KR101671114B1 - Nuclear localization signal peptide derived from ULK2 and uses thereof - Google Patents

Abstract

The present invention relates to a novel nuclear localization signal peptide and its use, wherein the nuclear localization signal of the present invention is an uncoordinated 51-kDa protein, which plays an important role in the autophagy control of animal cells. like kinase 2). The NLS peptide of the present invention was found to bind ULK2 to Kapβ2 and to position it in the nucleus. Therefore, the peptide of the present invention can be used not only to induce intracellular movement of a protein expressed in the cytoplasm, but also to control its function, and also to be useful for expressing an anti-cancer peptide or protein.

Description

Nuclear localization signal peptides derived from ULK2 and uses thereof Nuclear localization signal peptides derived from ULK2 and uses thereof [

The present invention relates to a novel nuclear localization signal peptide and its use, wherein the nuclear localization signal of the present invention is an uncoordinated 51-kDa protein, which plays an important role in the autophagy control of animal cells. like kinase 2).

ULK2 (uncoordinated 51-like kinase 2) is a member of the serine / threonine kinase protein family and plays an important role in controlling autophagy of animal cells [Yan J, et al . (1999) Mouse ULK2, a novel member of the UNC-51-like protein kinases: unique features of functional domains. Oncogene 18: 5850-5859]. ULK2 is localized in many places similar to ULK1, and appears to function redundantly with ULK1 [Zhou X, et al. (2007) Unc-51-like kinase 1/2-mediated endocytic processes regulate filopodia extension and branching of sensory axons. Proc Natl Acad Sci U SE 104: 5842-5847]. ULK2 is involved in many basic biological functions, including cell fate determination, metabolism, transcriptional regulation, and tumorigenesis, and rarely has enzymes that exert a broad influence on cell function regulation as ULK2 [Mizushima N. (2010) The role of the Atg1 / ULK1 complex in autophagy regulation. Curr Opin Cell Biol 22: 132-139]. Similar to other ULK family members, ULK2 also plays an important role in the signaling pathway of self-digestion [Alers S, et al. (2012) The incredible ULKs. Cell Commun Signal 10: 7]. Recent studies have shown that the activity of ULK2 is carefully regulated by mechanisms individually tailored to each substrate to avoid indiscriminate phosphorylation of ULK1 [Lee EJ, Tournier C (2011). The requirement of uncoordinated 51 -like kinase 1 (ULK1) and ULK2 in the regulation of autophagy. Autophagy 7: 689-695]. On the other hand, considering the importance of homeostasis of normal cells and the importance of self-extinguishing action in various diseases, studies on the mechanism of auto-digestion can be a useful approach for developing new therapeutic agents [Pyo JO, Nah J, Jung YK (2012) Molecules and their functions in autophagy. Exp Mol Med 44: 73-80].

Although the mechanism of regulation of ULK2 in auto-digestion has not yet been fully elucidated, it appears that very precise regulation occurs through a combination of phosphorylation, localization and interaction with ULK2 binding proteins [McAlpine F, et al. (2013) Regulation of nutrientsensitive autophagy by uncoordinated 51-like kinases 1 and 2. Autophagy 9: 361-373]. Unlike ULK1, which is found predominantly in the cytoplasm, ULK2 is mainly located in the nucleus, but the mechanism by which ULK2 is still located in the nucleus is not known. The localization of ULK2 appears to be regulated indirectly by binding to the binding protein and it appears that the binding protein controls ULK2 cellular localization by preventing ULK2 from going out of the nucleus.

Family of shuttling transport factors recognize nuclear localization sequence (NLS) or nuclear export sequence (NES) -containing proteins and regulate trafficking between nuclei and cytoplasm [Suel KE, et al. (2008) Modular organization and combinatorial energetics of proline-tyrosine nuclear localization signals. PLoS Biol 6: e137]. Kapβ2 (importin 2) is known as an import receptor for nuclear infiltration that directly recognizes the PY-NLS sequence and is involved in the import of PY-NLS-containing proteins [Lee BJ, et al. (2006) Rules for nuclear localization sequence recognition by karyopherin beta 2. Cell 126: 543-558 and Lange A, et al. (2008) A PY-NLS nuclear targeting signal is required for nuclear localization and function of the Saccharomyces cerevisiae mRNA-binding protein Hrp1. J Biol Chem 283: 12926-12934]. The localization of the PY-NLS-containing protein to the nucleus is mediated by their N-terminal and binding partner, Ran-GTP, and the other kappa2 sequence is the binding site of the PY-NLS motif- docking sites have been proposed [Lange A, et al. (2008) A PY-NLS nuclear targeting signal is required for nuclear localization and function of the Saccharomyces cerevisiae mRNA-binding protein Hrp1. J Biol Chem 283: 12926-12934]. PY-NLS is a relatively small, well-defined NLS with enriched binding energy. According to the structure and biochemical studies of Kapp2, the PY-NLS motif of its substrate proteins includes N-terminal hydrophobic or basic motifs recognized by Kapp2 and C-terminal (R / K / H) X25PY motifs [Shin SH, et al. (2012) The nuclear localization of glycogen synthase kinase 3beta is required for its putative PY-nuclear localization sequences. Mol Cells 34: 375-382].

The present inventors discovered a specific amino acid sequence that regulates the migration of ULK2 into eukaryotic nuclei in the course of identifying the mechanism of regulation of the ULK2 distribution in the cell, and named it as the PY-NLS motif of ULK2, And confirming that the movement of the protein to the cell nucleus is regulated depending on the presence or absence of the motif, thereby completing the present invention.

US Published Patent 2011-0268722A1

It is an object of the present invention to provide a novel nuclear localization signal peptide derived from the Uncoordinated 51-like kinase 2 (ULK2) protein.

Another object of the present invention is to provide a nucleic acid molecule encoding the nuclear localization signal peptide, a vector comprising the same, and a cell transformed therewith.

Another object of the present invention is to provide a nuclear transfer carrier using the nuclear localization signal peptide and a nuclear transfer method of the carrier using the nuclear localization signal peptide.

In order to achieve the above object, the present invention provides a nuclear localization signal peptide comprising the amino acid sequence of SEQ ID NO: 2 (gpgfgssppgaeaapslRyvPY).

In one embodiment of the present invention, the Nucleic Localization Signal (NLS) peptide comprises a sequence related to NLS function as a minimum sequence and may further include another sequence. As used herein, the term " nuclear localization signal (NLS) "refers to an amino acid sequence that serves to carry a specific substance, such as a protein or nucleic acid, into the cell nucleus. Can be prepared by a method commonly used in the field.

In one embodiment of the invention, the nuclear localization signal peptide is derived from the S / P space domain of the ULK2 protein (see Figure 1A).

In one embodiment of the present invention, the nuclear localization signal peptide may comprise the amino acid sequence 774 to 795 of the amino acid sequence of the ULK2 protein represented by the amino acid sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the nuclear localization signal peptide may interact with Kap beta 2.

The present invention also provides a nucleic acid molecule encoding said nuclear localization signal peptide.

In one embodiment of the present invention, the nucleic acid molecule may be composed of the nucleotide sequence of SEQ ID NO: 3, but is not limited thereto.

