KR101667363B1 - Endonuclease for Targeting blood coagulation factor and Composition for Treating Hemophilia Comprising the Same - Google Patents

Abstract

The present invention relates to a method for inversion of normal blood coagulation factor VIII (F8) gene, a method for inversion of blood coagulation factor VIII (F8) gene inversion, and a method for inversion Stem cells.
The method of the present invention effectively utilizes the inversion of intron 1 of the F8 gene, which is one of the causes of severe hemophilia A, and thus is usefully used as a research tool for studying the pathogenesis mechanism of type A hemophilia and for screening therapeutic agents . In addition, the inverse-proof inducible pluripotent stem cells prepared by the method of the present invention are effective for restoring type-A hemophilia by restoring the mutant genotype to a wild-type state without restricting the normal gene or protein transfer It enables the fundamental treatment.

Description

TECHNICAL FIELD The present invention relates to an endo-nuclease and a composition for treating hemophilia comprising the same, and a composition for treating hemophilia,

The present invention relates to a composition for treating type A hemophilia using an endocervical agent targeting a blood coagulation factor VIII gene.

Hemophilia A is one of the most common genetic bleeding disorders worldwide with a prevalence of 1 in 5,000 men (1). This disease is caused by genetic mutations including mass deletion, insertion, inversion and point mutations in X-linked coagulation factor VIII (F8) (Haemophilia A mutation, Structure, Test and Resource Site; http: // hadb. org.uk); A total of 1,492 mutations were reported to cause type A hemophilia. Clinical symptoms vary according to genotype (2). Hemophilia A can be divided into severe (<1% active), moderate (1-5% active) or mild (5-30% active) depending on the relative activity of F8 in patient plasma (1). Approximately 50% of severe hemophilia A is caused by two types of chromosomal inversion, including some of the F8 gene (3-5).

Currently, there is no realistic treatment method for type A hemophilia. Treatment with recombinant F8 protein was attempted, but limited due to the formation of F8-inactivated antibody, high cost and frequent administration frequency. Gene therapy is a promising option for treating hemophilia. Nathwani et al. (6) have transferred six F9 cDNAs encoding the coagulation factor IX into adeno-associated virus (AAV) vectors in six patients with hemophilia B, a more rare X-related hemorrhagic disease. Unfortunately, AAV can not be loaded with a large F8 cDNA (~8 kbp) and this vector can not be used to deliver full-length F8 cDNA to patients with type A haemophilia. On the other hand, the F9 cDNA is smaller (~ 1.4 kbp). Furthermore, gene therapy can ideally be applied to repair genetic defects rather than delivering functional genes that are not controlled by endogenous regulatory mechanisms.

Patient-derived induced pluripotent stem cells (iPSCs) can be another promising method for treating hemophilia. However, patient-derived iPSCs themselves can not be used for cell therapy because they have genetic defects intact. Importantly, defective genes include zinc finger nucleases (7-10), transcription activator-like effector nucleases (11-13) and clusters of regularly interspaced palindromic repeats (CRISPR) / Cas-derived RGENs RNA-guided endonucleases (14-21) and the like. These gene scissors target specific regions of the chromosomal DNA to produce DNA double-strand breaks (DSBs) by cutting, which is an inherent mechanism known as homologous recombination (HR) or nonhomologous end-joining (NHEJ) Can be fixed through. These gene scars cause chromosome rearrangements such as targeted mutagenesis and deletion (22, 23), redundancy and inversion (24). The genetically-calibrated iPSCs can then prevent teratoma formation in the patient by expressing the calibrated gene after being transplanted into the patient with proper somatic cell differentiation.

The present inventors produced a type-A hemophilia model cell line in which TALEN inverted the 140-kbp chromosomal segment of human iPSC to mimic the most common genotype of hemophilia A and flipped the inverted region back to the wild type Can be used. Above all, F8 mRNA was expressed in cells that were differentiated from reverted, i. E., Genetically modified iPSC, but not cells differentiated in the hemopoietic model iPSC. This is the first to report that gene scissors can be used to rearrange large gene segments of iPSCs and isolate clones containing these gene rearrangements, which is a genetic defect caused by genetic rearrangement of iPSC To provide a proof of principle to correct.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made extensive efforts to develop an efficient and fundamental treatment method for hemophilia A caused by gene mutation in blood coagulation factor VIII (F8). As a result, the T8 effector domain, in which the inverse of the F8 gene targets the inversion site, and a pair of endonuclease that binds to each of the domains and cleaves the gene site targeted by the domain, ), Thereby completing the present invention.

Accordingly, an object of the present invention is to provide a composition for inversion of blood coagulation factor VIII (F8) gene and an inversion correction method using the same.

Another object of the present invention is to provide a method for producing inducible pluripotent stem cells in which the inverse of blood coagulation factor VIII (F8) gene is calibrated, inducible pluripotent stem cells prepared therefrom, and A And to provide a composition for treating hemophilia.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a composition for inversion of blood coagulation factor VIII (F8) gene comprising a polypeptide comprising the following or a nucleotide encoding said polypeptide:

(a) a pair of endonuclease; And

(b) a pair of transcriptional activator-like (TAL) effector domains, each of which is linked to one of the endonuclease and comprises an amino acid sequence that specifically recognizes the inversion site of the F8 gene.

The present inventors have made extensive efforts to develop an efficient and fundamental treatment method for hemophilia A caused by gene mutation in blood coagulation factor VIII (F8). As a result, the T8 effector domain, in which the inverse of the F8 gene targets the inversion site, and a pair of endonuclease that binds to each of the domains and cleaves the gene site targeted by the domain, ). &Lt; / RTI &gt;

According to the present invention, the target site is guided using the TAL effector domain that specifically recognizes the inversion site of the F8 gene, and the endonuclease that binds the site to the domain is precisely cleaved Both ends of the inverted gene segment are cleaved. The cleaved gene site causes re-circulation at a certain frequency, resulting in correction of the inversion.

As used herein, the term &quot; nucleotide &quot; is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically mentioned (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews , 90: 543-584 (1990)).

The term &quot; specifically recognized &quot; in the present invention means selectively recognizing it by interaction with the target sequence of the present invention, and is used in the same sense as &quot; specifically binding &quot;. The TAL effector used in the present invention has a central repeat domain consisting of 34 amino acids, and the 12th and 13th amino acid residues are composed of various amino acids and are called RVD (repeat variable diresidue). Each RVD serves to identify a specific DNA base and recognizes and binds specifically to NI = A, NN = G, NG = T, and HD = C (Boch J, et al. Science 326 5959): 1509-1512 (2009)). Thus, if there is information about the target DNA sequence, a TAL effector amino acid sequence that specifically binds to the target DNA sequence can be determined based on such a code.

