KR101667648B1 - Method and biochip for detecting target polynucleotide electrically using conductive particles - Google Patents

Method and biochip for detecting target polynucleotide electrically using conductive particles Download PDF

Info

Publication number
KR101667648B1
KR101667648B1 KR1020100121155A KR20100121155A KR101667648B1 KR 101667648 B1 KR101667648 B1 KR 101667648B1 KR 1020100121155 A KR1020100121155 A KR 1020100121155A KR 20100121155 A KR20100121155 A KR 20100121155A KR 101667648 B1 KR101667648 B1 KR 101667648B1
Authority
KR
South Korea
Prior art keywords
target polynucleotide
nucleotide
conductive particles
conductive
metal electrodes
Prior art date
Application number
KR1020100121155A
Other languages
Korean (ko)
Other versions
KR20120059745A (en
Inventor
김성진
Original Assignee
(주) 하임바이오텍
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주) 하임바이오텍 filed Critical (주) 하임바이오텍
Priority to KR1020100121155A priority Critical patent/KR101667648B1/en
Publication of KR20120059745A publication Critical patent/KR20120059745A/en
Application granted granted Critical
Publication of KR101667648B1 publication Critical patent/KR101667648B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
    • C12Q2563/116—Nucleic acid detection characterized by the use of physical, structural and functional properties electrical properties of nucleic acids, e.g. impedance, conductivity or resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/60—Detection means characterised by use of a special device
    • C12Q2565/607—Detection means characterised by use of a special device being a sensor, e.g. electrode

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Electrochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서도 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출할 수 있다.The present invention relates to a method of forming conductive bridges between metal electrodes by connecting the conductive particles with target polynucleotides extended in a fixed state on the surface of the metal electrodes and forming a conductive bridge between the metal electrodes through the connection (chain formation) It is possible to conduct electricity between the metal electrodes even by the application of the power source to detect whether or not the amplification of the target polynucleotide is amplified and / or whether the amplification of the target polynucleotide is simple or precise, regardless of the kind of the target polynucleotide to be detected through detection of the direct current or the alternating current signal. Can be detected.

Description

전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법 및 이를 위한 바이오 칩{Method and biochip for detecting target polynucleotide electrically using conductive particles}[0001] The present invention relates to a method for electrically detecting a target polynucleotide using conductive particles,

본 발명은 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법 및 이를 위한 바이오 칩에 관한 것으로서, 보다 상세하게는 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩에 관한 것이다. The present invention relates to a method for electrically detecting a target polynucleotide using conductive particles and a biochip for the same, and more particularly, to a method for detecting and / or amplifying a target polynucleotide regardless of the kind of a target polynucleotide to be detected, And more particularly, to a method for electrically detecting a biochip and a biochip provided therefor.

구체적으로, 본 발명은 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩에 관한 것이다. Specifically, the present invention relates to a method of forming a conductive bridge between metal electrodes by connecting conductive particles with target polynucleotides extended in a fixed state on the surface of metal electrodes and forming a conductive bridge between the metal electrodes through connection (chain formation) The present invention relates to a method for electrically detecting whether or not amplification of a target polynucleotide is amplified and / or not, regardless of the kind of a target polynucleotide to be detected, and a biochip provided therefor.

보다 구체적으로, 본 발명은 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩에 관한 것이다.More specifically, the present invention relates to a method of forming a conductive bridge between conductive particles by a conductive bridge between metal electrodes through a connection between conductive particles and a target polynucleotide extending in a fixed state on the surface of metal electrodes , It is possible to easily detect whether or not the target polynucleotide is amplified and / or whether the target polynucleotide is amplified regardless of the kind of the target polynucleotide to be detected through the detection of the direct current or the alternating current signal, The present invention also relates to a biochip provided for the method.

DNA 칩과 마이크로플루이딕스 칩과 같은 바이오 칩은 유전자 정보 및 단백질 정보를 대량으로 그리고 자동화하여 분석할 수 있거나, 생리활성물질의 존재여부 및 기능을 비교적 간단하고 신속하게 분석할 수 있는 장치이다. 따라서, 바이오 칩은 유전자 및 단백질 연구분야, 의약분야, 농업, 식품, 환경 및 화학산업 등 다양한 분야에서 응용이 활발하게 이루어지고 있다. Biochips such as DNA chip and microfluidics chip can analyze gene information and protein information in a large amount and automatically, or analyze the existence and function of physiologically active substance relatively easily and quickly. Therefore, biochips are actively applied in various fields such as gene and protein research, medicine, agriculture, food, environment, and chemical industry.

DNA 칩은 표적 폴리뉴클레오티드에 대해 특이적인 프로브를 사전에 제작하여 유리 슬라이드에 마이크로어레이 장비를 이용하여 집적한 칩으로서, 표적 폴리뉴클레오티드를 형광물질이 표지된 특이적 프라이머를 이용하여 증폭한 후 증폭 산물을 DNA 칩에 혼성화시키고 스캐너로 형광신호를 분석하여 시료 내의 표적 폴리뉴클레오티드의 존재여부 및 서열변이 등을 분석하는데 사용된다. A DNA chip is a chip integrated with a microarray device on a glass slide by previously preparing a probe specific for a target polynucleotide. The target polynucleotide is amplified using a specific primer labeled with a fluorescent substance, Is hybridized to a DNA chip, and a fluorescence signal is analyzed with a scanner to analyze the presence of the target polynucleotide in the sample and the sequence variation.

생체 바이오 칩 또는 랩온어칩(Lab-on-a-chip)이라고도 불리는 마이크로플루이딕스 칩은 미량의 분석대상물질(DNA, RNA, 펩타이드, 단백질 등)을 칩 내의 챔버로 흘려보내면서 칩 내의 각종 생리활성물질의 반응양상을 분석하는 칩이다. 이러한 생체 바이오 칩은 전술한 DNA 칩에 비해 전기적 신호의 검출에 의해 비교적 간단하고 빠르게 생리활성물질의 존재여부 및/또는 반응여부를 확인할 수 있기 때문에 의료진단분야에서 활용도가 높다. A microfluidics chip, also called a bio-chip or a lab-on-a-chip, flows a small amount of analyte (DNA, RNA, peptide, protein, etc.) It is a chip that analyzes the reaction pattern of the active substance. Such a bio-bio-chip can be relatively easily and quickly detected by the detection of an electrical signal as compared with the above-described DNA chip, and thus it can be confirmed whether or not a bioactive substance is present and / or reacted.

예를 들어, 시료 내에 표적 폴리뉴클레오티드의 존재여부를 전기적으로 검출하는 마이크로플루이딕스 칩은 티올기가 부착된 프라이머를 SAM(Self Assembled Method) 방법을 이용하여 금속 전극 표면에 고정한 후 PCR 증폭을 반응 챔버 내에서 수행한 후 전기적 변화를 검출하고, 이를 통해 표적 폴리뉴클레오티드 증폭여부의 확인을 통해 시료 내에 표적 폴리뉴클레오티드의 존재여부를 분석할 수 있다. For example, a microfluidics chip that electrically detects the presence of a target polynucleotide in a sample is prepared by fixing a thiol-attached primer to the surface of a metal electrode using a SAM (Self Assembled Method) method, , And the presence of the target polynucleotide can be analyzed by detecting the electrical change and confirming whether the target polynucleotide is amplified.

즉, 생체 바이오 칩은 형광이 아닌 전기적 신호를 이용하여 하이브리드 형성 여부 내지는 생리활성물질(예를 들어, DNA)의 존재 및 반응 여부를 검출할 수 있어 장치의 소형화와 검출 편의성의 관점에서 유리하다. That is, the bio-biochip is capable of detecting whether or not a hybrid is formed or the presence or reaction of a bioactive material (e.g., DNA) using an electrical signal other than fluorescence, which is advantageous from the viewpoint of miniaturization of the apparatus and convenience of detection.

이와 관련하여 한국공개특허공보 제10-2004-0042021호에서는 생체 바이오 칩의 전극에 고정된 수용체와 생리활성물질의 반응에 의한 임피던스(또는 커패시턴스)의 변화를 측정하거나 칩 챔버 내에서 생리활성물질들 간의 반응에 의한 임피던스(또는 커패시턴스)의 변화를 전극이 감지하여 이를 전기적으로 검출하는 방식을 개시하고 있다. 즉, 종래의 바이오 칩에서는 생리활성물질의 반응에 따른 임피던스의 변화를 바이오 칩에 제공된 바이오 센서 전극이 감지하여 반응 유무 및 특정 생리활성물질의 존재 여부를 판단하는 방식을 채택하고 있다. 따라서, 종래의 바이오 칩의 신뢰성을 확보하기 위해서는 바이오 센서 전극에서 임피던스값 변화의 정밀한 감지가 중요하다.In this regard, Korean Patent Laid-Open No. 10-2004-0042021 discloses a method for measuring a change in impedance (or capacitance) due to a reaction between a receptor fixed to an electrode of a bio-biochip and a physiologically active substance, (Or capacitance) due to the reaction between the electrodes is detected by the electrode and electrically detected. That is, in a conventional biochip, a change in impedance due to a reaction of a bioactive material is sensed by a biosensor electrode provided in the biochip, and a method of determining the presence or absence of a reaction and existence of a specific bioactive material is adopted. Therefore, in order to secure the reliability of the conventional biochip, it is important to precisely detect the change of the impedance value in the biosensor electrode.

그러나, 이러한 종래기술의 바이오 칩은 교류를 사용하여 임피던스의 변화를 측정하는 방식을 사용하여 전기적 검출을 수행하기 때문에 여러가지 문제점을 갖고 있다. 예를 들어, 바이오 칩 내의 반응 챔버에 수용되는 완충용액에 의한 검출 재현성 문제와, 센싱 금속 전극으로의 비특이적 흡착 문제로 정확한 임피던스의 변화를 감지하기가 어려운 단점이 있다. However, such prior art biochip has various problems because electrical detection is performed using a method of measuring the change in impedance by using alternating current. For example, there is a disadvantage in that it is difficult to detect a change in accurate impedance due to a problem of detection reproducibility due to a buffer solution contained in a reaction chamber in a biochip and a problem of non-specific adsorption to a sensing metal electrode.

또한, 종래의 바이오 칩은 주파수 대역별로 교류를 인가하고 반응 전후에 있어 임피던스의 변화를 측정하여 대비하는 방식을 이용하는데, 반응 전후에 있어서 임피던스 변화를 보이는 교류의 주파수 대역과 임피던스 변화를 보이지 않는 교류의 주파수 대역이 존재하기 때문에 다양한 주파수 대역 별로 반응 전후에 임피던스를 측정해야 하는 불편과 이에 따른 분석의 어려움이 수반된다.In the conventional biochip, a method of applying an alternating current to each frequency band and measuring a change in impedance before and after the reaction is used. In this case, the frequency band of the alternating current having the impedance change before and after the reaction, Frequency band, there are inconveniences to measure the impedance before and after the reaction for various frequency bands, and the analysis is difficult.

따라서, 바이오 칩의 전극에 프라이머나 프로브와 같은 올리고뉴클레오티드를 고정하고 PCR 반응이나 혼성화 반응을 진행시킨 후 올리고뉴클레오티드가 고정된 센싱 전극 사이에 직류 또는 교류 전원을 인가하여 직류 또는 교류 전류값이나 저항값의 변화를 곧바로 검출하는 것이 간편하면서도 이상적인 방법이다. 그러나, 전술한 바와 같은 PCR 반응이나 혼성화 반응에 사용되는 완충용액 문제, 복잡한 생물학적, 생화학적 또는 화학적 반응 문제는 전기적 검출 방식의 신뢰도를 떨어뜨리고 상용화를 어렵게 하고 있는 실정이다.Therefore, an oligonucleotide such as a primer or a probe is immobilized on an electrode of a biochip and a PCR reaction or a hybridization reaction is performed. Then, a direct current or an alternating current power is applied between the sensing electrodes to which the oligonucleotide is immobilized, It is an easy and ideal method to detect the change of the temperature. However, the problems of the buffer solution used in the PCR reaction or the hybridization reaction as described above, and the complicated biological, biochemical or chemical reaction problems are deteriorating the reliability of the electric detection method and making it difficult to commercialize.

이와 관련하여 대한민국 등록특허 제10-0590546호에서는 증폭반응 챔버 내에 마련된 전극 표면에 프라이머 세트 중 제1 프라이머를 고정시키고, 나노입자가 표지된 제2 프라이머를 PCR 반응액에 첨가하고 전극 표면에서 PCR을 수행하여 PCR 증폭산물을 높은 측정 감도와 재현성으로 측정할 수 있다는 내용을 개시하고 있다. 그러나 상기 대한민국 등록특허 제10-0590546호는 여전히 교류를 인가하여 임피던스를 측정하여 PCR 증폭산물을 검출하고 있어 골드 나노입자를 사용한 점 이외에는 종래기술과 크게 다른 점이 없고, 특히 골드 나노입자 간의 전기적 연결에 관한 기술적 수단이 없어 실제 재현여부가 불가능한 기술로서 생각되고 있다. 또한, 상기 종래기술에서는 제2 프라이머와 결합된 골드 나노입자는 측정하고자 하는 PCR 증폭산물의 종류별로 별도로 제작되어야 하는 불편과 비용증가의 문제점이 있다. 즉, 상기 종래기술은 PCR 증폭산물의 종류별로 제2 프라이머가 달라지기 때문에 골드 나노입자의 개질과정이 복잡해 지고 비용이 증가하는 근본적인 문제가 있는 것이다. Korean Patent Registration No. 10-0590546 discloses a method of immobilizing a first primer in a primer set on an electrode surface provided in an amplification reaction chamber, adding a second primer labeled with nanoparticles to a PCR reaction solution, PCR amplification products can be measured with high measurement sensitivity and reproducibility. However, Korean Patent Registration No. 10-0590546 does not have much difference from the prior art except that gold nanoparticles are used because the PCR amplification product is detected by measuring the impedance by applying an alternating current. In particular, in the electrical connection between gold nanoparticles It is thought that it is impossible to reproduce it. In addition, the gold nanoparticles combined with the second primer have the disadvantages of being inconveniently manufactured separately for each type of PCR amplification product to be measured and increasing the cost. That is, since the second primer differs according to the type of the PCR amplification product, the conventional technique has a fundamental problem that the modification process of the gold nanoparticles becomes complicated and the cost increases.