The present invention also provides a vector comprising the nucleic acid molecule.

As used herein, the term "vector" refers to a nucleic acid molecule that is a means of delivery for transferring an outer genetic material to another cell, such as a plasmid vector, a bacteriophage vector, a cosmid vector, Vectors, and the like, but are not limited thereto. The vector of the present invention can be generally constructed as a vector for cloning or a vector for expression, and can be constructed as a host of prokaryotic or eukaryotic cells. The vector of the present invention can be produced using any known method suitable for the desired purpose and the type of the host cell. For example, vectors capable of being used in the present invention can be produced by manipulating plasmids, phage or viruses, etc., which are commonly used in the art to which the present invention belongs. When the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from a genome of a mammalian cell or a mammalian virus-derived promoter may be used. In addition, the vector of the present invention may comprise a selection marker.

The present invention also provides a cell transformed with the vector of the present invention.

As used herein, the term "transformation" refers to altering the genetic properties of an organism by introducing an external genetic material. Transformation is possible not only for bacteria such as Escherichia coli but also for plants and animal cells. Examples of well-known bacterial host cells include Escherichia coli and Bacillus sp., And eukaryotic cells include Saccharomyce cerevisiae, insect cells, human CHO cell line, HEK293 cell, HMDCK cell line and the like . The transforming method may be a method known in the art to which the present invention belongs. For example, when the host cell is a prokaryotic cell, the CaCl2 method [Cohen, S.N. et al., (1973) Proc. Natl. Acac. Sci. USA, 9: 2110-2114], electroporation [Dower, W.J. et al., (1988) Nucleic. Acids Res., 16: 6127-6145]. In the case of eukaryotic cells, microinjection [Capecchi, M.R., (1980) Cell, 22: 479], calcium phosphate precipitation method [Graham, F.L. et al., (1973) Virology, 52: 456], electroporation [Neumann, E. et al., (1982) EMBO J., 1: 841], but are not limited thereto.

The present invention also provides an intranuclear delivery vehicle comprising said nuclear localization signal peptide of the invention and a delivery material associated therewith.

The carrier material includes, but is not limited to, a compound (drug, marker, small molecule, nanoparticle, etc.), polypeptide, protein, nucleic acid or virus that can bind to the NLS peptide of the present invention and be transported into the nucleus. Examples of the polypeptide include an anti-apoptotic protein, an antibody, a cancer-related protein, a cell cycle regulating protein or an enzyme. Examples of the nucleic acid include, but are not limited to, RNA, DNA or cDNA. Examples of the compound include anticancer agents, anti-angiogenesis inhibitors, immunosuppressive agents, anti-inflammatory agents, analgesics, anti-arthritic agents, antipsychotics, nerve stabilizers, antiviral agents, antibiotics, analgesics, antihistamines, hormones, antihypertensive agents, A therapeutic agent for disease, a contrast agent for generating a detectable signal, a radioactive isotope, a fluorescent substance, and a magnetic particle, but the present invention is not limited thereto. The binding of the carrier material may be accomplished by conventional methods of the present invention, for example, covalently attached to the N-terminal or C-terminal of the NLS peptide of the present invention.

In one embodiment of the present invention, the intracellular carrier may further comprise a regulatory region comprising the 1027th serine residue (Ser1027) in the amino acid sequence of SEQ ID NO: 1.

In one embodiment of the present invention, the regulatory region may be one that modulates nuclear localization of the carrier by phosphorylation by protein kinase A (PKA). In accordance with one embodiment of the present invention, phosphorylation of ULK2 Ser1027 residues by protein kinase A (PKA) promotes localization of ULK2 into the nucleus (see FIG. 6-10) It may be a specific regulatory region for internalization.

The present invention also provides a method for delivering a desired transport material into the nucleus of a subject cell using the intracellular carrier. In one embodiment of the present invention, the delivery method comprises the steps of: preparing an intracranular carrier of the present invention comprising a carrier material; And contacting the intracellular carrier with a cell.

The NLS peptide of the present invention was found to bind ULK2 to Kapβ2 and to position it in the nucleus. Therefore, the peptide of the present invention can be used not only to induce intracellular movement of a protein expressed in the cytoplasm, but also to control its function, and also to be useful for expressing an anti-cancer peptide or protein.

Figure 1 shows the results of experiments showing the interaction between the PY-NLS motif (NLS peptide of the present invention) of ULK2 according to the present invention and Kapp2 and the intracellularization of ULK2 and Kapp2.
Figure 2 shows the results of experiments showing that the NLS peptide of the present invention is required for the interaction between ULK2 and Kapp2.
Figure 3 is an experimental result showing intracellular localization of an exogenous ULK2 PY mutation according to an embodiment of the present invention.
Figure 4 is an experimental result showing the self-extinguishing ability of ULK2 wild type and mutants according to one embodiment of the present invention.
FIG. 5 shows experimental results comparing the serine phosphorylation status of ULK2 wild type and mutants according to an embodiment of the present invention.
FIGS. 6 to 10 are the results of experiments on the intracellular localization and self-extinguishing ability of ULK2 Ser1027 mutants according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It will be apparent to those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited to these embodiments.

≪ Example 1 >

Materials and Methods

<1-1> Reagent

A protease inhibitor cocktail in the form of a tablet was purchased from Roche Molecular Biochemicals. Monoclonal and polyclonal antibodies to Kapβ2, ULK1, ULK2, LC3-II, Atg13, FIP200, WIPI, and phosphor Ser were purchased from Abcam (UK) or Cell Signaling (Boston, MA, USA).

<1-2> Cell culture and transfection

HEK293 cells were cultured in DMEM medium supplemented with 10% (v / v) heat-inactivated FBS (fetal bovine serum) and 1000 U penicillin-streptomycin (Gibco BRL). HEK293 cells were maintained in DMEM medium supplemented with 10% (v / v) FBS and antibiotics. Transfection was performed using lipofectamine and Plus reagent (Invitrogen) according to the manufacturer's instructions.

<1-3> Production of plasmid

The human ULK2 cDNA was obtained from the Korean Human Gene Bank (Gene ID; KIAA0623) and then cloned into the pEGFP C2 vector (Clontech, Palo Alto, CA, USA; EGFP was added at the C-terminus of ULK2). The primers used for cloning are as follows.

- Forward: 5'-CTCAAGCTTCGAATTCATGGAGGTGGTGGGTGAC-3 '(SEQ ID NO: 4),

- Reverse: 5'-CATAGCACCGCAACCGTGTGAGAATTCTGCAGTCGAC-3 '(SEQ ID NO: 5).

In order to produce kappa2 (karyopherin beta 2) -binding motif mutations, site-directed mutagenesis was performed in ULK2 using the following primers:

- Forward: 5'-CCC AGA GAA ACA TCA GCT TAT TTG GCT AAT CTC-3 '(SEQ ID NO: 6),

- Reverse: 5'-ATT AGC CAA ATA AGC TGA TGT TTC TCT GGG AAT-3 '(SEQ ID NO: 7); And

- Forward: 5'-AGC CTG AGA TAC GCT TAC GGT TGT TCT TGT-3 '(SEQ ID NO: 8),

- Reverse: 5'-TGA AGC ACC GTA AGC CAC GTA TCT CAG GCT GGG-3 '(SEQ ID NO: 9).