According to a specific embodiment of the present invention, the inverse of the F8 gene corrected by the present invention is the inverse of the F8 gene in the intron 1, and the pair of transcriptional activator-like effector domains are as shown in SEQ ID NO: Wherein the nucleotide sequences at the first and second positions are 10-20 bp apart from each other with a length of 15-25 bp, have. According to the present invention, the nucleotide sequence of Sequence Listing 5 is the nucleotide sequence of Homolog 1 of the intron 1 of the F8 gene (approximately 1 kb). Thus, the first position and the second position are each coupled to the left TAL effector and the right TAL effector, wherein a pair of endo-nuclease, each of which is connected thereto, has a 10-20 bp (spacer) portion between the first and second positions .

According to a specific embodiment of the present invention, the nucleotide sequence at the first position and the second position is the nucleotide sequence of the first and second sequences of the sequence listing, respectively.

More specifically, the amino acid sequence that specifically binds to the nucleotide sequence of the first sequence of the sequence listing of the present invention includes the amino acid sequence of the third sequence of the sequence listing.

More specifically, the amino acid sequence that specifically binds to the nucleotide sequence of the second sequence of the Sequence Listing of the present invention comprises the amino acid sequence of Sequence Listing 4.

According to a specific embodiment of the present invention, the endonuclease used in the present invention is FokI endonuclease.

According to the present invention, the endonuclease and the TAL effector of the present invention may be used in the form of protein, respectively, or may be transferred to a target cell by transformation with a vector carrying the DNA encoding them.

According to another aspect of the present invention, the present invention provides a method for producing an induced pluripotent stem cell in which the inverse of the blood coagulation factor VIII (F8) gene is calibrated, comprising the following steps:

(a) reverse-differentiating somatic cells isolated from patients suffering from type A hemophilia to obtain induced pluripotent stem cells; And

(b) contacting the induced pluripotent stem cells with the above-described composition of the present invention or transforming the above-mentioned composition into a gene carrier into which the composition is inserted.

The induced pluripotent stem cells obtained by repopulating somatic cells isolated from patients suffering from type A haemophilia retain the patient-specific inverted genes, which can be calibrated in vitro by the method of the present invention described above. In other words, if the TAL effector domain that specifically recognizes the inversion site after the inversion is investigated, inverted inverted at a certain frequency can be used to obtain patient-customized induced pluripotent stem cells having the same genotype as the wild type will be.

As used herein, the term &quot; induced pluripotent stem cell &quot; refers to a cell that has been induced to have pluripotent differentiation potential through artificial reprogramming from differentiated cells, and is also referred to as a degeneration inducing pluripotent stem cell do. IPS cells has substantially the same properties as ES cells, in particular cell appearance, it has a pre multipotential in gene and protein expression pattern is similar, in and to the bit vivo, to form a teratoma (teratoma), Gene Of germline transmission is possible. The inducible pluripotent stem cells of the present invention include stem cells derived from all mammals such as human, monkey, pig, horse, cattle, sheep, dog, cat, mouse, rabbit and the like, Induced pluripotent stem cells, most specifically induced pluripotent stem cells derived from patients with type A haemophilia.

As used herein, the term &quot; de-differentiation &quot; refers to the epigenetic regression process that renders existing differentiated cells into an undifferentiated state to enable the formation of new differentiated tissues. It is also referred to as a reprogramming process and refers to epigenetic changes ). &Lt; / RTI &gt; According to the purpose of the present invention, the term &quot; infertile &quot; is any process for returning differentiated cells having a differentiation ability of 0% or more to less than 100% to undifferentiated state. For example, And dividing the transformed cells into differentiated cells having 1% differentiation potential.

The degeneration of the present invention can be carried out through various methods known in the art that can restore the differentiation ability of already differentiated cells. For example, OCT4, NANOG, SOX2, LIN28 , KLF4, and c-MYC. &Lt; / RTI &gt;

The medium used for culturing human somatic cells to obtain the induced pluripotent stem cells includes any conventional medium. (Stanner, CP et al., Nat. New Biol. 230: 52 (1971)), Iscove's (Eagle's minimum essential medium, Eagle, H. Science 130: 73: 1 (1950)), 199 medium (Morgan et al., Proc. Soc. Exp. Bio. Med., 73: , CMRL 1066, RPMI 1640 (Moore et al., J. Amer. Med. Assoc. 199: 519 (1967)), F12 (Ham, Proc Natl Acad Sci USA 53: 288 (Dulbecco's modification of Eagle's medium, Dulbecco, R. et al., Virology 8: 396 (1959)), a mixture of DMEM and F12 (Barnes, RG Exp. Cell Res. 29: 515 McCoy ' s 5A (McCoy, TA, et al., &Lt; RTI ID = 0.0 &gt; And the MCDB series (Ham, RG et al., In Vitro 14: 11 (1978)) can be used, but the present invention is not limited thereto .

As used herein, the term &quot; gene transporter &quot; means an agent for introducing and expressing a desired target gene into a target cell. The ideal gene transducer is harmless to the human body or the cell, it is easy to mass-produce, and it is necessary to be able to efficiently transfer the gene.

As used herein, the term &quot; gene transfer &quot; means that a gene is carried into a cell and has the same meaning as transduction of a gene into a cell. At the tissue level, the term gene transfer has the same meaning as the spread of a gene. Accordingly, the gene carrier of the present invention can be described as a gene penetration system and a gene diffusion system.

To prepare the gene delivery vehicle of the present invention, the nucleotide sequence of the present invention is preferably present in a suitable expression construct. In such expression constructs, the nucleotide sequence of the invention is preferably operatively linked to a promoter. As used herein, the term &quot; operably linked &quot; means a functional linkage between a nucleic acid expression control sequence (e.g., an array of promoter, signal sequence, or transcription factor binding site) and another nucleic acid sequence, The regulatory sequence will regulate transcription and / or translation of the other nucleic acid sequences. In the present invention, the promoter bound to the nucleotide sequence of the present invention is preferably capable of regulating transcription of the rilacsin gene by operating in an animal cell, more preferably a mammalian cell, and includes a promoter derived from a mammalian virus And a promoter derived from the genome of a mammalian cell, such as CMV (mammalian cytomegalovirus) promoter, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, U6 promoter, HSV tk promoter, RSV promoter , Promoter of human IL-4 gene, promoter of human IL-4 gene, promoter of human lymphotoxin gene, promoter of human IL-2 gene, promoter of human IL-4 gene, promoter of human IL-2 gene, promoter of EF1 alpha promoter, metallothionein promoter, beta -actin promoter, human IL- But are not limited thereto. Most preferably, the promoter used in the present invention is a CMV promoter and / or a U6 promoter.

