 하루에 5mg/kg 용량으로 복강 주사하여 투여한 그룹 (n= 8). HFD + Butein, high fat diet를 섭취한 그룹에 하루에 15mg/kg 용량으로 복강 주사하여 투여한 그룹 (n= 7)).
도 16은 비만 유도된 C57BL/6 mice를 대상으로 Butein을 처리 (5, 15mg/kg)한 경우, 복부지방조직인 epididymal fat에서 지방세포 특이적인 PPARγ, aP2와 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 PGC-1α, CIDEA, COX7a, Dio2의 발현량을 비교한 결과이다.
도 17은 비만 유도된 C57BL/6 mice를 대상으로 Butein을 처리 (5, 15mg/kg)한 경우, 갈색지방조직인 brown fat에서 지방세포 특이적인 PPARγ, aP2와 베이지 지방세포에서 특이적인 UCP-1, PRDM16, Cox8b, 백색지방세포 특이적인 resistin, Nnmt, 및 베이지 지방세포에서 특이적인 PGC-1α, CIDEA, COX7a, Dio2의 발현량을 비교한 결과이다.
도 18은 비만 유도된 C57BL/6 mice를 대상으로 Butein을 처리(5, 15mg/kg)한 경우, 혈액내 glucose의 변화, 중성지방, 지방산, LDL, cholesterol 등의 변화를 나타낸 결과이다.
도 19는 고지방식이로 비만이 유도된 마우스에 butein 또는 resveratrol을 처리하여, 비만효과를 확인하기 위한 실험의 대략적인 모식도 이다.
도 20은 고지방식이로 비만이 유도된 (a) 20주령 또는 (b) 28주령 마우스에 butein 또는 resveratrol을 처리하여 비만 치료 효과 및 (c) 세 군간 식이량을 비교한 결과이다.
도 21은 고지방식이로 비만이 유도된 마우스에서 Butein 처리에 의한 (a) 항문의 온도 변화, (b) glucose tolerance test, (c) insulin tolerance test 결과를 나타낸 도이다.
도 22는 (a) 3T3-L1세포에서, PRDM4 siRNA (si#1과 si#2) 처리에 의한 지방 축적 정도를 Oil red O 염색으로 확인한 결과, (b) C3H10T1/2세포에서 PRDM4 siRNA (si#1과 si#2) 처리에 의한 유전자의 발현 변화, (c) t37i세포에서, PRDM4 siRNA (si#1과 si#2) 처리에 의한 유전자의 발현 변화를 확인한 결과이다.
도 23은 PRDM4 siRNA와 대조군 (scrambled RNA, scr)을 ip injection을 통하여 주사 하였을 때의 (a) 마우스의 체중 변화 및 (b) fat, spleen, kidney, liver 등의 기관 무게 변화를 나타낸 결과이다.
도 24는 PRDM4 siRNA 가 투여된 마우스의 (a) 항문의 온도 변화, (b) glucose tolerance test, (c) insulin tolerance test 결과를 나타낸 도이다.
도 25는 butein의 유도체를 지방세포로 분화된 C3H10T1/2 세포에 처리하였을 때 UCP-1의 발현량 및 PRDM4의 발현량을 나타낸 결과이다.FIG. 1 shows the results of the changes in the expression levels of PPARγ, aP2 and UCP-1 in the case of C3H10T1 / 2 cells induced to adipocytes and then treated with Butein.
FIG. 2 shows the result of comparing the expression levels of UCP-1, PRDM16, Cidea, and PGC-1a mRNA by Oil Red O staining and real time PCR in the case of treatment with Butein while differentiating T37i cells into brown fat.
FIG. 3 shows the results of comparing the expression levels of UCP-1 when C3H10T1 / 2 cells were differentiated into adipocytes and treated with sulfuretin, fisetin, butein, resveratrol or genistein.
FIG. 4 shows the results of measurement of UCP-1 expression in mouse embryonic fibroblast (MEF) cells treated with butein.
FIG. 5 shows the results of UCP-1 expression after 24 hours of treatment with various anti-obesity physiologically active substances and antimutagenic substances, which have been reported to have anti-obesity effect on C3H10T1 / 2 cells, compared with those of butein treatment.
Figure 6 shows the results of injecting butein and PBS into the peritoneal cavity of mice at a dose of 5 mg / kg for 14 days and then isolating epidydymal fat, which is abdominal adipose tissue, to detect adipocyte-specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, (N = 6), Butein (Butein), and Butein (N = 6) groups in the beef adipocytes.
Figure 7 shows that subcutaneous fat, which is subcutaneous fat tissue, was injected into the abdominal cavity of mice at a dose of 5 mg / kg for 14 days with butein and PBS, and then adipocyte specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, The results showed that UCP-1, PRDM16, Cox8b and Cidea were expressed in beige adipocytes.
Figure 8 shows that brown fat, which is a brown adipose tissue, was separated and injected into the abdominal cavity of mice at a dose of 5 mg / kg for 14 days with butein and PBS, and adipocyte specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, The results showed that UCP-1, PRDM16, Cox8b and Cidea were expressed in beige adipocytes.
FIG. 9 is a photograph showing changes in the appearance of mice for 8 weeks in the experiment in which Butein was administered to C57BL / 6 mice administered with high fat diet (ND, control group (N = 5) fed with normal chow diet, HFD, (n = 7), which received a high fat diet (n = 7) and 15 mg / kg / day of HFD + Butein and high fat diets.
FIG. 10 is a graph showing changes in body weight for 8 weeks in an experiment in which Butein was administered to C57BL / 6 mice administered with high fat diet.
FIG. 11 is a graph showing the effect of BUT on brown fat (BAT, brown Adipose Tissue), subcutaneous fat (FAT), abdominal fat (AF) and abdominal epididymal FAT ).
FIG. 12 is a graph comparing the weight of fat pad and liver in obesity-induced C57BL / 6 mice administered with high fat diet and 8-week-old Butein mice.
FIG. 13 is a graph showing changes in abdominal fat (AF), subcutaneous fat (SF) and brown fat (BAT) tissues in a mouse administered with a high fat diet and C57BL / 6 mice fed with obesity for 8 weeks, and Hematoxylin and eosin ), And compared them.
14 (a) is the result of glucose tolerance test and (b) insulin tolerance test in mice in which obese-induced C57BL / 6 mice and butein were administered for 8 weeks in a high fat diet.
FIG. 15 is a graph showing the effect of treatment with butein (5, 15 mg / kg) on obesity-induced C57BL / 6 mice in the subcutaneous fat, subcutaneous fat, fat cell specific PPARγ, aP2, white adipocyte-specific resistin, Nnmt, (HFD, obesity-induced control group (n = 7) consuming a high fat diet) compared with the UCP-1, PRDM16, Cox8b, PGC-1α, CIDEA, COX7a and Dio2 expression levels in beef fat cells. (HFD + Butein, high fat diet) were fed a dose of 5 mg / kg per day (n = 8) to a group taking HFD + Butein and high fat diets at a dose of 15 mg / kg Group (n = 7) administered by intraperitoneal injection at a dose of 1 mg / kg.
FIG. 16 is a graph showing the results of a comparison of adipocyte-specific PPARγ and aP2 in epididymal fat, which is abdominal adipose tissue, and UCP-1, which is specific for beige fat cells, in obese-induced C57BL / 6 mice treated with butein (5, 15 mg / kg) CIDEA, COX7a, and Dio2 in PRDM16, Cox8b, white adipocyte-specific resistin, Nnmt, and beige adipocytes.
FIG. 17 shows the results of treatment of obesity-induced C57BL / 6 mice treated with butein (5, 15 mg / kg), brown fat, brown fat, adipocyte-specific PPARγ, aP2 and UCP- CIDEA, COX7a, and Dio2 in PRDM16, Cox8b, white adipocyte-specific resistin, Nnmt, and beige adipocytes.
FIG. 18 shows changes in blood glucose, triglyceride, fatty acid, LDL, and cholesterol when treated with butein (5, 15 mg / kg) in obese-induced C57BL / 6 mice.
FIG. 19 is a schematic diagram of an experiment for confirming the obesity effect by treating butein or resveratrol with a high fat diet-induced obesity-induced mouse.
20 shows the results of comparing the effect of treating obesity with the treatment of butein or resveratrol with (a) 20-wk old or (b) 28-wk old mice induced by obesity and (c) a comparison of three groups of diets.
FIG. 21 is a graph showing the results of (a) temperature change of anus, (b) glucose tolerance test, and (c) insulin tolerance test by butein treatment in high fat diet-induced obesity-induced mice.
FIG. 22 shows (a) the degree of fat accumulation by treatment with PRDM4 siRNA (
FIG. 23 shows the results of (a) weight change in mice and (b) organ weight changes in fat, spleen, kidney, liver and the like when injected with PRDM4 siRNA and a control group (scrambled RNA, scr) via ip injection.
FIG. 24 is a graph showing the results of (a) temperature change of anus, (b) glucose tolerance test, and (c) insulin tolerance test in mice to which PRDM4 siRNA was administered.
FIG. 25 shows the expression levels of UCP-1 and PRDM4 when treated with C3H10T1 / 2 cells differentiated from butein derivatives into adipocytes.