Directed mutagenesis was performed in ULK2 using the QuikChange Multi Mutagenesis Kit (Stratagene, West Cedar, TX, USA) according to the manufacturer's instructions for the production of the S1027A and S1027D mutants. The primers used were as follows.

-Forward: 5'-ATT GAG AGA AGA CTG GCG GCG CTC TGC CAT AGC-3 '(SEQ ID NO: 10),

- Reverse: 5'-ATG GCA GAG CGC CGC CAG TCT TCT CTC AAT ACT-3 '(SEQ ID NO: 11); And

- Forward: 5'-ATT GAG AGA AGA CTG GAC GCG CTC TGC CAT AGC-3 '(SEQ ID NO: 12),

- Reverse: 5'-ATG GCA GAG CGC GTC CAG TCT TCT CTC AAT ACT-3 '(SEQ ID NO: 13).

GST-ULK2 WT (SEQ ID NO: 2), which contains a potential kappa2 binding motif (220qdlrmfyeKnRslmpSipRetsPY243: SEQ ID NO: 14) in the protein kinase domain or a potential kappa2 binding motif (774gpGfgssppgaeaapslRyvPY795: SEQ ID NO: 2) in the S / P space domain 1-600 aa) or (601-1036 aa) were prepared using the following primers, respectively.

- Forward: 5'- GGTTAA C CCGGG A ATG GAG GTG GTG GGT GAC GAC TTC-3 '(SEQ ID NO: 15),

- Reverse: 5'-G GTT CTC GAG AGA GAT AAT GAT TGT TGG CAA AGG 3 '(SEQ ID NO: 16); And

- Forward: 5'- GGTTAA C CCG GG AATGCCT ACT AAGACCACAGCT 3 '(SEQ ID NO: 17),

- Reverse 5'-GGTT CTC GAG TCACACGGTTGCGGTGCTATGGCA 3 '(SEQ ID NO: 18)

The PCR product was digested with SmaI and XhoI and cloned into pGEX-5X-1 vector. All GST-ULK2 constructs were identified by DNA sequencing. GST-labeled recombinant ULK2 or Kap? 2 proteins expressed in Escherichia coli BL21 (DE3) cells were purified using glutathione-agarose beads (Amersham Biosciences, CA, USA) according to the manufacturer's instructions. Purified proteins were used for pull-down assays.

<1-4> Immunoprecipitation

Cells were analyzed 48 hours after transfection. Cells were rinsed with ice-cold PBS (phosphate-buffered saline) and resuspended in 1 ml extraction buffer [10 mM Tris-HCl pH 7.4, 1 mM EDTA, 5 mM DTT, 100 mM NaCl, 1.0% Triton X- 100 μM molybdate, 20 mM sodium fluoride and protease inhibitor cocktail (one tablet per 10 ml extraction buffer)]. The pre-cleaned lysates were incubated with the appropriate antibodies for 1 h at 4 ° C and incubated with protein A-Sepharose beads (Pharmacia Co., NJ, USA) The resulting immune complexes were collected. The immune complexes were then centrifuged, captured, washed extensively in lysis buffer, and lysed in 2x sample buffer prior to loading onto 10% SDS-PAGE gel.

<1-5> ULK2  or Cap β2 pull-down assay ( pull - down assay )

All cell lysates of HEK293 cells transiently expressing ULK2 were pre-washed with glutathione agarose beads and 1 μg each of glutathione agarose-labeled recombinant ULK2 or Kapβ2 preparations were added to separate the samples, ULK2 and Kapβ2 were combined by incubation at 4 ° C for 2 hours with end-over-end rotation. The bound protein complexes were collected using a glutathione agarose bead slurry and washed extensively. After resuspension in 2x Laemmli sample buffer, samples were analyzed on 10% SDS-PAGE gel and Western blotting analysis was performed using Kapβ2 or ULK2 antibodies.

<1-6> Immunoblotting ( Immunoblotting )

ULK2 (or Kapβ2), pulled-down or immunoprecipitated, was dissolved in a 10% SDS-PAGE gel and transferred to the nitrocellulose membrane. Membranes were cultured in blocking buffer (5% dry skim milk in PBS and 0.05% Tween-20) and detected with secondary antibodies specific to the antibody and subsequently horseradish peroxidase-conjugated. Immunoconjugates were detected using a commercial Western blotting detection system (Pierce, Rockford, IL, USA).

<1-7> Confocal  Microscopic observation

In 60% confluence, HEK293 cells were inoculated on culture slides (SPL, Korea) coated with human fibronectin in an over night. The next day, cells were transfected with ULK2 / EGFP constructs and allowed to grow for an additional 48 hours. Cells were washed several times with ice-cold PBS and fixed in 2% paraformaldehyde for 10 minutes. Immobilized cells were permeabilized with 0.1% Triton X-100 for 10 minutes and blocked for 2 hours in PBS containing 5% BSA (Aurion, The Netherlands) and 0.1% Tween. (1: 100), ULK2 (1: 100), LC3 II (1: 100) or WIPI (1: 100) (in 5% BSA-PBS; Bio-Protocol, Palo Alto, Calif. After overnight incubation at 4 ° C with cholin (rabbit) or monoclonal (mouse) antibodies, slides were washed three times with 0.01% PBS-Tween. Alexa Fluor 568 or 488-conjugated donkey anti-rabbit (1: 200) or anti-mouse (1: 200) (in 5% BSA-PBS; Molecular Probes, Inc., Eugene, Oreg. Respectively. Confocal microscopy analysis was performed using LSM710 (Zeiss, Germany). The profiles of the ZEN program provided by the manufacturer were used to observe co-localizations of proteins and scan confocal microscope images. The nuclear or cytoplasmic fluorescence intensity profile of ULK1 / 2 was measured from the fluorescence image and the nuclear-to-total cell fluorescence (Fn / t) ratio was determined using the ZEN program. The Pearson's correlation coefficient (PCC) of co-localization between ULK2 and Kapβ2 was measured with LSM710 (Zeiss, Germany).

<1-8> FACS  analysis

Cells were transfected with ULK2 (WT), PY mutation (P242A or P794A), or EGFP vector, and Annexin V-PE cell death detection kit (BD Biosciences, NJ, USA) apoptosis rate was measured. The cells were gently vortexed and incubated for 15 min at 25 ° C in a dark environment. 400 [mu] l of binding buffer was then added to each tube. Fluorescence-activated cell sorting (FACS) was performed within one hour using FACS Calibur (BD Sciences).

<1-9> Measurement of self-extinguishing activity Autophagy assay )

To measure self-extinguishing activity, LC3 Western blotting (Bio-Protocol.org) was performed according to the manufacturer's instructions. This is carried out in the same manner as immunoblotting of <1-6> using an antibody against LC3. Each measurement was performed in 5 replicates.

