KR101681513B1 - Method for mass production of human follicle stimulating hormone - Google Patents

Abstract

The present invention relates to a method for mass-producing a recombinant human follicle-stimulating hormone using a vector in which a promoter, which is a transcriptional regulatory region of dihydrofolate reductase, is artificially weakened to improve a gene amplification efficiency, It is useful for the production of infertility treatment agent by expressing the follicle stimulating hormone with high efficiency and mass.

Description

The present invention relates to a method for mass production of human follicle stimulating hormone

The present invention relates to a method for mass production of human follicle-stimulating hormone, and more particularly, to a method for mass production of human follicle stimulating hormone by artificially attenuating a promoter, which is a transcriptional regulatory region of dihydrofolate reductase (DHFR) To a method for mass-producing recombinant human follicle stimulating hormone using a vector.

Human follicle-stimulating hormone (hFSH) is a glycoprotein hormone produced in the pituitary gland and secreted into the endocrine system. It is composed of alpha and beta subunit dimers. Alpha-subunit (hFSH-α) is a pituitary gland protein, luteinizing hormone (LH), placental glycoprotein, human chorionic gonadotropin (hCG) and thyroid stimulating hormone (TSH) It is a glycoprotein composed of 92 amino acids common to the same glycoprotein family. It has two N-glycosylation sites at positions 52 and 78 asparagine. The beta subunit (hFSH-β) It is a glycoprotein composed of 111 amino acids specific to hFSH, and has an N-glycosylation site at asparagine positions at positions 7 and 24. hFSH is a glycoprotein that accounts for about 40% of the total molecular weight, and such glycosylation is known to play an important role in the receptor binding ability and signal transduction activity of hFSH (Flack et al., J. Biol . Chem , 1994 13; 269 (19): 14015-20 and WO 01/58493).

hFSH is known to play an important role in the differentiation and development of germ cells in males and females. It has been used for mature follicles in a large number of women who have received assisted reproductive technology for infertility treatment, Are used to generate and increase sperm. Currently, products derived from urine and recombinant products are used as infertility drugs using hFSH. Urine-derived products, which are purified from urine of a woman, have low efficiency in production and instability of supply, and in particular have many risks in terms of safety. In contrast, genetically engineered products overcome the drawbacks of urine-derived products using genetic engineering technology, accounting for 80% of the ovulation inducer market.

Various vectors and hosts such as Escherichia coli have been used to produce large quantities of recombinant proteins using genetic engineering techniques, but they have limited disadvantages in the use of proteins having a complex structure or requiring glycosylation. To solve these problems, animal cell lines are used, yeasts, transgenic animals, and transgenic plants are used. In the case of yeast, it is easy to mass-produce, but it is known that the degree and pattern of glycosylation is very different from that of humans, resulting in a lot of immunogenicity (Hermeling et al., Pharm . Res . 21 (6): 897 -903 (2004)), and in the case of transgenic animals, the use thereof is limited due to the problems of animal care and possible contamination of pathogens. In addition, the method using an animal cell line has a high production cost and takes a lot of time and cost to produce a cell line. However, the recombinant protein produced is very similar to a human form and can be stably produced and administered. Also, as in hFSH, Proteins that are very important for activity are known as ideal hosts.

However, when hFSH is produced in an animal cell line using recombinant DNA technology, the expression level of hFSH is low and it is difficult to exhibit high productivity. Therefore, in order to use hFSH as a therapeutic agent, it is essential to secure a cell line capable of stable mass production, and development of an expression vector capable of expressing with high efficiency is also indispensable in order to secure such cell line.

Thus, the present inventors prepared an expression vector for animal cell lines capable of expressing hFSH with high efficiency using a vector in which the GC-rich repeated sequence of the dihydrofolate reductase (DHFR) promoter region has been deleted, The present inventors completed the present invention by securing a transformant capable of stably mass-producing hFSH by transforming an animal cell line with a vector.

Accordingly, it is an object of the present invention to provide a method for mass production of human follicle stimulating hormone.

Another object of the present invention is to provide an expression vector of human follicle stimulating hormone.

It is another object of the present invention to provide an animal cell line that produces human follicle stimulating hormone.

According to the above object, the present invention provides a method for producing a recombinant DNA comprising: 1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; And iii) transforming an animal cell line with an expression vector comprising a promoter of CMV early gene or a promoter of Rous sarcoma virus (RSV) and a human follicle stimulating hormone alpha subunit gene operably linked thereto; And 2) culturing the transformed animal cell line in the presence of a DHFR inhibitor.

According to the above object, the present invention provides a method for producing a recombinant DNA comprising: 1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) transforming an animal cell line with an expression vector comprising a human follicle stimulating hormone alpha subunit gene; And 2) culturing the transformed animal cell line in the presence of a DHFR inhibitor.

According to another aspect of the present invention, there is provided a gene encoding a DHFR promoter comprising: i) a gene encoding a DHFR promoter from which a GC-rich repeated sequence has been removed and DHFR operably linked thereto; ii) a promoter of the CMV early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; And iii) a promoter of the CMV early gene or a promoter of RSV and a human FSH alpha subunit gene operably linked thereto.

According to another aspect of the present invention, there is provided a method for producing a recombinant DNA comprising the steps of: i) a gene encoding a dihydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) a human follicle stimulating hormone alpha subunit gene.

According to another aspect of the present invention, there is provided an animal cell line transformed with the expression vector of human follicle stimulating hormone.

The present invention can be applied to the production of a therapeutic agent for infertility because the human ovarian stimulating hormone can be expressed with high efficiency and a large amount by using a vector in which the GC-rich repeated sequence of the DHFR promoter region is deleted.

Figure 1 shows the preparation process and map of hFSH-alpha and hFSH-beta subunit expression vectors.
Fig. 2 shows a process for producing a monocystone expression vector (pX0GC-CMV-FSH) of hFSH-a and -beta and a map thereof.
Fig. 3 shows a process for producing a polysystron expression vector (pX0GC-CMV-IR-FSH) of hFSH-α and -β and a map thereof.
Fig. 4 shows the process and the map of the production of a polysystron expression vector (pX0GC-CMV-UIR-FSH) of hFSH-a and -beta.
FIG. 5 shows the preparation process and the map of the monocystone expression vector (pX0GC-CMV-RSV-FSH) of hFSH-a and -beta.
FIG. 6 shows the expression level of hFSH by enzyme immunoassay of colonies obtained from the cell line transformed with the hFSH expression vector (pX0GC-CMV-FSH).
FIG. 7 shows the result of transferring 5 cell lines transformed with the hFSH expression vector (pX0GC-CMV-RSV-FSH) to a 6-well plate and measuring the amount of hFSH expression.
Fig. 8 shows the expression level of hFSH by enzyme immunoassay of colonies obtained from the cell line transformed with the hFSH expression vector (pX0GC-CMV-RSV-FSH).
FIG. 9 shows the survival cell density and survival rate according to the KCl concentration of the selected HMFS76 cell line.
FIG. 10 shows the survival rate and survival cell density according to the KCl concentration of the selected HMFS126 cell line.