본 발명에서, 뷰테인(Butein)을 처리한 경우, C3H101/2 세포주에서의 베이지 지방세포의 마커인 UCP-1(uncoupling protein-1)의 발현증가 및 T37i세포에서의 갈색 지방세포 마커인 UCP-1, PRDM16, Cidea등의 발현증가를 확인하였다. 또한 고지방 식이로 유도된 마우스에서 Butein 처리에 의한 체중 감소 및 포도당 과 인슐린의 대사 개선을 확인하고, 이에 기초하여 본 발명을 완성하였다.
In the present invention, the expression of UCP-1 (uncoupling protein-1), a marker of beige adipocytes in C3H101 / 2 cell line, and the expression of UCP-1, a brown fat cell marker in T37i cells, 1, PRDM16, and Cidea. In addition, weight loss and glucose and insulin metabolism improvement by butein treatment in high fat diet induced mice was confirmed, and the present invention was completed based on this finding.
이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.
본 발명은 뷰테인(Butein) 또는 뷰테인(Butein) 유도체, 또는 약제학적으로 허용되는 이의 염을 유효성분으로 포함하는, 백색지방세포로부터 베이지지방세포로의 분화 유도용 조성물을 제공한다.The present invention provides a composition for inducing differentiation from white adipocytes into beige adipocytes, comprising a Butein or Butein derivative or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명에서 뷰테인 유도체는 하기 화학식 1로 표시되는 화합물로서, In the present invention, the butane derivative is a compound represented by the following formula (1)
[화학식 1][Chemical Formula 1]
상기 화학식 1에서,In
R1은 OH, 또는 C1-C6 알킬이고, R2는 OH, 할로젠, 또는 C1-C6 알콕시이고, R3는 OH, 또는 C1-C6 알콕시이고, R4는 수소 또는 C1-C6 알킬일 수 있으며, 하기 반응식 1에 나타낸 바와 같이, 화합물 C를 프롤린 촉매 하에서 화합물 D와 반응시켜 제조하는 방법으로 상기 화학식 1과 유사한 화학식 B와 화학식 1의 화합물을 제조할 수 있다.R 1 is OH, or C 1 -C 6 alkyl, R 2 is OH, halogen, or C 1 -C 6 alkoxy, R 3 is OH, or C 1 -C 6 alkoxy, R 4 can be hydrogen or C 1 -C 6 alkyl, and is prepared by reacting compound C with compound D under proline catalysis, as shown in
[반응식 1][Reaction Scheme 1]
또한, 본 발명에서 뷰테인 유도체는 하기 화학식 2로 표시되는 화합물로서, In the present invention, the butane derivative is a compound represented by the following general formula (2)
[화학식 2](2)
상기 화학식 2에서, In
Ra, Rb, 및 Rc는 각각 동일하거나 다를 수 있으며, 수소 또는 OH이고, Rd는 OH 또는 C1-C6 알콕시이고, Re는 수소, 할로젠, 또는 C1-C6 알콕시일 수 있으며, 하기 반응식 2에 나타낸 바와 같이, 화합물 E를 산 촉매 하에서 화합물 F와 반응시켜 화학식 2의 화합물을 제조할 수 있다.R a , R b and R c may be the same or different and each is hydrogen or OH, R d is OH or C 1 -C 6 alkoxy and R e is hydrogen, halogen, or C 1 -C 6 alkoxy And compound E can be prepared by reacting compound E with compound F under acid catalysis, as shown in
[반응식 2][Reaction Scheme 2]
특히, 상기 화학식 1 또는 2의 화합물은 바람직하게는 2-(3,4-다이하이드록시페닐)-7-하이드로록시크로멘-4-온 (2-(3,4-dihydroxyphenyl)-7-hydroxychroman-4-one); (E)-1-(2,4-다이하이드록시페닐)-3-(4-하이드록시-3-메톡시페닐)프로프-2-엔-1-온 E(()-1-(2,4-dihydroxyphenyl)-3-(4-hydroxy-3-methoxyphenyl)prop-2-en-1-one); 7-하이드록시-2-(4-하이드록시-3-메톡시페닐)크로멘-4-온 (7-hydroxy-2-(4-hydroxy-3-methoxyphenyl)chroman-4-one); (E)-1-(2,4-다이하이드록시페닐)-3-(3-하이드록시-4-메톡시페닐)프로프-2-엔-1-온; ((E)-1-(2,4-dihydroxyphenyl)-3-(3-hydroxy-4-methoxyphenyl)prop-2-en-1-one); 7-하이드록시-2-(3-하이드록시-4-메톡시페닐)크로멘-4-온 (7-hydroxy-2-(3-hydroxy-4-methoxyphenyl)chroman-4-one); (E)-1-(2,4-다이하이드록시페닐)-3-(3-플루오로-4-하이드록시페닐)프로프-2-엔-1-온 ((E)-1-(2,4-dihydroxyphenyl)-3-(3-fluoro-4-hydroxyphenyl)prop-2-en-1-one); (E)-1-(2,4-다이하이드록시페닐)-3-(4-하이드록시페닐)프로프-2-엔-1-온 ((E)-1-(2,4-dihydroxyphenyl)-3-(4-hydroxyphenyl)prop-2-en-1-one); 2-(3,4-다이하이드록시페닐)-7-하이드록시-3-메틸크로멘-4-온 (2-(3,4-dihydroxyphenyl)-7-hydroxy-3-methylchroman-4-one); 2-(4-플루오로-3-메톡시페닐)-7-하이드록시크로멘-4-온 (2-(4-fluoro-3-methoxyphenyl)-7-hydroxychroman-4-one); (E)-3-(3,4-다이하이드록시페닐)-1-(4-하이드록시페닐)프로프-2-엔-1-온 ((E)-3-(3,4-dihydroxyphenyl)-1-(4-hydroxyphenyl)prop-2-en-1-one); (E)-1,3-비스(3,4-다이하이드록시페닐)프로프-2-엔-1-온 ((E)-1,3-bis(3,4-dihydroxyphenyl)prop-2-en-1-one); 및 (E)-1,3-비스(4-하이드록시페닐)프로프-2-엔-1-온 ((E)-1,3-bis(4-hydroxyphenyl)prop-2-en-1-one)으로 이루어진 군으로부터 선택될 수 있으나, 이로써, 제한되는 것은 아니다. Particularly, the compound of formula (1) or (2) is preferably 2- (3,4-dihydroxyphenyl) -7-hydroxyhydrochroman- -4-one); (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop- , 4-dihydroxyphenyl) -3- (4-hydroxy-3-methoxyphenyl) prop-2-en-1-one); 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chroman-4-one; (E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; ((E) -1- (2,4-dihydroxyphenyl) -3- (3-hydroxy-4-methoxyphenyl) prop-2-en-1-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chroman-4-one; (E) -1- (2-fluoro-4-hydroxyphenyl) prop-2-en- , 4-dihydroxyphenyl) -3- (3-fluoro-4-hydroxyphenyl) prop-2-en-1-one); (E) -1- (2,4-dihydroxyphenyl) -3- (4-hydroxyphenyl) prop- -3- (4-hydroxyphenyl) prop-2-en-1-one); 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchroman-4-one ; 2- (4-Fluoro-3-methoxyphenyl) -7-hydroxychroman-4-one; (E) -3- (3,4-dihydroxyphenyl) -1- (4-hydroxyphenyl) prop- -1- (4-hydroxyphenyl) prop-2-en-1-one); (E) -1,3-bis (3,4-dihydroxyphenyl) prop-2-ene- en-1-one); And (E) -1,3-bis (4-hydroxyphenyl) prop-2-en-1- one, but is not limited thereto.
본 발명에서 사용되는 용어, "약제학적으로 허용 가능한 이의 염"은 당해 기술분야에서 통상적인 방법에 의해 제조될 수 있는 것으로, 예를 들면, 염산, 브롬화수소, 황산, 황산수소나트륨, 인산, 탄산 등의 무기산과의 염 또는 개미산, 초산, 옥살산, 벤조산, 시트르산, 타르타르산, 글루콘산, 게스티스산, 푸마르산, 락토비온산, 살리실릭산, 또는 아세틸살리실릭산(아스피린)과 같은 유기산과 함께 약제학적으로 허용 가능한 이들의 산의 염을 형성하거나, 또는 나트륨, 칼륨 등의 알칼리금속이온과 반응하여 이들의 금속염을 형성하거나, 또는 암모늄 이온과 반응하여 또 다른 형태의 약제학적으로 허용 가능한 그의 염을 형성하는 것을 의미한다.The term "pharmaceutically acceptable salt thereof" used in the present invention refers to a salt that can be prepared by a conventional method in the art, for example, hydrochloric acid, hydrogen bromide, sulfuric acid, sodium hydrogen sulfate, Or an organic acid such as formic acid, acetic acid, oxalic acid, benzoic acid, citric acid, tartaric acid, gluconic acid, gestic acid, fumaric acid, lactobionic acid, salicylic acid or acetylsalicylic acid (aspirin) Or by reacting with an alkali metal ion such as sodium, potassium or the like to form a metal salt thereof or reacting with an ammonium ion to form another form of a pharmaceutically acceptable salt thereof, .