<1-10> Statistical Analysis

The results according to this example were expressed as the mean of ± SD of at least 4 independent experimental runs performed in 3 iterations. Variances of the variables measured between the control and experimental groups were analyzed by Student's t-test. Statistically significant deviations were accepted at * P <0.05 or ** P <0.01.

< Example  2>

Endogenous ULK2 Wow Cap β2 interactions and nuclear Positioning

Most of the kappa2-related proteins have a kappa2 binding motif (R / H / KX (2-5) PY) [Suel KE, et al. (2008) Modular organization and combinatorial energetics of proline-tyrosine nuclear localization signals. PLoS Biol 6: e137]. The present inventors have found that ULK2 has two potential kappa2 binding motifs. One of them is (220qdlrmfyeKnRslmp s ipRetsPY243) in the kinase domain and the other is in the S / P space domain (774gpgfgssppGaeaapslRyvPY795) (Figure 1A). The presence of the two conserved Kap? 2 binding motifs suggests that ULK2 can bind to Kapβ2 (FIG. 1B). Thus, the present inventors examined whether endogenous kappa2 forms a protein complex with ULK2 in HEK293 cells.

As shown in the left lane of FIG. 1C, the ULK2 immunoprecipitate contained Kap? 2. In addition, antibodies to Kapp2 also successfully captured ULK2 in the same lysates (Fig. 1C, right lane), confirming the hypothesis that the two proteins are physically linked. In addition, capture of ULK2 by kappa2 was also observed in a pull-down experiment with pGEX-5X-1 kappa2 fusion protein and HEK293 cell lysate (Fig. 2C).

Further, the present inventors examined whether ULK2 is associated with Kap beta 2 in cells using a confocal microscope. Endogenous ULK2 (green) and Kap? 2 (red) were actually co-localized in the same region in both nuclear and cytoplasmic (yellow) (Fig. 1D). Figure 1D highlights the co-localization of ULK2 and Kap? 2 in the enlarged image of a particular merged region (white point). The Pearson's correlation coefficient (PCC) of co-localization of ULK2 and Kapp2 was measured using LSM710 [Lieu KG, et al. (2014) The p53-induced factor Ei24 inhibits nuclear import through an importin beta-binding-like domain. J Cell Biol 205: 301-312 and Zinchuk V, Zinchuk O, Okada T (2007) Quantitative colocalization analysis of multicolor confocal immunofluorescence microscopic images: Acta Histochem Cytochem 40: 101-111]. The PCC value (0.60 +/- 0.12; n = 5) shows that the coexistence of ULK2 and Kapβ2 appears to be approximately 60% in HEK293 cells. In other cell lines, 3T3, MDCK2, and HepG2, endogenous ULK2 was notable in the cytoplasm but not in the cytoplasm.

In addition, since ULK1 has been reported not to include the kappa2 binding motif [Lee BJ, et al. (2006) Rules for nuclear localization sequence recognition by karyopherin beta 2. Cell 126: 543-558]. Confocal microscopy for ULK1 was also performed for comparison with ULK2. Unlike the experimental results for ULK2 (FIG. 1D), endogenous ULK1 was observed primarily in the cytoplasm, not the nucleus (FIG. 1E). Previous studies [Zhou X, et al. (2007); Chan EY, et al. (2009); Jung CH, et al. (2009)], we found that endogenous ULK2 is primarily located in the non-cytoplasmic nucleus (Fig. 1D).

In addition, nuclear-to-cytoplasmic fluorescence ratios of ULK1 or ULK2 were measured using the ZEN program [Lieu KG, et al. (2014) The p53-induced factor Ei24 inhibits nuclear import through an importin beta-binding-like domain. J Cell Biol 205: 301-312]. The Fn / t ratio (47.61 +/- 4.59; n = 10) of ULK2 was 2.4 times higher than that of ULK1 (19.09 +/- 2.87; n = 10) (Fig. The results show that although ULK2 is evenly distributed in both nucleus and cytoplasm (Fig. 1D), ULKl appears predominantly in cytoplasm (Fig. 1E). Thus, the results of this example show that about 60% of endogenous ULK2 interacts with Kapp2 in HEK293 cells, and approximately 47% of ULK2 locates from the cytoplasm to nucleus, in contrast to ULKl, which is primarily found in cytoplasm (Fig. 1E, graph).

< Example  3>

The PY - NLS  Identification of the motif

As can be seen in Figure 1C and 1D, in vitro (in In vitro experiments ULK2 interacted with Kapβ2. Since ULK2 has two well-conserved kappa2 binding motifs, the present inventors examined which of the two motifs binds to Kapp2 in HEK293 cells. First, we assume that the (774gpgfgssppGaeaapslRyvPY795) motif of ULK2 is a true PY-NLS motif and constructed GST-ULK2 WT (1-600 aa) or (601-1036 aa) to confirm this. These constructs each contain a potential kappa2 binding motif (220qdlrmfyeKnRslmpsipRetsPY243) in the kinase domain, or a potential kappa2 binding motif (774gpGfgssppgaeaapslRyvPY795) in the S / P space domain, respectively. Approximately 1 mg of 1-600, or 601-1036 fusion protein bound to glutathione-sepharose beads was incubated with HEK293 cell lysate. As a result of the pull-down analysis of kappa2 using GST-fused N-terminal ULK2 1-600 or C-terminal 601-1036 protein expressed in E. coli, the motif (774gpGfgssppgaeaapslRyvPY795) within the S / (Fig. 2A). (220qdlrmfyeKnRslmpSipRetsPY243) and (774gpgfgssppGaeaapslRyvPY795) motifs were found only in ULK2 and not in ULK1. This suggests that ULK2 and ULK1 will function differently.

In addition, co-immunoprecipitation experiments were performed to reveal the interaction between ULK2 and Kap? 2 via the PY-NLS motif (FIG. 2B). EGFP-ULK2 WT and point mutations (P242A or P794A) were individually transfected into HEK293 cells. After 48 hours, the cells were lysed and immunoprecipitated with rabbit anti-EGF antibody. Western blot analysis was performed with mouse anti-Kap? 2, anti-ULK2, or mouse anti-actin antibody (1: 2000 dilution) to confirm that Kap? 2 also fell with ULK2 by the antibody. As shown in Figure 2B, the EGFP-ULK2 WT and P242A mutants apparently dropped endogenous Kapβ, but the P794A mutation failed to interact with Kapβ2. The results thus show that the PY-NLS motif present in the 774795aa fragment of ULK2 is responsible for binding to Kapp.

To obtain more evidence for the interaction between ULK2 and Kap? 2 via the PY-NLS motif, pull-down experiments with purified GST-Kapβ2 protein in E. coli were performed (FIG. 2C). EGFP-ULK2 WT or EGFP-ULK2 PY-NLS mutation (P242A or P794A) was transfected into HEK293 cells. After 48 hours, the cells were lysed and cell lysates were pulled down with GST-Kapp2 beads. Western blot analysis was performed with rabbit anti-EGFP or mouse anti-kapp2 antibodies. As shown in Figure 2C, GST-Kap beta 2 could pull down the EGFP-ULK2 WT and P242A mutations, but did not interact with the P794A mutation. Similar results were also observed in FIG. 2B, indicating that the PY-NLS motif present in the 774795aa fragment plays a crucial role in the interaction between ULK2 and Kapβ (FIG. 2C). The results thus show that the PY-NLS motif (aa774795) in the ULK2 S / P space domain is the main functional PY-NLS motif in ULK2 (FIG. 1A).