Hereinafter, terms used in the present invention will be defined.

As used herein, the term " Monocistron "refers to a system in which proteins corresponding to each cistron are expressed in mRNA transcribed from different promoters. Here, the term "cistron" means a coding sequence of a nucleic acid encoding a single protein or polypeptide, and the cistron includes a 5 'start codon and a 3' stop codon.

In contrast, the term " polycistron "as used in the present invention means that one mRNA is synthesized in the same promoter and each cistron is separated by a stop codon and an initiation codon, and a ribosome binding Region is present, and the protein corresponding to each cistron is simultaneously expressed from the mRNA transcribed from one promoter.

Hereinafter, the present invention will be described.

The present invention relates to a method for producing a recombinant DNA comprising: 1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and a DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; And iii) transforming an animal cell line with an expression vector comprising a promoter of CMV early gene or a promoter of Rous sarcoma virus (RSV) and a human follicle stimulating hormone alpha subunit gene operably linked thereto; And 2) culturing the transformed animal cell line in the presence of a DHFR inhibitor. The method of mass production of human follicle stimulating hormone (hFSH) comprises the steps of:

The present invention also relates to a method for producing a recombinant vector comprising: 1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) transforming an animal cell line with an expression vector comprising a human follicle stimulating hormone alpha subunit gene; And 2) culturing the transformed animal cell line in the presence of a DHFR inhibitor.

Step 1) of the method of the present invention is a step of transforming an animal cell line with a recombinant expression vector that expresses hFSH with high efficiency. The hFSH expression vector may be a monocystone vector or a polycistron vector.

In one embodiment, the monocysteone vector has as its first component a gene encoding a DHFR promoter from which a GC-rich repeat sequence has been removed and a DHFR operably linked thereto, and the second component is CMV A promoter of an initial gene, a hFSH-beta subunit gene operably linked thereto, and a promoter of a CMV early gene or a promoter of RSV and a hFSH-alpha subunit gene operably linked thereto.

In the first component, the GC-rich repetitive sequence means a CCGCCC repeat sequence contained in a promoter which is a transcriptional regulatory factor of DHFR, and is disclosed in Korean Patent No. 880509. [ The vector containing the DHFR gene with the GC-rich repeat sequence of the DHFR promoter region removed can express the DHFR and the expression of the hFSH gene contained in the vector in a shorter time, even with a lower DHFR inhibitor, Lt; / RTI >

In the second component, the hFSH-beta subunit gene is regulated by the promoter of the CMV early gene, and the hFSH-alpha subunit gene is regulated by the same promoter or the promoter of RSV (monocystone) do.

Since the hFSH protein functions as a protein bound to alpha and beta subunits, it is effective to simultaneously express each subunit gene in a single cell. Accordingly, in one embodiment of the present invention, the hFSH gene contained in the expression vector is produced such that alpha and beta subunit genes are simultaneously expressed in an expression cassette of monocystorone to form a heterodimer. More specifically, a monocistronic expression vector capable of simultaneously expressing each hFSH subunit gene under the control of the same two promoters in the same vector is constructed by a beta The subgeneric gene may be made to contain an alpha subunit gene and a multiple polyadenylation sequence under the same CMV promoter control at the site below the beta subunit gene. Other mono-cistron expression vectors can be constructed to express beta subunit genes under the control of the CMV promoter and alpha subunit genes under the control of the RSV promoter.

In another embodiment, the polysystone vector of the present invention is characterized by simultaneously expressing hFSH-a and hFSH-beta under the control of one promoter, for example, a CMV promoter. Specifically, the polysaccharide expression vector has an internal ribosomal entry site (EMCV) of an encephalomyocarditis virus (EMCV) between the beta and alpha subunit genes so that the beta and alpha subunit genes can be expressed simultaneously under the control of the CMV promoter. IRES) gene. More preferably, an intron sequence may be included in the expression vector to stabilize the mRNA and improve the expression level. Specifically, a beta subunit containing the intron sequence (5'UTR) may be placed downstream of the CMV promoter, and the IRES gene of EMCV may be located between the beta and alpha subunit genes. The intron sequence is preferably the 5'UTR region of the hFSH beta subunit gene.

In the above method of the present invention, the alpha subunit gene preferably has the nucleotide sequence shown in SEQ ID NO: 5. The β subunit gene preferably has the nucleotide sequence shown in SEQ ID NO: 6. On the other hand, the promoter of RSV preferably has the nucleotide sequence shown in SEQ ID NO: 13.

The expression vector used in step 1) of the method of the present invention may be either pX0GC-CMV-FSH as shown in Fig. 2 or pX0GC-CMV-RSV-FSH as shown in Fig. 5 as a monocystolone vector, CMV-IR-FSH described in FIG. 4 or pX0GC-CMV-UIR-FSH described in FIG.

The animal cells used in step 1) of the method were CHO (Chinese hamster ovary) cell line, COS7 (Monkey kidney cells) cell line, NSO cell line, SP2 / 0 cell line, W138, Young hamster kidney (BHK: Baby hamster kidney cell line, MDCK, myeloma cell line, HuT 78 cell and 293 cell, and the like. Those skilled in the art will readily be able to select suitable animal cell lines applicable to amplification techniques using the DHFR of the present invention. Most preferably, a CHO cell line can be used. In the present invention, " transformation " of animal cell lines includes any method of introducing nucleic acids into organisms, cells, tissues or organs, and selecting appropriate standard techniques depending on the animal cell line used, as is known in the art can do. For mammalian cells without cell walls, the calcium phosphate precipitation method can be used (Graham et al, 1978, Virology , 52: 456-457). Specifically, in the present invention, a vector expressing a recombinant protein using lipofectamine was transferred into cells to transform CHO cells.