한편, 골드 나노입자에 티올기로 개질된 올리고 뉴클레오티드를 부착시킨 후 이들 올리고 뉴클레오티드 사이의 상보적 결합에 의해 골드 나노입자들을 어셈블링하는 기술도 소개되고 있으나, 이러한 기술은 바이오 센서나 바이오 칩에 직접 적용이 어려운 기술로서 상용화에는 문제가 있었다. 또한, 골드 나노입자를 이용한 DNA의 전기적 검출에 관한 여러 종래기술들이 있으나, 이들 종래기술들은 센싱 금속 전극 간의 통전을 위해 골드 나노입자들을 기판 상의 프로브에 고정시키는 과정 이외에 은(Ag) 양이온과 하이드로퀴논의 반응에 의한 전자 발생 과정이 별도로 필요하거나(Array-Based Electrical Detection of DNA with Nanoparticle Probe, Science 295, 1503 (2002)), 센싱 전극 간에서 골드 나노입자의 어셈블리를 위해 계속적으로 티올기를 공급하거나(Label-Free Electronic Dectection of DNA-Hybridization on Nanogapped Gold Particle Film, J. AM. CHEM. SOC. 2005, 127, 3280-3281), PNA 프로브를 사전에 이산화 실리콘 기판 상에 고정하는 과정(Electrical Detection of Oligonucleotide Using an Aggregate of Gold Nanoparticle as a Conductive Tag, Anal. Chem. 2008, 80, 9387-9394) 등을 요구하는 등 상용화를 위해서는 구현이 복잡하고 재현성도 떨어지는 문제점이 있었다. On the other hand, there is also disclosed a technique of attaching oligonucleotides modified with thiol groups to gold nanoparticles and assembling gold nanoparticles by complementary bonding between these oligonucleotides, but these techniques are directly applied to biosensors and biochips As a difficult technology, there was a problem in commercialization. In addition, there are a number of conventional techniques for the electrical detection of DNA using gold nanoparticles. However, these prior arts have also found that, in addition to fixing gold nanoparticles to a probe on a substrate for energization between the sensing metal electrodes, The electrochemical generation process of the nanoparticle probe is required separately (Array-Based Electrical Detection of DNA with Nanoparticle Probe, Science 295, 1503 (2002)) or continuously supplying thiol groups for assembly of gold nanoparticles between sensing electrodes 2005, 127, 3280-3281), a process for fixing a PNA probe on a silicon dioxide substrate in advance (Electrical Detection of Oligonucleotide (DNA-Hybridization on Nanogapped Gold Particle Film, J. Am. (Eg, an Aggregate of Gold Nanoparticle as a Conductive Tag, Anal. Chem. 2008, 80, 9387-9394). The reproducibility was also lowered.

이에 본 발명자는 전술한 바와 같은 종래기술들의 문제점을 해결하기 위해 예의 연구를 거듭한 결과, 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 바이오 칩을 고안하기에 이르렀다.The present inventors have conducted intensive studies to solve the problems of the prior art as described above, and as a result, the present inventors have found that the connection between the conductive particles and the target polynucleotides extended in a fixed state on the surface of the metal electrodes, By forming a conductive bridge between the metal electrodes through the formation of a chain (chain formation), electricity is conducted between the metal electrodes by application of a direct current or alternating current power, and the kind of the target polynucleotide to be detected through detection of a direct current or an alternating current signal A method of electrically and easily detecting whether or not amplification of a target polynucleotide is present and / or whether or not the target polynucleotide is amplified, and a biochip have been devised.

본 발명은 전술한 바와 같은 종래의 바이오 칩에서 전기화학적 방식을 이용하는 경우 완충용액 문제, 복잡한 생물학적, 생화학적 또는 화학적 반응 문제가 발생하여 전기적 검출 방식의 신뢰도를 떨어뜨리는 문제, 그리고 교류를 사용하여 임피던스의 변화를 측정하는 방식에서 나타나는 검출재현성 및 민감도 문제와, 교류 주파수 대역 설정과 관련한 문제점 및 불편을 해결하는데 그 목적이 있는 발명으로서, 전도성 입자를 이용하여 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩을 제공하는데 그 목적이 있다. The present invention has been made in view of the problems of the conventional biochip using an electrochemical method, such as a problem of a buffer solution, a complicated biological, biochemical or chemical reaction problem, which lowers the reliability of an electrical detection system, The present invention is directed to a detection reproducibility and sensitivity problem in a method of measuring a change in a frequency of a target polynucleotide and an object of solving the problems and inconveniences associated with the setting of an AC frequency band, The present invention also provides a method for electrically detecting whether or not amplification of a target polynucleotide is present and / or absent, simply and precisely, and a biochip provided for the method.

구체적으로, 본 발명은 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩을 제공하는데 그 목적이 있다.Specifically, the present invention relates to a method of forming a conductive bridge between metal electrodes by connecting conductive particles with target polynucleotides extended in a fixed state on the surface of metal electrodes and forming a conductive bridge between the metal electrodes through connection (chain formation) There is provided a method for electrically detecting whether or not amplification of a target polynucleotide is amplified and / or present, regardless of the kind of a target polynucleotide to be detected, and a biochip provided for the method.

보다 구체적으로, 본 발명은 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출하는 방법 및 이를 위해 제공되는 바이오 칩을 제공하는데 그 목적이 있다.More specifically, the present invention relates to a method of forming a conductive bridge between conductive particles by a conductive bridge between metal electrodes through a connection between conductive particles and a target polynucleotide extending in a fixed state on the surface of metal electrodes , It is possible to easily detect whether or not the target polynucleotide is amplified and / or whether the target polynucleotide is amplified regardless of the kind of the target polynucleotide to be detected through the detection of the direct current or the alternating current signal, The present invention also provides a method for electrically detecting a biochip and a biochip provided therefor.

우선, 본 발명의 명세서에서 사용되는 용어를 설명하면 다음과 같다.First, terms used in the specification of the present invention will be described as follows.

본 발명의 명세서에서 사용되는 "표적 폴리뉴클레오티드"란 시료 내에서 검출하고자 하는 단일 사슬 또는 이중 사슬의 DNA 또는 RNA로서 단일염기다형성 또는 유전자형 분석에 사용되는 특이적인 염기서열 부분을 갖는 폴리뉴클레오티드를 의미한다.As used herein, the term "target polynucleotide" refers to a single nucleotide or double-stranded DNA or RNA to be detected in a sample and refers to a polynucleotide having a specific base sequence portion used for single base polymorphism or genotyping .

본 발명의 명세서에서 사용되는 "변형 프라이머"는 표적 폴리뉴클레오티드와 특이적으로 결합하는 프라이머의 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열[이하, "집코드 서열(zip code sequence)"이라고도 함]을 추가한 프라이머를 의미한다. 본 발명의 일실시예에서 "변형 프라이머"는 업스트림 방향으로 표적 폴리뉴클레오티드를 연장하는 역방향의 변형 프라이머를 사용하는 것을 예로 들었으나, 본 발명은 이에 제한되는 것이 아니고 다운스트림 방향으로 표적 폴리뉴클레오티드를 연장하는 정방향의 변형 프라이머를 포함할 수 있다.As used herein, the term "modified primer" refers to a nucleotide sequence that does not have homology with the nucleotide sequence of a genomic gene at the end of a primer that specifically binds to the target polynucleotide, and is a non-homologous Means a primer in which a base sequence (hereinafter also referred to as "zip code sequence") is added. In one embodiment of the present invention, "modified primer" exemplifies the use of a modified primer in the reverse direction extending the target polynucleotide in the upstream direction, but the present invention is not limited thereto and may extend the target polynucleotide in the downstream direction Lt; RTI ID = 0.0 > primer. ≪ / RTI >

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법은,A method of electrically detecting a target polynucleotide using the conductive particles of an embodiment of the present invention includes:

(a) 검출대상 시료가 수용되는 반응 챔버와, 상기 반응 챔버 내에 위치하고 상기 검출대상 시료 내의 표적 폴리뉴클레오티드를 특이적으로 증폭하는 정방향 프라이머의 한쪽 말단이 고정된 적어도 2개의 금속 전극을 구비하는 전기적 검출장치를 제공하는 단계와,(a) an electrical detection system comprising a reaction chamber in which a sample to be detected is contained, and at least two metal electrodes fixed in one end of a forward primer located in the reaction chamber and specifically amplifying a target polynucleotide in the sample to be detected Providing a device,

(b) 상기 표적 폴리뉴클레오티드를 특이적으로 증폭하는 역방향 프라이머의 한쪽 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열 또는 이에 상보적인 서열을 추가한 역방향 변형 프라이머를 준비하는 단계와,(b) a nucleotide sequence having no homology to the nucleotide sequence of the genomic gene at one end of the reverse primer that specifically amplifies the target polynucleotide, and a non-homologous base sequence which is not complementarily hybridized with the genomic gene, Preparing a reverse strain primer having an added sequence,

(c) 상기 반응 챔버 내에서 상기 각각의 금속 전극에 고정된 정방향 프라이머와 상기 역방향 변형 프라이머를 이용하여 상기 반응 챔버 내로 도입된 검출대상 시료 내의 표적 폴리뉴클레오티드를 증폭함으로써, 한쪽 말단이 상기 각각의 금속 전극에 고정되고 다른 쪽 말단은 상기 비상동성 염기서열 또는 이에 상보적인 염기서열이 추가되어 연장된 표적 뉴클레오티드를 수득하는 단계와,(c) amplifying the target polynucleotide in the sample to be detected introduced into the reaction chamber using the forward primer fixed to each metal electrode and the reverse strain primer in the reaction chamber, The other end of which is immobilized on the electrode, the non-homologous nucleotide sequence or a complementary base sequence is added to obtain an elongated target nucleotide,

(d) 상기 (c) 단계에서 수득된 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 동일하거나 상보적인 염기서열을 갖는 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자를 준비하는 단계와,(d) a plurality of first nucleotide oligomers having a nucleotide sequence identical or complementary to the non-identical nucleotide sequence added to the other end of the target polynucleotide obtained in the step (c) Preparing a first conductive particle,

(e) 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자를 준비하는 단계와,(e) preparing a second conductive particle to which a plurality of second nucleotide oligomers are attached, the second conductive particle being complementary to the base sequence of the first nucleotide oligomer;

(f) 상기 복수개의 제1 뉴클레오티드 올리고머가 부착된 적어도 2개의 제1 전도성 입자를 상기 반응 챔버 내로 도입하고, 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 어느 하나는 상기 (c) 단계에서 수득된 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 상보적으로 어닐링되어 연장됨으로써 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 상기 제1 전도성 입자가 연결되는 단계와,(f) introducing at least two first conductive particles having the plurality of first nucleotide oligomers attached thereto into the reaction chamber, and any one of the plurality of first nucleotide oligomers attached to the first conductive particles is introduced into the reaction chamber, Wherein the target polynucleotide is annealed complementarily with the non-homologous base sequence or the complementary base sequence added to the other end of the target polynucleotide immobilized on each of the metal electrodes obtained in the step Connecting said first conductive particle to a polynucleotide;

(g) 상기 복수개의 제1 뉴클레오티드 올리고머가 부착된 적어도 하나의 제1 전도성 입자와 상기 복수개의 제2 뉴클레오티드 올리고머가 부착된 적어도 2개의 제2 전도성 입자를 상기 반응 챔버 내로 추가로 도입하고, 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 연결된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상보적으로 결합하며, 또한 추가로 도입된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 서로 상보적으로 결합되면서 상기 제1 및 제2 전도성 입자들의 연결을 통해 상기 적어도 2개의 금속 전극 사이에 전도성 브릿지를 형성하는 단계와,(g) further introducing into the reaction chamber at least one first conductive particle to which the plurality of first nucleotide oligomers are attached and at least two second conductive particles to which the plurality of second nucleotide oligomers are attached, At least one of the plurality of second nucleotide oligomers attached to the two conductive particles is complementary to at least one of the plurality of first nucleotide oligomers attached to the first conductive particle connected to the target polynucleotide immobilized on the respective metal electrode And at least one of a plurality of first nucleotide oligomers adhered to the first conductive particles and a plurality of second nucleotide oligomers adhered to the second conductive particles are complementarily combined with each other, Through the connection of the first and second conductive particles, Forming a conductive bridge between at least two metal electrodes,

(h) 상기 적어도 2개의 금속 전극에 전원을 인가한 후 전기적 변화를 측정하여 검출대상 시료 내에 표적 폴리뉴클레오티드의 존재여부를 전기적으로 검출하는 단계를 포함한다.(h) electrically detecting the presence or absence of the target polynucleotide in the detection target sample by measuring electrical change after applying power to the at least two metal electrodes.

바람직하게는 상기 복수개의 제1 뉴클레오티드 올리고머와 상기 복수개의 제2 뉴클레오티드 올리고머는 전도성 입자 부착을 위한 기능기로 개질된 후 각각 상기 제1 전도성 입자 및 상기 제2 전도성 입자에 부착된다. Preferably, the plurality of first nucleotide oligomers and the plurality of second nucleotide oligomers are modified into functional groups for attachment of conductive particles and then attached to the first conductive particles and the second conductive particles, respectively.