< Example  4>

Exogenous ULK2  And Cap β2 interaction and ULK2 Nuclear Localization  relevance

Confocal microscopy observations were performed to better understand the effect of the interaction between ULK2 and Kapp2 (Figure 3). We investigated whether the potential PY-NLS sequence (aa774795) of ULK2 could transfer the protein from the cytoplasm to the nucleus. Exogenous EGFP-ULK2 WT (green) and Kap? 2 (red) were also localized to the plasma membrane (yellow) as in the endogenous ULK2 experiment (Figure 1D) ). However, the exogenous EGFP-ULK2 PY-NLS P794A mutation (green) did not localize with Kapβ2 (red) (Fig. 3B), which appears to be due to mutations in its kappa2 binding site. The EGFP-ULK2 PY-NLS P794A mutation (green) was localized to the cytoplasmic region rather than the nucleus (Fig. 3B). However, the exogenous EGFP-ULK2 P242A mutation (green) was localized to the nucleus with Kapβ2 (red) (Fig. 3C), which appears to be due to its kappa2 binding site.

To quantify the localization of the ULK2 WT, PYNLS P794A mutation, or P242 mutation into the nucleus, the respective Fn / t ratio was determined. ULK2 WT (44.53 +/- 3.04; n = 10) and P242A mutation (67.2 +/- 4.19; n = 10) were mutations in ULK2 PY-NLS (P794A) -1.87; n = 10). These results indicate that the P794A mutation disrupted its ability to localize to the nucleus. Therefore, this can be seen as a PY-NLS mutation.

Taken together, these results indicate that Kapβ2 interacts with ULK2 through the PY-NLS conservative motif (774gpgfgssppGaeaapslRyvPY795) in the S / P space domain of ULK2, and the protein-protein interaction between them is localized to the nucleus of ULK2 (Fig. 3).

< Example  5>

ULK2 Cytoplasmic Positioning and  The relationship between self-digestion

In order to evaluate the effect of the ULK2 PY-NLS mutation (P794A) on autophagy, the microtubule-associated protein LC3 (homologue of mammalian homologue of Atg8, an autoprotein related factor of yeast, ) Was determined according to a known method [Lang T, et al. (1998) Aut2p and Aut7p, two novel microtubule-associated proteins are essential for delivery of autophagic vesicles to the vacuole. EMBO J 17: 3597-3607 and Kabeya Y, et al. (2000) LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 19: 5720-5728]. The total amount of LC3 is used as a marker of self-digestion. HEK293 cells cultured in glucose-free medium were transfected with respective EGFP-ULK2 (WT, P242A, and PY-NLS mutant) expression vectors and immunoprecipitated using EGFP monoclonal antibody (Figure 4). ULK2 proteins were traced at designated time intervals (0, 2, 4, 6 hours after induction of starvation), followed by SDS-PAGE and Western blot analysis with polyclonal anti-LC3 antibody. As a control for total cellular protein amount, actin levels were measured using anti-actin antibodies in each sample (Fig. 4A-C). The P242A mutation, which had been transferred to the nuclear domain, was used as a negative control (Fig. 4C).

As shown in Fig. 4B, LC3-II, a marker for the appearance of autophagosomes, was observed two hours earlier in cells transfected with ULK2 WT (Fig. 4A) or P242A mutation (Fig. 4C) NLS mutants, indicating that the ULK2 PY-NLS mutation in the cytoplasm promotes the appearance of autophagic bodies that are faster than ULK2 localized in the nucleus.

We also performed confocal microscopy observations of endogenous LC3 and each ULK2 construct 12 hours after starvation induction (FIG. 4D-F).

As shown in Fig. 4B, LC3-II (Fig. 4E) of cells transfected with ULK2 PY-NLS mutation showed intracellular LC3-II transfected with ULK2 WT (Fig. 4D) or P242A mutant Compared with II, it was localized with the mutant protein in the cytoplasm, and these proteins were mainly found in the nucleus.

< Example  6>

Serine Residue  Due to phosphorylation ULK2 Localization  change

As shown in Figures 1 and 2, the S / P space domain of ULK2 is involved in the physical interaction with Kapp2. EGFP-ULK2 WT, P242A, and P794A mutant proteins were transiently expressed in HEK293 cells and their serine phosphorylation status was compared to characterize the role of the protein-protein interactions in the nucleus. Phosphorylation of several serine residues including Ser335 of ULK2 (corresponding to Ser341 of ULK1) has been reported [Yan J, et al. (1999); And Chan EY, et al. (2009)]. Based on the hypothesis that the less phosphorylated ULK2 forms a protein complex in the cytoplasm, the present inventors have confirmed that intracellular localization of ULK2 affects its serine residue phosphorylation state. An anti-ULK2 antibody was used to observe ULK2 expression (Fig. 5A). In the same sample, an anti-Kap &lt; beta2 &gt; antibody was used to confirm whether Kap &lt; beta2 &gt; co-immunoprecipitated with exogenous ULK2. As shown in Fig. 2D, Kapβ2 was observed in cells transfected with EGFP-ULK2 WT and EGFP-ULK2 P242A mutant immunocomplexes, but observed in the immunoconjugate of EGFP-ULK2 PY-NLS mutant (P794A) (Fig. 5A). This is again the result indicating that ULK2 interacts with Kap beta 2 through the NLS consensus motif (774 gpGfssppgeaapslRyvPY795) of the S / P space domain (Fig. 5A).

As shown in FIG. 5B, Western blot analysis using an anti-phosphor Ser antibody together with an immunoprecipitant obtained with an anti-EGFP antibody showed that the same amount of EGFP-ULK2 and EGFP-ULK2 PY-NLS mutant proteins were examined , And serine phosphorylation of EGFP-ULK2 PY-NLS represented about 15% of the serine phosphorylation of EGFP-ULK2 (Fig. 5C). Thus, the results show that the serine phosphorylation of ULK2 localized to the cytoplasm occurs less than that of ULK2 localized to the nucleus.

< Example  7>

ULK2 Ser1027 Residue  Phosphorylation nuclear In positioning  Impact

To determine if the ULK2-specific phosphorylation site is involved in its regulation of intracellular localization, the ULK2 Ser1027 residue (1024RR1SA1028) of the C-terminal domain (CTD) overlapping the Atg13 and FIP200 binding sites was amplified with ULK2- Respectively. Because this potential site of ULK2 matches well with the consensus protein kinase A (PKA) substrate information [RRX- (S / T) -Φ], PKA phosphorylates 1027 residues of ULK2 as one of its specific substrate proteins [Wood JS, et al. (1996) Precision substrate targeting of protein kinases. The cGMP- and cAMP-dependent protein kinases. J Biol Chem 271: 174-179 and Tegge W, et al. (1995) Determination of cyclic nucleotide-dependent protein kinase substrate specificity by the use of peptide libraries on cellulose paper. Biochemistry 34: 10569-10577]. Preliminarily, we found that PKA phosphorylates the Ser1027 residue of ULK2 (rather than Ser468) with a PKA substrate phosphorylation-specific antibody. Thus, the present inventors have assumed that PKA-mediated phosphorylation of the ULK2 Ser1027 residue will affect functional dissociation with Atg13 and FIP200, localization to the nucleus, and autophosphorylation. It has been previously reported that intracellular localization of several proteins is also mediated through PKA phosphorylation (Dell'Acqua ML, et al. (2006) Regulation of neuronal PKA signaling through AKAP targeting dynamics. Eur J Cell Biol 85: 627-633 and Zhang M, et al. (2014) Protein kinase A activation enhances beta-catenin transcriptional activity through nuclear localization to PML bodies. PLoS One 9: e109523].