본 발명에서 사용되는 용어, "백색 지방세포"는 중성 지방으로 대량의 지방 에너지를 체내에 축적하는 기능을 갖는 세포로서, 임신말기, 유아기, 사춘기에 집중하여 증식하며, 15배까지 부풀어 올라 지방 비대화 현상의 원인이 되기도 하며, 일반적으로 "지방세포"라 함은 "백색 지방세포"를 의미한다.As used herein, the term "white adipocyte" is a neutral fat, a cell having a function of accumulating a large amount of fat energy in the body. It is a cell that proliferates at the end of pregnancy, infancy and puberty and blooms up to 15 times, And the term "adipocyte" generally means "white adipocyte ".
본 발명에서 사용되는 용어, "베이지 지방세포"는 백색 지방조직에서부터 유래될 수 있으며, 미토콘드리아에 철분이 존재하여 베이지색을 띄는 세포이다. 갈색지방세포는 백색 지방세포와 비교하여 에너지를 소비하여 열을 발생시킬 수 있는 지방세포이며, 베이지 지방세포 지방을 에너지로 변환하는 기능을 가지고 있으며, 차가운 기온이나 특정 호르몬에 반응하여 UCP-1을 생산한다.As used herein, the term "beige adipocytes" may be derived from white adipose tissue and is a beige-colored cell with iron present in the mitochondria. Brown adipocytes are fat cells that can generate heat by consuming energy compared to white adipocytes, and have the ability to convert beef adipocyte fat into energy, and are capable of producing UCP-1 in response to cold temperatures or specific hormones. Production.
본 발명에서 사용되는 용어, "분화(differentiation)"는 세포가 분열 증식하여 성장하는 동안에 서로 구조나 기능이 특수화하는 현상, 즉 생물의 세포, 조직 등이 각각에게 주어진 일을 수행하기 위하여 형태나 기능이 변해가는 것을 말한다. 일반적으로 비교적 단순한 계(系)가 둘 이상의 질적으로 다른 부분계(部分系)로 분리되는 현상이다. 예를 들면, 개체 발생에서 처음에 동질적이었던 알 부분 사이에 머리나 몸통 등의 구별이 생기거나 세포에도 근세포 또는 신경세포 등의 구별이 생기는 것과 같이 처음에 거의 동질이었던 어떤 생물계의 부분 사이에 질적인 차이가 생기는 것, 또는 그 결과로서 질적으로 구별할 수 있는 부역 또는 부분계로 나누어져 있는 상태를 분화라고 한다.The term "differentiation" used in the present invention refers to a phenomenon in which a structure or function is specialized with each other while cells are growing by proliferation and proliferation, that is, cells, tissues, Is changing. In general, a relatively simple system is separated into two or more qualitatively different systems. For example, there is a qualitative difference between the parts of a biological system that were almost homogeneous at first, such as the distinction of heads or trunks between the eggs that were homogeneous at first in the development of an individual, or the distinction of cells such as muscle cells or nerve cells The state in which there is a difference or as a result is divided into qualitative or inferior parts or partial systems is called differentiation.
본 발명의 조성물은 갈색 지방세포의 활성을 증가시키거나 UCP-1 또는 PRDM4의 발현을 증가시키는 것을 특징으로 한다.The composition of the present invention is characterized by increasing the activity of brown adipocytes or increasing the expression of UCP-1 or PRDM4.
본 발명에서 사용되는 용어, "갈색 지방세포"는 베이지 지방세포와 마찬가지로 지방을 에너지로 변환하는 기능을 갖는 세포로서, 육안으로 보면 황갈색 내지 적갈색을 띈다. 갈색 지방세포가 많을수록 체지방이 감소하며, 성인이 될수록 갈색 지방세포는 감소한다. 갈색 지방세포는 근육세포로 분화하는 줄기세포에 생성되는 반면, 베이지 지방세포는 백색 지방 세포층 안에서 생성된다는 점에서 차이가 있다. As used herein, the term "brown adipocyte" is a cell having a function of converting fat into energy, similar to beige adipocytes, and has a tan to reddish brown color visually. The more brown fat cells, the lower the body fat, and the more adult the brown fat cells are reduced. Brown adipocytes are produced in stem cells differentiated into muscle cells, whereas beige adipocytes are produced in white adipocyte layers.
본 발명에서 사용되는 용어, "분화 유도 조성물"은 초기 단계의 세포가 각 조직으로서의 특성을 갖게 되는 과정을 유도할 수 있는 조성물을 의미하며, 본 발명의 목적상 백색 지방세포를 베이지 지방세포로 분화유도를 할 수 있는 조성물을 의미한다.As used herein, the term "differentiation inducing composition" refers to a composition capable of inducing a process in which cells in an initial stage have characteristics as respective tissues. For the purpose of the present invention, white adipocytes are differentiated into beige fat cells Means a composition capable of induction.
본 발명의 베이지 지방세포로의 분화 유도 조성물은 뷰테인 또는 뷰테인 유도체를 전체 조성물 총 중량에 대하여 0.0001 내지 10 중량%, 바람직하게는 0.001 내지 1 중량%의 양으로 존재할 수 있으나, 이에 제한되지는 않는다. The beige adipocyte differentiation inducing composition of the present invention may be present in an amount of 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, based on the total weight of the total composition of butene or butane derivatives, but is not limited thereto .
본 발명의 일 실시예에서는 뷰테인 (Butein) 처리에 의한 베이지 지방세포의 마커인 UCP-1의 발현 증가를 확인하였으며 (실시예 1 참조), 갈색 지방세포 마커인 PRDM16, Cidea 등의 발현 증가를 확인하였다 (실시예 2 참조). 또한, 다른 항비만 생리활성 유효성분들과 비교하여, 뷰테인 처리에 의한 UCP-1의 발현에 대한 현저한 효과를 확인하였으며 (실시예 3 참조), in vivo 실험 및 고지방식이로 유도된 비만 마우스에서 베이지 또는 갈색 지방세포의 증가 및 비만 개선효과를 확인하였다 (실시예 4 및 5 참조). 본 발명의 다른 실시예에서는 Butein의 생리활성을 유도하는 유전자로 PRDM4을 발견하였으며, PRDM4 발현 억제에 의한 체중 증가 및 포도당 인슐린 대사 억제를 확인하였다 (실시예 6 및 7 참조). 아울러, 뷰테인 유도체를 제조하였으며, 상기 뷰테인 유도체 투여에 의한 UCP-1, 및 PRDM4의 발현량을 증가하였는 바, 본 발명의 베이지 지방세포로의 분화 유도 조성물은 비만의 예방 또는 치료용 약학적 조성물로서 이용될 수 있음을 확인하였다 (실시예 8 및 9 참조).In one embodiment of the present invention, the expression of UCP-1, a marker of beige fat cells by butein treatment, was observed (see Example 1), and the expression of PRDM16 and Cidea, which are brown adipocyte markers, (See Example 2). In addition, significant effects on UCP-1 expression by the butane treatment were confirmed (see Example 3), compared with other anti-obesity physiologically active compounds, and in vivo experiments and in an obesity- Increase in beige or brown adipocytes and improvement in obesity (see Examples 4 and 5). In another embodiment of the present invention, PRDM4 was found as a gene that induces physiological activity of Butein, and weight gain and inhibition of glucose insulin metabolism by inhibition of PRDM4 expression were confirmed (see Examples 6 and 7). In addition, the butane derivatives were prepared, and the expression amounts of UCP-1 and PRDM4 were increased by administration of the butane derivatives. As a result, the beige adipocyte differentiation inducing composition of the present invention is useful as a pharmaceutical composition for preventing or treating obesity (See Examples 8 and 9).
본 발명의 조성물에 의한 예방 또는 치료 대상 질병인 "비만 (obesity)"은 대사 장애로 인하여 체내에 지방세포가 증식 분화하고, 이로 인하여 지방이 과잉으로 축적된 상태를 의미하며, 에너지 흡수량이 소비량에 비해 상대적으로 증가하는 경우, 지방세포의 수와 부피가 증가되는 과정을 거쳐 결과적으로 지방조직의 질량이 증가된다. 세포 수준에서의 비만은 지방세포의 증식 및 분화의 촉진으로 인한 지방세포의 수와 부피의 증가를 의미한다.The term "obesity ", which is a disease to be prevented or treated by the composition of the present invention, refers to a state in which fat cells multiply and multiply in the body due to metabolic disturbance and, as a result, fat accumulates excessively. , The number of adipocytes and the volume of the adipocytes increase, resulting in an increase in the mass of the adipose tissue. Obesity at the cellular level means an increase in the number and volume of adipocytes due to promotion of proliferation and differentiation of adipocytes.
본 발명의 조성물은 약제학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약제학적으로 허용 가능한 담체는 생리식염수, 폴리에틸렌글리콜, 에탄올, 식물성 오일, 및 이소프로필미리스테이트 등을 포함할 수 있으나, 이에 제한되지는 않는다. 또한 기존에 알려진 줄기세포 배양용 배지, 분화 유도제 등을 더 포함할 수 있다.The compositions of the present invention may comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may include, but is not limited to, physiological saline, polyethylene glycol, ethanol, vegetable oil, and isopropyl myristate. Further, it may further include a culture medium for known stem cell culture, a differentiation inducing agent, and the like.