한편, 본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에서 사용되는 제1 전도성 입자 및 제2 전도성 입자는 골드 파티클, 실버 파티클, 크롬 파티클, 구리 파티클, 알루미늄 파티클, 산화철 나노입자, 자성 비드 또는 내부에 산화철을 포함하는 폴리머 비드 등일 수 있다.On the other hand, the first conductive particles and the second conductive particles used in the method for electrically detecting a target polynucleotide using the conductive particles according to an embodiment of the present invention include gold particles, silver particles, chrome particles, copper particles, aluminum particles, Iron oxide nanoparticles, magnetic beads or polymer beads containing iron oxide therein.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에 있어서, 상기 (h) 단계에서는 직류 또는 교류 전원을 인가하여 저항값의 변화 또는 전류값의 변화를 측정하는 것이 바람직하다. 한편, 본 발명은 직류전원의 인가에 한정되는 것이 아니고, 종래와 같이 교류전원을 이용할 수 있음은 물론이다.In the method of electrically detecting a target polynucleotide using the conductive particles according to an embodiment of the present invention, it is preferable to measure the change of the resistance value or the change of the current value by applying a direct current or an alternating current power in the step (h) Do. It should be noted that the present invention is not limited to the application of the direct current power, but it is needless to say that the present invention can use the alternating current power as in the prior art.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에 있어서, 상기 적어도 2개의 금속 전극은 IDE(interdigitated electrode)로서 형성되는 것이 바람직하다. 그러나, 본 발명에 있어서, 상기 적어도 2개의 금속 전극은 IDE 형태로 한정되는 것이 아니라 플러스의 전원이 인가되는 (+) 전극과 마이너스의 전원이 인가되는 (-)전극으로만으로도 형성할 수 있음은 물론이다. In a method of electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the at least two metal electrodes are preferably formed as an interdigitated electrode (IDE). However, in the present invention, the at least two metal electrodes are not limited to the IDE type but may be formed only of (+) electrodes to which a positive power is applied and (-) electrodes to which a negative power is applied to be.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에 있어서, 상기 금속 전극의 폭은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 2μm ∼ 4μm이고, 상기 금속 전극 사이의 간격은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 1μm ∼ 2μm이다.In the method for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the width of the metal electrode may be approximately 10 nm to 100 μm, preferably approximately 2 μm to 4 μm, The spacing can be between about 10 nm and 100 μm and is preferably between about 1 μm and 2 μm.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에 있어서, 상기 금속 전극은 금, 크롬, 구리 또는 알루미늄으로 형성하는 것이 바람직하다.In the method for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the metal electrode is preferably formed of gold, chromium, copper, or aluminum.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법에 있어서, 상기 정방향 프라이머는 서열번호 1의 염기서열을 갖는 올리고뉴클레오티드, 상기 역방향 변형 프라이머는 서열번호 2의 염기서열을 갖는 올리고뉴클레오티드, 상기 제1 뉴클레오티드 올리고머는 서열번호 3의 염기서열을 갖는 올리고뉴클레오티드, 그리고 상기 제2 뉴클레오티드 올리고머는 서열번호 4의 염기서열을 갖는 올리고뉴클레오티드일 수 있다.In the method for electrically detecting a target polynucleotide using the conductive particles according to an embodiment of the present invention, the forward primer is an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1, and the reverse-direction primer is a nucleotide sequence of SEQ ID NO: The first nucleotide oligomer may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 3, and the second nucleotide oligomer may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 4.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩은,A biochip for electrically detecting a target polynucleotide using the conductive particles according to an embodiment of the present invention,

제1기판과,A first substrate,

상기 제1기판 상에 형성되고 검출대상 시료 내의 표적 폴리뉴클레오티드를 특이적으로 증폭하는 정방향 프라이머의 한쪽 말단이 고정된 적어도 2개의 금속 전극과,At least two metal electrodes formed on the first substrate and one end of a forward primer that specifically amplifies a target polynucleotide in a detection target sample is immobilized,

상기 제1기판 상에 일정한 거리를 두고 상기 제1기판과 결합하여 반응 챔버 공간을 형성하는 제2기판과,A second substrate coupled to the first substrate at a predetermined distance on the first substrate to form a reaction chamber space;

상기 적어도 2개의 금속 전극 각각에 고정된 정방향 프라이머에 의해 특이적으로 연장되어 상기 적어도 2개의 금속 전극 각각에 한쪽 말단이 고정된 표적 폴리뉴클레오티드 사이에 전도성 브릿지 형성을 위한 조성물로서, 상기 표적 폴리뉴클레오티드를 특이적으로 증폭하는 역방향 프라이머의 한쪽 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열 또는 이에 상보적인 서열을 추가한 역방향 변형 프라이머와, 상기 역방향 변형 프라이머를 이용하여 상기 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 동일하거나 상보적인 염기서열을 갖는 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자와, 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자를 포함하는 전도성 브릿지 형성을 위한 조성물을 포함한다. A composition for forming a conductive bridge between target polynucleotides that are specifically extended by a forward primer fixed to each of the at least two metal electrodes and one end is fixed to each of the at least two metal electrodes, A reverse primer having a non-homologous base sequence complementary to the genomic gene or a sequence complementary thereto, as a nucleotide sequence having no homology with the nucleotide sequence of the genomic gene at one end of the specifically amplified reverse primer, and A first nucleotide oligomer having a nucleotide sequence complementary to or complementary to the non-identical nucleotide sequence added to the other end of the target polynucleotide using the reverse-direction modification primer, Conductive particles, It includes a composition for forming a conductive bridge comprising a second conductive particle group with a base sequence complementary to the plurality of the second nucleotide of the first nucleotide oligomers oligomers attached.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 어느 하나는 상기 각각의 금속 전극에 한쪽 말단이 고정된 상기 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 상보적으로 어닐링되어 연장됨으로써 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 상기 제1 전도성 입자가 연결되고, 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 연결된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상보적으로 결합하며, 또한 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 서로 상보적으로 결합되면서 상기 제1 및 제2 전도성 입자들의 연결을 통해 상기 적어도 2개의 금속 전극 사이에 전도성 브릿지를 형성하는 것을 특징으로 한다.In a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, any one of a plurality of first nucleotide oligomers adhered to the first conductive particle may be provided at one end Wherein the target polynucleotide is annealed complementarily with the non-identical nucleotide sequence added to the other end of the target polynucleotide, or a complementary base sequence thereof, to the target polynucleotide immobilized on each metal electrode, At least one of the plurality of second nucleotide oligomers attached to the second conductive particle is connected to a second conductive oligomer attached to the first conductive particle connected to the target polynucleotide immobilized on the respective metal electrode Complementarily combined with at least one And at least one of a plurality of first nucleotide oligomers adhered to the first conductive particle and a plurality of second nucleotide oligomers adhered to the second conductive particle are complementarily bonded to each other, 2 conductive bridges between the at least two metal electrodes through the connection of the conductive particles.

바람직하게는 상기 복수개의 제1 뉴클레오티드 올리고머와 상기 복수개의 제2 뉴클레오티드 올리고머는 전도성 입자 부착을 위한 기능기로 개질된 후 각각 상기 제1 전도성 입자 및 상기 제2 전도성 입자에 부착된다. Preferably, the plurality of first nucleotide oligomers and the plurality of second nucleotide oligomers are modified into functional groups for attachment of conductive particles and then attached to the first conductive particles and the second conductive particles, respectively.

한편, 본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 제1 전도성 입자 및 제2 전도성 입자는 골드 파티클, 실버 파티클, 크롬 파티클, 구리 파티클, 알루미늄 파티클, 산화철 나노입자, 자성 비드 또는 내부에 산화철을 포함하는 폴리머 비드 등일 수 있다.Meanwhile, in a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the first conductive particles and the second conductive particles may be selected from the group consisting of gold particles, silver particles, chromium particles, copper particles, aluminum Particles, iron oxide nanoparticles, magnetic beads or polymer beads containing iron oxide therein.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 적어도 2개의 금속 전극에는 직류 또는 교류전원을 인가하여 저항값의 변화 또는 전류값의 변화를 측정하여 표적 폴리뉴클레오티드의 증폭여부 또는 존재여부를 전기적으로 검출할 수 있다. 한편, 본 발명은 직류전원의 인가에 한정되는 것이 아니고, 종래와 같이 교류전원을 이용할 수 있음은 물론이다.In a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, a change in a resistance value or a change in a current value is measured by applying a direct current or an alternating current power to the at least two metal electrodes The presence or absence of amplification of the target polynucleotide can be electrically detected. It should be noted that the present invention is not limited to the application of the direct current power, but it is needless to say that the present invention can use the alternating current power as in the prior art.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 적어도 2개의 금속 전극은 IDE(interdigitated electrode)로서 형성되는 것이 바람직하다. 그러나, 본 발명에 있어서, 상기 적어도 2개의 금속 전극은 IDE 형태로 한정되는 것이 아니라 플러스의 전원이 인가되는 (+) 전극과 마이너스의 전원이 인가되는 (-)전극으로만으로도 형성할 수 있음은 물론이다. In a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the at least two metal electrodes are preferably formed as an interdigitated electrode (IDE). However, in the present invention, the at least two metal electrodes are not limited to the IDE type but may be formed only of (+) electrodes to which a positive power is applied and (-) electrodes to which a negative power is applied to be.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 금속 전극의 폭은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 2μm ∼ 4μm이고, 상기 금속 전극 사이의 간격은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 1μm ∼ 2μm이다.In the biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the width of the metal electrode may be approximately 10 nm to 100 μm, preferably approximately 2 μm to 4 μm, May be approximately 10 nm to 100 μm, and preferably approximately 1 μm to 2 μm.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 금속 전극은 금, 크롬, 구리 또는 알루미늄으로 형성하는 것이 바람직하다.In a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the metal electrode is preferably formed of gold, chromium, copper, or aluminum.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 정방향 프라이머는 서열번호 1의 염기서열을 갖는 올리고뉴클레오티드, 상기 역방향 변형 프라이머는 서열번호 2의 염기서열을 갖는 올리고뉴클레오티드, 상기 제1 뉴클레오티드 올리고머는 서열번호 3의 염기서열을 갖는 올리고뉴클레오티드, 그리고 상기 제2 뉴클레오티드 올리고머는 서열번호 4의 염기서열을 갖는 올리고뉴클레오티드일 수 있다.The forward primer is an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1, and the reverse-direction strand primer is a nucleotide sequence of SEQ ID NO: 2 The first nucleotide oligomer may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 3, and the second nucleotide oligomer may be an oligonucleotide having a nucleotide sequence of SEQ ID NO: 4.

본 발명의 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩에 있어서, 상기 제1 기판은 N형 또는 P형 실리콘 기판 상의 SiO2 절연층 위에 적어도 2개의 금속 전극이 형성된 것으로서 표적 폴리뉴클레오티드의 증폭여부 또는 존재여부의 확인을 위한 전기적인 검출을 수행한다. 상기 제2 기판은 상기 제1기판의 금속 전극이 외부 환경과 접촉되는 것을 방지하면서 상기 제1 기판과 결합하여 반응챔버 공간을 형성한다. 이러한 본 발명의 일실시예의 바이오 칩은 PCR 반응 칩에 적용될 수 있다.In a biochip for electrically detecting a target polynucleotide using conductive particles according to an embodiment of the present invention, the first substrate is formed by forming at least two metal electrodes on an SiO 2 insulating layer on an N-type or P-type silicon substrate And performs electrical detection to confirm whether or not the amplification of the target polynucleotide is amplified. The second substrate prevents the metal electrode of the first substrate from being in contact with the external environment, and forms a reaction chamber space by combining with the first substrate. The biochip of this embodiment of the present invention can be applied to a PCR reaction chip.

상기 기판들은 정사각형, 직사각형, 원형의 형상을 가질 수 있으나, 본 발명은 이에 제한되는 것은 아니다. 상기 제1 기판은 실리콘 기판이고, 상기 제2 기판은 유리 기판인 것이 바람직하나, 이들 기판은 이외에도 유리, 실리콘 기판, 융합 실리카, 폴리스티렌, 폴리메틸아크릴레이트, 폴리카보네이트, 금, 은, 구리, 또는 백금 중 어느 하나로 구성될 수 있다.The substrates may have a square, rectangular, or circular shape, but the present invention is not limited thereto. Preferably, the first substrate is a silicon substrate and the second substrate is a glass substrate. Alternatively, the substrate may be glass, a silicon substrate, fused silica, polystyrene, polymethyl acrylate, polycarbonate, gold, Platinum. ≪ / RTI >

또한, 본 발명의 다른 일실시예의 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩은 상기 제2기판 상에 제3기판이 적층되는 3단 방식의 바이오 칩으로 구성될 수 있다.In addition, a biochip for electrically detecting a target polynucleotide using conductive particles according to another embodiment of the present invention may be composed of a three-stage biochip in which a third substrate is stacked on the second substrate.

본 발명에 따르면 전술한 바와 같은 종래의 바이오 칩에서 전기화학적 방식을 이용하는 경우 완충용액 문제, 복잡한 생물학적, 생화학적 또는 화학적 반응 문제가 발생하여 전기적 검출 방식의 신뢰도를 떨어뜨리는 문제, 그리고 교류를 사용하여 임피던스의 변화를 측정하는 방식에서 나타나는 검출재현성 및 민감도 문제와, 교류 주파수 대역 설정과 관련한 문제점 및 불편을 해결할 수 있다.According to the present invention, when the electrochemical method is used in the conventional biochip as described above, problems of buffer solution, complicated biological, biochemical, or chemical reaction occur and the reliability of the electrical detection method is lowered. It is possible to solve the problem of detection reproducibility and sensitivity and the problem and inconvenience related to the setting of the alternating frequency band which appear in the method of measuring the change of the impedance.

구체적으로, 본 발명에 따르면 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출할 수 있다.Specifically, according to the present invention, the connection of the conductive particles with the target polynucleotides extended in a fixed state on the surface of the metal electrodes and the formation of the conductive bridge between the metal electrodes through the connection between the conductive particles (chain formation) , It is possible to easily and precisely and electrically detect whether the amplification and / or the amplification of the target polynucleotide is present regardless of the kind of the target polynucleotide to be detected.

특히, 본 발명에 따르면 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출할 수 있다.Particularly, according to the present invention, by the connection of the conductive particles with the target polynucleotides extended in a fixed state on the surface of the metal electrodes and the formation of the conductive bridge between the metal electrodes through the connection (chain formation) Current is applied between the metal electrodes by application of direct current or alternating current power to detect whether the target polynucleotide is amplified and / or not, regardless of the type of the target polynucleotide to be detected through detection of the direct current or the alternating current signal, It can be precisely detected electrically.