To confirm this hypothesis, EGFP-ULK2 WT, S1027A (dephosphorylated quasi-mutant), and S1027D (phosphorylated quasi-mutant) were generated through site-directed mutagenesis and their intracellular location And protein-protein interactions with Atg13 (Fig. 6A-C), FIP200 (Fig. 7A-C) and LC3-II (Fig. 8A-C). Confocal microscopy observations were performed to further analyze the binding ability between Kapp2 and each ULK2 protein, WT, S1027A, or S1027D (Fig. 9A-C).

As expected, compared to ULK2 WT or S1027D (Fig. 6A or 6C), ULK2 S1027A was not nuclear-transferred (Fig. 6B). Fn (n = 10) of WT (34.72 +/- 4.01; n = 10), S1027D (59.86 +/- 6.58; n = 10), and S1027A (11.50 +/- 3.48; n = 10) using a quantitative confocal microscope / t ratio was also measured (Figure 6C, bar graph). As a result, it was confirmed that PKA carries a phosphorylated analogous mutant (S1027D) to the nucleus, and this transfer did not occur for the PKA dephosphorylated analogous mutant (S1027A). Thus, PKA phosphorylation of ULK2 Ser1027 residues promotes localization of ULK2 into the nucleus, whereas dephosphorylated proteins remain in the cytoplasm.

In addition, ULK2 S1027A interacted with Atg13 (Fig. 6B) and FIP200 (Fig. 7B) in the cytoplasm (not the nucleus). In contrast, ULK2 WT and S1027D were mainly nuclear, but interacted much less with Atg13 (Figures 6A and 6C) or FIP200 (Figures 7A and 7C), indicating that phosphorylation of the Ser1027 residue by PKA It is one of the main regulating actions for anger.

In order to compare the autolytic activity of ULK2 WT, S1027A, and S1027D, endogenous LC3-II (a marker of auto-digestion) in HEK293 cells expressing these proteins was incubated with LC3-II (Fig. 8A-C). ULK2 S1027A (not nuclearized) co-localizes with LC3-II in the cytoplasm (more yellow than WT and S1027D) (Figure 8B), WT (nucleated) and S1027D (Fig. 8A and C). 6B, 7B, 8B and 9B) observed in the cytoplasm (expected to be an autologous somatic cell) (Figs. 6B, 7B, 8B and 9B) 6-10). These results support the fact that the dephosphorylation of Ser1027 residues in ULK2 (S1027A) increases its autopotactivity activity through association with increased LC3-II (Fig. 8B).

Confocal microscopy observations of endogenous kappa2 of ULK2 WT, S1027A, and S1027D in HEK293 cells also support the fact that ULK2 S1027D binds better with Kapβ2 and is better transported into the nucleus (FIG. 9C). Because this protein exposes its PY-NLS motif to Kapβ2 better due to its weak binding with ATG13 or FIP200 (FIG. 6C and FIG. 7C). In contrast, ULK2 WT or S1027A binds less to Kapβ2 and less to the nucleus due to the masking effect of the PY-NLS motif by binding to Atg13 or FIP200 (Figure 9A or Figure 9B) 9B). In the absence of PKA phosphorylation, PY-NLS of ULK2 appears to be blocked by steric inhibition due to strong binding to ATG13 or FIP200 (FIGS. 6B and 7B).

The Ser462 (459RRlST463) residue of ULK2 also matches the consensus sequence information [R-R-X- (S / T) -Φ] and is capable of phosphorylation by PKA (Fig. 1). We made and transfected S462A and S462D mutants to HEK293 cells and performed the same experiments for S1027A and S1027D. However, there was no intracellular localization change of the S462A or S462D mutation when compared to the S1027A or S1027D mutation, and the Western blot analysis with the PKA phosphorylation specific antibody showed a change in the protein-protein interaction with Atg13 or FIP200 (Figs. 6-10). In addition, the apoptotic ability of ULK2 S462A and S462D mutations did not change when compared to ULK2 WT. Thus, the results show that phosphorylation of ULK2 (not Ser462) Ser1027 by PKA is a specific regulatory region for the interaction with ATG13 or FIP200 and intracellular localization.

In order to obtain further evidence that the intracellular localization of ULK2 is regulated by PKA phosphorylation, a confocal microscopy with the treatment of PKA activator (forskolin, FSK) or inhibitor (H89) Localization of ULK2 was observed (Fig. 10A-C) [Chijiwa T, et al. (1990) Inhibition of forskolin-induced neurite outgrowth and protein phosphorylation by a newly synthesized selective inhibitor of cyclic AMP-dependent protein kinase, N- [2- (pbromocinnamylamino) ethyl] -5-isoquinolinesulfonamide cells. J Biol Chem 265: 5267-5272]. Compared with untreated cells (Fig. 10A), the cytoplasmic localization of H89-treated ULK2 (Fig. 10B) did not change significantly. However, increased localization of the FSK-treated ULK2 to the nucleus could be confirmed (Fig. 10C), demonstrating that the intracellular localization of ULK2 was altered by PKA phosphorylation. In addition, ULK2 (more phosphorylated by PKA) showed more binding to Kapp2 in FSK-treated cells than in normal or H89-treated cells, which is consistent with the results of Fig.

Fig. 10B, (0.56 +/- 0.13; n = 5); and Fig. 10C (Fig. 10C) , (0.74 +/- 0.12; n = 5)). The results also show that PKA phosphorylation increases binding between ULK2 and Kapp2. In addition, the nuclear or cytoplasmic fluorescence intensity (FI) profile (FIG. 10A-C, right) also indicates that PKA-phosphorylated ULK2 exhibits localization to increased nuclei (approximately twice as much as cytoplasm) (Figs. 10A and 10B, right). In addition, using a quantitative confocal microscope, normal DMEM-cultured HEK293 cells (49.36 +/- 4.90; n = 10), H89-treated cells (35.78 +/- 4.16; n = 10), or FSK- 52.73 +/- 3.65; n = 10). In agreement with the PCC and ULK2 S1027A / D mutation results (Figures 6-9), PKA phosphorylation activity by FSK promoted the transport of ULK2 into the nucleus by increasing the interaction between ULK2 and Kapβ2. However, inhibition of PKA phosphorylation by H89 inhibited the interaction between ULK2 and Kap? 2 and inhibited the transport of ULK2 into the nucleus (FIG. 10C, bar graph).

