KR101681669B1 - Method for Expressing High-Level of Target Protein by Gene Silencing - Google Patents

Abstract

The present invention relates to an expression vector comprising a polynucleotide encoding an shRNA capable of RNAi (RNA interference) expression of a glucoamylase, a recombinant microorganism into which the gene encoding the expression vector and the target protein are introduced, And a method for producing the protein.

Description

[0001] The present invention relates to a method for over expressing a target protein by gene silencing,

The present invention relates to an expression vector comprising a polynucleotide encoding an shRNA capable of RNAi (RNA interference) expression of a glucoamylase, a recombinant microorganism into which the gene encoding the expression vector and the target protein are introduced, and a recombinant microorganism using the recombinant microorganism And a method for producing a target protein.

Fungi are available for producing commercially useful proteins and organic acids. Saturated fungi, including Aspergillus niger , are widely used in the production of enzymes, food additives and antibiotics. In the case of cellulase or glucoamylase, it is possible to produce high yield of more than 30 g / L through industrial process development.

Since the fungal expression system has a eukaryotic expression system, transcription, processing and modification processes (for example, modification, glycosylation, disulfide bridge formation, etc.) are carried out, so that foreign proteins derived from eukaryotic cells including humans can be efficiently produced have. In particular, the mold expression system is known as a system capable of effectively preventing problems such as hyperglycosylation.

In addition, since it has an efficient secretion system, it can overcome the problems such as inactivation due to formation of an inclusion body by the expression in an Escherichia coli system. In addition, purification and concentration of proteins are simpler in process and lower in cost than other microorganisms. Many strains, such as deadly fungi, are recognized in the United States as GRAS (generally recognized as safe) and have advantages in the production and application of pharmaceutical products over other strains.

Wild-type strains such as Aspergillus niger 8795P or Aspergillus niger N402 have high protease activity and thus have various difficulties in the production of foreign proteins. In order to be used as a host, screening for strains with low protease activity and high expression of glucoamylase is required. In the strain with high expression of glucoamylase, the glucoamylase gene is over 10 copies of the wild type and the mRNA level is also highly expressed. Such a strain has good strain characteristics capable of expressing purely exogenous protein when the glucoamylase gene is removed.

Genetic inactivation in fungi is achieved by gene replacement. However, genetic inactivity is largely dependent on the transformation rate, and the degree of gene inactivation differs for each individual. The defect rate is as low as 0-40%. In particular, there are many cases where the number of glucoamylase genes is 10 or more and the method by gene substitution can not be used.

Accordingly, the inventors of the present application provide inventions related to a method capable of enhancing expression of a target protein, for example, catalase or peroxidase, using a gene inactivation mechanism by RNAi.

RNAi plays a unique role in gene regulation and can be used to silence target genes. RNAi induces the destruction of target gene mRNA after transcription by dsRNA by introducing double-stranded RNA consisting of sense RNA, homologous sequence, and antisense RNA, which is a homologous sequence thereof, into the fungus, Or more.

The dsRNA is then shortened to 21-25 nucleotides by the Dicer protein, RNase III. When a siRNA single strand complementary to mRNA binds, the mRNA is degraded by the nucleases. Fungi were first identified by Romano and Macino in Neurospora, and RNA silencing by RNA-dependent RNA polymerase also occurs in Aspergillus nidulans and Aspergillus oryzae. It has been reported that shRNA vectors are produced in Aspergillus oryzae to induce silencing of the amylase gene and brlA gene and to suppress expression over 90%.

Catalase and peroxidase are enzymes that decompose hydrogen peroxide into water and oxygen. They are used in bleaching processes of fibers, washing of contact lenses, and post-treatment of semiconductor wastewater. In fiber treatment process, it is used to prevent uneven dyeing before dyeing process. When catalase is used, it is one of the important enzymes in fiber processing because it has excellent energy saving effect in terms of energy and time as compared with the chemical method of using surfactant.

Under these circumstances, the inventors of the present application prepared a recombinant microorganism into which an expression vector containing a polynucleotide encoding a shRNA capable of RNAi-inducing glucoamylase and a gene of a desired protein was introduced. As a result of culturing the recombinant microorganism, The expression of the protein can be increased, and the present invention has been completed.

It is an object of the present invention to provide a method for increasing the expression of a target protein by glucoamylase gene silencing.

The present invention relates to an expression vector comprising a promoter and a polynucleotide operably linked to the promoter, wherein the polynucleotide encodes an shRNA capable of RNAi expression of a glucoamylase.

The present invention also relates to a recombinant microorganism into which said expression vector has been introduced.

The present invention further comprises a step of culturing the recombinant microorganism into which the gene encoding the expression vector and the target protein is introduced to express the target protein; And recovering the expressed target protein.

Through the present invention, the expression of the target protein can be increased under the condition that glucoamylase is inhibited through the RNAi mechanism without removing the gene in Aspergillus oryzae by substitution, so that it is possible to produce industrially useful protein in a large amount have. In addition, the target protein can be produced under the condition that only the glucoamylase gene is silenced, without removing specific genes that may affect the expression of the target protein.

1 is a schematic diagram of a structural gene of glucoamylase (glaA) 2206bp containing an intron.
2 is a schematic diagram of an shRNA vector forming a glucoamylase hairpin loop.
FIG. 3A shows real-time PCR results of GF101 strain and glucoamylase gene silencing transformants.
FIG. 3B shows the result of SDS-page analysis of the silencing of glucoamylase gene. M: marker; 1: strain GF101; 2: pRIT44 transformant 12; 3: pRIT44 transformant 17; 4: pRIT44 transformant 2; 5: pRIT44 transformant 13
Figure 4a is a schematic diagram of the Aspergillus oryzae transforming antibiotic pleomacin pAN7-Fleo vector.
FIG. 4B is a pDCAT schematic diagram in which the terminator of the asparaginase pdcA gene is inserted into the glucoamylase gene silencing vector.
4C is a pGLAP schematic diagram in which a glucoamylase promoter that induces the silencing of the glucoamylase gene is inserted.
5A is a pIRT41 shRNA expression vector that induces the silencing of the glucoamylase gene.
5B is a schematic diagram of shRNA expression vector pIRT42 to induce silencing of glucoamylase gene.
5C is a shRNA expression vector pIRT43 schematic diagram for inducing the silencing of glucoamylase gene.
5D is a shRNA expression vector pIRT44 model diagram for inducing the silencing of glucoamylase gene.
5E is a shRNA expression vector pIRT45 schematic diagram for inducing silencing of the glucoamylase gene.
6A is a schematic diagram of a hyromycin pAN7-Hyg vector for catalase transformation selection.
6B is a schematic diagram of a pDCAT-Hyg vector with a catalase termination factor inserted.
6C is a schematic diagram of a pGLASSP vector into which a glucoamylase promoter and a glucoamylase signal sequence are inserted to induce catalase expression.
7A is a schematic diagram of a catalase expression vector pGLASSP-ScyA expressed by a glucoamylase promoter and a glucoamylase signal sequence.
Figure 7b shows the results of SDS-page analysis of catalase transformants. Arrows represent the expressed catalase.
8A is a schematic diagram of a peroxidase vector pGLASSP-Cip1 expressed by a glucoamylase promoter and glucoamylase signal sequence.
8B shows the result of SDS-page analysis of peroxidase transformants. The arrows represent the expressed peroxidase.
FIG. 9 is a diagram showing a nucleotide sequence capable of forming glucoamylase dsRNA. Italics refers to introns. The underline indicates the position of the primer capable of PCR of the glucoamylase sense strand and the antisense strand.

In one aspect, the present invention relates to an expression vector comprising a promoter and a polynucleotide operably linked to the promoter, wherein the polynucleotide encodes an shRNA capable of RNAi expression of a glucoamylase.

"Promoter" as used herein refers to a DNA sequence that regulates the expression of a particular recombinant microorganism or a polynucleotide sequence operably linked in a host cell. As the promoter, a constitutive promoter that induces the expression of the target gene at all times at any time, or an inducible promoter that induces the expression of the target gene at a specific position and time can be used.