The gene carrier of the present invention can be produced in various forms including (i) naked recombinant DNA molecules, (ii) plasmids, (iii) viral vectors, and (iv) the naked recombinant DNA molecule or Or in the form of a liposome or a niozyme containing a plasmid.

The nucleotide sequence of the present invention can be applied to all gene delivery systems used for conventional animal transformation and is preferably a plasmid, an adenovirus (Lockett LJ, et al., Clin. Cancer Res. 3: 2075-2080 ), Adeno-associated viruses (AAV, Lashford LS., Et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), retrovirus (Gunzburg WH, et al., Retroviral ( Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), lentivirus (Wang G. et al., J. Clin. Invest. 104 (11): R55-62 Viruses (Puhlmann M. et al., Human Gene Therapy 10: 649-657 (1999)), viruses (Chamber R., et al., Proc. Natl. Act. Sci. USA 92: 1411-1415 ), Liposomes (Methosin in Molecular Biology, Vol. 199, SC Basu and M. Basu (Eds.), Human Press 2002) or niosomes. More specifically, the gene carrier of the present invention is a plasmid.

In the present invention, when the gene carrier is prepared based on a viral vector, the contacting step is carried out according to a virus infection method known in the art. Infection of host cells with viral vectors is described in the above cited documents.

If the gene delivery system in the present invention is a kit inner (naked) or recombinant DNA molecule is a plasmid, microinjection (Capecchi, MR, Cell, 22 :. 479 (1980); and Harland and Weintraub, J. Cell Biol 101: 1094- 1099 (1985)), calcium phosphate precipitation method (Graham, FL et al., Virology , 52: 456 (1973), and Chen and Okayama, Mol. Cell. Biol. 7: 2745-2752 6: 716-718 (1986)), liposome-mediated transfection (Eugene et al., EMBO J. , 1: 841 (1982), and Tur-Kaspa et al., Mol. Cell Biol. method (Wong, TK et al, Gene , 10:87 (1980); Nicolau and Sene, Biochim Biophys Acta, 721: .... 185-190 (1982); and Nicolau et al, methods Enzymol, 149 :. 157 (1987)) and DEAE-dextran treatment (Gopal, MoI. Cell Biol. , 5: 1188-1190 (1985)) and gene bendardment (Yang et al., Proc. Natl. Acad. Sci. 87: 9568-9572 (1990)), and most specifically, electroporation can be used.

According to a specific embodiment of the present invention, the pair of TAL effector domains of the present invention are 10-20 bp apart, more specifically 12-16 bp apart, over the region to be cleaved on the F8 gene, Specifically, it is 12-14 bp away.

According to a specific embodiment of the present invention, the type A hemophilia is type A haemophilia issued by inversion of intron 1 of the F8 gene, and the pair of transcriptional activator-like effector domains are selected from the group consisting of SEQ ID NO: And an amino acid sequence that specifically binds to the nucleotide sequence of the second sequence.

This embodiment is an embodiment for producing an induced pluripotent stem cell in which the inversion of the type A hemophilia in which the inversion occurs in the first intron of the F8 gene in the type A hemophilia is calibrated and its constitution and steps have already been described. The description thereof is omitted.

According to another aspect of the present invention, there is provided an induced pluripotent stem cell produced by the method of the present invention.

According to still another aspect of the present invention, there is provided a composition for treating type A hemophilia comprising the induced pluripotent stem cell of the present invention as an active ingredient.

The induced pluripotent stem cells of the present invention are cells that have been corrected for the gene inversion in hemophilia patients and then are differentiated into appropriate somatic cells to be transplanted into a patient and express the corrected gene to be a useful cell therapy composition for hemophilia A, . Accordingly, the composition of the present invention can directly induce differentiation into a target cell from a non -humanized bovine graft, or can be transplanted into a human after completion of differentiation from an in vitro to a target cell.

Specifically, the type A hemophilia to be treated in the present invention is severe A type hemophilia. As used herein, the term &quot; severe hemophilia A &quot; refers to a case where the activity of blood coagulation factor VIII (F8) is less than 1% of normal persons.

As used herein, the term &quot; treatment &quot; includes (a) inhibiting the development of a disease, disorder or condition; (b) relief of the disease, disorder or condition; Or (c) eliminating the disease, disease or condition. The composition of the present invention has a role of suppressing, eliminating or alleviating the development of a symptom that has been induced on the gene by correcting the same gene as the wild type that has been corrected in an individual afflicted with type A hemophilia. Therefore, the composition of the present invention may be a therapeutic composition of hemophilia type A by itself, or may be administered together with other pharmacological components to be used as a therapeutic aid for the disease. Herein, the term &quot; treatment &quot; or &quot; therapeutic agent &quot; includes the meaning of &quot; therapeutic aid &quot;

The term &quot; administering &quot; or &quot; administering &quot; as used herein refers to the administration of a therapeutically effective amount of a composition of the present invention directly to a subject to form the same amount in the body of the subject. Thus, the term &quot; administering &quot; is used to refer to the use of the term &quot; injected &quot; or &quot; transplantation &quot; as it includes injecting or transplanting adult pluripotent stem cells "Is used in the same sense.

A &quot; therapeutically effective amount &quot; of a composition means an amount of extract sufficient to provide a therapeutic or prophylactic effect to the subject to which the composition is to be administered, including a &quot; prophylactically effective amount &quot;. As used herein, the term &quot; subject &quot; includes without limitation humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons or rhesus monkeys. Specifically, the object of the present invention is human.

When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the formulation and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, saline, or a medium, but are not limited thereto.