Step 2) of the present invention is a step of culturing the transformed animal cell line in the presence of a DHFR inhibitor. In one embodiment of the present invention, a CHO cell line is used as the animal cell line, more specifically, a CHO cell line (CHO / dhfr-) lacking DHFR is used. That is, a CHO cell line deficient in DHFR is transformed with an expression vector according to the present invention containing a gene encoding a recombinant hFSH to obtain a methotrexate (MTX) concentration of 100 nM or lower, more preferably 50 nM or lower The present invention provides an animal cell line in which a number of genes have been amplified and proved to be productive. These cell lines were named "HMFS126" and deposited with KCTC 11529BP under accession number KCTC 11529BP on July 10, 2009 at the KRC Biotechnology Center, Yuseong-gu, Daejeon, Korea, as detailed in the following examples. In addition, in the present invention, the cultivation of the animal cell line can be carried out according to a suitable culture medium and culture conditions known in the art. Such a culturing process can be easily adjusted according to the animal cell line selected by those skilled in the art.

DHFR inhibitors such as methotrexate (MTX) may be added to the recombinant animal cell culture medium. As described above, in the protein recombination method according to the preferred embodiment of the present invention, the DHFR-deleted animal cell line is transformed with the expression vector according to the present invention, DHFR inhibitor is added to amplify the recombinant gene, This is because it is an object of the present invention to efficiently implement a system that enables amplification and selection.

According to a preferred embodiment of the present invention, in the case of DHFR inhibitor, it is preferable to use the DHFR inhibitor as short as possible in consideration of the stability and economical efficiency of the cell line. That is, by using DHFR inhibitor at a low concentration, it is possible to develop a production cell line within a short time with stability in mass production. Specifically, the present invention provides a method for producing a recombinant protein using a recombinant protein expression vector transformed with a DHFR-deficient CHO cell line, and MTX at a concentration of 100 nM or less, preferably 50 nM or less.

The method for mass production of hFSH of the transformant of the present invention is characterized by inducing high expression by adding KCl. According to Fukuda K. et al., J. Ferm . Bioeng . , 1993, Vol. 76, 111-116), the addition of inorganic cations in HEL (human embryonic lung) tissue-type plasminogen activator) is increased in a concentration-dependent manner. Therefore, in the present invention, specifically, a method of increasing the production amount by adding an inorganic cation, preferably KCl, to the production medium of the transformed monoclonal hFSH production at a concentration of 100 mM or less, more preferably 40 to 70 mM .

On the other hand, the present invention provides i) a gene encoding a DHFR promoter from which a GC-rich repeated sequence has been removed and DHFR operably linked thereto; ii) the promoter of the CMV early gene and the hFSH-beta subunit gene operably linked thereto; And iii) a promoter of the CMV early gene or a promoter of RSV and a hFSH-alpha subunit gene operably linked thereto.

The present invention also relates to a method for producing a recombinant vector comprising: 1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) a human follicle stimulating hormone alpha subunit gene.

The expression vector of the present invention is intended to induce high expression in an animal cell line and may preferably further comprise an animal cell line resistance gene used as a selective marker for permanent expression in animal cells. Examples of the resistance gene for an animal cell line include a neomycin resistance gene, a myosin resistance gene, a hygromycin resistance gene, and a blasticidin resistance gene, which are resistance genes for animal cell lines used in the art, no.

In addition, the expression vector of the present invention may further include components of a general vector, such as, but not limited to, a replication origin and a multiple adenylation signal sequence and other transcription control factors.

The expression vector is preferably pX0GC-CMV-FSH as shown in Fig. 2 or pX0GC-CMV-RSV-FSH as shown in Fig. 5 as a monocystone vector, or pX0GC-CMV- FSH or pX0GC-CMV-UIR-FSH as described in FIG.

Further, the present invention provides an animal cell line transformed with the expression vector of human follicle stimulating hormone.

Hereinafter, the present invention will be described in detail by way of examples and the like, but the scope of the present invention is not limited by the above embodiments.

Example 1: Preparation of monocystone expression vector (pX0GC-CMV-FSH) for recombinant hFSH expression

<1-1> Amplification of hFSH-α subunit and -β subunit gene

For the production of recombinant hFSH expression vector, hFSH-α subunit and -β subunit were amplified by PCR method. For the amplification of hFSH-alpha subunits, the human placenta cDNA library purchased from Orville (Rockville, MD, USA) was used as a template and the forward and reverse primers of SEQ ID NOS: 1 and 2 were used, and amplification of hFSH- , The forward and reverse primers of SEQ ID NOS: 3 and 4 were used, using the human pituitary cDNA library purchased from Origene as a template.

In order to facilitate cloning, a restriction enzyme SmaI recognition site was inserted into the hFSH-α subunit forward primer, a restriction enzyme XhoI recognition site was inserted into the reverse primer, a restriction enzyme BamHI recognition site was inserted into the hFSH-β subunit forward primer , And restriction enzyme EcoRI recognition site was inserted into the reverse oligo primer. The primers are shown in Table 1.

Primers for the amplification of hFSH-alpha subunit and beta subunit primer The base sequence (5'-3 ') SEQ ID NO: hFSH-alpha subunit Forward primer
(FSHaSSSmaI) GGGCCCGGGATGGATTACTACAGAAAATAT One Reverse primer
(FSHaASXhoI) GGGCTCGAGTTAAGATTTGTGATAATAAC 2 hFSH-beta subunit Forward primer
(FSHbSSBHI) CCCGGATCCAGGATGAAGACACTCCAGTTTT 3 Reverse primer
(FSHbASERI) GGGGAATTCTTATTCTTTCATTTCACCAA 4

The cDNA library (100 ng), primers, dNTPs and pFX polymerase (Invitrogen) were added to the polymerase chain reaction tubes, denatured at 95 ° C for 1 minute, and then denatured for 30 seconds at 95 ° C, The reaction was repeated 30 times for 45 seconds, and finally the reaction was carried out at 68 DEG C for 2 minutes. The obtained PCR products were confirmed by DNA sequencing, and the α subunit and β subunit were confirmed to have the nucleotide sequences of SEQ ID NOS: 5 and 6.

<1-2> hFSH -a subunit and hFSH -β subunit expression vector ( pX0GC - FSH -α, pX0GC - FSH -β)

In order to express the amplified hFSH-α, -β subunit PCR product in Example <1-1> under the control of each promoter, it was ligated with the expression vector pX0GC vector. The pX0GC vector used herein is an expression vector comprising a base sequence encoding DHFR promoter operably linked to the base sequence of the DHFR promoter from which at least one CCGCCC repeating sequence has been deleted and a vector prepared for inducing high expression of the recombinant protein (Refer to Korean Patent No. 880509).