본 발명의 조성물은, 비경구 투여를 위한 수용성 용액으로 제조할 수 있으며, 바람직하게는 한스 용액(Hank's solution), 링거 용액(Ringer's solution) 또는 물리적으로 완충된 염수와 같은 완충용액 등을 사용할 수 있다. 수용성 주입(injection) 현탁액은, 소디움 카르복시메틸셀룰로오스, 솔비톨 또는 데스트란과 같이 현탁액의 점도를 증가시킬 수 있는 기질을 첨가할 수 있다.The composition of the present invention may be prepared as an aqueous solution for parenteral administration, and preferably a buffer solution such as Hank's solution, Ringer's solution or physically buffered saline can be used . Aqueous injection suspensions may contain a substrate capable of increasing the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol or desran.
또한, 본 발명의 조성물의 바람직한 양태는 멸균 주사용 수성 또는 유성 현탁액의 멸균 주사용 제제의 형태일 수 있다. 상기 현탁액은 적합한 분산제 또는 습윤제(ex.트윈 80) 및 현탁화제를 사용하여 이 분야에 공지된 기술에 따라 제형화할 수 있다. 멸균 주사용 제제는 또한 무독성의 비경구적으로 허용되는 희석제 또는 용매 중의 멸균 주사 용액 또는 현탁액 (ex. 1,3-부탄디올 중의 용액)일 수 있다. 본 발명에서 사용될 수 있는 비히클 및 용매로는 만니톨, 물, 링거 용액 및 등장성 염화나트륨 용액 등이 있다. 또한, 멸균 비휘발성 오일이 통상적으로 용매 또는 현탁화 매질로서 사용된다. 상기 목적을 위해 합성 모노 또는 디글리세라이드를 포함하여 자극성이 적인 비휘발성 오일은 그 어느 것이라도 사용할 수 있다.In addition, preferred embodiments of the compositions of the present invention may be in the form of sterile injectable preparations of sterile injectable aqueous or oily suspensions. The suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (ex. Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent (e.g., a solution in 1,3-butanediol). Vehicles and solvents that may be used in the present invention include mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, nonvolatile oils are conventionally used as a solvent or suspending medium. Any non-volatile oil that is irritating, including synthetic mono- or diglycerides, may be used for this purpose.
본 발명의 다른 양태로서, 뷰테인(Butein) 또는 뷰테인(Butein) 유도체, 또는 약제학적으로 허용되는 이의 염을 백색 지방세포에 처리하는 단계를 포함하는, 백색지방으로부터 베이지지방세포로의 분화 유도방법을 제공한다. 본 발명의 방법은 상기 분화 유도용 조성물을 개체에 투여하는 단계를 포함하며, 본 발명에서 "개체"란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말 및 소 등의 포유류를 의미한다.As another aspect of the present invention, there is provided a method of inducing differentiation from a white fat to a beige adipocyte, comprising treating white adipocytes with a Butein or Butein derivative, or a pharmaceutically acceptable salt thereof, . In the present invention, the term "individual" means a subject in need of treatment for a disease, and more specifically, a human or non-human primate , Mice, rats, dogs, cats, horses, and cows.
본 발명의 또 다른 양태로서, a) in vitro 상에서 지방세포에 비만 치료 후보 물질을 처리하는 단계; b) 상기 지방 세포의 PRDM4의 유전자의 발현을 측정하는 단계; 및 c) 비처리군에 비해 PRDM4의 유전자의 발현을 증진시키는 물질을 비만 치료물질로 선정하는 단계를 포함하는, 비만 치료물질 스크리닝 방법을 제공한다.
In another aspect of the present invention, there is provided a method of treating obesity in a subject, comprising: a) treating obesity treatment candidate substances in fat cells in vitro; b) measuring the expression of PRDM4 gene in said adipocyte; And c) selecting a substance that promotes the expression of PRDM4 gene as an obesity treating substance compared to the non-treatment group.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.
실시예Example 1. 뷰테인( 1. Viewtain ( ButeinButein )에 의한 )On by 베이지지방세포로의Beige 분화 유도 확인 Identification of induction of differentiation
Butein 처리에 의한 베이지지방세포로의 분화 유도를 확인하기 위하여, 생쥐의 배아 섬유 모세포에서 기원한 다능성 줄기세포주인 C3H10T1/2 세포주를 이용하였다. C3H10T1/2 세포주를 6 well plate에 2.5×10⁴/ml의 농도로 지방세포 분화를 위한 1uM dexamethasone, 5ug/ml insulin, 20nM 3-isobutyl-1-methylxanthine(IBMX)과 PPARγ ligand (GW7845)를 함유한 배지를 이용하여 지방세포로 약 7-10일간 분화를 유도하였다. 분화 유도된 지방세포에 Butein을 농도별(5, 10, 20μM)로 24시간동안 처리한 후, 베이지 지방세포에서 발견되는 UCP-1의 발현을 realtime PCR을 통하여 확인하였다.
In order to confirm induction of differentiation into beige adipocytes by butein treatment, C3H10T1 / 2 cell line, a pluripotent stem cell line derived from mouse embryonic fibroblasts, was used. The C3H10T1 / 2 cell line was cultured in a 6 well plate at a concentration of 2.5 × 10 4 / ml containing 1 μM dexamethasone, 5 μg / ml insulin, 20 nM 3-isobutyl-1-methylxanthine (IBMX) and PPARγ ligand (GW7845) Differentiation was induced in adipocytes for about 7-10 days using the medium. The expression of UCP-1 found in beige adipocytes was confirmed by real-time PCR after treatment with different concentrations of butein (5, 10, 20 μM) for 24 h in differentiated adipocytes.
도 1에 나타난 바와 같이, Butein의 농도가 증가함에 따라 UCP-1의 발현이 증가하였으며, 이를 통해 베이지 지방세포로의 분화 증가를 확인하였다.
As shown in FIG. 1, the expression of UCP-1 was increased as the concentration of butein increased, thereby confirming an increase in differentiation into beige adipocytes.
실시예 2. 뷰테인(Butein)에 의한 갈색지방세포의 증가 확인Example 2. Confirmation of Increase of Brown Adipocytes by Butein
Butein 처리에 의한 갈색지방세포의 증가를 확인하기 위하여, 갈색지방전구세포인 T37i세포를 이용하였다. T37i세포를 5ug/ml insulin, 1nM T3 (triiodothyronine)를 함유한 배지로 2일간 배양하고 이 후, 5ug/ml insulin을 포함한 배지를 이용하여 지방세포로 6-8일간 분화 유도하였다. 분화 유도된 지방세포에 Butein을 농도별(5, 10, 20μM)로 6일간 처리하여, Oil Red O 염색하였으며, 지방세포분화와 관련된 PPARγ, aP2, 그리고 갈색지방세포 마커인 UCP-1, PRDM16, Cidea 유전자의 mRNA 발현량을 realtime PCR을 통하여 확인하였다.
In order to confirm the increase of brown adipocytes by butein treatment, T37i cells, a brown lipid precursor cell, were used. T37i cells were cultured for 2 days in medium containing 5 ug / ml insulin and 1 nM T3 (triiodothyronine), and then differentiated into adipocytes for 6 to 8 days using medium containing 5 ug / ml insulin. The differentiation-induced adipocytes were treated with Butein (5, 10, 20 μM) for 6 days and stained with Oil Red O. The PPARγ, aP2, and brown adipocyte markers UCP-1, PRDM16, The mRNA expression level of Cidea gene was confirmed by realtime PCR.
도 2에 나타난 바와 같이, Butein의 농도가 증가함에 따라 UCP-1의 발현의 증가 및 갈색지방세포의 마커인 PRDM16, Cidea 등의 발현 증가를 확인하였다.
As shown in FIG. 2, the expression of UCP-1 and the expression of PRDM16 and Cidea, which are markers of brown adipocytes, were increased as the concentration of butein increased.
실시예 3. 뷰테인 (Butein)의 특이적인 UCP-1의 발현 증가 확인 Example 3. Confirmation of Increased Expression of UCP-1 Specific to Butein
C3H10T1/2 세포를 이용하여, Butein 처리에 의한 UCP-1의 발현량 증가를 지방세포에 영향을 주는 물질로 알려진 sulfuretin, fisetin, resveratrol genistein 처리에 의한 경우와 비교하였으며, mouse embryonic fibroblast (MEF)세포를 이용하여 Butein을 처리에 의한 UCP-1의 발현량 증가를 대조군인 DMSO 처리에 의한 경우와 비교하였다.The increase of UCP-1 expression by butein treatment was compared with that of sulfuretin, fisetin, and resveratrol genistein, which are known to affect adipocytes, using C3H10T1 / 2 cells. Mouse embryonic fibroblast (MEF) cells , The increase in the expression level of UCP-1 by treatment with Butein was compared with that of the control group, DMSO treatment.
또한, 분화가 끝난 C3H10T1/2 세포에 항비만 효능을 지닌 것으로 보고된 다양한 항비만 생리활성 물질 및 천연물 유래 단일 물질 등을 24시간 동안 처리한 후의 UCP-1 발현량을 Butein 처리의 경우와 비교하였다.