The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered parenterally, specifically, intravascularly.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of this invention are 10 &lt; ² &gt; -10 &lt; ¹⁰ &gt; cells per day on an adult basis.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of excipients, powders, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

According to another aspect of the present invention, there is provided a composition for inducing the inverse of the blood coagulation factor VIII (F8) gene comprising a polypeptide comprising the nucleotide encoding the polypeptide or the polypeptide:

(a) a pair of endonuclease;

(b) a transcription activator-like effector domain comprising an amino acid sequence linked to one of (a) and specifically binding to a nucleotide sequence at a first position on the F8 gene; and

(c) a transcription activator-like (TAL) effector domain comprising an amino acid sequence linked to one of the abovementioned (a) and specifically binding to a nucleotide sequence at a second position on the F8 gene, 2 positions are each 15-25 bp in length and are 10-20 bp apart from each other.

Since each configuration used in the present invention has already been described above, the description thereof will be omitted in order to avoid excessive duplication.

In accordance with the present invention, the method of the present invention can induce recurrence or correction of inversions occurring when a patient cell in which an inversion occurs is used as a starting material, but conversely, when using normal cells as a starting material, have. Therefore, by using a cell having a normal genotype as a starting cell, the present invention can be a useful research tool for efficiently obtaining an artificial hemophilia cell.

According to still another aspect of the present invention, there is provided a method for inducing an inverse of the blood coagulation factor VIII (F8) gene, comprising introducing the composition of the present invention into a somatic cell of a normal person.

Since each composition and step used in the present invention has already been described above, the description thereof is omitted in order to avoid excessive overlapping.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a method for inversion of normal blood coagulation factor VIII (F8) gene, a method for inversion of blood coagulation factor VIII (F8) gene inversion, Derived derived pluripotent stem cells.

(b) The method of the present invention efficiently reproduces the inversion of intron 1 of the F8 gene, which is one of the causes of severe A-type hemophilia, and thus is useful as a research tool for investigating the pathogenesis mechanism of hemophilia A and for screening therapeutic agents Lt; / RTI &gt;

(c) The inverse-proof inducible pluripotent stem cells prepared by the method of the present invention are useful for restoring the mutant genotype to a wild-type state without restricting the normal gene or protein transfer, And enables the underlying treatment.

FIG. 1 is a diagram showing the result of producing an iPSC clone from HDF using an episomal reprogramming vector. 1A is a diagram showing the shape of an extended human iPSC (Epi3 clone) (scale bar, 200 mu m). Figure Ib is the result of alkaline phosphatase staining for iPSC (Epi3 clone) (scale bar, 500 mu m). Figure 1c shows the detection of the remaining episomal vector (EBNA-1) sequence in the established iPSC cell line (Epi1tEpi8). The GAPDH gene was used as a control for the isolated total DNA. Total DNA isolated from cells before and after electrophoresis (na) and after (6 days), respectively, were used as negative and positive control for episomal vector DNA, respectively. The retrovirus-derived wild type iPSC cell line (iPSC1) was also analyzed as a negative control. FIG. 1d shows the results of detecting the expression of human ESC-specific markers OCT4 and SSEA-4 through immunocytochemistry. The DAPI signal represents the entire cell in the image (scale bar, 100 μm). Figure 1e shows the results of RT-PCR analysis using gene-specific primers (Table 3) to measure the transcription levels of OCT4, SOX2, LIN28, NANOG and GAPDH. 3, WT-iPSC; 4, Inv 1; 5, Inv 2) and the wild type iPSC cell line (WT-iPSCEpi3) and the WT-iPSCEpi3 cell line (1, HDFs; 2, H9; 3, WT-iPSC; 4, Inv 1; 5, Inv 2) derived from the inverted clone (Inv 1 and Inv 2) derived from the WT-iPSCEpi3 cell line (1, HDFs; Figure 1f normalizes the expression of GAPDH as a result of quantifying OCT4, SOX2 and LIN28 mRNA in each cell via qPCR. Figure 1g shows the expression of ectoderm (Nestin), mesenchymal (? -Smooth muscle actin), and endoderm [AFP (? -Fetoprotein)] marker proteins (scale bar, 50 μm).
Figure 2 is a graph showing the TALEN-mediated inversion of the F8 gene in HEK 293T cells. Figure 2a is a predictive mechanism of chromosome inversion in patients with type A haemophilia. The inverse of the 140-kbp chromosomal segment corresponding to the F8 gene is associated with two homologous sites from the opposite direction (homolog 1 located in the intron 1 of the F8 gene and homolog 2 located in the 140-kbp upstream region). Red triangles represent the TALEN target site, and arrows represent the primers designed to detect the 140-kbp inversion, respectively. Figure 2b shows the T7E1 assay results for 11 TALEN pairs. The predicted positions of the DNA bands cleaved by T7E1 are marked with an asterisk.
Fig. 3 is a diagram showing the TALEN-mediated inversion of the F8 seat of the iPSC. FIG. 3A shows PCR analysis results of genomic DNA of four inverted clones. Genomic DNA samples isolated from type A haemophilia patient (Pa) and wild type iPSC (WT) were used as a positive control for inverse or normal genotype, respectively. FIG. 3B is a diagram showing a DNA sequence of a breakpoint junction of an inverted clone. The TALEN binding site was designated as red (homolog 1) or blue (homolog 2).
Figure 4 is a diagram showing the reversion of the F8 gene inversion. PCR analysis was performed on genomic DNA obtained from three repeat clones (Fig. 4A). Genomic DNA isolated from type A haemophilia patient cells (Pa) or wild type iPSC (WT) was used as a positive control for inverted or normal genotype, respectively. FIG. 4B is a view showing a DNA sequence of a breakpoint junction in a repeated clone. FIG. The TALEN binding site is shown as red (junction 1) or blue (junction 2). The dash represents deleted bases. Figure 4C shows chromatograms for sequences between two TALEN binding sites (homologs 1 and 2, respectively) in repeated clones (clones 1 and 3).
FIG. 5 is a graph showing the results of analysis of inverse and repeated clone characteristics. FIG. Figure 5A shows F8 gene expression in cells derived from inverted and repeated clones. Expression of F8 and ectodermal marker genes (FOXA2 and Sox17) in cells derived from wild-type iPSCs (WT), inverted clones (Inv 1 and 2) and repeated clones (Rev 1, 2, and 3) . GAPDH was used as a loading control. FIG. 5B is a graph showing F8 protein expression of epithelial cells differentiated in inverse and repeated clones. The differentiated cells were fixed and stained with the indicated antibody. The DAPI signal represents the entire cell in the image (FVIII, F8 protein, vWF, von Willebrand factor (mature epithelial marker protein);
FIG. 6 is a graph showing the results of analyzing characteristics of human iPSCs prepared using an episomal programming vector. Karyotype analysis was performed on the chromosomes of the WT-iPSC cell line of Episodes 10 (Epi3) and Epis8 (Epi8) (Fig. 6A). Expression of human ESC-specific surface markers Nanog and TRA-1-60 was measured by immunocytochemistry (Fig. 6b). The DAPI signal represents the entire cell in the image (scale bar, 100 μm). Figure 6c shows the expression of ectoderm (Pax6), mesenchymal (Brachyury) and endoderm (HNF3 [beta]) labeled proteins (scale bar, 50 [mu] m).
Figure 7 is a graph showing the frequency of the targeted inversions. The frequency of the targeted inversion was measured using digital PCR (Fig. 7A). Genomic DNA samples isolated from TALEN-encoding plasmid-transformed cells were serially diluted and subjected to digital PCR analysis. The frequency of chromosome inversions induced by ZFNs (zinc-finger nucleases) or TALEN was measured (Fig. 7B). Z10 is a ZFN pair targeting the intron homolog of homology with the F8 gene. The frequency of the 140-kbp inversion was measured by digital PCR. The upper and lower limits represent the confidence interval of 95%.
FIG. 8 is a graph showing the result of analyzing the TALEN off-target effect. FIG. The potential off-target sites of TALEN designed in the present invention have been explored in the in silico . Three potential off-target sites that were most similar to the TALEN target site were selected and subjected to T7E1 analysis to confirm off-target cleavage at these sites.
Figure 9 shows the expression of human ES markers in inverted and repeated clones. Oct4, Sox2 and Lin28 mRNA levels of wild-type iPSC cell line (WT-iPSCEpi3), inverted clone (Inv 1) and repeated clones (Rev 1, 2 and 3) were measured by quantitative PCR (qPCR). GAPDH mRNA was used for standardization.
10 is an illustration showing the in vitro differentiation of the inverted and repeated clones. The expression of the marker protein is expressed in ectoderm (α-smooth muscle actin) and endoderm (AFP (α-feto protein) in the inverse clone (upper) and repeated clones And HNF3 [beta]] (scale bar, 50 [mu] m).