도 1은 본 발명의 일실시예에서 금속 전극들 표면에 고정된 정방향 고정 프라이머와, 역방향 변형 프라이머를 이용하여 금속 전극들 표면에 고정된 상태로 표적 폴리뉴클레오티드를 PCR 증폭하는 과정과 증폭산물을 개략적으로 설명하는 도면이다.
도 2는 본 발명의 일실시예에서 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 금속 전극 사이의 통전이 이루어지는 과정을 설명하는 도면이다.
도 3은 본 발명의 일실시예의 IDE 형태의 금속 전극들을 도시한 평면도이다.
도 4는 본 발명의 일실시예에 있어서, 실리콘 기판(10)상에 산화절연막(12)을 사이에 두고 단순한 플러스 금속 전극(20a)과 마이너스 금속 전극(20b)이 형성된 경우를 도시하는 단면도이다.
도 5는 도 3에 도시된 바와 같은 플러스 단자에 양극 전원을 연결하고 마이너스 단자에 음극 전원을 연결한 후 500mV의 직류(DC)를 인가하여 측정한 전류값 그래프이다.
도 6은 본 발명의 일실시예에 사용되는 PCR 반응 칩(200)의 단면을 도시하는 도면이다.FIG. 1 is a diagram illustrating a process of PCR amplification of a target polynucleotide in a state where it is immobilized on the surface of metal electrodes using a forward-direction fixing primer fixed to the surface of metal electrodes in the embodiment of the present invention, Fig.
FIG. 2 is a graph showing the relationship between the conductive particles and the conductive polynucleotides of the target polynucleotides extending in a fixed state on the surface of the metal electrodes in the embodiment of the present invention, FIG. 2 is a view for explaining a process of conducting electricity between metal electrodes by forming a metal electrode.
3 is a plan view showing the metal electrodes of the IDE type in one embodiment of the present invention.
4 is a cross-sectional view showing a case where a simple positive metal electrode 20a and a negative metal electrode 20b are formed on the silicon substrate 10 with the oxide insulating film 12 interposed therebetween in the embodiment of the present invention .
5 is a graph of a current value measured by connecting a positive power source to a positive terminal as shown in FIG. 3, connecting a negative power source to a negative terminal, and applying a direct current (DC) of 500 mV.
6 is a cross-sectional view of a PCR reaction chip 200 used in an embodiment of the present invention.

이하, 본 발명을 실시예에 기초하여 보다 상세히 기술한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. 본 발명에 인용된 참고문헌은 본 발명에 참고로서 통합된다.
Hereinafter, the present invention will be described in more detail based on examples. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. The references cited in the present invention are incorporated herein by reference.

실시예Example

실시예 1 : 정방향 고정 프라이머 및 역방향 변형 프라이머 등의 준비Example 1 Preparation of Forward Fixing Primer and Reverse Strain Primer

1) 금속 전극에 한쪽 말단, 예를 들어 5'말단이 고정되고 표적 폴리뉴클레오티드를 특이적으로 증폭하는 정방향 고정 프라이머와, 표적 폴리뉴클레오티드를 특이적으로 증폭하는 역방향 프라이머의 한쪽 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열 또는 이에 상보적인 서열을 추가한 역방향 변형 프라이머 등을 준비한다.
1) a forward fixing primer having one end, for example, a 5 'end fixed to the metal electrode and specifically amplifying the target polynucleotide; and a base primer of a genomic gene at one end of the reverse primer that specifically amplifies the target polynucleotide A non-homologous base sequence which does not hybridize with the genomic gene complementarily or a reverse-direction mutagenic primer in which a sequence complementary thereto is added is prepared as a base sequence having no homology with the sequence.

2) 우선, 이를 위해 본 실시예에서는 Promega 사의 GoTaq® PCR Core System II(Promega, M7665)의 DNA 주형(323bp)을 표적 폴리뉴클레오티드로서 선정하고, 상기 표적 폴리뉴클레오티드의 양쪽 말단에 각각 특이적인 정방향 고정 프라이머 및 역방향 프라이머는 상기 DNA 주형의 제조사가 제공하는 프라이머 염기서열을 사용하여 준비한다. 또한, 상기 제조사에서 제공하는 역방향 프라이머(5'-AGCCGCCGTCCCGTCAAGTCAG-3')의 5' 말단에 집코드 서열(5'-CGCGCGCAGCTGCAGCTTGCTCATG-3')을 추가하여 변형시킨 역방향 변형 프라이머를 제작할 수 있다(도 1 참조). 제작된 정방향 고정 프라이머 및 역방향 변형 프라이머의 염기서열은 다음과 같다. 아래의 역방향 변형 프라이머의 염기서열 중 밑줄친 부분은 집코드 서열이다.
2) First, in this Example, a DNA template (323 bp) of GoTaq ® PCR Core System II (Promega, M7665) from Promega was selected as a target polynucleotide, and specific forward and reverse primers were attached to both ends of the target polynucleotide, The primer and the reverse primer are prepared using the primer sequence provided by the manufacturer of the DNA template. Further, a reverse-direction modification primer can be prepared by modifying the 5'-end of the reverse primer (5'-AGCCGCCGTCCCGTCAAGTCAG-3 ') provided by the manufacturer by adding a home-coding sequence (5'-CGCGCGCAGCTGCAGCTTGCTCATG-3' Reference). The nucleotide sequences of the prepared forward and reverse primer primers are as follows. The underlined part of the nucleotide sequence of the reverse-reverse primer shown below is a homologous sequence.

① 정방향 고정 프라이머:① Forward fixing primer:

5'-SH-(PEG)-GCCATTCTCACCGGATTCAGTCGTC-3' (서열번호 1)5'-SH- (PEG) -GCCATTCTCACCGGATTCAGTCGTC-3 '(SEQ ID NO: 1)

② 역방향 변형 프라이머:② Reverse strain primer:

5'-CGCGCGCAGCTGCAGCTTGCTCATGAGCCGCCGTCCCGTCAAGTCAG-3' (서열번호 2)
5'- CGCGCGCAGCTGCAGCTTGCTCATG AGCCGCCGTCCCGTCAAGTCAG-3 '(SEQ ID NO: 2)

3) 한편, 집코드 서열은 게놈 DNA의 염기서열에 없는 서열을 갖는 뉴클레오티드 올리고머로서 게놈 DNA와 비특이적으로 혼성화되지 않도록 설계된 서열이다. 본 발명의 실시예들에서 사용된 집코드 서열은 오로지 설명을 위한 예시로서 거론된 것이며 본 발명을 제한하기 위한 것이 아님을 밝혀 둔다. 본 발명이 속하는 기술분야의 당업자라면 본 발명의 실시예들에서 사용된 집코드 서열 이외에도 당업계에 알려진 다양한 집코드 서열들을 사용하여 프라이머를 변형시킬 수 있음을 용이하게 이해할 것이다(참고문헌: Slentz-Kesler et al., Polymorphism Analysis Using Single Base Chain Extension A Microsphere-Based, Genome Res., 2000, 10: 549-557).
3) On the other hand, the home-coding sequence is a nucleotide oligomer having a sequence not in the nucleotide sequence of the genomic DNA, and is designed so as not to nonspecifically hybridize with genomic DNA. It is to be understood that the home code sequences used in the embodiments of the present invention are only mentioned for illustrative purposes and not for limiting the present invention. Those skilled in the art will readily appreciate that the primers can be modified using a variety of home coding sequences known in the art in addition to the home coding sequences used in embodiments of the present invention (see, e.g., Slentz- Kesler et al., Polymorphism Analysis Using Single Base Chain Extension A Microsphere-Based, Genome Res., 2000, 10: 549-557).

4) 그리고, 정방향 고정 프라이머는, 예를 들어 정방향 프라이머의 5' 말단에 PEG(폴리에틸렌글리콜) 또는 탄소사슬(-CH2-)의 스페이서를 결합시키고 다시 그 말단에 티올(thiol)기와 같은 기능기를 결합시킨 후, 티올기를 이용한 SAM(Self Assembled Method) 방법을 이용하여 상기 정방향 프라이머를 바이오 칩 내에 형성된 금속 전극 표면에 고정시킨다. 당업계에 널리 알려진 MEMS(Micro-Electro-Mechanical-Systems)기술을 이용하여 실리콘 웨이퍼 상에 IDE 형태 또는 단순한 (+) 전극과 (-)전극을 형성하고 이 위에 정방향 프라이머의 5' 말단을 고정한다. 이러한 금속 전극 형성과 뉴클레오티드 올리고머의 금속 전극 고정은 당업자라면 공지된 기술에 따라 용이하게 실시할 수 있다(대한민국 등록특허 제10-0969667호 및 제10-0969671호 등 참조). 이에 대한 내용은 후술하도록 한다.
4) For example, a forward primer can be obtained by, for example, binding a spacer of PEG (polyethylene glycol) or a carbon chain (-CH 2 -) to the 5 'end of a forward primer and then attaching a functional group such as a thiol group And then the forward primer is immobilized on the surface of the metal electrode formed in the biochip using SAM (Self Assembled Method) using a thiol group. (IDE) or simple (+) electrode and (-) electrode are formed on a silicon wafer using MEMS (Micro-Electro-Mechanical-Systems) technology well known in the art, and the 5 'end of the forward primer is fixed thereon . Such metal electrode formation and metal electrode fixing of the nucleotide oligomer can be easily carried out according to a known technique by those skilled in the art (see Korean Patent Nos. 10-0969667 and 10-0969671). The contents thereof will be described later.

5) 또한, 시료 내에 존재하는 표적 폴리뉴클레오티드의 양적 증가를 위해 비대칭 PCR 반응을 수행할 경우에는 금속 전극 표면에 고정되지 않고 자유롭게 PCR 증폭용 완충 용액에 존재하는 정방향의 프라이머도 요구되는데, 정방향의 프라이머는 금속 전극에 고정화된 정방향 고정 프라이머와는 달리 스페이서와 기능기가 붙어 있지 않아 자유롭게 용액 내에 존재하게 된다. 또한, 자유로운 정방향 프라이머는 비대칭 PCR 반응을 위해 역방향 변형 프라이머에 비해 상대적으로 낮은 농도, 예를 들어 1:8 또는 1:16 비율로 용액 내에 존재하게 된다.
5) When an asymmetric PCR reaction is performed for quantitative increase of a target polynucleotide present in a sample, a forward primer present in a buffer solution for PCR amplification is not required to be fixed on the surface of a metal electrode but is also required to be a forward primer. Unlike the forward fixing primer immobilized on the metal electrode, the spacer and the functional group are not attached to each other and are freely present in the solution. In addition, the free forward primer is present in the solution at a relatively low concentration, such as 1: 8 or 1:16, as compared to the reverse strain primer for asymmetric PCR reactions.

실시예 2: 올리고머가 부착된 제1 및 제2 전도성 입자들의 준비Example 2 Preparation of Oligomer-Attached First and Second Conductive Particles

본 실시예에서는 적어도 2개의 금속 전극 각각에 한쪽 말단이 고정된 표적 폴리뉴클레오티드 사이에서 전도성 브릿지 형성을 위해 사용되는 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자와, 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자를 준비한다. 본 실시예에서는 전도성 입자로서 골드 나노입자를 예로 들었으나, 본 발명은 이에 제한되는 것이 아니고 전도성을 갖는 나노입자라면 어느 것이라도 사용할 수 있음을 본 발명의 기술분야에 속하는 당업자라면 용이하게 이해할 것이다.
In this embodiment, a first conductive particle to which a plurality of first nucleotide oligomers are attached, which is used for forming a conductive bridge between target polynucleotides having one end fixed to each of at least two metal electrodes, and a second conductive oligomer having a base of the first nucleotide oligomer A second conductive particle to which a plurality of second nucleotide oligomers complementary to the sequence are attached is prepared. Although gold nanoparticles are used as the conductive particles in the present embodiment, the present invention is not limited thereto. Anyone skilled in the art will readily understand that any conductive nanoparticles can be used.

1) 우선, 골드 나노입자에 부착되는 뉴클레오티드 올리고머를 티올로 개질한다. 이를 위해 역방향 변형 프라이머를 이용하여 증폭된 표적 폴리뉴클레오티드의 3' 말단에 추가적으로 연장되는 서열인 5'-CATGAGCAAGCTGCAGCTGCGCGCG-3'(5'-CGCGCGCAGCTGCAGCTTGCTCATG-3'의 집코드 서열에 상보적인 서열)에 상보적인 제1 뉴클레오티드 올리고머의 염기서열(서열번호 3)을 결정하고, 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 제2 뉴클레오티드 올리고머의 염기서열(염기서열 4)을 결정한 후 티올기를 5'말단에 부착하여 제1 뉴클레오티드 올리고머 및 제2 뉴클레오티드 올리고머를 제작한다(도 2 참조). 그런 다음, 이들 뉴클레오티드 올리고머를 DTT(Dithiothreitol)로 환원 처리하여 이황화결합(disulfide bond) 상태에서 -SH기("-S-S-"→"-SH")로 전환시킴으로써 티올기의 기능기가 부착된 뉴클레오티드 올리고머를 수득한다. 한편, 뉴클레오티드 올리고머는 티올기 이외에도 다양한 나노입자 부착을 위한 기능기, 예를 들어 전도성 폴리머와 같은 기능기로 개질될 수 있다.
1) First, nucleotide oligomers attached to gold nanoparticles are modified with thiol. To this end, a complementary sequence to 5'-CATGAGCAAGCTGCAGCTGCGCGCG-3 '(sequence complementary to the homologous sequence of 5'-CGCGCGCAGCTGCAGCTTGCTCATG-3'), a sequence further extending at the 3'end of the amplified target polynucleotide using a reverse strain primer The nucleotide sequence (SEQ ID NO: 3) of the first nucleotide oligomer was determined, and the nucleotide sequence (nucleotide sequence 4) of the second nucleotide oligomer complementary to the nucleotide sequence of the first nucleotide oligomer was determined. The thiol group was then attached to the 5 ' A first nucleotide oligomer and a second nucleotide oligomer are prepared (see Fig. 2). Subsequently, these nucleotide oligomers are reduced with DTT (Dithiothreitol) to convert them into a -SH group ("-SS-" → "-SH") in a disulfide bond state to form a nucleotide oligomer having a functional group of a thiol group . On the other hand, the nucleotide oligomer may be modified to a functional group such as a functional polymer for attaching various nanoparticles in addition to the thiol group, for example, a conductive polymer.