First, to construct hFSH-α subunit expression vector, the pX0GC vector was treated with restriction enzymes EcoRV and XhoI at the same time and electrophoresed to separate and purified. On the other hand, the hFSH-α PCR product was treated with SmaI and XhoI, and purified using a DNA purification kit. The sections were ligated together using T4 DNA ligase and designated pX0GC-FSH-alpha (FIG. 1).

In order to construct hFSH-β subunit expression vector, pX0GC vector and hFSH-β PCR product were treated with restriction enzymes EcoR I and BamH I, ligated with T4 DNA ligase, and ligated with pX0GC-FSH-β (Fig. 1). These vectors were used to prepare the monocysitol and polycistron expression vectors of the following examples for simultaneous expression of hFSH-alpha subunit and hFSH-beta subunit.

&Lt; 1-3 > Production of monocystone expression vector (pX0GC-CMV-FSH) of hFSH-α and -β

Since the hFSH protein binds to alpha and beta subunits and functions as a protein, it is effective to simultaneously express each subunit gene in a single cell. Thus, in this example, a monocistron expression vector capable of simultaneously expressing each hFSH subunit gene under the control of the same two promoters in one vector was prepared. This vector is prepared by using the pXOGC-FSH-? And pX0GC-FSH-? Of Example <1-2> as the original vector and is a vector containing the poly A sequence under the control of the promoter of the cytomegalovirus (CMV) The subunit gene is located and an alpha subunit gene containing the polyA sequence is located under the control of the same CMV promoter. The vector was prepared as follows.

The pX0GC-FSH-? was digested with restriction enzymes NruI and PVUII, and a DNA of about 1.4 kb containing the sequence of CMV promoter-hFSH-? -poly A was isolated, -α was introduced into a vector treated with restriction enzyme NruI by a blunt ligation method and named pX0GC-CMV-FSH (FIG. 2).

Example 2: Preparation of a polycistron expression vector (pX0GC-CMV-IR-FSH) for expression of recombinant hFSH

A polycistron expression vector capable of simultaneously expressing hFSH-α and hFSH-β under the control of one promoter using pXOGC-FSH-α and pX0GC-FSH-β of Example <1-2> Respectively. The vector is a vector capable of simultaneously expressing the? And? Subunit gene under the control of the CMV promoter. The vector includes an internal ribosomal entry site (IRES) gene of encephalomyocarditis virus (IRES) between the? And? Subunit gene No. 7).

PCR was carried out using a pIRES-Neo plasmid purchased from Clontech as a template and forward and reverse primers having the nucleotide sequences of SEQ ID NOS: 8 and 9 in order to obtain the IRES gene. At the end of the primer sequence, the MluI restriction enzyme recognition sequence was inserted into the forward primer and the HindIII restriction enzyme recognition sequence was inserted into the reverse primer in consideration of the sequential cloning process. The forward and reverse primers used in the PCR are shown in Table 2.

Primers for IRES amplification primer The base sequence (5'-3 ') SEQ ID NO: Forward primer
(IRESMLUSS) CGACGCGTAGCATGCATCTAGGGCGGCCAATTCCG 8 Reverse primer
(IRESH3AS) CCCAAGCTTGGGTTGTGGCAAGCTTATCATCGTG 9

Template DNA (100 ng) and primers, dNTPs and pFX polymerase (Invitrogen) were added to the PCR tubes, denatured at 95 ° C for 1 minute, and then denatured for 30 seconds at 95 ° C, 30 seconds at 60 ° C, The reaction was repeated 30 times for 45 seconds, and finally the reaction was carried out at 68 DEG C for 2 minutes. The products obtained from the PCR reaction were treated with restriction enzymes MluI and HindIII, and the pX0GC-FSH-? In which the? Subunit gene was inserted was treated with the same restriction enzyme, and the mutagenesis reaction was performed using T4 DNA ligase. The vector was named pXOGC-IR-FSH-a. Finally, in order to construct a polyclastron expression vector capable of simultaneously expressing hFSH-α and hFSH-β under the control of one promoter, pX0GC-FSH-β of Example <1-2> was digested with restriction enzymes NruI and SciI And then inserted into the NruI restriction site upstream of the IRES gene upstream of the pXOGC-IR-FSH-α, and this was named pX0GC-CMV-IR-FSH 3).

Example 3: Preparation of a polycyclone expression vector (pX0GC-CMV-UIR-FSH) for recombinant hFSH expression

Using the pXOGC-FSH-? And pX0GC-FSH-? In Example <1-2>, a polysystron expression vector capable of simultaneously expressing hFSH-alpha and hFSH-beta under the control of one promoter was prepared . This vector was designed to include the UTR region of the hFSH-beta subunit gene described in SEQ ID NO: 10 so that the beta and alpha subunit genes can be expressed simultaneously under the control of the CMV promoter so that hFSH can be more stably expressed . Locating the β subunit gene containing the intron region (5 'UTR) described in SEQ ID NO: 10 on the downstram from CMV pro and locating the IRES gene of EMCV (encephalomyocarditis virus) between the β and α subunit gene Respectively.

First, PCR was performed using a genomic DNA isolated from human blood as a template and primers having the nucleotide sequences of SEQ ID NOs: 11 and 12 in order to secure the intron region of the hFSH beta subunit gene. The forward and reverse primers used in the PCR reaction are shown in Table 3.

Primers for 5'UTR amplification primer The base sequence (5'-3 ') SEQ ID NO: Forward primer
(FSHBetaUTRBHISS) CGCGGATCCACAGCTCTTGCCAGGCAAGGCAGCCG 11 Reverse primer
(FSHBetaUTRH3AS) CCCAAGCTTCCTGGTCTGGGAAGCAAACAATGAAG 12

The PCR reaction was performed under the same conditions as described in Example <1-3> to amplify a DNA fragment corresponding to the hFSH-β 5'UTR region of about 0.9 Kb. The amplified PCR products were treated with restriction enzymes BamHI and HindIII and then treated with the same enzymes to obtain pX0GC-FSH-beta and T4 DNA ligase of Example < 1-2 > To construct pX0GC-UFSH-beta. In order to construct a policytrone expression vector capable of simultaneously expressing hFSH-alpha and hFSH-beta under the control of one promoter, including the 5'UTR region and the IRES region of the hFSH-beta subunit gene, the pX0GC-UFSH -β was digested with restriction enzymes NruI and SciI to separate only the β subunit gene including the CMV promoter and the 5 'UTR region (SEQ ID NO: 10), and then the upstream region of the IRES gene of pXOGC-IR-FSH- NruI restriction enzyme site and named it pX0GC-CMV-UIR-FSH (FIG. 4).