In one embodiment, the promoters of the invention may be recombinant microorganisms or natural, homologous, exogenous or heterologous hosts, and include promoters such as aspartases or neutral amylase promoters, acid amylase promoters, a-glucosidase promoter, and the like, but is not limited thereto. Preferably, the promoter may be an aspergillus or an exogenous glucoamylase gene of SEQ ID NO: 2 capable of transcribing the polynucleotide.

"Operably linked" refers to a parallel of two or more components, wherein the components are in a relationship to effect in an intended manner. For example, a promoter is operably linked to a coding sequence if it functions to control or regulate the transcription of the linked sequence. The operably linked DNA sequences are contiguous, wherein two or more nucleotides coding for a secretory leader / signal sequence and a polynucleotide that is contiguous and within the leader frame can be joined. The polyadenylation site is operably linked to the coding sequence if it is located at the downstream end of the coding sequence so that the transcription proceeds through the coding sequence into the polyadenylation sequence. The linkage can be carried out by a recombinant method known in the field of the present invention, for example, a PCR method and the like.

As used herein, the term "vector" means a DNA fragment (s), a nucleic acid molecule, which is transferred into a cell, and can be mixed with a plasmid. 1B, a pIRT 43 having a cleavage map of Fig. 1C, a pIRT 44 having a cleavage map of Fig. 1D, and a pIRT 44 having a cleavage map of Fig. And pIRT 45 having a cleavage map.

As used herein, "polynucleotide" may comprise nucleic acid molecules, e. G. DNA, RNA or variants thereof. The polynucleotide may be a naturally occurring polynucleotide molecule, a synthetic polynucleotide molecule, or a combination of one or more naturally occurring polynucleotide molecules and one or more synthetic polynucleotide molecules. In addition, naturally occurring polynucleotide molecules in which one or more nucleotides are altered, deleted, or added, for example, by mutation are encompassed by the above definition. The polynucleotide can be characterized by the sequence of the individual nucleotides and the process and method of converting the amino acid sequence of the polypeptide into the corresponding nucleotide sequence encoding it are well known to those skilled in the art.

As used herein, shRNA refers to a single-stranded RNA that has a stem-loop structure in vivo and a complementary long base pair of RNAs on both sides of the loop region, including sense and antisense To form a double-stranded stem. ShRNAs are generally transcribed and synthesized by in vivo linked promoters, and shRNAs are then loop-cleaved by Dicer and interact with RISCs similar to siRNAs. Hereinafter, it is also referred to as dsRNA according to the structure formed in vivo.

The polynucleotide of the present invention encodes an shRNA capable of RNAi expression of a glucoamylase, wherein the glucoamylase is, for example, a glucoamylase having the sequence represented by SEQ ID NO: 1 which is Aspergillus oryzae-derived glucoamylase Lt; / RTI >

The polynucleotide encoding the shRNA of the present invention is, for example, a portion excluding the 5'-URT region, the signal sequence and the precursor sequence in the transcription portion of glucoamylase. The sense sequence and the antisense sequence start point are the same, Sense sequence. In one embodiment, the sense and antisense sequence homology sites may be between 50% and 75% and the size of the sense sequence may be between 400 bp and 1,000 bp or less. The loop sequence may be an sequence other than the antisense and homologous portions of the sense sequence, and the size of the loop may be larger than the antisense, for example, 155 bp or more and 300 bp or less.

The dsRNA may be coded from one or more sequences selected from the group consisting of the sequences represented by SEQ ID NOS: 3, 4, 6, 8, 10-13. Specifically, as shown in Table 2 of Example 4, the dsRNA comprises a sense sequence of SEQ ID NO: 3, an antisense sequence of SEQ ID NO: 4 and a loop of SEQ ID NO: 5 (pIRT 41) (PIRT 42), sense of SEQ ID NO: 6, antisense of SEQ ID NO: 8 and loop (pIRT 43) of SEQ ID NO: 9, sense of SEQ ID NO: 10, antisense of SEQ ID NO: 11 and antisense of SEQ ID NO: The loop of SEQ ID NO: 12 (pIRT44), the sense of SEQ ID NO: 11, the antisense of SEQ ID NO: 13, and the loop of SEQ ID NO: 14 (pIRT45).

According to the embodiment of the present invention, it was confirmed that the dsRNA can inhibit the expression of the glucoamylase gene silencing or glucoamylase. The silencing of the glucoamylase gene by the dsRNA according to the present invention can be about 30% or more, for example, compared with the control group, and the optimal gene silencing can be more than 90%. In this regard, according to Example 7 of the present invention, it was confirmed that it was decreased by 90% more than that of the control group, and decreased by 34% by less. In particular, the IRT44 transformants, which are the expression vector pIRT44 transformants containing the sense of SEQ ID NO: 10, the antisense of SEQ ID NO: 11 and the loop of SEQ ID NO: 12, all expressed about 10% of the glucoamylase expression ratio compared to the control group. Expression was also reduced by 80 to 90% (Table 4).

As used herein, "expression" refers to transcription and / or translation processes occurring within a cell. The transcription level of the recombinant microorganism or the desired product in the host cell can be determined based on the amount of the corresponding mRNA present in the cell. For example, the mRNA transcribed from the corresponding sequence can be quantified by PCR or the like. Polypeptides encoded by the polynucleotides can be assayed by a variety of methods, e. G., ELISA, analysis of the biological activity of the polypeptide, or assays that are independent of the activity, such as radioimmunoassay using immunoglobulins, And quantified using Western blotting.

In addition, the vector of the present invention includes a selection marker for cloning and selection of a cloning origin (e. G., The ColE1 or oriP origin of replication), a suitable terminator and is useful for dsRNA transcription in eukaryotic cells A polyadenylation sequence may be linked.

The selectable marker may be, for example, a ble gene, which can be used for screening strains transformed with genes having selectable characteristics in antibiotic pleomacin and non-transformed strains.

In addition, the terminator or polyadenylation sequence may be, for example, a transcription termination factor of the pdcA gene or a transcription termination factor of a glucoamylase. The transcription termination factor of the pdcA gene may have a sequence of SEQ ID NO: 15 derived from Aspergillus oryzae, and the transcription termination factor of the glucoamylase may be A. niger , Derived sequence of SEQ ID NO: 16.

In another aspect, the present invention relates to a recombinant microorganism into which the expression vector is introduced.

As used herein, "recombinant microorganism" means, for example, a host cell into which a polynucleotide encoding a heterologous polypeptide or protein or constituting an shRNA can be introduced or transfected. The recombinant microorganism may be eukaryotic origin, which can efficiently produce an exogenous polypeptide or protein derived from a eukaryotic cell including a human, and may be preferably a mold. Since the fungus has a eukaryotic expression system, transcription, processing and transformation processes are performed, it is possible to efficiently produce an exogenous polypeptide or protein derived from a eukaryote.

In particular, the fungus used in the present invention may be a strain that overexpresses glucoamylase, and may be, for example, Aspergillus oryzae. The strain is produced through several mutagenesis and subculture, the spore color is brown, and the growth rate may be more than 30% higher than that of the wild type.

A polynucleotide encoding a desired protein may be further introduced into such a recombinant microorganism. By introducing the gene encoding the target protein into the recombinant microorganism, the target protein can be co-expressed in a state in which the expression of the glucoamylase is inhibited.