2) 상업적으로 입수가능한 직경 13nmm의 골드 나노입자 콜로이드(골드 클로라이드 농도 0.01%, 용량 100ml; 영국에 소재하는 BBInternational로 부터 구입) 450㎕를 상기 1)번 과정에서 티올로 개질되고 최종 농도가 1μM로 조정된 각각의 뉴클레오티드 올리고머(제1 뉴클레오티드 올리고머 및 제2 뉴클레오티드 올리고머) 50㎕와 혼합하여 전체 부피가 500㎕가 되도록 한다. 그리고, 2가지 혼합용액 각각을 25℃에서 24시간 동안 인큐베이션하면서 100rpm으로 지속적으로 교반하여 골드 나노 입자 콜로이드에 제1 뉴클레오티드 올리고머 또는 제2 뉴클레오티드 올리고머를 고정화시킨다.
2) Commercially available gold nanoparticle colloid (gold chloride concentration 0.01%, volume 100 ml; purchased from BBInternational, UK) having a diameter of 13 nm was modified with thiol in the above step 1) to a final concentration of 1 μM Mixed with 50 μl of each of the adjusted nucleotide oligomers (first nucleotide oligomer and second nucleotide oligomer) so that the total volume is 500 μl. Then, each of the two mixed solutions is continuously stirred at 100 rpm while being incubated at 25 캜 for 24 hours to fix the first nucleotide oligomer or the second nucleotide oligomer to the gold nanoparticle colloid.

3) 그리고 나서, 상기 2)번 과정이 완료된 2가지 혼합용액 각각에 2×농도의 에이징 버퍼(Aging Buffer)(0.1M Nacl + 0.01M 소듐 포스페이트) 500㎕를 첨가하고 실온에서 40시간 동안 인큐베이션한다. 또한, 50mM 소듐 포스페이트(sodium phosphate)와 1M NaCl로 이루어진 SPSC 버퍼(pH 6.5)로 씻어내어 골드 나노입자에 비-공유적으로 결합된 뉴클레오티드 올리고머들을 제거한다.
3) Then, 500 μl of a 2 × concentration Aging Buffer (0.1 M Nacl + 0.01 M sodium phosphate) was added to each of the two mixed solutions completed in the above 2) procedure and incubated at room temperature for 40 hours . It is also washed with SPSC buffer (pH 6.5) consisting of 50 mM sodium phosphate and 1M NaCl to remove non-covalently bound nucleotide oligomers to the gold nanoparticles.

4) 상기 3)번 과정을 통해 얻은 2가지 혼합용액 각각을 30분 동안 16,100g로 원심분리한 후 제1 뉴클레오티드 올리고머 또는 제2 뉴클레오티드 올리고머가 부착된 골드 나노입자들을 침전시킨 다음 상층액을 제거하고, 재차 에이징 버퍼 500㎕를 첨가하여 혼합한다.
4) Each of the two mixed solutions obtained in the above step 3) was centrifuged at 16,100 g for 30 minutes, and gold nanoparticles having a first nucleotide oligomer or a second nucleotide oligomer were precipitated and then the supernatant was removed , And 500 에이 of aging buffer is added again and mixed.

5) 상기 4)번 과정을 2회 반복하여 제1 뉴클레오티드 올리고머 또는 제2 뉴클레오티드 올리고머가 부착된 골드 나노입자들 (G1 또는 G2)을 수득한다.
5) The gold nanoparticles (G1 or G2) having the first nucleotide oligomer or the second oligonucleotide oligomer are obtained by repeating the above step 4) twice.

6) 상기 5)번 과정에서 수득된 제1 뉴클레오티드 올리고머 또는 제2 뉴클레오티드 올리고머가 부착된 골드 나노입자들 (G1 또는 G2)에 에이징 버퍼 250㎕를 첨가하여 보관한다.
6) 250 에이 of aging buffer is added to gold nanoparticles (G1 or G2) having the first nucleotide oligomer or second nucleotide oligomer attached thereto obtained in the above step 5).

7) 본 실시예를 통해 수득된 제1 뉴클레오티드 올리고머 또는 제2 뉴클레오티드 올리고머가 부착된 골드 나노입자들(G1 또는 G2)의 혼합용액은 후술하는 실시예에서의 사용 전에 버퍼를 1X PBS 버퍼로 교체한 후 30분 동안 16,100g로 원심분리하고, 상층액을 제거한 다음 1X PBS 버퍼 250㎕를 첨가한다. 그리고 이 과정을 1회 더 반복한 후 1X PBS 버퍼를 첨가하여 전체 용량을 250㎕로 맞춘다.
7) A mixed solution of the first nucleotide oligomer or the second nucleotide oligomer-adhered gold nanoparticles (G1 or G2) obtained through this example was replaced with a 1X PBS buffer before use in the following examples Centrifuge at 16,100 g for 30 minutes, remove the supernatant, and add 250 1 of 1X PBS buffer. This procedure is repeated one more time, and 1X PBS buffer is added to adjust the total volume to 250 μl.

한편, 본 실시예에서는 전도성 입자의 일례로서 골드 나노입자를 사용하였지만, 본 발명은 이에 제한되는 것이 아니고, 예를 들어 실버 파티클, 크롬 파티클, 구리 파티클, 알루미늄 파티클, 산화철 나노입자, 자성 비드 또는 내부에 산화철을 포함하는 폴리머 비드 등과 같이 전도성을 갖는 당업계에 알려진 다양한 크기와 재질의 입자를 사용할 수 있다. 즉, 전원을 인가하면 통전되어 저항값, 전류값 등의 변화를 가져올 수 있는 입자라면 어느 것이라도 사용이 가능하다.
In the present embodiment, gold nanoparticles are used as an example of conductive particles. However, the present invention is not limited thereto. For example, silver particles, chrome particles, copper particles, aluminum particles, iron oxide nanoparticles, Particles of various sizes and materials known in the art having conductivity such as polymer beads containing iron oxide may be used. That is, any particle can be used as long as it is energized when a power source is applied to change the resistance value and the current value.

실시예 3: PCR 반응 칩을 구성하는 금속 전극의 제작Example 3: Fabrication of a metal electrode constituting a PCR reaction chip

본 발명의 일실시예에서 사용되는 바이오 칩은 당업계에 알려진 일반적인 방법을 이용하여 제작하는데, 산화 실리콘 박막 형성 기술, 포토리소그래피(photolithography)기술, 노광 패너팅 기술, 현상 기술, 습식 및/또는 건식 에칭 기술 등을 사용하여 제작한다. 예를 들어, PCR 반응 칩은 당업계에 알려진 방법을 이용하여 제작하는데, 실리콘 기판과 전극 부분은 산화 실리콘 박막 형성 기술, 포토리소그래피(photolithography)기술, 노광 패너팅 기술, 현상 기술, 습식 및/또는 건식 에칭 기술 등을 사용하여 제작한다. 그리고, MEMS(Micro-Electro-Mechanical-Systems)기술을 이용하여 실리콘 기판 상에 IDE(Interdigitated Electrode) 형태의 금속 전극을 형성한 후, 전술한 바와 같은 정방향 고정 프라이머를 금속 전극에 고정하는 방식으로 제작된다. 본 발명의 일실시예에서 사용되는 PCR 반응 칩은 당업계에 널리 알려진 방법에 따라 당업자라면 용이하게 제작할 수 있으므로 그 상세한 설명을 생략한다(대한민국 등록특허 제10-0969667호 및 제10-0969671호 등 참조).The biochip used in one embodiment of the present invention is fabricated using a general method known in the art, including a silicon oxide thin film forming technique, a photolithography technique, an exposure panneling technique, a developing technique, a wet and / Etching technique or the like. For example, PCR reaction chips are fabricated using methods known in the art, and the silicon substrate and electrode portions may be fabricated using techniques such as silicon oxide thin film formation techniques, photolithography techniques, exposure patterning techniques, Dry etching technique or the like. Then, a metal electrode in the form of an IDE (Interdigitated Electrode) is formed on a silicon substrate by using MEMS (Micro-Electro-Mechanical-Systems) technology, and then the above-described forward fixing primer is fixed to the metal electrode do. The PCR reaction chip used in one embodiment of the present invention can be easily manufactured by those skilled in the art according to a method well known in the art, and therefore, a detailed description thereof will be omitted (Korean Patent Nos. 10-0969667 and 10-0969671 Reference).

도 3에는 후술하는 PCR 반응 칩(200)을 구성하는 바이오센서(100)의 평면도가 도시되어 있다. 도 3의 (a)에서 도시된 바이오 센서(100)는 IDE(interdigitated electrode) 형태의 금속 전극(20)과 이러한 IDE 형태의 금속 전극(20)의 양 단자(21a, 21b)에 전선이 연결되어 구성되어 있다. 3 is a plan view of the biosensor 100 constituting the PCR reaction chip 200 described later. The biosensor 100 shown in FIG. 3A is connected to a metal electrode 20 in the form of an IDE (interdigitated electrode) and to both terminals 21a and 21b of the IDE type metal electrode 20 Consists of.

도 3의 (b)는 도 3의 (a)에 도시된 IDE 형태의 금속 전극(20)과 양 단자(21a 21b)를 확대하여 모식적으로 나타낸 도면이다. 도 3의 (b)에서 확인할 수 있는 바와 같이 IDE 형태의 금속 전극(20)은 손가락 형상의 한 쌍의 전극(20a, 20b)이 서로 일정한 간격을 두고 엇갈리게 배열되어 있다. 그리고, 포지티브 전위가 인가되는 플러스 단자(21a)에 IDE 금속 전극(20)의 플러스 금속 전극들(20a)이 분기되어 전기적으로 연결되어 있고, 네거티브 전위가 인가되는 마이너스 단자(21b)에 IDE 금속 전극(20)의 마이너스 금속 전극들(20b)이 분기되어 전기적으로 연결되어 있다. 3B is an enlarged view schematically showing the IDE type metal electrode 20 and both terminals 21a 21b shown in FIG. 3A. As can be seen from FIG. 3 (b), the IDE-type metal electrode 20 has a finger-shaped pair of electrodes 20a and 20b staggered at a predetermined interval from each other. The positive metal electrodes 20a of the IDE metal electrode 20 are branched and electrically connected to the positive terminal 21a to which the positive electric potential is applied and the negative metal electrode 21b to which the negative electric potential is applied is connected to the IDE metal electrode And the negative metal electrodes 20b of the negative electrode 20 are branched and electrically connected.

한편, IDE 형태의 금속전극의 면적은 약 1㎛ ×1㎛에서 수백 ㎛ ×수백 ㎛의 면적일 수 있고, 표적 폴리뉴클레오티드의 PCR 증폭산물의 증폭량에 맞추어 전체 IDE의 면적을 선정할 수 있다. On the other hand, the area of the metal electrode of the IDE type may be about 1 탆 1 탆 to several hundred 탆 x several hundred 탆, and the area of the entire IDE can be selected in accordance with the amplification amount of the PCR amplification product of the target polynucleotide.

도 3의 (c)에는 손가락 형상의 한 쌍의 전극(20a, 20b)을 일부 확대한 것이 도시되어 있다. 각 금속 전극(20a, 20b) 폭(t)은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 2μm ∼ 4μm이고, 금속 전극 사이의 간격(d)은 대략 10nm ∼ 100μm일 수 있으며 바람직하기로는 대략 1μm ∼ 2μm이다. 후술하는 실험에서는 정량적 분석을 위해 IDE 형태의 금속 전극의 면적을 약 500㎛ ×500㎛으로 하고, 금속 전극 사이의 간격(d)은 약 1.7μm 그리고 각 금속 전극의 폭(t)은 약 4μm로 하였다. Fig. 3 (c) shows a finger-shaped pair of electrodes 20a and 20b partially enlarged. The width t of each of the metal electrodes 20a and 20b may be approximately 10 nm to 100 μm and is preferably approximately 2 μm to 4 μm and the distance d between the metal electrodes may be approximately 10 nm to 100 μm, To 2 m. For the quantitative analysis, the area of the metal electrode of the IDE type is about 500 μm × 500 μm, the distance d between the metal electrodes is about 1.7 μm, and the width t of each metal electrode is about 4 μm Respectively.

도 4에는 실리콘 기판(10)상에 산화절연막(12)을 사이에 두고 단순한 플러스 금속 전극(20a)과 마이너스 금속 전극(20b)이 형성된 경우가 도시되어 있다.4 shows a case where a simple positive metal electrode 20a and a negative metal electrode 20b are formed on the silicon substrate 10 with the oxide insulating film 12 interposed therebetween.

또한, 도 3 및 도 4에 도시된 금속 전극(20a, 20b) 상에는 정방향 고정 프라이머가 고정될 수 있다. 즉, 전술한 바와 같은 정방향 고정 프라이머(서열번호 1)의 5' 말단에 PEG(폴리에틸렌글리콜) 또는 탄소사슬(-CH2-)의 스페이서를 결합시키고 다시 그 말단에 티올(thiol)기와 같은 기능기를 결합시킨 후, 티올기를 이용한 SAM(Self Assembled Method) 방법을 이용하여 상기 정방향 고정 프라이머를 플러스 금속 전극들(20a) 및 마이너스 금속 전극들(20b) 표면에 고정시킬 수 있다. 이러한 정방향 고정 프라이머의 금속 전극 고정은 당업자라면 공지된 기술에 따라 용이하게 실시할 수 있으므로 그 상세한 설명을 생략한다(대한민국 등록특허 제10-0969667호 및 제10-0969671호 등 참조).In addition, a forward fixing primer may be fixed on the metal electrodes 20a and 20b shown in FIGS. That is, a spacer of PEG (polyethylene glycol) or a carbon chain (-CH 2 -) is bonded to the 5 'end of the forward fixing primer (SEQ ID NO: 1) as described above, and a functional group such as a thiol group The positive fixed primer may be fixed to the surfaces of the positive metal electrodes 20a and the negative metal electrodes 20b by using a SAM (Self Assembled Method) method using a thiol group. The fixing of the metal electrode of the forward fixing primer can be easily carried out according to a known technique by those skilled in the art, so that a detailed description thereof will be omitted (see Korean Patent Nos. 10-0969667 and 10-0969671).

한편, 티올기 외에도 정방향 고정 프라이머와 전도성 폴리머를 결합시킨 후, 정방향 고정 프라이머와 결합되어 있는 전도성 폴리머를 공지된 SAM(Self Assembled Method) 방법을 이용하여 금속 전극 표면에 고정시킬 수 있다. 상기 전도성 폴리머로는 공지된 전도성 폴리머가 모두 사용될 수 있으며, 예를 들어, 특히 고전도성 폴리머인 폴리아세틸렌(Polyacetylene), 폴리(p-페닐렌) (Poly(p-phenylene): PPP), 폴리피롤(Polypyrrole: PPy), 폴리아닐린(Polyaniline), 폴리티오펜(Polythiophene) 등이 사용될 수 있다. 전도성 폴리머와 정방향 고정 프라이머는 폴리머와 DNA간의 공지된 결합방법을 이용하여 결합시킬 수 있다.
In addition to the thiol group, the conductive polymer combined with the forward fixing primer and the conductive polymer may be fixed to the surface of the metal electrode using a known SAM (Self Assembled Method) method. As the conductive polymer, any conductive polymer known in the art may be used. For example, highly conductive polymers such as polyacetylene, poly (p-phenylene) (PPP), polypyrrole Polypyrrole: PPy, polyaniline, and polythiophene. The conductive polymer and the forward-direction immobilized primer can be bound using a known bonding method between the polymer and DNA.