Example 4: Preparation of monocystone expression vector (pX0GC-CMV-RSV-FSH) for expression of recombinant hFSH

Using the pXOGC-FSH-α and pX0GC-FSH-β of Example <1-2>, a monocystorone expression vector capable of simultaneously expressing each subunit gene of hFSH under the control of different promoters in the same vector was prepared Respectively. This vector is a vector in which a subunit gene can be expressed under the control of the CMV promoter and an alpha subunit gene can be expressed under the control of the RSV promoter. As compared with the pX0GC-CMV-FSH expression vector described in Example 1-3, The RSV promoter described in SEQ ID NO: 13 is located between the alpha subunit gene.

PCR was performed using primers having the nucleotide sequences of SEQ ID NOS: 14 and 15, using the pRSV-GFP plasmid derived from the pantropic retroviral vector of clontech as a template in order to obtain the RSV promoter gene. At the end of the primer sequence, the MluI restriction enzyme recognition sequence was inserted into the forward primer and the HindIII restriction enzyme recognition sequence was inserted into the reverse primer in consideration of the sequential cloning process. The forward and reverse primers used in the PCR reaction are shown in Table 4.

Primers for RSV promoter amplification primer The base sequence (5'-3 ') SEQ ID NO: Forward primer
(RSVMLUSS) CGACGCGTATCCCCTCAGGATATAGTAGTTTCGC 14 Reverse primer
(RSVHinIIIAS) CCCAAGCTTTTGGAGGTGCACACCAATGTGGTGA 15

The template DNA (100 ng), primer, dNTP and pFX polymerase (Invitrogen) were added to the PCR tube, denatured at 95 ° C for 1 minute, and then denatured for 30 seconds at 95 ° C, 30 seconds at 60 ° C, The reaction for 30 seconds was repeated 30 times, and finally the reaction was carried out at 68 DEG C for 2 minutes. The DNA product of about 0.3 kb obtained from the PCR reaction was treated with restriction enzymes MluI and HindIII, and pX0GC-FSH-alpha and T4 DNA of Example <1-2> in which the alpha subunit gene treated with the same restriction enzyme was inserted The ligating reaction was carried out using ligase, which was named pXOGC-RSV-FSH-a. Finally, to prepare a monocystron expression vector capable of simultaneously expressing the hFSH subunit gene under the control of different promoters, pX0GC-FSH-β of Example <1-2> was treated with restriction enzymes PvuII and NruI The β-subunit gene containing the CMV promoter and the multiple adenylation sequence was isolated and inserted into the NruI restriction site upstream of the RSV promoter of pXOGC-RSV-FSH-α, which was ligated to pX0GC-CMV-RSV-FSH (Fig. 5).

Example 5: Preparation of hFSH expressing cell line (1)

<5-1> Transformation of cell line

The recombinant hFSH expression vector (pX0GC-CMV-FSH) prepared in Example 1 was transfected with a CHO cell line (CHO / dhfr-) (Urlaub et al., Somat. Cell. Mol. Genet ., 12, 555-566, 1986) to prepare a cell line capable of mass production of hFSH protein. Specifically, DG44-CHO (dhfr deficient) cells (purchased from Dr. Chasin of Columbia University) in culture are cultured in a T75 culture container, and when cells proliferate to the extent of covering 80 to 90% of the bottom of the culture container, (Gibco, Cat. No. 18324-012). In other words, insert 3 mL of Opti-MEM (Gibco, Cat. No. 51985034) into each of two tubes, add 5 μg of DNA to one tube, and 20 μL of lipofectamine After each solution was allowed to stand at room temperature for 30 minutes, the two solutions were mixed and placed in cells washed three times with Opti-MEM medium. The cells were cultured in a 5% CO ₂ incubator at 37 ° C for about 18 hours, and then washed three times with DMEM-F12 (Gibco, cat. No. 11330) containing 10% fetal bovine serum (BSA) Then, the culture medium was changed to culture medium and cultured for 48 hours. After approximately full-grown cells at the bottom of the culture vessel were obtained by trypsin treatment, 10% dialyzed fetal bovine serum and 1 mg / ml G418 (Cellgro, cat. No. (WELGENE, cat. No., LM008-02) without Hypoxanthine-Thymidine (HT-61-234 -RG) Only the transduced cells survived and colonized and cultured at 2 or 3 days intervals until the cells were proliferated.

<5-2> Confirmation of expression of hFSH by enzyme immunoassay

A part of the cells transduced in the above Example <5-1> was transferred to a 24-well plate at a concentration of 2 x 10 <^4> cells / well and cultured to cover the bottom of the culture container. 200 μL per well of CHO-A-SFM (Gibco, cat. No. 05-5072EF) supplemented with sodium butyrate (Sigma, cat. No. B5887) ₂ incubator for 48 hours. The cell culture was transferred to a 1.5-mL tube and centrifuged to collect only the supernatant and measure the expression level of hFSH. Expression levels were measured using an enzyme immunoassay kit (IBL, Cat. No. RE52121) according to the manufacturer's protocol. Specifically, the cell culture medium was first diluted with physiological saline containing 0.05% Tween-20, and added to the wells of the kit in an amount of 25 μL. The standard material of the kit was also added to the wells at the same volume, 100 μL of anti-hFSH antibody conjugated with Horse Radish Peroxidase (HRP) was added thereto, and reaction was carried out in a plate shaker at room temperature for 30 minutes. Thereafter, the substrate was washed 5 times with the washing solution, and 100 μL of the substrate solution was added thereto, followed by incubation at room temperature. After about 10 minutes, 50 μL of the reaction stop solution was added to stop the reaction, and the absorbance at 450 nm was measured. The standard curves and functions were obtained using the concentration of the standard solution provided by the kit manufacturer and the absorbance values obtained, and then the amount of hFSH was quantified using the standard curves and functions. As a result, it was confirmed that the transfected and selected cells express a certain amount of hFSH.