As used herein, "introduction" may be performed by a process related to the transformation of the protoplast, followed by protoplast production and cell wall reproduction. DNA inserted into the protoplast can be inserted into the chromosome of the recombinant microorganism. As a method for inserting the gene on the chromosome of the host cell, a commonly known gene manipulation method can be used. For example, an electroporation method, lipofection, microinjection, ballistic method, virosome, liposome, immunoliposome, polyvalent cation Or lipid: nucleic acid conjugates, naked DNA, artificial virens, and chemical promoted DNA infusion. Other representative nucleic acid delivery systems can be found in Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Maryland), and sonophoresis, for example using the Sonitron 2000 system (Rich- And BTX Molecular Syntem (Holliston, MA). Ripofection methods are described in U.S. Pat. No. 5,049,386, U.S. Pat. No. 4,946,787 and U.S. Pat. No. 4,897,355, and lipofection reagents are commercially available, for example, Transfectam ^™ and Lipofectin ^™ . Cation or neutral lipids suitable for effective receptor-recognition lipofection of polynucleotides include Felgner's lipid (WO 91/17424 and WO 91/16024) and can be delivered to the cell via in vitro introduction, into the target tissue via in vivo introduction have. Methods of making lipid: nucleic acid complexes comprising target liposomes, such as immunological lipid complexes, are well known in the art (Crystal, Science, 270: 404-410, 1995; Blaese et al., Cancer Gene Ther., 2: 291 Gene et al., Gene Therapy., 2: 710-9, 1995; Behr et al., Bioconjugate Chem., 5: 382389,1994; Remy et al., Bioconjugate Chem., 5: 722, 1995; Ahmad et al, Cancer Res, 52:.. 4817-4820, 1992; U.S. Patent No. 4,186,183; U.S. Patent No. 4,217,344; U.S. Patent No. 4,235,871; U.S. Patent No. 4,261,975; U.S. Patent No. 4,485,054 U.S. Patent No. 4,501,728; U.S. Patent No. 4,774,085; U.S. Patent No. 4,837,028; U.S. Patent No. 4,946,787). The inserted DNA sequence is stably maintained in the cell. DNA is usually inserted into homologous, non-homologous regions in the chromosome, and usually 20 copies or more are inserted in one copy.

In another aspect of the present invention, there is provided a method for producing a recombinant microorganism, comprising: culturing a polynucleotide encoding an shRNA capable of RNAi expression of the glucoamylase and a recombinant microorganism into which a gene encoding a target protein is introduced to express a target protein; And recovering the expressed target protein.

The target protein may be a protein heterologous to the recombinant microorganism, for example, catalase or peroxidase. The inventors of the present application confirmed that the expression of catalase or peroxidase, which is a target protein, is increased in a state where the expression of glucoamylase represented by SEQ ID NO: 1 is inhibited. It was confirmed that the expression rate of catalase was increased about 5-fold in the strain in which the glucoamylase gene silencing was caused by shRNA in the strain having a large amount of glucoamylase expression (Example 11), and the expression rate of peroxidase was increased about 7.8-fold 14).

The expression vector containing the gene encoding the target protein may be, for example, a pGLAPSS vector having a cleavage map of FIG. 6C. The expression vector may also contain a suitable terminator and may be linked to a polyadenylation sequence such that it is useful in the transcription of the desired protein in eukaryotic cells.

The termination or polyadenylation sequence may be, for example, a transcription termination factor of the pdcA gene or a glucoamylase transcription termination factor. The transcription termination factor of the pdcA gene may have a sequence of SEQ ID NO: 15 derived from Aspergillus oryzae, and the transcription termination factor of the glucoamylase may be A. niger , Derived sequence of SEQ ID NO: 16.

The expression vector may also comprise one or more selectable markers. The selectable marker may be, for example, a hyg gene and may be used for screening strains transformed with a gene having selectable characteristics from an antibiotic hygromycin and non-transformed strains.

Thereafter, an expression vector containing a polynucleotide encoding an shRNA capable of RNAi expression of a glucoamylase is cultured and a recombinant microorganism into which a polynucleotide encoding a target protein is further introduced is cultured, and then the expressed target protein is recovered.

In the culturing step, the recombinant microorganism may be cultured in a predetermined medium for inducing the action of the inserted promoter. For example, the medium may contain glucose or starch as a carbon source. The amount of carbon source included can be, for example, about 1-6% (w / v) or less.

In the recovering step, the target protein produced from the recombinant microorganism can be separated or substantially purified. For example, it may be separated or purified by a known method such as centrifugation, dialysis, chromatography, etc., and may not contain other cellular material or culture medium substantially by separation or purification.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

[Materials and Methods]

1. MM Salt solution

The production of 500 ml is as follows. Sodium nitro calibrated with (NaNO ₃₎ 76g, potassium phosphate mono bejik (KH ₂ PO ₄₎ 38g, potassium phosphate die bejik (K ₂ HPO ₄₎ 38g, potassium chloride (KCl) 26g, magnesium sulfate (MgSO ₄₎ 26g, jinkeu sulfate _{(ZnSO 4 7H 2 O) 1.10g} , boric acid (H ₂ BO ₃₎ 0.55g, broken varnish that chloride _{(MnCl 2 · 4H 2 O)} 0.25g, ferric sulfate _{(FeSO 4 · 7H 2 O)} 0.25g, cobalt 0.08 g of Chloride (CoCl ₂ .6H ₂ O), 0.05 g of Copper sulfate, 0.055 g of Ammonium molybdate, and 0.38 g of EDTA (EDTA).

2. Extraction of gDNA from mold

Aspergillus oryzae (purchased from A. oryzae KACC 44997, Information Center for Agricultural Genetic Resources), Aspergillus DNA extraction from A. niger N402, FGSC, Fungal Genetic Stock Center was performed by LEE and Taylar. 20-60 mg of the dried mycelial flour was placed in an EP tube and mixed well by adding 400 μL lysis buffer (50 mM EDTA, 50 mM Tris-HCl, pH 8.0, 3% SDS, 1% 2-Mercaptoethanol). The EP tube was allowed to react at 65 DEG C for 1 hour, and then gDNA was separated by adding 2x phenol / chloroform. The separated gDNA was precipitated with ethanol and extracted.

3. Extraction of RNA from fungi

After the water was removed, the mycelium was rapidly frozen in liquid nitrogen and freeze-dried. The dried mycelia were ground into flour and then 1 ml of triazole was added. After 5 minutes incubation at RT, 0.2 ml of chloroform was added and centrifuged to remove supernatant. The supernatant was precipitated with two times of ethanol to extract RNA.

Example 1: Mutagenesis

The N402 strain was cultured for 4 days in a Petri dish and 0.08% Tween 80 was used to harvest unspiked spores and then diluted to 10 ³ cells / ml. 1 ml of the diluted solution was inoculated on a minimal solid medium supplemented with starch, and incubated on a turntable rotating at 60 rpm on a petri dish with the dish cover removed. The mutagenization was induced in uv 300J for 10-30 minutes while rotating. And cultured for 5 days. Mutants were selected from the cultured mutant colonies inoculated on the same medium to form rings. A strain with low protease activity and high expression of glucoamylase was firstly screened. Generation of genetically stable strains by 10-pass subculture and single spore isolation. This was named GF101. The GF101 strain has a low activity of acid protease and a high expression level of glucoamylase activity of 1,000 to 1,300 U / ml.

Example 2. Confirmation of glucoamylase expression level in flask and fermentation tank

6% CSL, 0.05% antifoaming agent and 0.01% α-amylase were added to the mixture, and the mixture was heated to 70~80 ° C. and liquefied for 30 minutes. . 50 ml of the liquefied liquid was dispensed into a 250 ml flask, and sterilized at 121 캜 for 15 minutes. The mutant strains were harvested from the culture dishes cultured for 5 days with 0.1% Tween 80, and then harvested at 1 × 10 ⁶ cells / ml and 1 ml of the diluted solution was inoculated. And cultured in a shaking incubator at 28 DEG C, 200 rpm for 4 days. After cultivation, the sperm was removed and the glucoamylase activity was confirmed. As a carbon source, the cells were cultured in the presence of glucose and citrate, resulting in expression of 1,000 U / ml or more (Table 1). The total amount of amylase activity of GF101 strain was 4,000 ~ 4,500 U / ml in the 5L fermenter using 14% morphine, 6% soybean powder, 6% CSL and 0.05% defoamer composition. Of these, glucoamylase expresses all of the G1, G2, and G3 types, and the G1 type of about 120 kDa is the most highly expressed. The activity of acid protease was about 2 times lower than that of N402 and SP56 strains.

[Table 1] Amount of expression of glucoamylase in GF101 strain

Example 3. Expression of the glucoamylase promoter gene and pdcA  Cloning the terminator

Amplification of the terminator region of the pdcA gene derived from Aspergillus oryzae KACC 44997 and cloning of the PCR product was performed as follows. PCR was performed with a pdcA primer containing HindIII, BamHI, SpeI, NotI at the 5'-end and XbaI at the 5'-end, and the PCR product was ligated to the pAN7-Ble vector (Fig. 4A) Hind III / Xba I and named pDCAT-ble (Fig. 4b).