실시예 4: PCR 반응 칩의 제작Example 4: Production of PCR reaction chip

한편, 도 3에 도시된 바와 같은 금속 전극(20a, 20b)들과 이러한 금속 전극(20a, 20b)에 고정된 정방향 고정 프라이머(22)를 이용하여 반응 챔버 공간(46)을 갖는 전극 어레이형 PCR 반응 칩(200)을 구성할 수 있다. 그 일례가 도 6에 도시되어 있다. 이러한 형태의 전극 어레이형 PCR 반응 칩(200)의 제작은 전술한 바와 같은 공지기술을 이용하여 제작할 수 있음을 본 발명이 속하는 기술분야의 당업자라면 용이하게 이해할 것이다. The electrode array type PCR having the reaction chamber space 46 using the metal electrodes 20a and 20b as shown in FIG. 3 and the forward fixing primer 22 fixed to the metal electrodes 20a and 20b, The reaction chip 200 can be constituted. An example thereof is shown in Fig. It will be easily understood by those skilled in the art that the electrode array type PCR reaction chip 200 of this type can be fabricated using known techniques as described above.

도 6에는 유리 웨이퍼(30)를 사이에 두고 상부 전극이 형성된 실리콘 기판(10a)과 하부 전극이 형성된 실리콘 기판(10b)이 접합된 3단 구조의 PCR 반응 칩이 도시되어 있다. 그러나, 본 발명은 이에 제한되는 것이 아니고, 예를 들어 실리콘기판(10)이 직접 결합된 2단 구조의 PCR 반응 칩, IDE 전극이 형성된 챔버를 갖는 PCR 반응 칩 등을 포함할 수 있다.6 shows a three-step PCR reaction chip in which a silicon substrate 10a on which an upper electrode is formed and a silicon substrate 10b on which a lower electrode are formed is sandwiched by a glass wafer 30 therebetween. However, the present invention is not limited thereto, and may include, for example, a PCR reaction chip having a two-stage structure in which a silicon substrate 10 is directly bonded, and a PCR reaction chip having a chamber in which an IDE electrode is formed.

도 6에 도시된 PCR 반응 칩(200)은 상부 전극이 형성된 실리콘 기판(10a)과 하부 전극이 형성된 실리콘 기판(10b)이 삼차원적으로 서로 마주 보는 구조로 되어 있다. 상기 PCR 반응 칩(200)에서 상부 실리콘 기판(10a) 및 하부 실리콘 기판(10b) 상에는 각각 상부 금속 전극 및 하부 금속 전극이 형성되어 있다. 상부 금속 전극 및 하부 금속 전극은 각각 산화절연막(12a, 12b)을 사이에 두고 실리콘 기판(10a, 10b)상에 형성되어 있고, 포지티브 전위가 인가되는 플러스 단자(미도시)에 전기적으로 연결되는 플러스 금속 전극들(20a)과, 네거티브 전위가 인가되는 마이너스 단자(미도시)에 전기적으로 연결되는 마이너스 금속 전극들(20b)로 구성되어 있다.The PCR reaction chip 200 shown in FIG. 6 has a structure in which a silicon substrate 10a on which an upper electrode is formed and a silicon substrate 10b on which a lower electrode is formed face each other three-dimensionally. In the PCR reaction chip 200, an upper metal electrode and a lower metal electrode are formed on the upper silicon substrate 10a and the lower silicon substrate 10b, respectively. The upper metal electrode and the lower metal electrode are formed on the silicon substrates 10a and 10b with the oxide insulating films 12a and 12b sandwiched therebetween and are electrically connected to a positive terminal (not shown) to which a positive potential is applied, Metal electrodes 20a and negative metal electrodes 20b electrically connected to a negative terminal (not shown) to which a negative potential is applied.

한편, 도 6에 도시된 바와 같이, 상부 실리콘 기판(10a)은 유리 웨이퍼(30)에 의해 일정한 거리를 두고 하부 실리콘 기판(10b)과 접합되어 반응 챔버 공간(46)을 형성한다. 상기 반응 챔버 공간(46)은 검출 대상 시료, PCR 반응 용액(DNA 중합효소 포함), 전술한 프라이머들 및 제1, 제2 도전성 입자들(G1, G2)이 수용되어 PCR 반응이 수행되는 공간이다. 상부 실리콘 기판(10a)에는 두께 방향으로 유체 유입구(36a)가 관통되어 형성되어 있으며, 상기 유체 유입구(36a)에 대향하는 위치에 두께 방향으로 유출구(36b)가 관통되어 형성되어 있다. 상기 유입구(36a)와 상기 반응챔버(46), 그리고 상기 유출구(36b)와 상기 반응챔버(46)는 유체가 유동될 수 있도록 연통되어 있다. 상기 유입구(36a)를 통해 검출대상 시료, PCR 반응용액, 전술한 프라이머들, 제1, 제2 도전성 입자들(G1, G2), 세척용액 등이 유입되고 상기 유출구(36b)를 통해 PCR 반응용액, PCR 반응 후 용액, 세척용액 등이 유출된다.
6, the upper silicon substrate 10a is bonded to the lower silicon substrate 10b at a predetermined distance by the glass wafer 30 to form a reaction chamber space 46. [ The reaction chamber space 46 is a space in which PCR is performed by receiving a sample to be detected, a PCR reaction solution (including a DNA polymerase), the primers described above, and the first and second conductive particles G1 and G2 . The upper silicon substrate 10a is formed with a fluid inlet 36a penetrating therethrough in the thickness direction and an outlet 36b penetrating the upper silicon substrate 10a in a thickness direction at a position opposite to the fluid inlet 36a. The inlet 36a and the reaction chamber 46 and the outlet 36b and the reaction chamber 46 communicate with each other to allow the fluid to flow. The PCR reaction solution, the primers, the first and second conductive particles G1 and G2 and the washing solution are introduced into the PCR reaction solution through the inlet 36a and through the outlet 36b. , The solution after the PCR reaction, the washing solution, and the like.

실시예 5: PCR 증폭 반응 및 연장 반응 수행Example 5: PCR amplification reaction and extension reaction

1) 전술한 바와 같이 실시예 3 및 실시예 4에 따라 정방향 고정 프라이머(서열번호 1)가 고정된 적어도 2개의 금속 전극(20a, 20b)과, PCR 반응 수행을 위한 반응 챔버 공간(46)을 형성한 후 PCR 반응을 수행한다 (도 3 및 도 6 참조).
1) As described above, according to Example 3 and Example 4, at least two metal electrodes 20a and 20b to which a forward fixing primer (SEQ ID NO: 1) is immobilized, and a reaction chamber space 46 for performing a PCR reaction And the PCR reaction is performed (see FIGS. 3 and 6).

2) 도 1의 (a) 내지 (e)에서는 본 실시예에서 수행되는 PCR 증폭과정과 증폭산물을 개략적으로 설명하고 있다. 본 실시예에 따르면, 금속 전극에 고정된 정방향 고정 프라이머(서열번호 1) 및 자유로운 정방향의 프라이머와, 역방향 변형 프라이머(서열번호 2)를 이용하여 PCR 증폭을 수행함으로써 금속 전극에 고정된 표적 폴리뉴클레오티드의 PCR 증폭 산물이 생성되는 동시에 그 3'말단에 제1 전도성 입자에 부착된 제1뉴클레오티드 올리고머가 상보적으로 결합하는 추가 염기서열(본 실시예에서는 5'-CGCGCGCAGCTGCAGCTTGCTCATG-3'의 집코드 서열에 상보적인 서열인 5'-CATGAGCAAGCTGCAGCTGCGCGCG-3')이 추가적으로 연장하여 생성된다(도 1의 (e) 참조).
2) In FIGS. 1 (a) to (e), the PCR amplification process and the amplification product performed in the present embodiment are schematically described. According to this embodiment, PCR amplification is carried out using a forward fixing primer (SEQ ID NO: 1) fixed to a metal electrode, a free forward primer and a reverse strain primer (SEQ ID NO: 2) to form a target polynucleotide And a second nucleotide oligomer complementary to the first nucleotide oligomer attached to the first conductive particle at the 3 'end thereof (in this example, 5'-CGCGCGCAGCTGCAGCTTGCTCATG-3'(5'-CATGAGCAAGCTGCAGCTGCGCGCG-3') which is a complementary sequence is further extended (see Fig. 1 (e)).

3) 전술한 2)번 과정의 PCR 반응을 수행하기 위해, 2X PCR 마스터 믹스 용액(Master mix solution)(i-StarMAX II)(대한민국 경기도 성남시 소재의 주식회사 인트론 바이오테크놀로지로부터 구입) 12㎕에 증폭대상이 되는 표적 폴리뉴클레오티드(GoTaq® PCR Core System II의 DNA 주형) 1㎕와, 상기 실시예 1에서 준비된 프라이머들 (서열번호 1 내지 서열번호 2) 2㎕를 넣고, 2차 증류수를 9㎕ 추가하여 보관용 용액의 부피를 24㎕로 맞춘다. 그리고 다음의 조건으로 PCR 반응을 수행한다.3) In order to carry out the PCR reaction of the above-mentioned 2) process, 12 μl of a 2 × PCR master mix solution (i-StarMAX II) (purchased from Intron Biotechnology Co., Ltd., Seongnam, Gyeonggi- 1 μl of the target polynucleotide (GoTaq ® PCR Core System II) and 2 μl of the primers (SEQ ID NO: 1 to SEQ ID NO: 2) prepared in Example 1 were added and 9 μL of secondary distilled water was added Set the volume of the storage solution to 24 μl. The PCR reaction is carried out under the following conditions.

95℃ 5분95 ℃ 5 min

95℃ 30초, 55℃ 30초, 72℃ 30초 (30 사이클)95 ° C for 30 seconds, 55 ° C for 30 seconds, 72 ° C for 30 seconds (30 cycles)

72℃ 5분.
72 ° C for 5 minutes.

4) 상기 3)번 과정에서 증폭되어 칩 내의 금속 전극 표면에 고정된 표적 폴리뉴클레오티드의 이중 사슬을 단일 사슬로 변성시킨다. 즉, PCR 증폭 과정이 끝난 후, 반응 용액이 수용된 반응 챔버를 약 95℃로 가열하고 동시에 약 95℃의 세척용 버퍼(washing buffer)를 사용하여 반응 챔버 내의 용액을 제거한다. 이와 같이 하면 금속 전극 표면에서 증폭된 표적 폴리뉴클레오티드의 PCR 산물 중 금속 전극 표면에 고정된 정방향 고정 프라이머에 의해 연장된 단일 사슬의 표적 폴리뉴클레오티드만이 남게 되고 변성 과정에 의해 금속 전극 표면으로부터 이탈된 ss-DNA는 세척용 버퍼에 의해 완전히 제거되어 도 1의 (e) 상태에서 도 2의 (f) 상태로 전환된다.
4) The double strand of the target polynucleotide amplified in the above step 3) and fixed on the surface of the metal electrode in the chip is denatured into a single chain. That is, after completion of the PCR amplification process, the reaction chamber containing the reaction solution is heated to about 95 ° C and at the same time, the solution in the reaction chamber is removed using a washing buffer at about 95 ° C. In this way, only the target polynucleotide of a single chain extending by the forward-direction fixed primer fixed on the surface of the metal electrode among the PCR products of the target polynucleotide amplified on the surface of the metal electrode is left, and ss -DNA is completely removed by the wash buffer and is switched from the state of FIG. 1 (e) to the state of FIG. 2 (f).

5) 그리고 복수개의 제1 뉴클레오티드 올리고머(서열번호 3)가 부착된 적어도 2개의 제1 전도성 입자(G1)를 반응 챔버 내로 도입하여, 상기 2)번 과정에서 설명된 바와 같이 표적 폴리뉴클레오티드의 3'말단에 추가로 연장된 염기서열에는 상기 제1 전도성 입자(G1)에 부착된 복수개의 제1 뉴클레오티드 올리고머(서열번호 3) 중 어느 하나가 아래와 같은 조건(표 1 및 표 2 참조)하에서 어닐링(혼성화)되도록 한다(도 2의 (g) 참조). 그런 다음 PCR 반응 용액 (주형과 프라이머는 없음)을 반응 챔버에 주입하여 아래와 같은 조건(표 1 및 표 3 참조)으로 한번의 연장 반응(extension)을 진행한다(도 2의 (h) 참조). 이로써 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 제1 전도성 입자(G1)가 연결된다. 5), and introducing at least two first conductive particles (G1) having a plurality of first nucleotide oligomers (SEQ ID NO: 3) attached thereto into the reaction chamber to form the 3 'end of the target polynucleotide as described in step 2) (SEQ ID NO: 3) attached to the first conductive particle (G1) was subjected to annealing (hybridization) under the following conditions (see Table 1 and Table 2) (See Fig. 2 (g)). Then, a PCR reaction solution (no template and no primer) is injected into the reaction chamber, and one extension reaction is performed under the following conditions (see Table 1 and Table 3) (see FIG. 2 (h)). Whereby the first conductive particles G1 are connected to the target polynucleotide immobilized on each metal electrode.