In addition, the amount of UCP-1 expression after 24 hours treatment of various anti-obesity physiologically active substances and natural substance-derived monoclonal antibodies reported to have anti-obesity effect on differentiated C3H10T1 / 2 cells was compared with that of butein treatment .
도 3 내지 도 4에서 나타난 바와 같이, C3H10T1/2 세포에서, Butein 처리를 한 경우, sulfuretin, fisetin, resveratrol genistein 처리에 의한 경우와 비교하여 3배이상 UCP-1의 발현이 증가하였으며, MEF세포에서, Butein 처리에 의한 경우, 대조군과 비교하여 10배이상 UCP-1의 발현이 증가하였다. 또한, 도 5에서 나타난 바와 같이, 일반적으로 기존에 알려진 항비만 생리활성 물질들을 처리한 경우, UCP-1의 발현량이 증가하지 않은 반면, Butein 처리를 한 경우, UCP-1의 발현량이 특이적으로 현격하게 증가하였다.
As shown in FIG. 3 to FIG. 4, in the case of C3H10T1 / 2 cells, the expression of UCP-1 was increased 3 times or more as compared with the case of treatment with sulfuretin, fisetin and resveratrol genistein, , And UCP-1 expression by Butein treatment was 10 times or more higher than that of the control group. In addition, as shown in FIG. 5, when the conventional antiobesity physiologically active substances were treated, the expression level of UCP-1 was not increased. On the other hand, when Butein treatment was performed, the expression level of UCP-1 was specifically Respectively.
실시예 4. in vivo에서 백색 지방세포 억제 및 베이지와 갈색 지방세포의 증가 확인Example 4. In vivo inhibition of white adipocytes and increase in beige and brown adipocytes
In vivo에서 Butein의 베이지와 갈색 지방세포의 증가 및 백색지방세포의 억제 활성을 검증하기 위해 마우스에 총 14일간 투여하여 지방조직에서 마커의 발현을 측정하였다. 5mg/kg의 용량으로 6마리의 쥐에 복강주사로 투여하였고 대조군으로 용매만을 6마리에 복강에 투여하였다. 14일 후 복부지방 (epididymal fat)과 피하지방 (subcutaneous fat) 그리고 갈색지방 (brown fat)에서 백색지방 및 베이지(갈색)지방 마커의 발현량을 realtime PCR을 통하여 확인하였다.
In order to examine the increase of beige and brown adipose cells and the inhibitory activity of white adipocytes in vivo, the expression of markers in adipose tissue was measured by administration to mice for a total of 14 days. Six rats were dosed intraperitoneally with a dose of 5 mg / kg. As a control group, only 6 mice were administered intraperitoneally. After 14 days, the expression levels of white fat and beige (brown) fat markers in epididymal fat, subcutaneous fat and brown fat were confirmed by realtime PCR.
도 6 내지 도 8에 나타난 바와 같이, C3H10T1/2 및 T37i세포에서와 유사하게 갈색지방세포 마커인 UCP-1, PRDM16 Cox8b, Cidea의 증가 및 지방세포 마커인 PPARg, aP2, 그리고 백색지방세포 마커인 resistin, Nnmt (nicotinamide N-methyltransferase)의 감소를 확인하였다.
As shown in FIGS. 6 to 8, the increase in the brown fat cell markers UCP-1, PRDM16 Cox8b, Cidea and the fat cell markers PPARg, aP2, and white fat cell markers similar to those in C3H10T1 / 2 and T37i cells resistin and Nnmt (nicotinamide N-methyltransferase).
실시예 5. 고지방식이로 유도된 비만 마우스에서 비만 개선효과 확인Example 5: Obesity improvement effect in obese mice induced by high fat diet
5.1. PBS 투여군과의 비교실험5.1. Comparison with PBS-treated group
뷰테인의 항비만 효과를 확인하기 위하여 C57BL6/J 마우스에 고지방식이로 비만을 유도하여 복강 주사로 투여하였다. 7주된 마우스를 1주간 적응 시킨 후, 고지방식이 (60% fat, Research Diet에서 구입)를 8주간 투여하면서 비만을 유도하였으며, 뷰테인은 하루에 5mg/kg과 15mg/kg의 용량으로 각각 7마리에 투여하였다. 대조군으로는 정상 식이 섭취군 (5마리), 고지방식이 섭취에 PBS 투여군 (7마리)을 사용하였다.To confirm the anti-obesity effect of buitane, high fat diet was induced in C57BL6 / J mice by intraperitoneal injection. Obesity was induced by high-fat diet (60% fat, purchased from Research Diet) for 8 weeks after 7 weeks of mouse adaptation for 1 week. Butane was administered at a dose of 5 mg / kg and 15 mg / kg for 7 Lt; / RTI > Control group was fed normal diet (5 rats) and PBS diet (7 rats).
투여 기간 동안의 체중 증가량 및 각종 장기의 무게를 조사하여 비교하였으며, 8주 후에는 glucose tolerance test (GTT)와 insulin tolerance test (ITT) 를 수행하였으며, 조직 및 혈액학적 분석을 병행하였다.
The glucose tolerance test (GTT) and the insulin tolerance test (ITT) were performed 8 weeks later. Tissue and hematological analysis were performed simultaneously.
도 9 내지 도 18에 나타난 바와 같이, 정상식이 대조군에 비해 고지방식이 대조군에서 증가된 몸무게와 간과 내장 지방조직 무게는 뷰테인의 투여에 의해 농도 의존적으로 감소되는 경향을 보였다. 또한, GTT와 ITT에서는 15mg/kg을 투여한 군에서 유의적으로 비만에 의한 포도당과 인슐린의 대사를 개선시켰으며, 베이지 지방세포에서 특이적으로 발현되는 UCP-1, PRDM16, Cox8b, PGC-1α, CIDEA, COX7a, Dio2의 증가를 확인하였다. 혈액 분석에서도 글루코스, 콜레스테롤, 중성지방, HDL, LDL, fatty acid 등이 고용량의 Butein 투여군에서 유의적인 차이를 보였다. As shown in FIG. 9 to FIG. 18, the body weight and liver and visceral fat tissue weights were increased in the control group compared to the control group in a dose-dependent manner by the administration of butaine. In GTT and ITT, the metabolism of glucose and insulin by obesity was significantly improved in the group treated with 15 mg / kg. UCP-1, PRDM16, Cox8b, PGC-1α , CIDEA, COX7a, and Dio2. In blood analysis, glucose, cholesterol, triglyceride, HDL, LDL and fatty acid showed significant difference in the high dose of butein.
5.2. 5.2. PBSPBS 또는 or 레즈베라트롤Rezveratrol ( ( ResveratrolResveratrol ) ) 투여군과의Group 비교실험 Comparative experiment
뷰테인의 항비만 효과를 확인하기 위하여 C57BL6/J 마우스에 고지방식이로 비만을 유도한 후, Butein 처리에 따른 체중 변화 확인하였다. 구체적으로, 7주된 마우스를 1주간 적응시킨 후, 고지방식이 (60% fat, Research Diet에서 구입)를 12주간 투여하여 비만을 유도하였다. 이 후, 상기 비만이 유도된 마우스에 Butein을 하루에 30 mg/kg의 용량으로 8주간 8마리에 투여하였다. 대조군으로는 PBS 투여군 (7마리)과 항비만 예방 효능이 뛰어나다고 알려진 레즈베라트롤 (Resveratrol) 투여군 (8마리)을 사용하였다.In order to confirm the anti - obesity effect of buitane, high fat diet was induced in C57BL6 / J mouse, and then the body weight was changed by treatment with butein. Specifically, obesity was induced by high-fat diet (60% fat, purchased from Research Diet) for 12 weeks after 7 weeks of mouse adaptation for 1 week. Thereafter, the obesity-induced mice were administered Butein at a dose of 30 mg / kg per day for 8 weeks for 8 weeks. As a control group, PBS group (7 rats) and Resveratrol group (8 rats), which is known to have excellent anti - obesity efficacy, were used.
8주간의 투여 후 체중 증가량을 조사하여 비교하였으며, 8주 후에는 glucose tolerance test (GTT)와 insulin tolerance test (ITT) 를 수행하였으며, 혈액학적 분석을 병행하였다.
The glucose tolerance test (GTT) and the insulin tolerance test (ITT) were performed 8 weeks later. Hematological analysis was also performed.
도 20에 나타난 바와 같이, PBS 투여군에 비해 뷰테인 투여군에서, 체중이 약 10% 가량 감소되는 경향을 보였으며, 종래의 항비만 약물인 레즈베라트롤 (Resveratrol) 투여군에 비해서도 체중 감소효과가 현저히 우수함을 확인하였다. 구체적으로, 28주령 mice 에서 resveratrol 처리된 군에서는 대조군과 비교하여 체중의 변화가 없었던 반면, butein이 처리된 군에서는 체중이 현저하게 감소한 것을 확인하였으며, 이때 식이량에는 세 군간 차이가 없었다. As shown in FIG. 20, the body weight was reduced by about 10% in the butane-treated group compared to the PBS-administered group, and the weight loss effect was remarkably superior to that of the conventional anti-obesity drug Resveratrol Respectively. Specifically, in the resveratrol-treated group in 28-week-old mice, there was no change in body weight compared to the control group, while in the butein-treated group, the body weight was significantly decreased.