Primers used for pDCAT vector construction:

pdcAHBSNF (SEQ ID NO: 17)

ATAT AAGCTTGGATCCACTAGTGCGGCCGC AAGCTTGGCACTGGCCGTCGTTTTACAACGTC

pdcAX R (SEQ ID NO: 18)

ATAT TCTAGA GTTCACCCTCCCACCCGAGAGAG

Amplification of the promoter region shown in SEQ ID NO: 2 and cloning of the PCR product of the glucoamylase gene derived from Aspergillus or GF101 was performed as follows. Glucoamylase PF containing HindIII at the 5'-end and 5'- PCR was performed with a glucoamylase PR primer containing BamH1. The PCR product was cloned into HindIII / BamH of pDCAT vector and named pGLAP. The plasmid is shown in Figure 4c.

Primers used for pGLAP vector construction

GlaAPHF (SEQ ID NO: 19)

ATAT AAGCTT GACTCCAACCGGGGGGAGTAC

GlaAPR (SEQ ID NO: 20)

ATAT GGATCC TGCTGAGGTGTAATGATGCTG

Example 4. Construction of dsRNA expression vector

Amplification of the ORF region of the intron-containing glucoamylase gene (Fig. 2) derived from Aspergillus niger GF101 and cloning of the PCR product was performed as follows. PCR was performed with a glucoamylase ORFF containing the HindIII at the 5'-terminus and a glucoamylase ORFR primer containing the XbaI at the 5'-terminus. The PCR product was ligated to the HindIII / XbaI of the pAN7-Ble vector with the glucoamylase gene Was cloned and named pGLAORF.

In order to construct an expression vector for generating dsRNA, the DNA fragment (SEQ ID NO: 3) was amplified with si BAF1 and si SPR3 primers, followed by cloning into 1000 bp DNA downstream from the promoter amylase promoter BamH1 / Spe I, SEQ ID NO: 4) amplified 699 bp DNA using si NOF1 and si SP R2 primers, and constructed Spe I / Not I and named pIRT 41 (Fig. 5A). The dsRNA expressed in these vectors forms a loop (SEQ ID NO: 5) structure. The shRNA expression vector was named pIRT 41, pIRT 42, pIRT 43, pIRT 44, pIRT 45 (Figures 5b, 5c, 5d, 5e) according to the position and size of glucoamylase.

The primer sequences and sense, antisense and loop strand DNA sizes used in shRNA vectors are shown in FIG. 9 and Table 2. The cloning method was constructed using the same restriction enzymes as the pIRT 41 vector construction method after PCR using the respective primers. Italics refers to introns. The underline indicates the position of the primer capable of PCR of the glucoamylase sense strand and the antisense strand.

[Table 2] Sense, antisense and loop used in shRNA vector

pIRT 41 vector

Sense 1000 bp, Antisense 699 bp, Loop 301 bp

Sense primer (si BAF1 / si SPR3), Antisense primer (si NOF1 / si SPR2)

pIRT 42 vector

Sense 699 bp, Antisense 502 bp, Loop 199 bp

Sense primer (si BAF1 / si SPR2), Antisense primer (si NOF1 / si SPR1)

pIRT 43 vector

Sense 502 bp, Antisense 347 bp, Loop 155 bp

Sense primer (si BAF1 / si SPR1), Antisense primer (si NOF1 / si SPR0)

pIRT 44 vector

Sense 700 bp, Antisense 400 bp, Loop 300 bp

Sense primer (si BAF2 / si SPR4), Antisense primer (si NOF2 / si SPR3)

pIRT 45 vector

Sense 400 bp, Antisense 100 bp, Loop 300 bp

Sense primer (si BAF2 / si SPR3), Antisense primer (si NOF2 / si SPR2)

Primers used for pIRT vector construction

si BAF1: SEQ ID NO: 21

ATAT GGATCC GACCTTGGATTCATGGTTGAG

si BAF2: SEQ ID NO: 22

ATAT GGATCC TCGTTAGGAACGACCTGTCG

si NOF1: SEQ ID NO: 23

ATAT GCGGCCGC GACCTTGGATTCATGGTTGAG

si NOF2: SEQ ID NO: 24

ATAT GCGGCCGC TCGTTAGGAACGACCTGTCG

si SPR0: SEQ ID NO: 25

ATAT ACTAGT TGATACCCTGGACAATTGCC

si SPR1: SEQ ID NO: 26

ATAT ACTAGT AAGCAGCCACTGCCCGAAGC

si SPR2: SEQ ID NO: 27

ATAT ACTAGT GCTCTGCTGGCGCATCTTTGG

si SPR3: SEQ ID NO: 28

ATAT ACTAGT AGCAGGGCTGGAAGGTGGAG

si SPR4: SEQ ID NO: 29

ATAT ACTAGT TATAAGTCGAACTGGACGAAG

Example 5. Transformation of pIRT vectors

Transformation of the vector into host cells was carried out by modifying the method of Tilburn et al., (1983). The spores of Aspergillus niger GF101 strain were dispersed evenly in CYS (1% of corn starch, 0.15% of yeast extract, 21.86% of sorbitol) and cultured at 30 ° C for 5-6 days until spores were uniformly formed. 5 ml 0.08% Tween 80 was mixed well and the spores were inoculated into an appropriate amount of 0.01% (w / v) YPD medium and cultured at 30 ° C until hyphae were formed. The mycelium was filtered through a filter paper, washed with sterilized water and then washed with 0.7 M KCl solution. The mycelium was reacted with appropriate amount of 0.7 M KCl solution and lysing enzyme-sigma for 2 ~ 3 hours to form the protoplast. The formed protoplasts were separated and collected by removing mycelia using filter paper. Washed with 10 ml of 0.7 M KCl buffer and then washed with 15 ml of SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl ₂ ) and suspended in SB buffer. Each 10 μg of expression plasmid and 90 μl of protoplast were mixed and 13 μl of 25% PEG 6000 was added to induce metastasis. The blended solution was injected into the minimal medium supplemented with plommaicin (100 ug / ml), and 4.5 ml of the same medium was overlaid and cultured at 30 캜 for 5 days.

Example 6. Flask culture of pIRTs transformants

14% of corn, 6% of soybean powder, 6% of CSL, 0.05% of antifoaming agent and 0.01% of? -Amylase were added and heated to 70 to 80 ° C and liquefied for 30 minutes. 50 ml of the liquefied liquid was dispensed into a 250 ml flask, and sterilized at 121 캜 for 15 minutes. The mutant strains were harvested from the culture dishes cultured for 5 days with 0.1% Tween 80, and then harvested at 1 × 10 ⁶ cells / ml, and 1 ml of the diluted solution was inoculated. And cultured in a shaking incubator at 28 DEG C, 200 rpm for 4 days. All of the transformants were silenced by glucoamylase, among which the gene silencing of pIRT44 transformants was the highest (Table 3).

[Table 3] Results of glucoamylase gene silencing of pIRT transformants

Example 7. Real Time PCR of pIRTs Transformants

For each transformant, the mycelia cultured for 24 h were pulverized using liquid nitrogen, and then RNA was pulverized using a triazole (Invitrogen, USA). The shRNA effect produced by each pIRT expression vector was reduced by as much as 90% and by as much as 34% (Table 4).

In particular, real time PCR results showed that the IRT44 alleles, which were pIRT44 transformants, expressed about 10% of glucoamylase expression compared to GF101 and 80 ~ 90% of total protein compared to GF101. It was confirmed that the amount of alpha-glucosidase expression was relatively increased while the amount of expression of glucoamylase was decreased (FIGS. 3A and 3B).