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Experimental Method

Plasmid encoding TALEN.

The TALEN plasmid used in the present invention was synthesized by a conventionally reported method using a TAL effector array plasmid constructed for a one-stop Golden-Gate assembly (12). Each TALEN plasmid encodes the N-terminal 135 amino acids of AvrBs3, an array of RVD modules, one of the four RVD halfrepeats, and the Sharkey FokI domain (45). The TALEN site was designed to target the intron homolog of the F8 gene, intron 1; Potential off-target sites were identified according to previously reported methods (12).

Isolation of genomic DNA from patients with type A haemophilia.

Blood cells of type A hemophilia patients were analyzed under the approval of Seoul National University Research Ethics Review Committee. Blood samples were obtained from the Korea Hemophilia Foundation, and genomic DNA was isolated by conventional methods (24).

Measures the frequency of targeted inversions.

The frequency of the targeted inversion was measured by digital PCR analysis in a conventionally reported method (23). Genomic DNA samples isolated from TALEN plasmid-transformed cells were sequentially diluted and nested PCR was performed on the diluted samples using appropriate primers (Table 1). Positive band segments at each dilution were counted and the results were analyzed using the Extreme Limiting Dilution Analysis program (46).

The primers used in the present invention Name of the primer The sequence (5 'to 3') Experiments used homolog 1-1F AAATCACCCAAGGAAGCACA Inversion and Reversion homologue 1 R TGGCATTAACGTATTACTTGGAGA Inversion and Reversion homolog 2-2F GGCAGGGATCTTGTTGGTAAA Inversion and Reversion homolog 2-2R TGCTGAGCTAGCAGGTTTAATG Inversion and Reversion GAPDH- F CCCCTCAAGGGCATCCTGGGCTA qPCR and RT-PCR GAPDH -R GAGGTCCACCACCCTGTTGCTGTA qPCR and RT-PCR Oct4- F CCTCACTTCACTGCACTGTA qPCR Oct4- R CAGGTTTTCTTTCCCTAGCT qPCR Sox2- F CCCAGCAGACTTCACATGT qPCR Sox2- R CCTCCCATTTCCCTCGTTTT qPCR Lin28- F AGCCAAGCCACTACATTC qPCR Lin28- R AGATACGTCATTCGCACA qPCR Nanog- F TGAACCTCAGCTACAAACAG qPCR Nanog- R TGGTGGTAGGAAGAGTAAAG qPCR F8- F CTGCTTTAGTGCCACCAGAAGA RT-PCR F8- R GACTGACAGGATGGGAAGCC RT-PCR FOXA2- F CTACGCCAACATGAACTCCA RT-PCR FOXA2- R AAGGGGAAGAGGTCCATGAT RT-PCR Sox17- F AGCGCCCTTCACGTGTACTA RT-PCR Sox17- R CTTGCACACGAAGTGCAGAT RT-PCR GAPDH- F GAACATCATCCCTGCCTCTACTG iPS generation (PCR) GAPDH -R CAGGAAATGAGCTTGACAAAGTGG iPS generation (PCR) EBNA-1- F ATGGACGAGGACGGGGAAGA iPS generation (PCR) EBNA-1- R GCCAATGCAACTTGGACGTT iPS generation (PCR) 293-F GAGCAGGGAGGCAAGAATTA TALENs activity screening 293-R TGAGGGAAAACGCATCTAGG TALENs activity screening

Cell culture

HEK 293T / 17 (ATCC; CRL-11268) and adult HDFs (Invitrogen; C-004-5C) were cultured in DMEM supplemented with FBS (10% vol / vol) and antibiotic (1%). The human ESC (hESC) cell line (H9) purchased from WiCell, the retrovirus-derived wild-type iPSCs (iPSC1) and the iPSCs prepared in the present invention were cultured in a 20% (vol / vol) knockout serum substitute (Invitrogen), 4.5 g / HESC culture medium consisting of DMEM / F12 medium supplemented with L-glutamine, 1% nonessential amino acid, 0.1 mM 2-mercaptoethanol and 4 ng / ml bFGF (basic fibroblast growth factor, PeproTech) (47, 48).

Identification of TALEN targeting F8 locus in HEK 293T cells

To confirm the gene-manipulated activity of TALEN designed in the present invention, each TALEN pair was transformed into HEK 293T cells and their activity was measured by T7E1 analysis (10). HEK 293T / 17 cells were seeded at 80% confluence and then transfected with a TALEN-encoding plasmid using Lipofectamine 2000 (Invitrogen) to measure the frequency of TALEN-induced inversion targeting the F8 locus Respectively. Genomic DNA samples were isolated and the chromosomal inversion was confirmed by PCR analysis using a previously reported method (23).