<5-3> Selection of hFSH Expressing Cell Lines

In order to increase the hFSH expression level of hFSH-expressing cells in Example <5-2>, cells selected by using a selection medium containing 10 nM MTX (Sigma, cat. No. M8407) The cells were subcultured in a T75 culture container every 3 days for 2 weeks. Some cells of each well were transferred to a 24-well plate in the same manner as in Example < 5-2 > At a concentration of 10 nM or more, the expression level of hFSH was not increased any more. In order to reduce heterogeneity at this stage, monoclonal screening was performed using a limiting dilution method. In other words, clones expressing uneven hFSH expression rate were subjected to limiting dilution method to isolate single cells having uniform hFSH expression and high productivity. Specifically, the cells of the wells having the highest expression level among the cells of the 6-well plate were diluted in a 96-well plate so that the cells were inoculated at a rate of not more than 1 per well. Then, plates in which only one cell was inoculated were selected, Lt; / RTI &gt; Then, the cells of the well plate that formed the colonies were separated, and the amount of expression of hFSH was measured by enzyme immunoassay (FIG. 6). A recombinant CHO cell line showing stable growth characteristics and high productivity of hFSH at 10 nM MTX among the cell lines isolated by the limiting dilution method was finally selected and named HMFS76. The final selected cell lines were adapted to suspension culture using serum-free medium (EX-CELL CHO medium, Sigma, Cat. No. 14360C, USA).

Example 6: Preparation of hSH expressing cell line (2)

<6-1> Transformation of cell line

The pX0GC-CMV-RSV-FSH vector prepared in Example 4 was cultured in the same manner as in Example 5 to prepare a cell line capable of expressing a larger amount of hFSH than the hFSH expressing cell line selected in Example 5, The cell line was transfected. Using MEM-a medium without HT supplement containing G418 to screen only the transduced cells, only transduced cells survive and colonize and replicate every 2 or 3 days until they proliferate Lt; / RTI &gt;

<6-2> Selection of hFSH Highly Expressing Cell Lines

In order to increase the hFSH expression level of the cells transfected and survived in the above Example <6-1>, selected cells were cultured in T75 culture medium using 10 nM MTX (Sigma, Cat No. M8407) The cells were transferred from the vessel to five 6-well plates and subcultured every 3 days for 2 weeks. Some cells of each well were transferred to a 24-well plate in the same manner as in Example < 5-2 > And the amount of expression was measured. In the same manner, the MTX concentration was sequentially increased from 15 nM to 40 nM every 2 weeks. When the transfected cells were cultured, the expression level of hFSH was measured and the expression level was increased (FIG. 7). At a concentration of 40 nM or more, the expression level of hFSH was no longer increased, and single clones were selected by limiting dilution as in Example <5-3>. The expression level of hFSH was measured by enzyme immunoassay (FIG. 8). Single cells expressing hFSH were isolated, and a recombinant CHO cell line highly expressing hFSH and stable growth characteristics at 40 nM MTX was finally selected to obtain HMFS126 (Accession No. KCTC 11529BP). The hFSH expressing cell line showed about 10-fold increase in the expression level compared to the HMFS76 cell line prepared in Example <5-3>. The final selected cell line was adapted to suspension culture using serum-free medium.

Example  7: Growth of cell line upon addition of potassium chloride in medium hFSH  Measurement of production (1)

&Lt; 7-1 > Cultivation

One vial (1 × 10 ⁷ cells / ml) of hFSH expressing cell line (HMFS76), which was adapted to the floating culture after being selected in Example <5-3> and stored in a liquid nitrogen tank, was taken out and dissolved as rapidly as possible in a constant temperature water bath at 37 ° C. , Washed once with EX-CELL CHO medium (Sigma, cat. No. 14360C) supplemented with 40 nM MTX and 0.5 g / L dextran-sulfate, and incubated at 90 x g for 5 The cells were inoculated in a Erlenmeyer flask (Corning cat # 431144, USA) containing 50 mL of the seed culture medium and cultured in a CO ₂ incubator (37 ° C., 5% CO ₂ ) at a cell concentration of 10 × 10 ⁵ The cells were cultured for 2 to 4 days until they became cells / ml, and then centrifuged in the same manner as above, and subcultured in a fresh Erlenmeyer flask containing 100 mL of fresh seed culture medium. And the culture volume was increased by 2 times until the cells were subcultured.

<7-2> Growth of cell line upon addition of potassium chloride and hFSH The production of

In order to examine the effect of addition of potassium chloride (KCl) in the medium on the production of hFSH, 4.2 x 10 ⁵ cells / ml of the recombinant CHO cell line in culture was inoculated into 5 Erlenmeyer flasks in a volume of 50 ml. At this time, the concentrations of KCl were added to the culture medium to 10, 40, 70 and 100 mM, respectively, and the flask containing no KCl was set as a control. Two days after the start of the culture, the culture temperature was lowered from 37 ° C to 30.5 ° C for the production of hFSH and incubated for 4 days with 2 mM sodium butyrate (cat. No. B5887, Sigma, USA). As shown in FIG. 9, when the KCl was added to the culture medium, the cell number and survival rate decreased depending on the concentration of KCl. Especially, when 100 mM KCl was added, The cell survival rate was drastically decreased.

On the other hand, the culture supernatant was recovered through centrifugation on the fourth day of culture, and then the amount of hFSH expressed in each culture supernatant was measured using enzyme immunoassay as in Example < 5-3 >. The measured values were calculated as the production amount (%) relative to the control group and are shown in Table 5 below.

Production of hFSH according to KCl addition concentration (%) Addition concentration of KCl (mM) FSH  Production (% of control) 0 100.0 10 103.0 40 114.6 70 141.9 100 73.1

As can be seen from Table 5, hFSH production was increased with increasing KCl concentration, and hFSH production was significantly increased with addition of 40 mM or more.

<7-3> KCl The growth of cell lines and hFSH The production of

In order to examine the cell line growth and hFSH production depending on the addition concentration and addition timing of KCl, 40 mM and 70 mM KCl showing significant hFSH production increase in Table 5 were added to the growth and production stages of the cell line, respectively The experiment was carried out. Prior to addition, some of the cells were cultured in a culture medium supplemented with 40 mM KCl and adapted to a high concentration of KCl. Specific experimental conditions are shown in Table 6. That is, 40 mM or 70 mM KCl was added stepwise to KCl-adapted or non-adapted cell lines to compare cell concentration, survival rate and hFSH production.