[Table 4]

Primers used for RTPCR

glaA gene

RTglaAF: SEQ ID NO: 30

ACACGTACTACAACGGCAACC

RTglaAP: SEQ ID NO: 31

TTCCTGTGCACCTTGGCTGCC

RTglaAR: SEQ ID NO: 32

CTTCACGGCATCTACAATGCT

b-actin gene

RTactF: SEQ ID NO: 33

CGTGACATCAAGGAGAAGCTC

RTactP: SEQ ID NO: 34

ACGGAAACGCTCGTTGCCGAT

RTactR: SEQ ID NO: 35

TGAAGGTGGTCTCGTGGATAC

Example 8. S. thermophil room ( Scytalidium thermophilum ) Production of catalase expression vector

Amplification of the terminator region of the pdcA gene derived from Aspergillus oryzae and cloning of the PCR product were performed as follows. PdcA F containing HindIII, StuI, NotI at the 5'-end and 5'- PCR was performed with the pdcAR primer containing Xba I, and the PCR product was cloned into Hind III / Xba I of pAN7-hyg (Fig. 6A) vector and named pDCAT-hyg (Fig.

Amplification of the promoter + signal sequence + precursor sequence region of glucoamylase gene derived from Aspergillus or GF101 and cloning of PCR product were performed as follows. The PCR product was cloned into HindIII / StuI of pDCAT-hyg vector and PCR was performed with glucoamylase PR primer containing 5'-terminal 5'-end of Glucoamylase PF and StuI at 5'- Respectively. The plasmid was labeled (Figure 6C). The catalase gene was obtained by PCR using the nucleotide ScyA F and the NotI-containing ScyA R at the 5'-terminal after the extraction of the S. thermophilus gDNA and then cloning into StuI / NotI of the pGLASSP vector to obtain PGLASSP-ScyA ).

[Primer used for pDCAT vector construction]

pdcA primer

pdcAHSNF: SEQ ID NO: 36

ATAT AAGCTTAGGCCTGCGGCCGC AAGCTTGGCACTGGCCGTCGTTTTACAACGTC

pdcAX R: SEQ ID NO: 37

ATAT TCTAGA GTTCACCCTCCCACCCGAGAGAG

Primers used for pGLAPSS vector construction

glaA primer

GlaAPHF: SEQ ID NO: 38

ATAT AAGCTT GACTCCAACCGGGGGGAGTAC

GlaASSSR: SEQ ID NO: 39

ATAT AGGCCT CTTGGAAATCACATTTGCCAAC

[Primer used for construction of pGLAPSS-ScyA vector]

Catalase primer

ScyA F: SEQ ID NO: 40

CAAGCAACATGTCCCTTTGCGGAC

ScyA R: SEQ ID NO: 41

ATAT GCGGCCGCT AAGAGTCGAGAGCAAACCGATC

Example 9. Transformation of PGLASSP-ScyA

The spores of Aspergillus niger IRT417 were dispersed evenly in CYS (1% of corn starch, 0.15% of yeast extract, 21.86% of sorbitol) and incubated at 30 ° C for 5-6 days until spores were uniformly formed. 5 ml 0.08% Tween 80 was mixed well and the spores were inoculated into an appropriate amount of 0.01% (w / v) YPD medium and cultured at 30 ° C until hyphae were formed. The mycelium was filtered through a filter paper, washed with sterile water, and then washed again with 0.7 M KCl solution. The mycelium was reacted with an appropriate amount of 0.7 M KCl solution and ligation enzyme (sigma) to break the outer wall of the cell and reacted for 2-3 hours to form a protoplast. The formed protoplasts were separated and collected after removing mycelia using filter paper. Washed with 10 ml of 0.7 M KCl buffer, washed with 15 ml of the following SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl2) and suspended in SB buffer. After mixing 10 μg of each pGlaASS-ScyA plasmid and 90 μl of protoplast, 13 μl of 25% PEG 6000 was added to induce metastasis. The blended solution was injected into minimal medium supplemented with plommaicin (100 ug / ml) and overlayed with 4.5 ml of the same medium and incubated at 30 캜 for 5 days.

Example 10. Flask culture of PGLASSP-ScyA transformants

14% of corn, 6% of soybean powder, 6% of CSL, 0.05% of antifoaming agent and 0.01% of? -Amylase were added and heated to 70 to 80 ° C and liquefied for 30 minutes. 50 ml of the liquefied liquid was dispensed into a 250 ml flask, and sterilized at 121 C for 15 minutes. The mutant strains were harvested from the culture dishes cultured for 5 days with 0.1% Tween 80, and then harvested at 1 × 10 ⁶ cells / ml and 1 ml of the diluted solution was inoculated. And cultured in a shaking incubator at 28C, 200 rpm for 4 days.

[Table 5] Activity of PGLASSP-ScyA transformants

Example 11. Identification of activity of PGLASSP-ScyA transformants

1U is the amount of enzyme that decomposes 1μmole of hydrogen peroxide per minute. Prepare by adding 0.1 ml of 30% Hydrogen Peroxide to 49.9 ml of 50 mM potassium phosphate buffer (pH 7.0). 30 ul of the fermentation broth was added and the absorbance was measured at 255 nm. The catalase activity of GF101 and IRT417 strains was less than 10 U / ml. The activity of catalase activity was 548 U / ml in strains with high expression of glucoamylase, and 3000 U / ml in strains with glucoamylase gene silencing by shRNA. The expression of catalase by the glucoamylase gene silencing was increased about 5 times as a whole (Fig. 7B).

Example 12. C. Cinerius ( Coprinus cinereus )  Production of peroxidase expression vector

The C. cinereus peroxidase gene was obtained by PCR using Cp1A F of nucleotide Cip1A F and Cip1R containing NotI at the 5'-terminal after C. cereerius gDNA extraction, and cloning into StuI / NotI of pGLASSP vector PGLASSP-Cip1 (Fig. 8A).

[Primer used for construction of pGLAPSS-Cip1 vector]

Cip1 F: SEQ ID NO: 42

CCGATGCTGCAGCATAATGC

Cip1 R: SEQ ID NO: 43

ATAT GCGGCCGCT TCGCTAGGCTAGTCGGAAGGC

Example 13. PGLASSP-Cip1 transformation and transformant Culture of flasks

The spores of Aspergillus niger IRT417 strain were dispersed evenly in CYS (1% of corn starch, 0.15% of yeast extract, 21.86% of sorbitol), and cultured at 30 ° C for 5-6 days until spores were uniformly formed. 5 ml 0.08% Tween 80 was mixed well and the spores were inoculated into an appropriate amount of 0.01% (w / v) YPD medium and cultured at 30 ° C until hyphae were formed. The mycelium was filtered through a filter paper, washed with sterile water, and then washed again with 0.7 M KCl solution. The mycelium was reacted with an appropriate amount of 0.7 M KCl solution and lysis enzyme (Sigma) to break the outer wall of the cell and reacted for 2-3 hours to form a protoplast. The formed protoplasts were separated and collected after removing mycelia using filter paper. After washing with 10 ml of 0.7 M KCl buffer, it was washed with 15 ml of SB buffer (1.2 M sorbitol, 10 mM Tris-HCl, 20 mM CaCl ₂ ) and suspended in SB buffer solution. After mixing 10 μg of each pGlaASS-Cip1 plasmid with 90 μl of protoplast, 13 μl of 25% PEG 6000 was added to induce metastasis. The blended solution was injected into minimal medium supplemented with plommaicin (100 ug / ml) and overlayed with 4.5 ml of the same medium and incubated at 30 캜 for 5 days.

Example 14. Flask culture of PGLASSP-Cip1 transformants

14% of corn, 6% of yeast extract, 2% of CSL, 0.05% of antifoaming agent and 0.01% of? -Amylase were added and heated to 70 to 80 ° C and liquefied for 30 minutes. 50 ml of the liquefied liquid was dispensed into a 250 ml flask, and sterilized at 121 캜 for 15 minutes. The mutant strains were harvested from the culture dishes cultured for 5 days with 0.1% Tween 80, and then harvested at 1 × 10 ⁶ cells / ml and 1 ml of the diluted solution was inoculated. And cultured in a shaking incubator at 28 DEG C, 200 rpm for 4 days.