Production of iPSC and differentiation into in vitro into three embryos

Episomal vectors encoding specific reprogramming factors were used according to the reported method (49). In summary, HDF grown in DMEM supplemented with 10% FBS was electroporated with an episome vector (total 3 μg) according to the manufacturer's instructions through a micropore system (Neon; Invitrogen). After a pulse of 3 times for 10 minutes at a voltage of 1,650 volts, the cells were further cultured in DMEM (10% FBS). After 7 days of transformation, the cells were transferred to the feeder layer. iPSC colonies, which resemble hESCs, were picked up as machinery and further cultured for characterization.

The iPSC is expressed in vitro using three well known methods: (50, 51). Embryoid bodies (EBs) formed by partially isolating iPSCs via type IV collagenase (Invitrogen) were transferred to an ultralow attachment plate (Corning) and resuspended in 20% (vol / vol) knockout serum (Invitrogen ), 4.5 g / L L-glutamine, 1% non-essential amino acid, 0.1 mM 2-mercaptoethanol and 5% FBS in DMEM / F12 (1: After that, the EBs were attached to a matrigel-coated dish and cultured for another 10 days. Whether or not EBs were spontaneously differentiated into cells representative of three embryos were examined through immunostaining using an appropriate antibody.

Differentiation of iPSC.

IPSCs were differentiated into endoderm lines according to the previously reported method (52). In summary, iPSC colonies were cultured in mTeSR-1 hESC growth medium (StemCell Technology) in a feeder-free environment. To obtain definite endoderm cells, undifferentiated iPCS was suspended in RPMI / B27 (RPMI-1640, Sigma, B27) supplemented with 100 ng / mL ofactin A (PeproTech) and 5 μM phosphatidylinositol 3-canine inhibitor (LY-294002; Sigma) Gt; Invitrogen) &lt; / RTI &gt; medium for 5 days. Cells differentiated into endoderm were collected and total RNA was isolated and used as a template for cDNA synthesis.

IPSCs were differentiated into endodermal epithelial cells (54). Briefly, EBs were cultured in hESC medium supplemented with 20 ng / mL BMP4 (bone morphogenic protein 4, R & D Systems) and 10 ng / mL actin A (PeproTech) And then differentiated into epithelial cells in medium supplemented with 100 ng / mL VEGF (PeproTech) and 50 ng / mL basic FGF (R & D Systems) for 10 days.

TALEN transformation for iPSC inversion and recovery induction

The cultured iPSCs were collected by treating type IV collagen. After washing with PBS, cells were further treated with Accutase (Invitrogen) to produce single cell suspensions (55). These single cells were mixed with a TALEN-encoding plasmid (5 μg of each plasmid) and pulsed with 850 voltage for 30 minutes. Cells were then seeded into feeder cells and cultured for 10 days. To detect the genome inversion or restoration, the cells obtained from each colony were disrupted at 56 [deg.] C for 3 hours in lysis buffer [1x Ex-taq buffer (pH 8.0) containing Proteinase K]. After inactivating the proteinase K, 2 μL of the genomic DNA solution was subjected to PCR using Ex-taq DNA polymerase (Takara) and a specific primer. The PCR products were analyzed by agarose gel electrophoresis and the primers used were shown in Table 3.

Isolation of cell clonal perforations, PCR analysis and DNA sequencing of inflection points.

In order to isolate the clonal perturbation of the inverted (or repeated) cells, each of the colonies identified as having the desired gene modification by PCR was separated into single cells using collagenase and Accutase by a known method, Respectively. After three passages, several clones (6 inverted and 4 restored) were selected for sequencing and further experiments. For sequencing, amplified PCR products were electrophoresed and eluted from agarose gel using Gel Extraction kit (SolGent) and cloned into pGEM-T vector (Promega). The cloned PCR products were sequenced using T7 primers.

RNA isolation, RT-PCR and qPCR.

Total RNA was purified from the cells according to the manufacturer's instructions using TRIzol reagent (Invitrogen). CDNA was synthesized from total RNA (1 μg) using a DiaStar cDNA synthesis kit (SolGent). In order to confirm the expression of Factor VIII, FOXA2, Sox17 and GAPDH, PCR was performed using Ex-Taq (Takara) as a template for the synthesized cDNA. For qPCR, SYBR Premix Ex-Taq (Takara) was used according to the manufacturer's instructions. Specific primers for RT-PCR or qPCR are listed in Table 3.

Alkaline phosphatase staining and immunostaining

Alkaline phosphatase activity was measured using a leukocyte alkaline phosphatase staining kit (Sigma) according to the manufacturer's instructions. For pluripotent stem cell marker staining, cells were fixed in 4% formaldehyde solution and permeabilized with 0.2% Triton X-100. After washing with PBS, cells were incubated in PBS solution containing 5% normal goat serum and 2% BSA. Cells were then incubated with primary antibody for 2 hours at room temperature, washed with PBS and incubated with fluorescent-conjugated secondary antibody (Alexa Fluor 488 or 594; Invitrogen) for 1 hour at room temperature. To visualize the nuclei, cells were mounted on an antifade mounting medium containing DAPI (Vector Laboratories). Images were captured and analyzed using an Olympus IX71 microscope or FSX system.

DNA fingerprint analysis and karyotype analysis.

PCR-based STR (short tandem repeat) assays were performed at the Gene-Analysis Institute of Human Pass Inc. to identify the source of dermal fibroblasts in the iPSC cell line. Briefly, STR loci were amplified using AmpFISTR PCR system (Applied Biosystems) from iPSC cell lines and genomic PCR-products isolated from their parental cells. Amplification products were analyzed using an ABI PRISM 3130XLSTR P analyzer and Genemapper (Version 3.2; Applied Biosystems). For karyotyping, chromosomes were stained with Giemsa and analyzed by G-banding. Chromosome Image Processing System was used for analysis.

Statistical analysis

Data are presented as means ± standard error. Student's t-test was used for statistical analysis and P <0.05 was considered statistically significant.

Experiment result

Fabrication and characterization of human iPSCs.