또한, 도 21에 나타난 바와 같이, 뷰테인을 투여한 군(HFD-But)에서 항문의 온도가 증가하였으며, GTT와 ITT에서는 Butein을 투여한 군에서 유의적으로 비만에 의한 포도당과 인슐린의 대사를 개선시킴을 확인하였다 (높은 insulin sensitivity).
In addition, as shown in Fig. 21, the temperature of the anal increases in the group administered with butane (HFD-But), and the metabolism of glucose and insulin by obesity in the group treated with Butein was increased (High insulin sensitivity).
실시예 6. Butein의 생리활성을 유도하는 유전자의 확인 및 발현 억제Example 6 Identification and Expression Suppression of Gene Inducing Biological Activity of Butein
Butein의 생리활성을 유도하는 유전자를 확인하기 위해 microarray를 실시 하였으며, 이들 유전자 중에서 약 2배 이상 발현이 증가된 PRDM4 (PR domain-containing protein 4) 유전자를 확인하였다. 구체적으로 Butein의 생리활성 유도여부를 확인하기 위하여, PRDM4 유전자 발현을 siRNA (small interfering RNA)로 억제시킨 후, 백색 지방세포 및 베이지세포 분화 정도를 비교하였다.
A microarray was performed to identify the genes that induce the bioactivity of butein, and PRDM4 (PR domain-containing protein 4) gene, which is expressed more than twice as much as these genes, was identified. Specifically, the expression of PRDM4 gene was inhibited by siRNA (small interfering RNA), and the degree of white adipocyte and beige cell differentiation was compared to confirm the induction of physiological activity of butein.
상기 실시예에서 사용된 두 개의 PRDM4의 siRNA sequences는 다음과 같다.The siRNA sequences of the two PRDM4s used in the above example are as follows.
PRDM4 siRNAPRDM4 siRNA
Sense 5' GAAUUACGCUCAACAGAUAUU 3' (서열번호 1)Sense 5 'GAAUUACGCUCAACAGAUAUU 3' (SEQ ID NO: 1)
Antisense 5' UAUCUGUUGAGCGUAAUUCUU 3' (서열번호 2)
Antisense 5 'UAUCUGUUGAGCGUAAUUCUU 3' (SEQ ID NO: 2)
도 22에 나타난 바와 같이, 분화된 지방세포인 C3H10T1/2에 PRDM4 siRNA를 처리한 경우, UCP-1의 발현량의 감소와 백색 지방세포로의 분화 유도 및 촉진을 확인하였다. 구체적으로 PRDM4 siRNA는 C3H10T1/2 세포에서 백색 지방세포 마커인 Nnmt와 resistin은 증가시켰으며, 갈색 지방세포마커인 UCP-1과 Dio2를 억제하였다. 또한, PRDM4 siRNA는 갈색지방세포인 t37i세포에서, 갈색지방세포 마커인 UCP-1, Cidea, Cox7a1, Dio2의 발현을 감소시켰다. 상기 결과는 PRDM 유전자는 butein 투여에 의한 갈색지방세포 유도 및 백색지방세포 억제와 관련이 있음을 의미한다.
As shown in FIG. 22, when the differentiated adipocyte C3H10T1 / 2 was treated with PRDM4 siRNA, the decrease in the expression level of UCP-1 and the induction and promotion of differentiation into white adipocytes were confirmed. Specifically, PRDM4 siRNA increased Nnmt and resistin, which are white adipocyte markers in C3H10T1 / 2 cells, and inhibited UCP-1 and Dio2, which are brown adipocyte markers. In addition, PRDM4 siRNA reduced expression of brown adipocyte markers UCP-1, Cidea, Cox7a1, and Dio2 in t37i cells, a brown fat adipocyte. These results indicate that the PRDM gene is associated with the induction of brown adipocytes and inhibition of white adipocytes by administration of butein.
실시예 7. PRDM4 유전자 발현 억제를 통한 체중 등의 변화 확인Example 7. Confirmation of changes in body weight and the like through suppression of PRDM4 gene expression
PRDM4의 생체내 기능을 확인하기 위해 고지방식이를 투여하면서PRDM4 siRNA와 scrambled RNA를 일주일에 두 번씩 각각 25mg/kg으로 6주간 주사하였다. 투여 기간 동안 PRDM4 siRNA 투여군 (si PRDM4)과 대조군인 Scrambled RNA 투여군 (Scr)의 체중 증가량 및 각종 장기의 무게를 조사하여 비교하였으며, 6주 후에는 glucose tolerance test (GTT)와 insulin tolerance test (ITT)를 수행하였다.
In order to confirm the in vivo function of PRDM4, PRDM4 siRNA and scrambled RNA were injected at 25 mg / kg twice a week for 6 weeks while high-fat diet was administered. The glucose tolerance test (GTT) and insulin tolerance test (ITT) were performed 6 weeks after the administration of PRDM4 siRNA (PRDM4) and control group Scrambled RNA (Scr) Respectively.
도 23 내지 도 24에서 나타나 바와 같이, PRDM4 siRNA 투여군은 대조군과 비교하여, 투여 4주 후부터 유의적인 체중 증가를 보였다. 내장지방 (Fat)의 무게도 증가되었으며, 간조직 (Liver) 역시 증가되는 경향성을 보였다. PRDM4 siRNA 투여군에서 나타나는 몸무게의 증가는 GTT와 ITT에서 포도당과 인슐린의 대사를 방해하였으며, 체온도 Butein 투여군과 비교하여, 유의적인 감소를 보였다.
As shown in FIG. 23 to FIG. 24, PRDM4 siRNA administration group showed a significant weight increase after 4 weeks from the control group. The weight of visceral fat was also increased, and liver was also increased. The increase in body weight in the PRDM4 siRNA group interfered with glucose and insulin metabolism in GTT and ITT, and body temperature was significantly reduced compared to Butein group.
실시예 8. 뷰테인(Butein) 및 뷰테인 유도체의 제조 Example 8. Preparation of Butein and Butane Derivatives
화합물의 제조단계는 각각 그에 상응하는 대표적인 예들을 하기에 기재하였다. 치환기가 다른 화합물들의 경우에도 하기와 유사한 단계를 통해 실제로 제조되었으며, 제조된 화합물은 표 1에 구체적으로 나타내었다. Representative examples corresponding to the respective steps of preparing the compounds are described below. Compounds having different substituents were actually prepared through steps similar to those described below, and the compounds prepared are specifically shown in Table 1.
[표 1][Table 1]
8.1. 뷰테인의 제조8.1. Manufacture of Butane
본 발명에 따른 화학식 1-1로 표시되는 뷰테인 화합물은 상기 반응식 3에 따라 제조하였다. The butene compound represented by formula (1-1) according to the present invention was prepared according to the reaction scheme (3).
[반응식 3][Reaction Scheme 3]
본 실시예에서 수행된 대표적인 반응예의 반응 조건 등은 하기에 나타내는 바와 같다; (a) 반응조건 및 재료 : 화합물 2 (152 mg, 1 mmol)와 화합물 3 (138 mg, 1 mmol)을 반응 용기에 넣고 EtOH (0.1 ml)와 KOH 수용액 (60% w/w, 1 ml)을 넣어 용해시키고 100℃로 온도를 높여 3시간 동안 반응시켰다. 상온으로 서서히 온도를 낮추면서 HCl로 pH 3이 될 때까지 점적하였다. 반응 용액을 에틸아세테이트 (10 ml)로 희석시킨 후 물로 세척(3 ml, 2회)하고 수집한 유기층을 무수 황산마그네슘으로 건조시켜 여과한 후, 순상 컬럼 조건 (에틸아세테이트 : 헥산 = 1 : 2)으로 정제하여 노란색 고체로서 1-1번 화합물 (102 mg, 수율 40%)을 수득하였으며 이에 대한 NMR 데이터는 다음과 같다; 1H, 400 MHz, DMSO-d6): δ 1H-NMR (CD3OD): δ 7.81 (1H, d, J = 8.9 Hz, H-6′), 7.70 (1H, d, J = 15.3 Hz, H-β), 7.40 (1H, d, J = 15.3 Hz, H-α), 7.15 (1H, d,J = 1.8 Hz, H-2), 7.05 (1H, dd, J = 8.2, 1.8 Hz, H-6), 6.82 (1H, d, J = 8.2 Hz, H-5), 6.40 (1H, dd, J = 8.9, 2.4 Hz, H-5′), 6.33 (1H, d, J = 2.4 Hz, H-3′), LRMs(ESI) m/z = 273.1 (M+H)+.