어닐링(혼성화) 조건 및 1회 연장 반응 조건Annealing (hybridization) conditions and one extension reaction condition 과정process 온도Temperature 시간time 어닐링(혼성화)Annealing (hybridization) 66℃66 ° C 5분5 minutes 1회 연장One extension 72℃72 ℃ 2분2 minutes

어닐링(혼성화) 용액 조성Annealing (Hybridization) Solution Composition 성분ingredient 사용량usage 최종 농도Final concentration 25mM MgCl2 25 mM MgCl 2 12㎕12 μl 3mM3mM 5X 완충 용액5X buffer solution 20㎕20 쨉 l 1X1X 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자 콜로이드(G1)(0.01%)A first conductive particle colloid (G1) (0.01%) with a first nucleotide oligomer attached thereto, 65.5㎕65.5 l 1% BSA1% BSA 2.5㎕2.5 μl 0.025%0.025% 총 계sum 100㎕100 μl

연장 반응용 용액 조성Solution composition for extended reaction 성분ingredient 사용량usage 최종 농도Final concentration 25mM MgCl2 25 mM MgCl 2 12㎕12 μl 3mM3mM 5X 완충용액5X buffer solution 20㎕20 쨉 l 1X1X 10mM dNTP10 mM dNTP 2㎕2 μl 0.2mM0.2 mM Tag 5U/㎕Tag 5U / μl 1㎕1 μl 2.5U/㎕2.5 U / μl 1% BSA1% BSA 2.5㎕2.5 μl 0.025%0.025% DIW (탈이온수)DIW (deionized water) 62.5㎕62.5 l 총 계sum 100㎕100 μl

6) 상기 5)번 과정의 1회 연장 반응이 끝난 후, 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자인 골드 나노입자 G1과 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자인 골드 나노입자 G2를 동시에 섞으면서 반응 챔버에 주입한 후, 대략 10분간 상기 표 1 및 표 2의 조건과 동일한 조건 하에서 혼성화(Hybridization) 과정을 통해 골드 나노입자 G1과 G2간 체인이 형성되도록 반응시킨다. 본 과정을 통해 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 연결된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상보적으로 결합하며, 또한 추가로 도입된 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 서로 상보적으로 결합되면서 상기 제1 및 제2 전도성 입자들(G1, G2) 간의 체인 형성을 통해 금속 전극 사이에서 통전을 위한 전도성 브릿지를 형성하게 된다.
6) After completion of the one-time extension reaction in the step 5), the gold nanoparticle G1, which is the first conductive particle having the plurality of first nucleotide oligomers attached thereto, and the second conductive particle having the plurality of second nucleotide oligomers The nanoparticles G2 are injected into the reaction chamber at the same time and reacted for about 10 minutes to form a chain between the gold nanoparticles G1 and G2 through a hybridization process under the same conditions as in Table 1 and Table 2 above. Wherein at least one of the plurality of second nucleotide oligomers adhered to the second conductive particle through the process comprises at least one of a plurality of first nucleotide oligomers attached to the first conductive particle connected to the target polynucleotide immobilized on each metal electrode And at least one of a plurality of first nucleotide oligomers adhered to the further introduced first conductive particles and a plurality of second nucleotide oligomers adhered to the second conductive particles are complementary to each other, And forms a conductive bridge between the metal electrodes through the chain formation between the first and second conductive particles G1 and G2.

7) 상기 6)번의 반응이 끝난 후, 시린지 펌프를 이용하여 500㎕/분의 유속으로 PBS 완충용액을 반응 챔버에 흘려 보내어 반응하지 않은 전도성 입자인 골드 나노입자 콜로이드들을 씻어낸 후, 도 3에 도시된 바와 같은 플러스 단자(21a)에 양극 전원을 연결하고 마이너스 단자(21b)에 음극 전원을 연결한 후 500mV의 직류(DC)를 인가하여 저항값 및 전류값을 측정한다. 전기적 검출은 반응 챔버 내에 PBS 완충용액을 채운 환경에서도 가능하나 탈이온수, 질소 또는 공기환경에서도 전기적 검출이 가능하다. 그 결과는 도 5에 도시되어 있다. 도 5에서는 종래기술의 경우와는 달리, 표적 폴리뉴클레오티드 템플리트를 갖지 않는 네거티브 검출대상 시료를 대상으로 실험을 수행한 경우에는 직류인가 후에도 전류값의 변화가 없으나, 표적 폴리뉴클레오티드 템플리트를 갖는 포지티브 검출대상 시료를 대상으로 실험을 수행한 경우에는 직류인가 후에 대략 1.6 ∼ 1.8 mA의 전류값이 측정되었다. 따라서, 본 발명을 이용하면 직류인가에 대한 LOW 또는 HIGH 값의 측정으로 검출대상 시료 내에 표적 폴리뉴클레오티드가 존재하는지 여부 또는 증폭여부를 쉽고 신속하게 판정할 수 있다. 또한, 저항값을 측정하면 표적 폴리뉴클레오티드 템플리트를 갖지 않는 네거티브 검출대상 시료를 대상으로 실험을 수행한 경우에는 저항값이 약 1.4MΩ이고 표적 폴리뉴클레오티드 템플리트를 갖는 포지티브 검출대상 시료를 대상으로 실험을 수행한 경우에는 저항값이 약 300Ω으로서, 검출 대상 시료 내에 표적 폴리뉴클레오티드 템플리트의 존재여부에 따라 저항값이 크게 차이가 나는 것을 알 수 있다. 따라서, 직류인가 후 검출된 현저히 작은 저항값으로부터도 검출대상 시료 내에 표적 폴리뉴클레오티드가 존재하는지 여부 또는 증폭여부를 확인할 수 있다. 7) After the reaction of 6), the PBS buffer solution was flowed into the reaction chamber at a flow rate of 500 μl / min using a syringe pump to wash out the unreacted conductive gold nanoparticle colloids, A positive power source is connected to the positive terminal 21a as shown, a negative power source is connected to the negative terminal 21b, and a direct current (DC) of 500 mV is applied to measure the resistance value and the current value. Electrical detection is possible in an environment filled with PBS buffer solution in the reaction chamber, but also in deionized water, nitrogen or air environment. The result is shown in Fig. 5, when an experiment was conducted on a sample to be detected without a target polynucleotide template, there was no change in the current value even after application of the DC current, but in the case of a positive detection target having a target polynucleotide template When the experiment was performed on the sample, the current value of about 1.6 to 1.8 mA was measured after the direct current application. Therefore, by using the present invention, it is possible to easily and quickly determine whether or not the target polynucleotide is present in the sample to be detected by measuring the LOW or HIGH value with respect to the direct current application. In addition, when the resistance value is measured, when a test is performed on a sample to be detected which does not have a target polynucleotide template, an experiment is performed on a sample of a positive detection target having a resistance value of about 1.4 MΩ and a target polynucleotide template In one case, the resistance value is about 300 OMEGA, and it can be seen that the resistance value greatly differs depending on the presence or absence of the target polynucleotide template in the detection target sample. Therefore, it can be confirmed whether or not the target polynucleotide is present in the detection target sample or whether amplification is possible even from a remarkably small resistance value detected after application of the direct current.

따라서, 본 발명에 따르면 금속 전극들 표면에 고정된 상태로 연장시킨 표적 폴리뉴클레오티드들과 전도성 입자들의 연결 그리고 이러한 전도성 입자들 간의 연결(체인형성)을 통한 금속 전극들 사이의 전도성 브릿지 형성에 의해, 직류 또는 교류 전원의 인가에 의해서 금속 전극 사이의 통전이 이루어져 직류 또는 교류 전류 신호의 검출을 통해 검출대상이 되는 표적 폴리뉴클레오티드의 종류에 관계없이 표적 폴리뉴클레오티드의 증폭 여부 및/또는 존재 여부를 간단하면서도 정밀하게 전기적으로 검출할 수 있다.Therefore, according to the present invention, by the connection of the conductive particles with the target polynucleotides extended in a fixed state on the surface of the metal electrodes and the formation of the conductive bridge between the metal electrodes through the connection (chain formation) Current is applied between the metal electrodes by application of direct current or alternating current power to detect whether the target polynucleotide is amplified and / or not, regardless of the type of the target polynucleotide to be detected through detection of the direct current or the alternating current signal, It can be precisely detected electrically.

이상 본 발명을 상기 실시예를 들어 설명하였으나, 본 발명은 이에 제한되는 것이 아니다. 당업자라면 본 발명의 취지 및 범위를 벗어나지 않고 수정, 변경을 할 수 있으며 이러한 수정과 변경 또한 본 발명에 속하는 것임을 알 수 있을 것이다.Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. It will be understood by those skilled in the art that modifications and variations may be made without departing from the spirit and scope of the invention, and that such modifications and variations are also contemplated by the present invention.

10: 실리콘 기판
10a: 상부 전극이 형성된 실리콘 기판
10b: 하부 전극이 형성된 실리콘 기판
12, 12a, 12b: 산화절연막
20: 금속 전극
20a: 플러스 금속 전극 20b: 마이너스 금속 전극
30: 유리 웨이퍼
36a: 유입구 36b: 유출구
100: 바이오센서 200: PCR 반응 칩10: silicon substrate
10a: a silicon substrate on which an upper electrode is formed
10b: a silicon substrate on which a lower electrode is formed
12, 12a, 12b: oxide insulating film
20: metal electrode
20a: positive metal electrode 20b: negative metal electrode
30: Glass wafer
36a: Inlet port 36b: Outlet
100: Biosensor 200: PCR reaction chip

<110> KIM, Sung Jin <120> Method and biochip for detecting target polynucleotide electrically using conductive particles <130> P10-0216KR <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 gccattctca ccggattcag tcgtc 25 <210> 2 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Modified reverse primer <400> 2 cgcgcgcagc tgcagcttgc tcatgagccg ccgtcccgtc aagtcag 47 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> First nucleotide oligomer <220> <221> misc_feature <222> (1) <223> A thiol group is attached at the 5'terminal of the first nucleotide oligomer and the first nucleotide oligomers bind to a nanoparticle using the thiol group <400> 3 cgcgcgcagc tgcagcttgc tcatg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Second nucleotide oligomer <220> <221> misc_feature <222> (1) <223> A thiol group is attached at the 5'terminal of the second nucleotide oligomer and the second nucleotide oligomers bind to a nanoparticle using the thiol group <400> 4 catgagcaag ctgcagctgc gcgcg 25 <110> KIM, Sung Jin <120> Method and biochip for detecting target polynucleotide          electrically using conductive particles <130> P10-0216KR <160> 4 <170> Kopatentin 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 gccattctca ccggattcag tcgtc 25 <210> 2 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> Modified reverse primer <400> 2 cgcgcgcagc tgcagcttgc tcatgagccg ccgtcccgtc aagtcag 47 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> First nucleotide oligomer <220> <221> misc_feature <222> (1) <223> A thiol group is attached at the 5'terminal of the first          nucleotide oligomer and the first nucleotide oligomers bind to a          nanoparticle using the thiol group <400> 3 cgcgcgcagc tgcagcttgc tcatg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Second nucleotide oligomer <220> <221> misc_feature <222> (1) <223> A thiol group is attached at the 5'terminal of the second          nucleotide oligomer and the second nucleotide oligomer bind to a          nanoparticle using the thiol group <400> 4 catgagcaag ctgcagctgc gcgcg 25

Claims (12)