Experimental conditions of experimental group and control group group KCl adaptation KCl concentration Addition step Experiment 1 X 40 mM Production stage Experiment 2 O 40 mM Production stage Experiment group 3 X 40 mM Growth stage Experiment group 4 O 40 mM Growth stage Experiment group 5 O 70 mM Growth stage Control group X X -

As shown in FIG. 10, the cell concentration and survival rate of the experimental group 5 in which the KCl concentration was 70 mM were very low. When KCl was added from the production stage (experimental group 1 and experimental group 2) The cell concentration was higher compared to the case of addition (experimental groups 3 and 4).

On the other hand, as shown in Table 7 below, the yield of hFSH was the highest when 40 mM KCl was added from the production stage (experimental groups 1 and 2), and when the cell line was pre- Similar degree.

Production rate of experimental group (%) group hFSH production (% of control) Experiment 1 156.2 Experiment 2 159.9 Experiment group 3 119.4 Experiment group 4 116.1 Experiment group 5 56.2 Control group 100.0

Example  8: Growth of cell line upon addition of potassium chloride in medium hFSH  Measuring of yield (2)

The cell line growth and hFSH production by KCl addition were measured in the same manner as in Example 7 with respect to the hFSH expressing cell line (HMFS126) selected in Example <6-2>.

One vial (1 × 10 ⁷ cells / ml) of hFSH expressing cell line (HMFS126) stored in a liquid nitrogen tank adapted to the floating culture after selection in Example <6-2> was taken out and collected as in Example <7-1> Method, and a sufficient number of cells were obtained. Cells were prepared at a concentration of about 4.2 × 10 ⁵ cells / ml and inoculated into two Erlenmeyer flasks at a culture volume of 50 mL. The culture temperature was lowered to 30.5 ° C. and 1.5 mM sodium butyrate was added thereto. Culturing for expression was performed. At this time, KCl was added to 40 mM only in one flask, and the expression level was compared with the case where KCl was not added.

The measurement results are shown in Table 8 below.

Production of hFSH by addition of KCl group Production (% of control) Control group 100.0 Experimental group (40 mM KCl added) 127.4

As a result, the number of cells and the survival rate were maintained to be slightly higher than that of the case without addition of KCl, but the amount of hFSH production increased by about 30% when KCl was added, and the expression amount of hFSH was also increased by the addition of KCl I could confirm. In this experiment, the cells in culture were collected to a certain number, and cultured from the production stage immediately without cell growth stage to produce hFSH.

Korea Biotechnology Research Institute KCTC11529 20090710

<110> HANMI PHARM. CO., LTD <120> METHOD FOR MASS PRODUCTION OF HUMAN FOLLICLE STIMULATING HORMONE <130> FPD / 201001-0039 <160> 15 <170> Kopatentin 1.71 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of hFSH-alpha subunit <400> 1 gggcccggga tggattacta cagaaaatat 30 <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of hFSH-alpha subunit <400> 2 gggctcgagt taagatttgt gataataac 29 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of hFSH-beta subunit <400> 3 cccggatcca ggatgaagac actccagttt t 31 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of hFSH-beta subunit <400> 4 ggggaattct tattctttca tttcaccaa 29 <210> 5 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> hFSH-alpha subunit <400> 5 atggattact acagaaaata tgcagctatc tttctggtca cattgtcggt gtttctgcat 60 gttctccatt ccgctcctga tgtgcaggat tgcccagaat gcacgctaca ggaaaaccca 120 ttcttctccc agccgggtgc cccaatactt cagtgcatgg gctgctgctt ctctagagca 180 tatcccactc cactaaggtc caagaagacg atgttggtcc aaaagaacgt cacctcagag 240 tccacttgct gtgtagctaa atcatataac agggtcacag taatgggggg tttcaaagtg 300 gagaaccaca cggcgtgcca ctgcagtact tgttattatc acaaatctta a 351 <210> 6 <211> 390 <212> DNA <213> Artificial Sequence <220> <223> hFSH-beta subunit <400> 6 atgaagacac tccagttttt cttccttttc tgttgctgga aagcaatctg ctgcaatagc 60 tgtgagctga ccaacatcac cattgcaata gagaaagaag aatgtcgttt ctgcataagc 120 atcaacacca cttggtgtgc tggctactgc tacaccaggg atctggtgta taaggaccca 180 gccaggccca aaatccagaa aacatgtacc ttcaaggaac tggtatacga aacagtgaga 240 gtgcccggct gtgctcacca tgcagattcc ttgtatacat acccagtggc cacccagtgt 300 cactgtggca agtgtgacag cgacagcact gattgtactg tgcgaggcct ggggcccagc 360 tactgctcct ttggtgaaat gaaagaataa 390 <210> 7 <211> 595 <212> DNA <213> Encephalomyocarditis virus <220> <221> gene &Lt; 222 > (1) .. (595) <223> Internal ribosomal entry site <400> 7 cgcccctctc cccccccccc ctctccctcc ccccccccta acgttactgg ccgaagccgc 60 ttggaataag gccggtgtgc gtttgtctat atgttatttt ccaccatatt gccgtctttt 120 ggcaatgtga gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt 180 tcccctctcg ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg 240 gaagcttctt gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca 300 cctggcgaca ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg 360 gcacaacccc agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc 420 tcaagcgtat tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggatct 480 gatctggggc ctcggtgcac atgctttaca tgtgtttagt cgaggttaaa aaaacgtcta 540 ggccccccga accacgggga cgtggttttc ctttgaaaaa cacgatgata agctt 595 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of IRES <400> 8 cgacgcgtag catgcatcta gggcggccaa ttccg 35 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of IRES <400> 9 cccaagcttg ggttgtggca agcttatcat cgtg 34 <210> 10 <211> 887 <212> DNA <213> Artificial Sequence <220> <223> hFSH-beta 5'UTR <400> 10 acagctcttg ccaggcaagg cagccgacca caggtgagtc ttggcatcta ccgttttcaa 60 gtggtgacag ctacttttga aattacagat ttgtcaggac atggaggaca aaactagagc 120 ttctcactac tgttgtgtag gaaatttatg cttgtcaacc tggcttgtaa aatatggtta 180 atataacgta atcactgtta gcaagtaact gactttatag accaatatgc ctctcttctg 240 aaatggtctt attttaaaca aatgtgagca aaagaaaata tttatgagat tctaaaaatg 300 aagacataat tttgtagtat agaattttct tggccaggaa tggtggctca tgcttgtaat 360 cccagcactt tgggaggcca aggtcagagg attgcttgag cctggaaggt tgaagatgca 420 gtgattcatg attataccac tgcactccag cctgggcaac agagcaagac cctgtctcaa 480 gaaaagaaaa gaattttatt tttcttttca gacaaaaata gactttaaaa taataatgga 540 agaacaaata tgatgatcac aattatcaga gtaattactt tatgacagtc agcaataaga 600 ttctaatctt taaatattcc tctgcttaaa tcattatatt ggagttttga tctataatat 660 attcccaccc tgacccaaaa attgaagaag gacaaggaaa aatgttgttc caagaaacaa 720 agatgtaagt aaaaaggcat aaggaaggaa aaaaaacttt tgaagcaaaa tgtgattgag 780 gaggatgagc agaccaatta tttttggttt ggtcagctta cataatgatt atcgttcttt 840 ggtttctcag tttctagtgg gcttcattgt ttgcttccca gaccagg 887 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of hFSH-beta 5'UTR <400> 11 cgcggatcca cagctcttgc caggcaaggc agccg 35 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of hFSH-beta 5'UTR <400> 12 cccaagcttc ctggtctggg aagcaaacaa tgaag 35 <210> 13 <211> 312 <212> DNA <213> Rous sarcoma virus <220> <221> promoter &Lt; 222 > (1) <223> RSV promoter <400> 13 atcccctcag gatatagtag tttcgctttt gcatagggag ggggaaatgt agtcttatgc 60 aatactcttg tagtcttgca acatggtaac gatgagttag caacatgcct tacaaggaga 120 gaaaaagcac cgtgcatgcc gattggtgga agtaaggtgg tacgatcgtg ccttattagg 180 aaggcaacag acgggtctga catggattgg acgaaccact gaattccgca ttgcagagat 240 attgtattta agtgcctagc tcgatacagc aaacgccatt tgaccattca ccacattggt 300 gtgcacctcc aa 312 <210> 14 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for amplification of RSV promoter <400> 14 cgacgcgtat cccctcagga tatagtagtt tcgc 34 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for amplification of RSV promoter <400> 15 cccaagcttt tggaggtgca caccaatgtg gtga 34