Example 15. Identification of activity of PGLASSP-Cip1 transformants

1U is the amount of enzyme that degrades 1 μmole hydrogen peroxide per minute. It is made by adding 0.1 ml of 30% H ₂ O ₂ to 49.9 ml of 50 mM potassium phosphate buffer (pH 7.0). 30 ul of the fermentation broth was added and the absorbance was measured at 255 nm. The catalase activity was 149.9 U / ml in the GF101 strain with high expression of glucoamylase and 1,176 U / ml activity in the strain in which glucoamylase gene silencing was induced by shRNA. Glucoamylase gene silencing increased the overall peroxidase expression rate by about 7.8 fold (Figure 8b).

[Table 6] PGLASSP-Cip1 Identification of the activity of the transformants

It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

<110> Genofocus Co., Ltd. <120> Method for Expressing High-Level of Target Protein by Gene          Silencing <130> P14-B174 <160> 43 <170> Kopatentin 2.0 <210> 1 <211> 2172 <212> DNA <213> glucoamylase of Aspergillus niger <400> 1 ggcctcgtc atttccaagc gcgcgacctt ggattcatgg ttgagcaacg aagcgaccgt ggctcgtact 120 gccatcctga ataacatcgg ggcggacggt gcttgggtgt cgggcgcgga ctctggcatt 180 gtcgttgcta gtcccagcac ggataacccg gactgtatgt ttcgagctca gatttagtat 240 gagtgtgtca ttgattgatt gatgctgact ggcgtgtcgt ttgttgtaga cttctacacc 300 tggactcgcg actctggtct cgtcctcaag accctcgtcg atctcttccg aaatggagat 360 accagtctcc tctccaccat tgagaactac atctccgccc aggcaattgt ccagggtatc 420 agtaacccct ctggtgatct gtccagcggc gctggtctcg gtgaacccaa gttcaatgtc 480 gatgagactg cctacactgg ttcttgggga cggccgcagc gagatggtcc ggctctgaga 540 gcaactgcta tgatcggctt cgggcagtgg ctgcttgtat gttctccacc cccttgcgtc 600 tgatctgtga catatgtagc tgactggtca ggacaatggc tacaccagca ccgcaacgga 660 cattgtttgg cccctcgtta ggaacgacct gtcgtatgtg gctcaatact ggaaccagac 720 aggatatggt gtgtttgttt tattttaaat ttccaaagat gcgccagcag agctaacccg 780 cgatcgcaga tctctgggaa gaagtcaatg gctcgtcttt ctttacgatt gctgtgcaac 840 accgcgccct tgtcgaaggt agtgccttcg cgacggccgt cggctcgtcc tgctcctggt 900 gtgattctca ggcacccgaa attctctgct acctgcagtc cttctggacc ggcagcttca 960 ttctggccaa cttcgatagc agccgttccg gcaaggacgc aaacaccctc ctgggaagca 1020 tccacacctt tgatcctgag gccgcatgcg acgactccac cttccagccc tgctccccgc 1080 gcgcgctcgc caaccacaag gaggttgtag actctttccg ctcaatctat accctcaacg 1140 atggtctcag tgacagcgag gctgttgcgg tgggtcggta ccctgaggac acgtactaca 1200 acggcaaccc gtggttcctg tgcaccttgg ctgccgcaga gcagttgtac gatgctctat 1260 accagtggga caagcagggg tcgttggagg tcacagatgt gtcgctggac ttcttcaagg 1320 cactgtacag cgatgctgct actggcacct actcttcgtc cagttcgact tatagtagca 1380 ttgtagatgc cgtgaagact ttcgccgatg gcttcgtctc tattgtggta agtctacgct 1440 agacaagcgc tcatgttgac agagggtgcg tactaacaga agtaggaaac tcacgccgca 1500 agcaacggct ccatgtccga gcaatacgac aagtctgatg gcgagcagct ttccgctcgc 1560 gacctgacct ggtcttatgc tgctctgctg accgccaaca accgtcgtaa ctccgtcgtg 1620 cctgcttctt ggggcgagac ctctgccagc agcgtgcccg gcacctgtgc ggccacatct 1680 gccattggta cctacagcag tgtgactgtc acctcgtggc cgagtatcgt ggctactggc 1740 ggcaccacta cgacggctac ccccactgga tccggcagcg tgacctcgac cagcaagacc 1800 accgcgactg ctagcaagac cagcaccagt acgtcatcaa cctcctgtac cactcccacc 1860 gccgtggctg tgactttcga tctgacagct accaccacct acggcgagaa catctacctg 1920 gtcggatcga tctctcagct gggtgactgg gaaaccagcg acggcatagc tctgagtgct 1980 gacaagtaca cttccagcga cccgctctgg tatgtcactg tgactctgcc ggctggtgag 2040 tcgtttgagt acaagtttat ccgcattgag agcgatgact ccgtggagtg ggagagtgat 2100 cccaaccgag aatacaccgt tcctcaggcg tgcggaacgt cgaccgcgac ggtgactgac 2160 acctggcggt ag 2172 <210> 2 <211> 810 <212> DNA <213> glucoamylase promoter of Aspergillus niger <400> 2 cgaactccaa ccggggggag tacattgagt ggccgcagtg gaaggaatcg cggcagttga 60 tgaatttcgg agcgaacgac gccagtctcc ttacggatga tttccgcaac gggacatatg 120 agttcatcct gcagaatacc gcggcgttcc acatctgatg ccattggcgg aggggtccgg 180 acggtcagga acttagcctt atgagatgaa tgatggacgt gtctggcctc ggaaaaggat 240 atatggggat cataatagta ctagccatat taatgaaggg catataccac gcgttggacc 300 tgcgttatag cttcccgtta gttatagtac catcgttata ccagccaatc aagtcaccac 360 gcacgaccgg ggacggcgaa tccccgggaa ttgaaagaaa ttgcatccca ggccagtgag 420 gccagcgatt ggccacctct ccaaggcaca gggccattct gcagcgctgg tggattcatc 480 gcaatttccc ccggcccggc ccgacaccgc tataggctgg ttctcccaca ccatcggaga 540 ttcgtcgcct aatgtctcgt ccgttcacaa gctgaagagc ttgaagtggc gagatgtctc 600 tgcaggaatt caagctagat gctaagcgat attgcatggc aatatgtgtt gatgcatgtg 660 cttcttcctt cagcttcccc tcgtgcagat gaggtttggc tataaattga agtggttggt 720 cggggttccg tgaggggctg aagtgcttcc tcccttttag acgcaactga gagcctgagc 780 ttcatcccca gcatcgatta cacctcagca 810 <210> 3 <211> 1000 <212> DNA <213> Artificial Sequence <220> <223> Sense strand of shRNA <400> 3 gaccttggat tcatggttga gcaacgaagc gaccgtggct cgtactgcca tcctgaataa 60 catcggggcg gacggtgctt gggtgtcggg cgcggactct ggcattgtcg ttgctagtcc 120 cagcacggat aacccggact gtatgtttcg agctcagatt tagtatgagt gtgtcattga 180 ttgattgatg ctgactggcg tgtcgtttgt tgtagacttc tacacctgga ctcgcgactc 240 tggtctcgtc ctcaagaccc tcgtcgatct cttccgaaat ggagatacca gtctcctctc 300 caccattgag aactacatct ccgcccaggc aattgtccag ggtatcagta acccctctgg 360 tgatctgtcc agcggcgctg gtctcggtga acccaagttc aatgtcgatg agactgccta 420 cactggttct tggggacggc cgcagcgaga tggtccggct ctgagagcaa ctgctatgat 480 cggcttcggg cagtggctgc ttgtatgttc tccaccccct tgcgtctgat ctgtgacata 540 tgtagctgac tggtcaggac aatggctaca ccagcaccgc aacggacatt gtttggcccc 600 tcgttaggaa cgacctgtcg tatgtggctc aatactggaa ccagacagga tatggtgtgt 660 ttgttttatt ttaaatttcc aaagatgcgc cagcagagct aacccgcgat cgcagatctc 720 tgggaagaag tcaatggctc gtctttcttt acgattgctg tgcaacaccg cgcccttgtc 780 gaaggtagtg ccttcgcgac ggccgtcggc tcgtcctgct cctggtgtga ttctcaggca 840 cccgaaattc tctgctacct gcagtccttc tggaccggca gcttcattct ggccaacttc 900 gatagcagcc gttccggcaa ggacgcaaac accctcctgg gaagcatcca cacctttgat 960 cctgaggccg catgcgacga ctccaccttc cagccctgct 1000 <210> 4 <211> 699 <212> DNA <213> Artificial Sequence <220> <223> Antisense strand of shRNA <400> 4 gaccttggat tcatggttga gcaacgaagc gaccgtggct cgtactgcca tcctgaataa 60 catcggggcg gacggtgctt gggtgtcggg cgcggactct ggcattgtcg ttgctagtcc 120 cagcacggat aacccggact gtatgtttcg agctcagatt tagtatgagt gtgtcattga 180 ttgattgatg ctgactggcg tgtcgtttgt tgtagacttc tacacctgga ctcgcgactc 240 tggtctcgtc ctcaagaccc tcgtcgatct cttccgaaat ggagatacca gtctcctctc 300 caccattgag aactacatct ccgcccaggc aattgtccag ggtatcagta acccctctgg 360 tgatctgtcc agcggcgctg gtctcggtga acccaagttc aatgtcgatg agactgccta 420 cactggttct tggggacggc cgcagcgaga tggtccggct ctgagagcaa ctgctatgat 480 cggcttcggg cagtggctgc ttgtatgttc tccaccccct tgcgtctgat ctgtgacata 540 tgtagctgac tggtcaggac aatggctaca ccagcaccgc aacggacatt gtttggcccc 600 tcgttaggaa cgacctgtcg tatgtggctc aatactggaa ccagacagga tatggtgtgt 660 ttgttttatt ttaaatttcc aaagatgcgc cagcagagc 699 <210> 5 <211> 306 <212> DNA <213> Artificial Sequence <220> <223> loop of shRNA <400> 5 taacccgcga tcgcagatct ctgggaagaa gtcaatggct cgtctttctt tacgattgct 60 gtgcaacacc gcgcccttgt cgaaggtagt gccttcgcga cggccgtcgg ctcgtcctgc 120 tcctggtgtg attctcaggc acccgaaatt ctctgctacc tgcagtcctt ctggaccggc 180 agcttcattc tggccaactt cgatagcagc cgttccggca aggacgcaaa caccctcctg 240 ggaagcatcc acacctttga tcctgaggcc gcatgcgacg actccacctt ccagccctgc 300 tccccg 306 <210> 6 <211> 502 <212> DNA <213> Artificial Sequence <220> <223> Antisense of shRNA <400> 6 gaccttggat tcatggttga gcaacgaagc gaccgtggct cgtactgcca tcctgaataa 60 catcggggcg gacggtgctt gggtgtcggg cgcggactct ggcattgtcg ttgctagtcc 120 cagcacggat aacccggact gtatgtttcg agctcagatt tagtatgagt gtgtcattga 180 ttgattgatg ctgactggcg tgtcgtttgt tgtagacttc tacacctgga ctcgcgactc 240 tggtctcgtc ctcaagaccc tcgtcgatct cttccgaaat ggagatacca gtctcctctc 300 caccattgag aactacatct ccgcccaggc aattgtccag ggtatcagta acccctctgg 360 tgatctgtcc agcggcgctg gtctcggtga acccaagttc aatgtcgatg agactgccta 420 cactggttct tggggacggc cgcagcgaga tggtccggct ctgagagcaa ctgctatgat 480 cggcttcggg cagtggctgc tt 502 <210> 7 <211> 137 <212> DNA <213> Artificial Sequence <220> <223> loop of shRNA <400> 7 gtatgttctc cacccccttg cgtccattgt ttggcccctc gttaggaacg acctgtcgta 60 tgtggctcaa tactggaacc agacaggata tggtgtgttt gttttatttt aaatttccaa 120 agatgcgcca gcagagc 137 <210> 8 <211> 347 <212> DNA <213> Artificial Sequence <220> <223> Antisense strand of shRNA <400> 8 gaccttggat tcatggttga gcaacgaagc gaccgtggct cgtactgcca tcctgaataa 60 catcggggcg gacggtgctt