(a) 검출대상 시료가 수용되는 반응 챔버와, 상기 반응 챔버 내에 위치하고 상기 검출대상 시료 내의 표적 폴리뉴클레오티드를 특이적으로 증폭하는 정방향 프라이머의 한쪽 말단이 고정된 적어도 2개의 금속 전극을 구비하는 전기적 검출장치를 제공하는 단계와,
(b) 상기 표적 폴리뉴클레오티드를 특이적으로 증폭하는 역방향 프라이머의 한쪽 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열 또는 이에 상보적인 서열을 추가한 역방향 변형 프라이머를 준비하는 단계와,
(c) 상기 반응 챔버 내에서 상기 각각의 금속 전극에 고정된 정방향 프라이머와 상기 역방향 변형 프라이머를 이용하여 상기 반응 챔버 내로 도입된 검출대상 시료 내의 표적 폴리뉴클레오티드를 증폭함으로써, 한쪽 말단이 상기 각각의 금속 전극에 고정되고 다른 쪽 말단은 상기 비상동성 염기서열 또는 이에 상보적인 염기서열이 추가되어 연장된 표적 뉴클레오티드를 수득하는 단계와,
(d) 상기 (c) 단계에서 수득된 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 동일하거나 상보적인 염기서열을 갖는 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자를 준비하는 단계와,
(e) 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자를 준비하는 단계와,
(f) 상기 복수개의 제1 뉴클레오티드 올리고머가 부착된 적어도 2개의 제1 전도성 입자를 상기 반응 챔버 내로 도입하고, 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 어느 하나는 상기 (c) 단계에서 수득된 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 상보적으로 어닐링되어 연장됨으로써 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 상기 제1 전도성 입자가 연결되는 단계와,
(g) 상기 복수개의 제1 뉴클레오티드 올리고머가 부착된 적어도 하나의 제1 전도성 입자와 상기 복수개의 제2 뉴클레오티드 올리고머가 부착된 적어도 2개의 제2 전도성 입자를 상기 반응 챔버 내로 추가로 도입하고, 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 연결된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상보적으로 결합하며, 또한 추가로 도입된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 서로 상보적으로 결합되면서 상기 제1 및 제2 전도성 입자들의 연결을 통해 상기 적어도 2개의 금속 전극 사이에 전도성 브릿지를 형성하는 단계와,
(h) 상기 적어도 2개의 금속 전극에 전원을 인가한 후 전기적 변화를 측정하여 검출대상 시료 내에 표적 폴리뉴클레오티드의 존재여부를 전기적으로 검출하는 단계를 포함하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법.(a) an electrical detection system comprising a reaction chamber in which a sample to be detected is contained, and at least two metal electrodes fixed in one end of a forward primer located in the reaction chamber and specifically amplifying a target polynucleotide in the sample to be detected Providing a device,
(b) a nucleotide sequence having no homology to the nucleotide sequence of the genomic gene at one end of the reverse primer that specifically amplifies the target polynucleotide, and a non-homologous base sequence which is not complementarily hybridized with the genomic gene, Preparing a reverse strain primer having an added sequence,
(c) amplifying the target polynucleotide in the sample to be detected introduced into the reaction chamber using the forward primer fixed to each metal electrode and the reverse strain primer in the reaction chamber, The other end of which is immobilized on the electrode, the non-homologous nucleotide sequence or a complementary base sequence is added to obtain an elongated target nucleotide,
(d) a plurality of first nucleotide oligomers having a nucleotide sequence identical or complementary to the non-identical nucleotide sequence added to the other end of the target polynucleotide obtained in the step (c) Preparing a first conductive particle,
(e) preparing a second conductive particle to which a plurality of second nucleotide oligomers are attached, the second conductive particle being complementary to the base sequence of the first nucleotide oligomer;
(f) introducing at least two first conductive particles having the plurality of first nucleotide oligomers attached thereto into the reaction chamber, and any one of the plurality of first nucleotide oligomers attached to the first conductive particles is introduced into the reaction chamber, Wherein the target polynucleotide is annealed complementarily with the non-homologous base sequence or the complementary base sequence added to the other end of the target polynucleotide immobilized on each of the metal electrodes obtained in the step Connecting said first conductive particle to a polynucleotide;
(g) further introducing into the reaction chamber at least one first conductive particle to which the plurality of first nucleotide oligomers are attached and at least two second conductive particles to which the plurality of second nucleotide oligomers are attached, At least one of the plurality of second nucleotide oligomers attached to the two conductive particles is complementary to at least one of the plurality of first nucleotide oligomers attached to the first conductive particle connected to the target polynucleotide immobilized on the respective metal electrode And at least one of a plurality of first nucleotide oligomers adhered to the first conductive particles and a plurality of second nucleotide oligomers adhered to the second conductive particles are complementarily combined with each other, Through the connection of the first and second conductive particles, Forming a conductive bridge between at least two metal electrodes,
(h) electrically inspecting the presence or absence of the target polynucleotide in the sample to be detected by measuring the electrical change after applying power to the at least two metal electrodes to electrically detect the target polynucleotide / RTI &gt; 제1항에 있어서,
상기 복수개의 제1 뉴클레오티드 올리고머와 상기 복수개의 제2 뉴클레오티드 올리고머는 전도성 입자 부착을 위한 기능기로 개질된 후 각각 상기 제1 전도성 입자 및 상기 제2 전도성 입자에 부착되는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법.The method according to claim 1,
Wherein said plurality of first nucleotide oligomers and said plurality of second nucleotide oligomers are modified to functional groups for attachment of conductive particles and then attached to said first conductive particles and said second conductive particles, A method for electrically detecting a target polynucleotide. 제1항 또는 제2항에 있어서,
상기 (h) 단계에서는 직류 또는 교류 전원을 인가하여 저항값의 변화 또는 전류값의 변화를 측정하는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법.3. The method according to claim 1 or 2,
Wherein in step (h), a change in resistance value or a change in current value is measured by applying a direct current or an alternating current power to electrically detect the target polynucleotide. 제1항 또는 제2항에 있어서,
상기 적어도 2개의 금속 전극은 IDE(interdigitated electrode)로서 형성되거나 일반적인 (+) 전극과 (-)전극으로 형성되는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법.3. The method according to claim 1 or 2,
Wherein the at least two metal electrodes are formed as an interdigitated electrode (IDE) or are formed of a general positive electrode and a negative electrode. 제4항에 있어서,
상기 금속 전극의 폭은 10nm ∼ 100μm이고, 상기 금속 전극 사이의 간격은 10nm ∼ 100μm인 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 방법.5. The method of claim 4,
Wherein the width of the metal electrode is 10 nm to 100 μm and the interval between the metal electrodes is 10 nm to 100 μm. 제1기판과,
상기 제1기판 상에 형성되고 검출대상 시료 내의 표적 폴리뉴클레오티드를 특이적으로 증폭하는 정방향 프라이머의 한쪽 말단이 고정된 적어도 2개의 금속 전극과,
상기 제1기판 상에 일정한 거리를 두고 상기 제1기판과 결합하여 반응 챔버 공간을 형성하는 제2기판과,
상기 적어도 2개의 금속 전극 각각에 고정된 정방향 프라이머에 의해 특이적으로 연장되어 상기 적어도 2개의 금속 전극 각각에 한쪽 말단이 고정된 표적 폴리뉴클레오티드 사이에 전도성 브릿지 형성을 위한 조성물로서, 상기 표적 폴리뉴클레오티드를 특이적으로 증폭하는 역방향 프라이머의 한쪽 말단에 게놈 유전자의 염기서열과 상동성을 갖지 않는 염기서열로서 게놈 유전자와 상보적으로 혼성화되지 않는 비상동성 염기서열 또는 이에 상보적인 서열을 추가한 역방향 변형 프라이머와, 상기 역방향 변형 프라이머를 이용하여 상기 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 동일하거나 상보적인 염기서열을 갖는 복수개의 제1 뉴클레오티드 올리고머가 부착된 제1 전도성 입자와, 상기 제1 뉴클레오티드 올리고머의 염기서열과 상보적인 복수개의 제2 뉴클레오티드 올리고머가 부착된 제2 전도성 입자를 포함하는 전도성 브릿지 형성을 위한 조성물을 포함하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩. A first substrate,
At least two metal electrodes formed on the first substrate and one end of a forward primer that specifically amplifies a target polynucleotide in a detection target sample is immobilized,
A second substrate coupled to the first substrate at a predetermined distance on the first substrate to form a reaction chamber space;
A composition for forming a conductive bridge between target polynucleotides that are specifically extended by a forward primer fixed to each of the at least two metal electrodes and one end is fixed to each of the at least two metal electrodes, A reverse primer having a non-homologous base sequence complementary to the genomic gene or a sequence complementary thereto, as a nucleotide sequence having no homology with the nucleotide sequence of the genomic gene at one end of the specifically amplified reverse primer, and A first nucleotide oligomer having a nucleotide sequence complementary to or complementary to the non-identical nucleotide sequence added to the other end of the target polynucleotide using the reverse-direction modification primer, Conductive particles, And a second conductive particle having a plurality of second nucleotide oligomers attached thereto complementary to the base sequence of the first nucleotide oligomer, wherein the conductive particle comprises a composition for forming a conductive bridge, chip. 제6항에 있어서,
상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 어느 하나는 상기 각각의 금속 전극에 한쪽 말단이 고정된 상기 표적 폴리뉴클레오티드의 다른 쪽 말단에 추가된 상기 비상동성 염기서열 또는 이에 상보적인 염기서열과 상보적으로 어닐링되어 연장됨으로써 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 상기 제1 전도성 입자가 연결되고, 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 상기 각각의 금속 전극에 고정된 표적 폴리뉴클레오티드에 연결된 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상보적으로 결합하며, 또한 상기 제1 전도성 입자에 부착된 복수개의 제1 뉴클레오티드 올리고머 중 적어도 하나와 상기 제2 전도성 입자에 부착된 복수개의 제2 뉴클레오티드 올리고머 중 적어도 하나는 서로 상보적으로 결합되면서 상기 제1 및 제2 전도성 입자들의 연결을 통해 상기 적어도 2개의 금속 전극 사이에 전도성 브릿지를 형성하는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.The method according to claim 6,
Wherein one of the plurality of first nucleotide oligomers adhered to the first conductive particle is the noncancerous base sequence added to the other end of the target polynucleotide to which one end is fixed to each of the metal electrodes, Wherein at least one of the plurality of second nucleotide oligomers attached to the second conductive particle is connected to the target polynucleotide fixed to the respective metal electrode by annealing and extending complementarily with the sequence, And a plurality of first nucleotide oligomers attached to said first conductive particle, said first nucleotide oligomer being complementary to at least one of a plurality of first nucleotide oligomers attached to said first conductive particle connected to a target polynucleotide immobilized on said metal electrode And at least one of the second conductive mouth Wherein at least one of the plurality of second nucleotide oligomers attached to the conductive particles is complementarily bonded to each other to form a conductive bridge between the at least two metal electrodes through the connection of the first and second conductive particles. A biochip for electrically detecting a target polynucleotide. 제6항 또는 제7항에 있어서,
상기 복수개의 제1 뉴클레오티드 올리고머와 상기 복수개의 제2 뉴클레오티드 올리고머는 전도성 입자 부착을 위한 기능기로 개질된 후 각각 상기 제1 전도성 입자 및 상기 제2 전도성 입자에 부착되는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.8. The method according to claim 6 or 7,
Wherein said plurality of first nucleotide oligomers and said plurality of second nucleotide oligomers are modified to functional groups for attachment of conductive particles and then attached to said first conductive particles and said second conductive particles, A biochip for electrically detecting a target polynucleotide. 제6항 또는 제7항에 있어서,
상기 적어도 2개의 금속 전극에는 직류 또는 교류 전원을 인가하여 저항값의 변화 또는 전류값의 변화를 측정하여 표적 폴리뉴클레오티드의 증폭여부 또는 존재여부를 전기적으로 검출하는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.8. The method according to claim 6 or 7,
Wherein the at least two metal electrodes are electrically or non-amplified by measuring the change in the resistance value or the change in the current value by applying a direct current or an alternating current power to electrically detect the presence or absence of amplification of the target polynucleotide. A biochip for electrically detecting a polynucleotide. 제6항 또는 제7항에 있어서,
상기 적어도 2개의 금속 전극은 IDE(interdigitated electrode)로서 형성되거나 일반적인 (+) 전극과 (-)전극으로 형성되는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.8. The method according to claim 6 or 7,
Wherein the at least two metal electrodes are formed as an interdigitated electrode (IDE), or are formed of a general positive electrode and a negative electrode, and electrically detect the target polynucleotide using the conductive particles. 제10항에 있어서,
상기 금속 전극의 폭은 10nm ∼ 100μm이고, 상기 금속 전극 사이의 간격은 10nm ∼ 100μm인 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.11. The method of claim 10,
Wherein the width of the metal electrode is 10 nm to 100 μm and the distance between the metal electrodes is 10 nm to 100 μm. 제6항 또는 제7항에 있어서,
상기 제2기판 상에 제3기판이 추가로 적층되는 3단 방식의 구조를 갖는 것을 특징으로 하는 전도성 입자를 이용하여 표적 폴리뉴클레오티드를 전기적으로 검출하는 바이오 칩.8. The method according to claim 6 or 7,
And a third substrate is further laminated on the second substrate. The biochip electrically detects the target polynucleotide using the conductive particles.
KR1020100121155A 2010-12-01 2010-12-01 Method and biochip for detecting target polynucleotide electrically using conductive particles KR101667648B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020100121155A KR101667648B1 (en) 2010-12-01 2010-12-01 Method and biochip for detecting target polynucleotide electrically using conductive particles

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020100121155A KR101667648B1 (en) 2010-12-01 2010-12-01 Method and biochip for detecting target polynucleotide electrically using conductive particles

Publications (2)

Publication Number Publication Date
KR20120059745A KR20120059745A (en) 2012-06-11
KR101667648B1 true KR101667648B1 (en) 2016-10-20

Family

ID=46610831

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020100121155A KR101667648B1 (en) 2010-12-01 2010-12-01 Method and biochip for detecting target polynucleotide electrically using conductive particles

Country Status (1)

Country Link
KR (1) KR101667648B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005042785A1 (en) 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
JP2006501486A (en) 2002-05-14 2006-01-12 ナノスフェアー　インコーポレイテッド Electrical detection of DNA hybridization and specific binding events
KR100969667B1 (en) 2008-03-24 2010-07-14 디지탈 지노믹스(주) Method for detecting biomolecules electrically and biochip provided with therefor

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20070031957A (en) * 2004-05-28 2007-03-20 나노겐 인코포레이티드 Nanoscale electronic detection system and methods for their manufacture

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2006501486A (en) 2002-05-14 2006-01-12 ナノスフェアー　インコーポレイテッド Electrical detection of DNA hybridization and specific binding events
WO2005042785A1 (en) 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
KR100969667B1 (en) 2008-03-24 2010-07-14 디지탈 지노믹스(주) Method for detecting biomolecules electrically and biochip provided with therefor

Also Published As

Publication number Publication date
KR20120059745A (en) 2012-06-11

Similar Documents

Publication Publication Date Title
US20220333168A1 (en) Method for identifying and quantifying organic and biochemical substances
Cinti et al. based strips for the electrochemical detection of single and double stranded DNA
Gooding Electrochemical DNA hybridization biosensors
Luo et al. Immobilization-free sequence-specific electrochemical detection of DNA using ferrocene-labeled peptide nucleic acid
de Lumley-Woodyear et al. Direct enzyme-amplified electrical recognition of a 30-base model oligonucleotide
Shiddiky et al. Highly selective and sensitive DNA assay based on electrocatalytic oxidation of ferrocene bearing zinc (II)− cyclen complexes with diethylamine
Sun et al. Dual signal amplification by eATRP and DNA-templated silver nanoparticles for ultrasensitive electrochemical detection of nucleic acids
Furst et al. Electrochemical patterning and detection of DNA arrays on a two-electrode platform
Wan et al. Nanoprobe-initiated enzymatic polymerization for highly sensitive electrochemical DNA detection
TW200526788A (en) Method for detecting analytes by means of an analyte/polymeric activator bilayer arrangement
Li et al. One-step modification of electrode surface for ultrasensitive and highly selective detection of nucleic acids with practical applications
Chen et al. Ultrasensitive electrochemical biosensor developed by probe lengthening for detection of genomic DNA in human serum
Ferreira Electrochemical nano (bio) sensors: advances, diagnosis and monitoring of diseases Rodrigo Michelin Iost1, Welter Cantanhede da Silva2, Joao Marcos Madurro3, Ana Graci Brito Madurro4, Lucas Franco
Trifonov et al. Application of the hybridization chain reaction on electrodes for the amplified and parallel electrochemical analysis of DNA
Díaz‐González et al. Diagnostics using multiplexed electrochemical readout devices
CA2432864A1 (en) Method for the impedimetric detection of one or more analytes in a sample, and device for use therein
Bala et al. Application of nucleic acid analogues as receptor layers for biosensors
Moeller et al. Chip-based electrical detection of DNA
Cheng et al. Hairpin probes based click polymerization for label-free electrochemical detection of human T-lymphotropic virus types II
KR100773543B1 (en) Electrochemical sensor for detecting biomolecule method for preparing the same and method for detecting biomolecule using the electrochemical sensor
Yu et al. Signal-on electrochemical detection for drug-resistant hepatitis B virus mutants through three-way junction transduction and exonuclease III-assisted catalyzed hairpin assembly
Bonaldo et al. Influence of BSA protein on electrochemical response of genosensors
WO2008097190A1 (en) Methods of electrically detecting a nucleic acid by means of an electrode pair
JP4376188B2 (en) Method and apparatus for PCR amplification and detection of nucleotide sequences
TW200936767A (en) Method and device for detection of nucleic acids and/or polypeptides

Legal Events

Date Code Title Description
N231 Notification of change of applicant
A201 Request for examination
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20190718

Year of fee payment: 4