Therefore, the present inventors have found that the domain for protein-protein interaction with Atg13 or FIP200 overlaps with the ULK2 Ser1027 residue, which can be phosphorylated by PKA (Fig. IA), and thus ULK2 S1027A (cytoplasm) or S1027D ) Mutants were different from each other. Since Atg13 or FIP200 binds to dephosphorylated ULK2 (S1027A), the PY-NLS domain of ULK2 S1027A will probably not be available for Kapβ2. Ultimately, this appears to cause ULK2 S1027A to remain in the cytoplasm as an active form of auto-digestion (Figs. 4 and 6).

< Example  8>

ULK2  Effect of localization on cell survival

Cell viability was measured by FACS analysis to determine the effect of ULK2 on cell viability. According to FACS results, cells containing ULK2 PY-NLS or S1027A mutations (Fig. 5 and 6) (mainly localized to the cytoplasm with increased self-extinguishing activity) were detected in EGFP- Showed higher apoptosis rates than cells transfected with ULK2 WT, P242A, S1027D, or EGFP vectors alone (Table 1).

Instead, the promotion of localization of ULK2 to the nucleus by the S1027D mutation reduced both its autolytic activity and programmed cell death (Table 1). Therefore, the above results show that the localization of ULK2 in the cell is related to both apoptosis and autophagy.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the essential characteristics thereof. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chungbuk National University <120> Nuclear localization signal peptide derived from ULK2 and uses          the <130> pN1505-142 <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 1036 <212> PRT <213> ULK2 aminoacid sequence <400> 1 Met Glu Val Val Gly Asp Phe Glu Tyr Ser Lys Arg Asp Leu Val Gly   1 5 10 15 His Gly Ala Phe Ala Val Val Phe Arg Gly Arg His Arg Gln Lys Thr              20 25 30 Asp Trp Glu Val Ala Ile Lys Ser Ile Asn Lys Lys Asn Leu Ser Lys          35 40 45 Ser Gln Ile Leu Leu Gly Lys Glu Ile Lys Ile Leu Lys Glu Leu Gln      50 55 60 His Glu Asn Ile Val Ala Leu Tyr Asp Val Glu Glu Leu Pro Asn Ser  65 70 75 80 Val Phe Leu Val Met Glu Tyr Cys Asn Gly Gly Asp Leu Ala Asp Tyr                  85 90 95 Leu Gln Ala Lys Gly Thr Leu Ser Glu Asp Thr Ile Arg Val Phe Leu             100 105 110 His Gln Ile Ala Ala Met Arg Ile Leu His Ser Lys Gly Ile Ile         115 120 125 His Arg Asp Leu Lys Pro Gln Asn Ile Leu Leu Ser Tyr Ala Asn Arg     130 135 140 Arg Lys Ser Ser Val Ser Gly Ile Arg Ile Lys Ile Ala Asp Phe Gly 145 150 155 160 Phe Ala Arg Tyr Leu His Ser Asn Met Met Ala Ala Thr Leu Cys Gly                 165 170 175 Ser Pro Met Tyr Met Ala Pro Glu Val Ile Met Ser Gln His Tyr Asp             180 185 190 Ala Lys Ala Asp Leu Trp Ser Ile Gly Thr Val Ile Tyr Gln Cys Leu         195 200 205 Val Gly Lys Pro Pro Phe Gln Ala Asn Ser Pro Gln Asp Leu Arg Met     210 215 220 Phe Tyr Glu Lys Asn Arg Ser Leu Met Pro Ser Ile Pro Arg Glu Thr 225 230 235 240 Ser Pro Tyr Leu Ala Asn Leu Leu Leu Gly Leu Leu Gln Arg Asn Gln                 245 250 255 Lys Asp Arg Met Asp Phe Glu Ala Phe Phe Ser His Pro Phe Leu Glu             260 265 270 Gln Gly Pro Val Lys Lys Ser Cys Pro Val Val Pro Val Met Tyr Ser         275 280 285 Gly Ser Val Ser Gly Ser Ser Cys Gly Ser Ser Pro Ser Cys Arg Phe     290 295 300 Ala Ser Pro Pro Ser Leu Pro Asp Met Gln His Ile Gln Glu Glu Asn 305 310 315 320 Leu Ser Ser Pro Pro Leu Gly Pro Pro Asn Tyr Leu Gln Val Ser Lys                 325 330 335 Asp Ser Ala Ser Thr Ser Ser Lys Asn Ser Ser Cys Asp Thr Asp Asp             340 345 350 Phe Val Leu Val Pro His Asn Ile Ser Ser Asp His Ser Cys Asp Met         355 360 365 Pro Val Gly Thr Ala Gly Arg Arg Ala Ser Asn Glu Phe Leu Val Cys     370 375 380 Gly Gly Gln Cys Gln Pro Thr Val Ser Pro His Ser Glu Thr Ala Pro 385 390 395 400 Ile Pro Val Pro Thr Gln Ile Arg Asn Tyr Gln Arg Ile Glu Gln Asn                 405 410 415 Leu Thr Ser Thr Ala Ser Ser Gly Thr Asn Val His Gly Ser Ser Arg             420 425 430 Ser Ala Val Val Arg Arg Ser Asn Thr Ser Pro Met Gly Phe Leu Arg         435 440 445 Pro Gly Ser Cys Ser Pro Val Pro Ala Asp Thr Ala Gln Thr Val Gly     450 455 460 Arg Arg Leu Ser Thr Gly Ser Ser Arg Pro Tyr Ser Pro Ser Leu 465 470 475 480 Val Gly Thr Ile Pro Glu Gln Phe Ser Gln Cys Cys Cys Gly His Pro                 485 490 495 Gln Gly His Asp Ser Arg Ser Ser Asn Ser Ser Gly Ser Pro Val Pro             500 505 510 Gln Ala Gln Ser Pro Gln Ser Leu Leu Ser Gly Ala Arg Leu Gln Ser         515 520 525 Ala Pro Thr Leu Thr Asp Ile Tyr Gln Asn Lys Gln Lys Leu Arg Lys     530 535 540 Gln His Ser Asp Pro Val Cys Pro Ser His Thr Gly Ala Gly Tyr Ser 545 550 555 560 Tyr Ser Pro Gln Pro Ser Arg Pro Gly Ser Leu Gly Thr Ser Pro Thr                 565 570 575 Lys His Leu Gly Ser Ser Pro Arg Ser Ser Asp Trp Phe Phe Lys Thr             580 585 590 Pro Leu Pro Thr Ile Ile Gly Ser Pro Thr Lys Thr Thr Ala Pro Phe         595 600 605 Lys Ile Pro Lys Thr Gln Ala Ser Ser Asn Leu Leu Ala Leu Val Thr     610 615 620 Arg His Gly Pro Ala Glu Glu Gln Ser Lys Asp Gly Asn Glu Pro Arg 625 630 635 640 Glu Cys Ala His Cys Leu Leu Val