gggtgtcggg cgcggactct ggcattgtcg ttgctagtcc 120 cagcacggat aacccggact gtatgtttcg agctcagatt tagtatgagt gtgtcattga 180 ttgattgatg ctgactggcg tgtcgtttgt tgtagacttc tacacctgga ctcgcgactc 240 tggtctcgtc ctcaagaccc tcgtcgatct cttccgaaat ggagatacca gtctcctctc 300 caccattgag aactacatct ccgcccaggc aattgtccag ggtatca 347 <210> 9 <211> 95 <212> DNA <213> Artificial Sequence <220> <223> loop of shRNA <400> 9 atgagactgc ctacactggt tcttggggac ggccgcagcg agatggtccg gctctgagag 60 caactgctat gatcggcttc gggcagtggc tgctt 95 <210> 10 <211> 700 <212> DNA <213> Artificial Sequence <220> <223> Sense strand of shRNA <400> 10 tcgttaggaa cgacctgtcg tatgtggctc aatactggaa ccagacagga tatggtgtgt 60 ttgttttatt ttaaatttcc aaagatgcgc cagcagagct aacccgcgat cgcagatctc 120 tgggaagaag tcaatggctc gtctttcttt acgattgctg tgcaacaccg cgcccttgtc 180 gaaggtagtg ccttcgcgac ggccgtcggc tcgtcctgct cctggtgtga ttctcaggca 240 cccgaaattc tctgctacct gcagtccttc tggaccggca gcttcattct ggccaacttc 300 gatagcagcc gttccggcaa ggacgcaaac accctcctgg gaagcatcca cacctttgat 360 cctgaggccg catgcgacga ctccaccttc cagccctgct ccccgcgcgc gctcgccaac 420 cacaaggagg ttgtagactc tttccgctca atctataccc tcaacgatgg tctcagtgac 480 agcgaggctg ttgcggtggg tcggtaccct gaggacacgt actacaacgg caacccgtgg 540 ttcctgtgca ccttggctgc cgcagagcag ttgtacgatg ctctatacca gtgggacaag 600 caggggtcgt tggaggtcac agatgtgtcg ctggacttct tcaaggcact gtacagcgat 660 gctgctactg gcacctactc ttcgtccagt tcgacttata 700 <210> 11 <211> 400 <212> DNA <213> Artificial Sequence <220> <223> Antisense strand of shRNA <400> 11 tcgttaggaa cgacctgtcg tatgtggctc aatactggaa ccagacagga tatggtgtgt 60 ttgttttatt ttaaatttcc aaagatgcgc cagcagagct aacccgcgat cgcagatctc 120 tgggaagaag tcaatggctc gtctttcttt acgattgctg tgcaacaccg cgcccttgtc 180 gaaggtagtg ccttcgcgac ggccgtcggc tcgtcctgct cctggtgtga ttctcaggca 240 cccgaaattc tctgctacct gcagtccttc tggaccggca gcttcattct ggccaacttc 300 gatagcagcc gttccggcaa ggacgcaaac accctcctgg gaagcatcca cacctttgat 360 cctgaggccg catgcgacga ctccaccttc cagccctgct 400 <210> 12 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> loop of shRNA <400> 12 ccccgcgcgc gctcgccaac cacaaggagg ttgtagactc tttccgctca atctataccc 60 tcaacgatgg tctcagtgac agcgaggctg ttgcggtggg tcggtaccct gaggacacgt 120 actacaacgg caacccgtgg ttcctgtgca ccttggctgc cgcagagcag ttgtacgatg 180 ctctatacca gtgggacaag caggggtcgt tggaggtcac agatgtgtcg ctggacttct 240 tcaaggcact gtacagcgat gctgctactg gcacctactc ttcgtccagt tcgacttata 300                                                                          300 <210> 13 <211> 339 <212> DNA <213> Artificial Sequence <220> <223> Antisense strand of shRNA <400> 13 tcgttaggaa cgacctgtcg tatgtggctc aatactggaa ccagacagga tatggtgtgt 60 ttgttttatt ttaaatttcc aaagatgcgc cagcagagct ccacaccttt gatcctgagg 120 ccgcatgcga cgactccacc ttccagccct gctccccgcg cgcgctcgcc aaccacaagg 180 aggttgtaga ctctttccgc tcaatctata ccctcaacga tggtctcagt gacagcgagg 240 ctgttgcggt gggtcggtac cctgaggaca cgtactacaa cggcaacccg tggttcctgt 300 gcaccttggc tgccgcagag cagttgtacg atgctctat 339 <210> 14 <211> 240 <212> DNA <213> Artificial Sequence <220> <223> loop of shRNA <400> 14 taacccgcga tcgcagatct ctgggaagaa gtcaatggct cgtctttctt tacgattgct 60 gtgcaacacc gcgcccttgt cgaaggtagt gccttcgcga cggccgtcgg ctcgtcctgc 120 tcctggtttc tggccaactt cgatagcagc cgttccggca aggacgcaaa caccctcctg 180 ggaagcacca cacctttgat cctgaggccg catgcgacga ctccaccttc cagccctgct 240                                                                          240 <210> 15 <211> 343 <212> DNA <213> Terminator of PCdA from Aspergillus Oryzae <400> 15 gcggaacaag tccctttaat ttcttcaaga catcctccag gatagaccag atctctttcc 60 ttctttacgg ctcgggaaat cggtttcagt tagcatgcca ccatgcacac ggggcatttt 120 taattccatc atgacatgtg gttaagagat tttgttcgtt tgcgatagtt ttataatgag 180 ttctttatct gctttccctc tccttctttc ctttcaatac cttctaagtt aaaacaataa 240 tcagatttaa ttaaataaca atgaattaaa tgttaattta gagagagaga cagagaaaaa 300 gagaaaaaga aataaccaga ctctctcggg tgggagggtg aac 343 <210> 16 <211> 885 <212> DNA <213> Terminator of glaA from Aspergillus niger <400> 16 acaatcaatc catttcgcta tagttaaagg atggggatga gggcaattgg ttatatgatc 60 atgtatgtag tgggtgtgca taatagtagt gaaatggaag ccaagtcatg tgattgtaat 120 cgaccgacgg aattgaggat atccggaaat acagacaccg tgaaagccat ggtctttcct 180 tcgtgtagaa gaccagacag acagtccctg atttaccctt gcacaaagca ctagaaaatt 240 agcattccat ccttctctgc ttgctctgct gatatcactg tcattcaatg catagccatg 300 agctcatctt agatccaagc acgtaattcc atagccgagg tccacagtgg agcagcaaca 360 ttccccatca ttgctttccc caggggcctc ccaacgacta aatcaagagt atatctctac 420 cgtccaatag atcgtcttcg cttcaaaatc tttgacaatt ccaagagggt ccccatccat 480 caaacccagt tcaataatag ccgagatgca tggtggagtc aattaggcag tattgctgga 540 atgtcggggc cagttggccc ggtggtcatt ggccgcctgt gatgccatct gccactaaat 600 ccgatcattg atccaccgcc cacgaggcgc gtctttgctt tttgcgcggc gtccaggttc 660 aactctctct gcagctccag tccaacgctg actgactagt ttacctactg gtctgatcgg 720 ctccatcaga gctatggcgt tatcccgtgc cgttgctgcg caatcgctat cttgatcgca 780 accttgaact cactcttgtt ttaatagtga tcttggtgac ggagtgtcgg tgagtgacaa 840 ccaacatcgt gcaagggaga ttgatacgga attgtcgctc ccatc 885 <210> 17 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> pDCAHBSNF Primer <400> 17 atataagctt ggatccacta gtgcggccgc aagcttggca ctggccgtcg ttttacaacg 60 tc 62 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pDCAX R Primer <400> 18 atattctaga gttcaccctc ccacccgaga gag 33 <210> 19 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GlaAPHF Primer <400> 19 atataagctt gactccaacc ggggggagta c 31 <210> 20 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GlaAPR Primer <400> 20 atatggatcc tgctgaggtg taatgatgct g 31 <210> 21 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> si BAF1 Primer <400> 21 atatggatcc gaccttggat tcatggttga g 31 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> si BAF2 Primer <400> 22 atatggatcc tcgttaggaa cgacctgtcg 30 <210> 23 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> si NOF1 Primer <400> 23 atatgcggcc gcgaccttgg attcatggtt gag 33 <210> 24 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> si NOF2 Primer <400> 24 atatgcggcc gctcgttagg aacgacctgt cg 32 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> si SPR0 Primer <400> 25 atatactagt tgataccctg gacaattgcc 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> si SPR1 Primer <400> 26 atatactagt aagcagccac tgcccgaagc 30 <210> 27 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> si SPR2 Primer <400> 27 atatactagt gctctgctgg cgcatctttg g 31 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> siRNA Primer <400> 28 atatactagt agcagggctg gaaggtggag 30 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> si SPR4 Primer <400> 29 atatactagt tataagtcga actggacgaa g 31 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTglaAF Primer <400> 30 acacgtacta caacggcaac c 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTglaAP Primer <400> 31 ttcctgtgca ccttggctgc c 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTglaAR Primer <400> 32 cttcacggca tctacaatgc t 21 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTactF Primer <400> 33 cgtgacatca aggagaagct c 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTactP Primer <400> 34 acggaaacgc tcgttgccga t 21 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> RTactR Primer <400> 35 tgaaggtggt ctcgtggata c 21 <210> 36 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> pDCAHSNF Primer <400> 36 atataagctt aggcctgcgg ccgcaagctt ggcactggcc gtcgttttac aacgtc 56 <210> 37 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> pDCAX R Primer <400> 37 atattctaga gttcaccctc ccacccgaga gag 33 <210> 38 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> GlaAPHF Primer <400> 38 atataagctt gactccaacc ggggggagta c 31 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> GlaASSSR Primer <400> 39 atataggcct cttggaaatc acatttgcca ac 32 <210> 40 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ScyA F Primer <400> 40 caagcaacat gtccctttgc ggac 24 <210> 41 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> ScyA R Primer <400> 41 atatgcggcc gctaagagtc gagagcaaac cgatc 35 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cip1 F Primer <400> 42 ccgatgctgc agcataatgc 20 <210> 43 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Cip1 R Primer <400> 43 atatgcggcc gcttcgctag gctagtcgga aggc 34