The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows; (a) Reaction conditions and materials: Compound 2 (152 mg, 1 mmol) and Compound 3 (138 mg, 1 mmol) were placed in a reaction vessel and EtOH (0.1 ml) and aqueous KOH solution (60% w / And the temperature was raised to 100 占 폚 and allowed to react for 3 hours. The temperature was gradually lowered to room temperature, and the solution was dropped to
8.2. 화학식 1-2의 화합물의 제조8.2. Preparation of the compound of the formula 1-2
본 발명에 따른 화학식 1-2로 표시되는 뷰테인 유도체 화합물은 상기 반응식 4에 따라 제조하였다. The butene derivative compound represented by formula 1-2 according to the present invention was prepared according to the
[반응식 4][Reaction Scheme 4]
본 실시예에서 수행된 대표적인 반응예의 반응 조건 등은 하기에 나타내는 바와 같다; The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows;
(a) 반응조건 및 재료 : 화합물 4 (152 mg, 1 mmol)와 화합물 5 (152 mg, 1 mmol)를 무수 메탄올 (5 ml)에 녹인 후, 프롤린 (0.5 eq, 0.5 mmol)을 첨가하였다. 80 ℃로 서서히 온도를 올린 후, 3일 동안 교반을 하였다. 화합물 3, 6이 모두 소모된 것을 확인한 후, 에틸아세테이트로 희석시켜 물로 세척하였다. 수집된 유기층을 무수 황산마그네슘으로 건조하여 농축시킨 후 컬럼 크로마토그래피 (에틸아세테이트:헥산 = 1: 2)로 분리정제하였다. 그 결과 노란색 고체인 화합물 1-1 (114 mg, 수득률 36%)과 노란색 고체인 화합물 1-2 (85 mg, 수득률 33%)를 각각 얻었다. 이 때 얻어진 화합물 1-1은 상기 반응의 생성물과 동일하였으며 화합물 1-2에 대한 NMR 데이터는 다음과 같다; 1H NMR (DMSO-d6): 1H-NMR (CD3OD): δ 7.69 (1H, d, J = 8.7 Hz, H-5), 6.87 (1H, d, J = 1.8 Hz, H-2′), 6.77 (1H, d, J =8.2 Hz, H-5′), 6.74 (1H, dd, J = 8.2, 1.8 Hz, H-6′), 6.44 (1H, dd, J = 8.7, 2.2 Hz, H-6), 6.32 (1H, d, J = 2.2 Hz, H-8), 5.22 (1H, dd, J = 13.2, 2.8 Hz, H-2), 2.94 (1H, dd, J = 13.2, 17.0 Hz, H-3a), 2.65 (1H, dd, J = 17.0, 2.8 Hz, H-3b); Ms(ESI) m/z = 273.1 (M+H)+.
(a) Reaction conditions and materials: Compound 4 (152 mg, 1 mmol) and compound 5 (152 mg, 1 mmol) were dissolved in anhydrous methanol (5 ml) and proline (0.5 eq, 0.5 mmol) was added. After gradually raising the temperature to 80 占 폚, stirring was performed for 3 days. After confirming that all of the
8.3. 화학식 1-9의 화합물의 제조8.3. Preparation of the compound of formula 1-9
본 발명에 따른 화학식 1-9로 표시되는 뷰테인 유도체 화합물은 상기 반응식 5에 따라 제조하였다. The butene derivative compound represented by the general formula 1-9 according to the present invention was prepared according to the
[반응식 5][Reaction Scheme 5]
본 실시예에서 수행된 대표적인 반응예의 반응 조건 등은 하기에 나타내는 바와 같다;The reaction conditions and the like of the representative reaction examples performed in this embodiment are as follows;
(a) 반응조건 및 재료 : 화합물 1-1 (272 mg, 1 mmol)을 무수 메탄올 (5 ml)에 녹인 후 Pd/C (14 mg, 5% g/g)을 넣고 수소 기류 상태를 만들었다. 상온에서 5시간 반응하여 화합물 1-1이 모두 소모된 것을 확인 후 cellite를 이용하여 여과한 후 여과액을 농축시켜 컬럼 크로마토그래피 (에틸아세테이트 : 헥산 = 1:6)을 이용하여 정제하였다. 그 결과 노란 고체인 화합물 1-9 (250 mg, 수득률 91%)를 얻었다. 이 때 얻어진 화합물 1-9에 대한 NMR 데이터는 다음과 같다; (MeOD) 7.72 (1H, d, J = 8.8 Hz), 6.85 (1H, s), 6.80 (1H, d, J = 8.0 Hz), 6.57 (1H, dd, J = 2.0, 8.0 Hz), 6.35 (1H, dd, J = 2.4, 8.8 Hz), 6.26 (1H, d, J = 2.4 Hz), 3.17 (2H, t, J = 8.0 Hz), 2.86 (2H, J = 8.0 Hz); Ms(ESI) m/z = 275.1 (M+H)+.
(a) Reaction conditions and materials: Compound 1-1 (272 mg, 1 mmol) was dissolved in anhydrous methanol (5 ml) and Pd / C (14 mg, 5% g / g) The mixture was reacted at room temperature for 5 hours to confirm that Compound 1-1 had been consumed. After filtration using cellite, the filtrate was concentrated and purified by column chromatography (ethyl acetate: hexane = 1: 6). As a result, a yellow solid Compound 1-9 (250 mg, yield 91%) was obtained. NMR data for Compound 1-9 thus obtained are as follows; (1H, d, J = 8.0 Hz), 6.85 (1H, d, J = 8.0 Hz) (1H, d, J = 2.4, 8.8 Hz), 6.26 (1H, d, J = 2.4 Hz), 3.17 (2H, t, J = 8.0 Hz), 2.86 (2H, J = 8.0 Hz). Ms (ESI) m / z = 275.1 (M + H) < + >.
실시예 9. 뷰테인(Butein) 유도체의 항비만 효과 확인Example 9. Confirmation of Anti-obesity Effect of Butein Derivatives
뷰테인 유도체의 항비만 효과를 확인하기 위하여, Butein 유도체 (화학식 1-1 내지 1-8, 1-10 내지 1-14) 처리에 의한 UCP-1, 및 PRDM4 발현량 변화를 측정하였다. 분화된 C3H10T1/2 지방세포에 뷰테인 및 유도체 화합물을 24시간 동안 투여한 후 real time PCR을 이용해 UCP-1과 PRDM4의 발현량을 조사하였다.In order to confirm the anti-obesity effect of the butane derivatives, changes in the amounts of UCP-1 and PRDM4 expression by treatment with butein derivatives (Formulas 1-1 to 1-8, 1-10 to 1-14) were measured. The expression levels of UCP-1 and PRDM4 were measured by real time PCR after differentiation of C3H10T1 / 2 adipocytes with butane and derivative compounds for 24 hours.
그 결과, 도 25에 나타낸 바와 같이, 뷰테인 뿐만 아니라 뷰테인 유도체 화합물에서도 유의적인 UCP-1, 및 PRDM4의 발현량 증가를 확인하였다. 특히, 뷰테인 유도체 화합물 1-11 (BD-10), 및 1-12 (BD-11)를 투여한 군의 경우에는, 뷰테인을 투여군 (BFI)보다 UCP-1, 및 PRDM4의 발현량이 현저하게 증가함을 확인하였다.
As a result, as shown in Fig. 25, the expression levels of UCP-1 and PRDM4 significantly increased in not only butene butane derivative compounds. In particular, in the case of the group to which the butane derivative 1-11 (BD-10) and 1-12 (BD-11) were administered, the amount of UCP-1 and PRDM4 expression was significantly higher than that of the group administered with butaine (BFI) .
본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the present invention as defined by the following claims. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.
<110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> Composition for inducing beige and brown fat cells and method of inducing the same <130> R-2013-0079-KR-2_MP15-009 <150> 2014/0078275 <151> 2014-06-25 <160> 2 <170> KoPatentIn <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_sense <400> 1 gaauuacgcu caacagauau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_antisense <400> 2 uaucuguuga gcguaauucu u 21 <110> Research and Business Foundation SUNGKYUNKWAN UNIVERSITY <120> Composition for inducing beige and brown fat cells and method of inducing the same <130> R-2013-0079-KR-2_MP15-009 <150> 2014/0078275 <151> 2014-06-25 <160> 2 <170> KoPatentin <210> 1 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_sense <400> 1 gaauuacgcu caacagauau u 21 <210> 2 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> PRDM4 siRNA_antisense <400> 2 uaucuguuga gcguaauucu u 21
Claims (10)
[화학식 1]
상기 화학식 1에서,
R1은 OH, 또는 C1-C6 알킬이고, R2는 OH, 할로젠, 또는 C1-C6 알콕시이고, R3는 OH, 또는 C1-C6 알콕시이고, R4는 수소 또는 C1-C6 알킬이다.
A pharmaceutical composition for preventing or treating obesity, which comprises a compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient.
[Chemical Formula 1]
In Formula 1,
R 1 is OH, or C 1 -C 6 alkyl, R 2 is OH, halogen, or C 1 -C 6 alkoxy, R 3 is OH, or C 1 -C 6 alkoxy, and R 4 is hydrogen or C 1 -C 6 alkyl.
상기 화학식 1로 표시되는 화합물은 2-(3,4-다이하이드록시페닐)-7-하이드로록시크로멘-4-온; 7-하이드록시-2-(4-하이드록시-3-메톡시페닐)크로멘-4-온; 7-하이드록시-2-(3-하이드록시-4-메톡시페닐)크로멘-4-온; 2-(3,4-다이하이드록시페닐)-7-하이드록시-3-메틸크로멘-4-온; 및 2-(4-플루오로-3-메톡시페닐)-7-하이드록시크로멘-4-온으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 조성물.