Wild type iPSCs were obtained from human dermal fibroblasts (HDFs) by electroporation of episomal vectors encoding four Yamanaka factors. Embryonic stem cells (ESC) -like colonies appeared 10 days after the transfected cells were replicated in the feeder cell layer. A total of eight colonies (designated Epi1-Epi8) with alkaline phosphatase activity were selected (Figures 1a and 1b). After 7 or 8 passages, PCR was carried out using a primer specific for the EBNA-1 sequence in the vector to confirm that no episome vector was present in these clones. Only one clone (Epi1) contained the EBNA-1 sequence and was subsequently excluded from analysis (Figure 1c). Next, karyotypes of two iPSC cell lines (Epi3 and Epi8) were identified and they had a normal karyotype, as shown in Figure 6a. DNA fingerprint analysis was performed to determine whether these iPSCs were derived from parental HDF (Table 2). After such initial characterization, the present inventors selected the Epi3 cell line as a subject of further experiments.

STR (short tandem repeat) assay for iPS cell line Locus / cell line HDF Epi3 Epi4 Epi8 D8S1179 11 15 11 15 11 15 11 15 D21S11 29 30 29 30 29 30 29 30 D7S820 10 11 10 11 10 11 10 11 CSF1PO 11 13 11 13 11 13 11 13 D3S1358 16 18 16 18 16 18 16 18 TH01 8 9 8 9 8 9 8 9 D13S317 8 10 8 10 8 10 8 10 D16S539 9 13 9 13 9 13 9 13 D2S1338 20 23 20 23 20 23 20 23 D19S433 13 14 13 14 13 14 13 14 vWA 14 18 14 18 14 18 14 18 TPOX 8 11 8 11 8 11 8 11 D18S51 14 24 14 24 14 24 14 24 D5S818 12 12 12 12 12 12 12 12 FGA 23 26 23 26 23 26 23 26

This iPSC cell line expressed a typical ESC marker protein such as OCT4, NANOG, SSEA-4 and TRA-1-60 (Fig. 1d and Fig. 6b). RT-PCR and quantitative PCR (qPCR) analysis revealed that the polyposis marker gene was highly expressed in the Epi3 cell line than the human ESC cell line H9 (FIGS. 1E and 1F). Next, the differentiation ability of Epi3 cell line was examined. To give a gelatin embryoid bodies were to spontaneously differentiate into the three germ layers in vitro coating to adhere to the culture plate. As expected, the marker proteins of the ectoderm (Nestin and Pax6), α-smooth muscle actin and Brachyury and endoderm [AFP (α-feto protein) and HNF3β (hepatocyte nuclear factor 3-β) Were expressed in differentiated cells (Fig. Ig and Fig. 6c). These data show that Epi3 cell lines derived from adult HDF have pluripotency.

Targeted inverted inverted F8 locus of iPSCs using TALEN pairs.

Structural variations (SVs), such as inversions, are associated with genetic disorders including type A haemophilia (25). Nearly half of severe hemophilia A is caused by two different inversions that damage the X-linked F8 gene. These inversions are nonallelic HR (NAHR) comprising sequences within the intron (1-4% of severe A-type hemophilia) or within the 22nd intron (about 50% of severe A-type hemophilia) and their corresponding Originating from homologous sequences (named 1 or 2 intron positions, respectively) (3, 4). The present inventors constructed eleven pairs of TALEN targeting the intron homology No. 1 with focus on intron 1 inversion (Fig. 2A). The genetically engineered activity of these TALENs was tested through HEK 293T cells using T7E1 (T7 endonuclease I) assay (10) (FIG. 2B). The most active TALEN pair (named TALEN 01) was selected by inducing a mutation at the target site at a frequency of 33%. The TALEN induced a 140-kb inversion involving the intron homologous number 1 in HEK 293T cells at a frequency of 1.9% (FIG. 7). Next, the present inventors examined whether the TALEN showed off-target effect in a region having high homology. As a result, it was confirmed through T7E1 analysis that off-target mutation was not detected in these regions (FIG. 8 and Table 3) .

Potential off-target areas of TALEN 01 Chromosome number Gene name Left-half site
(5 'to 3') Spacer (bp) Right-half site
(5 'to 3') chr.9 N / A TATAGATTtGCCAtTtTCTC 13 TAAAaTATAAaGAAAAgTtT chr.14 PRKD1 TgTAGATTGGtCAGTgTCTC 12 aAAAGcAaAcTcAAAACTGT chr.4 N / A TtTtGATTGGCCAGcCTCTC 12 aAAAGaAaAcTGAAAACaGa

The present inventors then induced 140-kb inversion in iPSC using the same TALEN pair to produce hemophilia model cell lines. The TALEN plasmid was electroporated into the wild type iPSC and cultured for 10 days to form colonies. PCR was performed on genomic DNA samples isolated from each colony using specific primers capable of detecting inversions. Six of the 432 colonies (1.4%, comparable to HEK 293 cells) exhibited positive PCR bands at the two breakpoint junctions. Four colonies were further cultured to produce single cell clones. These clones formed PCR bands that were diagnostic criteria for 140-kb inversion, but did not generate PCR bands corresponding to the wild-type genotype (Fig. 3a). Next, the inventors cloned these PCR products and examined the DNA sequence to confirm the inverted genotype. No indel (insertions or deletions) were found in the target site of TALEN (Fig. 3b), indicating that a single DSB induced by TALEN in the intron analog 1 or 2 had DNA inversion through error-free NAHR . However, it is not possible to exclude the possibility that TALEN produced a total of two DSBs, one in intron homolog 1 and one in homolog 2, and that these DSBs bound to each other between NHEJs without leaving a second mutation.

Targeted inversions of inverse segments in an iPSC system.

In a previous study, we used a ZFN pair to induce a targeted chromosome inversion involving the intron homology of No. 1 of HEK 293 cells to isolate heterozygous clones with inverse (24). However, HEK 293 cells do not express the F8 gene and can not be used for cell therapy. Furthermore, HEK 293 cells have three copies of the X chromosome. This limitation hinders attempts to restore therapeutic expression by restoring the expression of the F8 gene by restoring the inverted region.

We examined whether the inverted 140-kbp segment of the hemopoietic model iPSC cell line could be corrected by reversion with the TALEN pair (the TALEN site is completely conserved in the disease model cell line). The TALEN plasmid was transformed into two iPSC clones (hereinafter &quot; inverted clones &quot;) containing invertase and PCR was performed on genomic DNA samples isolated from several colonies to identify repeat cells. The present inventors screened a total of 300 colonies and then obtained two repeated clones from each iPSC clone. Therefore, the recovery frequency was 1.3% (4 out of 300), which is the same as the inversion frequency. PCR analysis showed that the genotypes of these repeat clones were consistent with the genotypes restored to the wild type: Inverse clone specific PCR bands were not detected in these clone samples (FIG. 4A). These PCR products containing homologues 1 and 2 were then cloned and sequenced. There were no additional mutations in the two clones, but in the other two clones, 2-bp deletion occurred in both TALEN sites in both homologues 1 and 2 (FIG. 4B). These results show that inverted genotypes in severe hemophilia A can be corrected using the same TALEN pair used to generate the disease model.