Claims (15)

And a polynucleotide encoding an shRNA capable of RNAi expression of the expression of a glucoamylase operably linked to the promoter, wherein the polynucleotide encoding the shRNA comprises a sense of SEQ ID NO: 10, an antisense of SEQ ID NO: 11 And a loop sequence of SEQ ID NO: 12.
2. The expression vector according to claim 1, wherein the glucoamylase is encoded by the nucleotide sequence shown in SEQ ID NO: 1.
delete 2. The expression vector according to claim 1, wherein the promoter is represented by the sequence of SEQ ID NO: 2.
The expression vector of claim 1, wherein said vector is pIRT 44 having a cleavage map of Figure 5D.
The expression vector according to claim 1, further comprising a transcription termination factor of the pdcA gene or a transcription termination factor of a glucoamylase.
7. The expression vector according to claim 6, wherein the transcription termination factor of the pdcA gene is represented by the sequence of SEQ ID NO:
7. The expression vector according to claim 6, wherein the glucoamylase transcription termination factor is represented by SEQ ID NO: 16.
8. A recombinant microorganism into which an expression vector of any one of claims 1, 2, and 4 to 8 is introduced.
The recombinant microorganism according to claim 9, which is a fungus.
11. The recombinant microorganism of claim 10, wherein the fungus is Aspergillus niger .
10. The recombinant microorganism according to claim 9, wherein a gene encoding a target protein is further introduced.
Culturing the recombinant microorganism of claim 12 to express a target protein; And recovering the expressed target protein.
14. The method according to claim 13, wherein the expression of the target protein is increased when the expression of the glucoamylase is inhibited.
14. The method according to claim 13, wherein the target protein is catalase or peroxidase.

Images