The method according to claim 1,
The compound represented by Formula 1 is 2- (3,4-dihydroxyphenyl) -7-hydrooxychromen-4-one; 7-hydroxy-2- (4-hydroxy-3-methoxyphenyl) chromen-4-one; 7-hydroxy-2- (3-hydroxy-4-methoxyphenyl) chromen-4-one; 2- (3,4-dihydroxyphenyl) -7-hydroxy-3-methylchromen-4-one; And 2- (4-fluoro-3-methoxyphenyl) -7-hydroxychromen-4-one.
상기 조성물은 갈색 지방세포의 활성을 증가시키는 것을 특징으로 하는, 조성물.
The method according to claim 1,
Wherein said composition increases the activity of brown adipocytes.
상기 조성물은 UCP-1(uncoupling protein-1)의 발현을 증가시키는 것을 특징으로 하는, 조성물.
The method according to claim 1,
Wherein the composition increases the expression of UCP-1 (uncoupling protein-1).
상기 조성물은 PRDM4 (PR domain-containing protein 4)의 유전자의 발현을 증가시키는 것을 특징으로 하는, 조성물.
The method according to claim 1,
Wherein the composition increases the expression of PRDM4 (PR domain-containing protein 4) gene.
A method for inducing differentiation from a white adipocyte into a beige adipocyte, comprising the step of treating the white adipocytes with the composition of claim 1 or 4 in vitro .
상기 유도방법은 갈색 지방세포의 활성을 증가시키는 것을 특징으로 하는, 유도방법.
9. The method of claim 8,
Wherein said induction method increases the activity of brown adipocytes.
a) in vitro 상에서 지방세포에 비만 치료 후보 물질을 처리하는 단계;
b) 상기 지방 세포의 PRDM4 (PR domain-containing protein 4)의 유전자의 발현을 측정하는 단계; 및
c) 비처리군에 비해 PRDM4의 유전자의 발현을 증진시키는 물질을 비만 치료물질로 선정하는 단계.A method for screening obesity treating substances comprising the steps of:
a) treating obesity treating candidate substances in fat cells in vitro;
b) measuring the expression of PRDM4 (PR domain-containing protein 4) gene of said adipocyte; And
c) selecting a substance that promotes the expression of PRDM4 gene as a therapeutic substance for obesity compared to the non-treatment group.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14/745,772 US9549908B2 (en) | 2014-06-25 | 2015-06-22 | Composition for inducing differentiation into beige and brown adipocytes and method of inducing the same |
US15/374,187 US9877946B2 (en) | 2014-06-25 | 2016-12-09 | Method for treating, managing, inhibiting, or preventing obesity |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020140078275 | 2014-06-25 | ||
KR20140078275 | 2014-06-25 |
Related Child Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020160095361A Division KR101671675B1 (en) | 2014-06-25 | 2016-07-27 | Composition for inducing beige and brown fat cells and method of inducing the same |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20160000840A KR20160000840A (en) | 2016-01-05 |
KR101699160B1 true KR101699160B1 (en) | 2017-01-23 |
Family
ID=55164754
Family Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020150071581A KR101699160B1 (en) | 2014-06-25 | 2015-05-22 | Composition for inducing beige and brown fat cells and method of inducing the same |
KR1020160095361A KR101671675B1 (en) | 2014-06-25 | 2016-07-27 | Composition for inducing beige and brown fat cells and method of inducing the same |
Family Applications After (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020160095361A KR101671675B1 (en) | 2014-06-25 | 2016-07-27 | Composition for inducing beige and brown fat cells and method of inducing the same |
Country Status (1)
Country | Link |
---|---|
KR (2) | KR101699160B1 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR102088554B1 (en) * | 2016-06-13 | 2020-03-12 | 성균관대학교산학협력단 | Composition comprising extract or fraction of butea monosperma |
KR102414532B1 (en) * | 2020-03-11 | 2022-06-30 | 가톨릭관동대학교산학협력단 | Composition for inducing brown fat cells comprising Isoliquiritigenin Derivatives for Preventing or Treating of heart Related Diseases |
EP3900720A1 (en) * | 2020-04-22 | 2021-10-27 | Sunnutrapharma S.r.l. | Composition based on genistein for the treatment of obesity |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2013149258A2 (en) * | 2012-03-30 | 2013-10-03 | Charles Drew University of Medicine and Science | Compositions and methods for treating or preventing metabolic syndrome disorders |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101075742B1 (en) * | 2009-04-16 | 2011-10-21 | 이화여자대학교 산학협력단 | Composition comprising the compounds isolated from the extract of Anemarrhena asphodeloides Bunge for preventing and treating lipid metabolism disorder |
EP3345921A1 (en) * | 2009-06-08 | 2018-07-11 | Acceleron Pharma Inc. | Use of anti-actriib antibodies for increasing thermogenic adipocytes |
-
2015
- 2015-05-22 KR KR1020150071581A patent/KR101699160B1/en active IP Right Grant
-
2016
- 2016-07-27 KR KR1020160095361A patent/KR101671675B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2013149258A2 (en) * | 2012-03-30 | 2013-10-03 | Charles Drew University of Medicine and Science | Compositions and methods for treating or preventing metabolic syndrome disorders |
Non-Patent Citations (2)
Title |
---|
논문(EUROPEAN JOURNAL OF PHARMACOLOGY, VOLUME 738, 2014.09.05) |
논문(THE JOURNAL OF LIPID RESEARCH, 54, 2013.05) |
Also Published As
Publication number | Publication date |
---|---|
KR101671675B1 (en) | 2016-11-16 |
KR20160000840A (en) | 2016-01-05 |
KR20160097165A (en) | 2016-08-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104000806B (en) | Telomerase activating compounds and its application method | |
KR20200022480A (en) | Compositions and Methods for Controlling Hair Growth | |
JP2011526250A (en) | Diglycid ether derivative therapeutic agent and method of use thereof | |
JP2021534248A (en) | 3-aryloxyl-3-5-membered heteroaryl-propylamine compound and its use | |
JP2021534249A (en) | 3-aryloxy-3-aryl-propylamine compounds and their uses | |
JP2022516136A (en) | Compositions and Methods for Regulating Hair Growth | |
KR101699160B1 (en) | Composition for inducing beige and brown fat cells and method of inducing the same | |
CN104053439A (en) | Meglumine salt formulations of 1-(5,6-dichloro-1h-benzo[D]imidazol-2-yl)-1H-pyrazole-4-carboxylic acid | |
JP2018526417A (en) | Compound for the treatment or prevention of hyperuricemia or gout | |
JP2014101359A (en) | Cancer cell inhibitory drug and cancer stem-cell detection probe | |
US9877946B2 (en) | Method for treating, managing, inhibiting, or preventing obesity | |
CN105209037A (en) | Lipidic furan, pyrrole, and thiophene compounds for treatment of cancer, neurological disorders, and fibrotic disorders | |
KR100624238B1 (en) | Pharmaceutical composition for prevention and treating of metabolic bone diseases containing alpha-arylmethoxyacrylate derivatives | |
US20200331828A1 (en) | Novel compounds which activate estrogen receptors and compositions and methods of using the same | |
JP2022532746A (en) | 3-aryloxyl-3-5-membered heteroaryl-propylamine compound and its crystal form and use | |
JP4819692B2 (en) | Benzofurans and benzothiophenes | |
JP6798706B2 (en) | Treatment for amyotrophic lateral disease | |
KR101457637B1 (en) | A dihydropyrazolecarbothioamide derivative, Method of preparing the same, and anti-cancer agent comprising the same | |
KR100903974B1 (en) | Novel 2,4,5-trisubtituted-1,3-thiazole derivatives and pharmaceutically acceptable salt thereof, method for preparation, therapeutic agent for antiinflammatory disease induced by spc activity containing 2,4,5-trisubstituted-1,3-thiazole derivatives as an effective ingredient | |
KR102580387B1 (en) | Pharmaceutical compositions comprising novel pyrazolo[3,4-b]pyridine derivatives for preventing or treating metabolic diseases including obesity and diabetes mellitus, or nonalcholic steatohepatitis | |
EP2682392A2 (en) | Pyrazole derivatives, preparation method thereof, and composition for preventing and treating osteoporosis containing same | |
KR101857141B1 (en) | New compounds, the preparation thereof and pharmaceutical composition comprising the same for alleviation, prevention or treatment of osteoporosis | |
US8404863B2 (en) | Tetrahydroindoles having sphingosine-1-phosphate receptor activity | |
KR20060134303A (en) | Alpha-arylmethoxyacrylate derivatives having amino substituent and pharmaceutical composition for prevention and treating of metabolic bone diseases containing the same | |
CN112930176A (en) | Cyclohexanecarboxamide derivatives for promoting thermogenesis in adipose tissue |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
N231 | Notification of change of applicant | ||
E902 | Notification of reason for refusal | ||
A107 | Divisional application of patent | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant | ||
FPAY | Annual fee payment |
Payment date: 20200203 Year of fee payment: 4 |