Gln Gly Ser Glu Arg Gln Arg Ala                 645 650 655 Glu Gln Gln Ser Lys Ala Val Phe Gly Arg Ser Val Ser Thr Gly Lys             660 665 670 Leu Ser Asp Gln Gln Gly Lys Thr Pro Ile Cys Arg His Gln Gly Ser         675 680 685 Thr Asp Ser Leu Asn Thr Glu Arg Pro Met Asp Ile Ala Pro Ala Gly     690 695 700 Ala Cys Gly Gly Val Leu Ala Pro Pro Ala Gly Thr Ala Ala Ser Ser 705 710 715 720 Lys Ala Val Leu Phe Thr Val Gly Ser Pro Pro His Ser Ala Ala Ala                 725 730 735 Pro Thr Cys Thr His Met Phe Leu Arg Thr Arg Thr Thr Ser Val Gly             740 745 750 Pro Ser Asn Ser Gly Gly Ser Leu Cys Ala Met Ser Gly Arg Val Cys         755 760 765 Val Gly Ser Pro Pro Gly Pro Gly Phe Gly Ser Ser Pro Pro Gly Ala     770 775 780 Glu Ala Ala Pro Ser Leu Arg Tyr Val Pro Tyr Gly Ala Ser Pro 785 790 795 800 Ser Leu Glu Gly Leu Ile Thr Phe Glu Ala Pro Glu Leu Pro Glu Glu                 805 810 815 Thr Leu Met Glu Arg Glu His Thr Asp Thr Leu Arg His Leu Asn Val             820 825 830 Met Leu Met Phe Thr Glu Cys Val Leu Asp Leu Thr Ala Met Arg Gly         835 840 845 Gly Asn Pro Glu Leu Cys Thr Ser Ala Val Ser Leu Tyr Gln Ile Gln     850 855 860 Glu Ser Val Val Val Asp Gln Ile Ser Gln Leu Ser Lys Asp Trp Gly 865 870 875 880 Arg Val Glu Gln Leu Val Leu Tyr Met Lys Ala Ala Gln Leu Leu Ala                 885 890 895 Ala Ser Leu His Leu Ala Lys Ala Gln Ile Lys Ser Gly Lys Leu Ser             900 905 910 Pro Ser Thr Ala Val Lys Gln Val Val Lys Asn Leu Asn Glu Arg Tyr         915 920 925 Lys Phe Cys Ile Thr Met Cys Lys Lys Leu Thr Glu Lys Leu Asn Arg     930 935 940 Phe Phe Ser Asp Lys Gln Arg Phe Ile Asp Glu Ile Asn Ser Val Thr 945 950 955 960 Ala Glu Lys Leu Ile Tyr Asn Cys Ala Val Glu Met Val Gln Ser Ala                 965 970 975 Ala Leu Asp Glu Met Phe Gln Gln Thr Glu Asp Ile Val Tyr Arg Tyr             980 985 990 His Lys Ala Leu Leu Leu Glu Gly Leu Ser Arg Ile Leu Gln Asp         995 1000 1005 Pro Ala Asp Ile Glu Asn Val His Lys Tyr Lys Cys Ser Ile Glu Arg    1010 1015 1020 Arg Leu Ser Ala Leu Cys His Ser Thr Ala Thr Val 1025 1030 1035 <210> 2 <211> 22 <212> PRT <213> nuclear localization signal peptide <400> 2 Gly Pro Gly Phe Gly Ser Ser Pro Pro Gly Ala Glu Ala Ala Pro Ser   1 5 10 15 Leu Arg Tyr Val Pro Tyr              20 <210> 3 <211> 66 <212> DNA Nuclear localization signal peptide coding nucleotide sequence <400> 3 ggcccaggct tcggctcttc ccctccagga gcagaggcag ctcccagcct gagatacgtg 60 ccttac 66 <210> 4 <211> 34 <212> DNA <213> F primer (ULK2 cloning) <400> 4 ctcaagcttc gaattcatgg aggtggtggg tgac 34 <210> 5 <211> 37 <212> DNA <213> R primer (ULK2 cloning) <400> 5 catagcaccg caaccgtgtg agaattctgc agtcgac 37 <210> 6 <211> 33 <212> DNA <213> F primer (karyopherin beta 2) <400> 6 cccagagaaa catcagctta tttggctaat ctc 33 <210> 7 <211> 33 <212> DNA <213> R pimer (karyopherin beta 2) <400> 7 attagccaaa taagctgatg tttctctggg aat 33 <210> 8 <211> 30 <212> DNA <213> F primer (karyopherin beta 2) <400> 8 agcctgagat acgcttacgg ttgttcttgt 30 <210> 9 <211> 33 <212> DNA <213> R primer (karyopherin beta 2) <400> 9 tgaagcaccg taagccacgt atctcaggct ggg 33 <210> 10 <211> 33 <212> DNA &Lt; 213 > F primer (S1027A) <400> 10 attgagagaa gactggcggc gctctgccat agc 33 <210> 11 <211> 33 <212> DNA <213> R primer (S1027A) <400> 11 atggcagagc gccgccagtc ttctctcaat act 33 <210> 12 <211> 33 <212> DNA <213> F primer (S1027D) <400> 12 attgagagaa gactggacgc gctctgccat agc 33 <210> 13 <211> 33 <212> DNA <213> R primer (S1027D) <400> 13 atggcagagc gcgtccagtc ttctctcaat act 33 <210> 14 <211> 24 <212> PRT <213> Kap beta 2 motif sequence <400> 14 Gln Asp Leu Arg Met Phe Tyr Glu Lys Asn Arg Ser Leu Met Pro Ser   1 5 10 15 Ile Pro Arg Glu Thr Ser Pro Tyr              20 <210> 15 <211> 37 <212> DNA <213> F primer (GST-ULK2 WT) <400> 15 ggttaacccg ggaatggagg tggtgggtga cgacttc 37 <210> 16 <211> 34 <212> DNA <213> R primer (GST-ULK2 WT) <400> 16 ggttctcgag agagccaatg attgttggca aagg 34 <210> 17 <211> 34 <212> DNA <213> F primer (GST-ULK2 WT) <400> 17 ggttaacccg ggaatgccta ctaagaccac agct 34 <210> 18 <211> 34 <212> DNA <213> R primer (GST-ULK2 WT) <400> 18 ggttctcgag tcacacggtt gcggtgctat ggca 34

Claims (12)

delete delete delete delete delete delete delete delete A nucleated signal peptide consisting of the amino acid sequence of SEQ ID NO: 2; And
A kappa2 comprising a motif which is the amino acid sequence of SEQ ID NO: 14;
Wherein the nuclear localization signal peptide, the amino acid sequence of SEQ ID NO: 2 interacts with the amino acid sequence of SEQ ID NO: 14 of the kappa2. 10. The method of claim 9,
Wherein the complex further comprises a regulatory region comprising the 1027th serine residue (Ser) of the amino acid sequence of SEQ ID NO: 1 comprising the nuclear localization signal peptide. 11. The method of claim 10,
Wherein said regulatory region regulates nuclear localization of the carrier by phosphorylation by protein kinase A (PKA). 12. A method of delivering a desired delivery material into the nucleus of a subject cell using the intracranial delivery protein complex of any one of claims 9-11.

Images