Claims (21)

1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; And iii) transforming an animal cell line with an expression vector comprising a promoter of CMV early gene or a promoter of Rous sarcoma virus (RSV) and a human follicle stimulating hormone alpha subunit gene operably linked thereto; And
2) culturing the transformed animal cell line in the presence of DHFR inhibitor in a medium supplemented with 10 to 100 mM potassium chloride.
1) i) a gene encoding a dehydrofolate reductase (DHFR) promoter from which a GC-rich repetitive sequence has been removed and DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) transforming an animal cell line with an expression vector comprising a human follicle stimulating hormone alpha subunit gene; And
2) culturing the transformed animal cell line in the presence of DHFR inhibitor in a medium supplemented with 10 to 100 mM potassium chloride.
3. The method according to claim 1 or 2,
Wherein said GC-rich repeat sequence consists of the nucleotide sequence of CCGCCC.
3. The method according to claim 1 or 2,
Wherein said alpha subunit gene is composed of the nucleotide sequence shown in SEQ ID NO: 5. 5. A method for mass production of human FSH,
3. The method according to claim 1 or 2,
Wherein the beta subunit gene is composed of the nucleotide sequence of SEQ ID NO: 6.
The method according to claim 1,
Characterized in that the promoter of said Rous sarcoma virus is composed of the nucleotide sequence shown in SEQ ID NO: &lt; RTI ID = 0.0 &gt; 13. &lt; / RTI &gt;
The method according to claim 1,
Wherein the expression vector is pX0GC-CMV-FSH as shown in Fig. 2 or pX0GC-CMV-RSV-FSH as shown in Fig. 5 as a method for mass production of human follicle stimulating hormone.
3. The method of claim 2,
Wherein the expression vector is pX0GC-CMV-IR-FSH as described in Fig. 3.
3. The method according to claim 1 or 2,
The animal cell line of the above step 1) is selected from the group consisting of CHO (Chinese hamster ovary) cell line, COS7 (Monkey kidney cells) cell line, NSO cell line, SP2 / 0 cell line, W138, baby hamster kidney (BHK) , MDCK, a myeloma cell line, a HuT 78 cell, and a 293 cell.
The method according to claim 1,
Wherein the transformed animal cell line of step 2) is a recombinant CHO cell line HMFS126 (accession number: KCTC 11529BP).
delete 3. The method according to claim 1 or 2,
Wherein the transformed animal cell line is cultured in a medium supplemented with 40 to 70 mM potassium chloride, and a method for mass production of human follicle stimulating hormone.
i) a gene encoding a dehydrofolate reductase (DHFR) promoter having a GC-rich repeat sequence removed and a DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; And iii) a promoter of the CMV early gene or promoter of Rous sarcoma virus (RSV) and a human follicle stimulating hormone alpha subunit gene operably linked thereto,
Wherein the expression vector is pX0GC-CMV-FSH as shown in Fig. 2 or pX0GC-CMV-RSV-FSH as shown in Fig.
delete i) a gene encoding a dehydrofolate reductase (DHFR) promoter having a GC-rich repeat sequence removed and a DHFR operably linked thereto; ii) a promoter of the cytomegalovirus (CMV) early gene and a human follicle stimulating hormone beta subunit gene operably linked thereto; iii) internal ribosome entry site (IRES) gene; And iv) an expression vector for a human follicle stimulating hormone, which comprises a human follicle stimulating hormone alpha subunit gene,
Wherein the expression vector is pX0GC-CMV-IR-FSH described in Fig. 3.
delete An animal cell line transformed with an expression vector of human follicle stimulating hormone of claim 13 or 15,
Wherein the animal cell line is a CHO (Chinese hamster ovary) cell line.
3. The method of claim 2,
Wherein the expression vector further comprises an intron sequence (5 'UTR) between the promoter of the cytomegalovirus (CMV) early gene and the human FSH beta subunit gene.
19. The method of claim 18,
Wherein the expression vector is pXOGC-CMV-UIR-FSH as shown in Fig. 4.
16. The method of claim 15,
Wherein the expression vector further comprises an intron sequence (5 ' UTR) between the promoter of the cytomegalovirus (CMV) early gene and the human follicle stimulating hormone beta subunit gene.
21. The method of claim 20,
Wherein the expression vector is the pXOGC-CMV-UIR-FSH shown in Fig. 4.

Images