In addition, we examined whether the inverse clones and repeat clones remain pluripotent cells by confirming whether they express human ES markers and whether they have the ability to differentiate into three primary primary lobules. These clones were expressed at levels comparable to wild-type stem cell marker iPSC were differentiated (Fig. 1f and S4), of 3 germ layers in vitro (Fig. 10). These results show that TALEN-mediated genetic engineering does not negatively affect the versatility of the iPSC.

F8 gene expression in cells differentiated from repeated iPSCs.

The F8 gene is expressed in endothelial and mesoderm-derived hepatocytes and epithelial cells, respectively (26-29). First, the present inventors investigated whether the F8 gene can be expressed in endoderm cells derived from wild-type and repeated iPSC clones. As a result of F8 mRNA measurement by RT-PCR analysis after iPSC differentiated into endoderm, F8 mRNA was detected in cells differentiated from wild-type and repeated iPSC clones as expected (Fig. 5A). On the other hand, F8 mRNA was not detected in the cells differentiated from inverted iPSC, although it was differentiated into endoderm as efficiently as wild type and repeated iPSC. Next, we examined the expression of F8 protein in the epithelial cells, the main producer of F8 protein (28). After iPSCs were differentiated into epithelial cells, immunostaining for F8 protein detection was performed. As expected, cells differentiated in wild-type and repeated iPSC clones expressed F8 protein (Fig. 5B). However, the cells differentiated from the inverse clone were successfully expressed by epithelial cells of these iPSCs, but the expression of the F8 protein was not expressed even though it was confirmed by expression of von Willebrand factor, a mature epithelial cell marker protein. These results demonstrate that the integrity of the F8 gene is maintained in repeated iPSCs.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

references

1. Graw J, et al. (2005) Haemophilia A: From mutation analysis to new therapies. Nat Rev Genet 6 (6): 488-501.

2. Bolton-Maggs PH, Pasi KJ (2003) Haemophilia and B. Lancet 361 (9371): 1801-1809.

3. Lakich D, Kazazian HH, Jr., Antonarakis SE, Gitschier J (1993) Inversions of the factor VIII gene common to severe haemophilia A. Nat Genet 5 (3): 236-241.

4. Naylor J, Brinke A, Hassock S, Green PM, Giannelli F (1993) Characteristic mRNA abnormality found in half of patients with severe haemophilia due to large DNA inversions. Hum MoI Genet 2 (11): 1773-1778.

5. Bagnall RD, Waseem N, Green PM, Giannelli F (2002) Recurrent inversion breaking intron 1 of the factor VIII gene is a frequent cause of severe hemophilia A. Blood 99 (1): 168-174.

6. Nathwani AC, et al. (2011) Adenovirus-associated virus vector-mediated gene transfer in hemophilia B. N Engl J Med 365 (25): 2357-2365.

7. Porteus MH, Baltimore D (2003) Chimeric nucleases stimulate gene targeting in human cells. Science 300 (5620): 763.

8. Bibikova M, Beumer K, Trautman JK, Carroll D (2003) Enhancing gene targeting with zinc finger nucleases. Science 300 (5620): 764.

9. Urnov FD, et al. (2005) Highly efficient endogenous human gene expression using zinc-finger nucleases. Nature 435 (7042): 646-651.

Kim, HJ, Cho, SW, Kim, JH (2009) Targeted genome editing in human cells with zinc finger nucleases. Genome Res 19 (7): 1279-1288.

11. Miller JC, et al. (2011) A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29 (2): 143-148.

12. Kim Y, et al. (2013) A library of TAL effector nucleases spanning the human genome. Nat Biotechnol 31 (3): 251-258.

13. Kim YK, et al. (2013) TALEN-based knockout library for human microRNAs. Nat Struct MoI Biol 20 (12): 1458-1464.

14. Cho SW, Lee J, Carroll D, Kim JS, Lee J (2013) Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195 (3): 1177-1180.

15. Sung YH, et al. (2014) Highly efficient gene knockout in mice and zebrafish with RNA guided endonucleases. Genome Res 24 (1): 125131.

16. Cho SW, et al. (2014) Analysis of off-target effects of CRISPR / Cas-derived RNA-guided endonucleases and nickases. Genome Res 24 (1): 132-141.

17. Cho SW, Kim S, Kim JM, Kim JS (2013) Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. Nat Biotechnol 31 (3): 230-232.

18. Cong L, et al. (2013) Multiplex genome engineering using CRISPR / Cas systems. Science 339 (6121): 819-823.

19. Hwang WY, et al. (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31 (3): 227-229.

20. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA (2013) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol 31 (3): 233-239.

21. Mali P, et al. (2013) RNA-guided human genome engineering via Cas9. Science 339 (6121): 823-826.

22. Lee HJ, Kim E, Kim JS (2010) Targeted chromosomal deletions in human cells using zinc finger nucleases. Genome Res 20 (1): 81-89.

23. Kim S, Lee HJ, Kim E, Kim JS (2010) Analysis of targeted chromosomal deletions induced by zinc finger nucleases. Cold Spring Harb Protoc 10.1101 / pdb.prot5477.

24. Lee HJ, Kweon J, Kim E, Kim S, Kim JS (2012) Targeted chromosomal duplications and inversions in the human genome using zinc finger nucleases. Genome Res 22 (3): 539-548.

25. Feuk L, Carson AR, Scherer SW (2006) Structural variation in the human genome. Nat Rev Genet 7 (2): 85-97.

26. Zelechowska MG, van Mourik JA, Brodniewicz-Proba T (1985) Ultrastructural localization

of factor VIII procoagulant antigen in human liver hepatocytes. Nature

317 (6039): 729-730.

27. Hollestelle MJ, et al. (2001) Tissue distribution of factor VIII gene expression in vivo

28. Shahani T, et al. (2010) Activation of human endothelial cells from specific vascular beds induces the release of a FVIII storage pool. Blood 115 (23): 4902-4909.

29. Terraube V, O'Donnell JS, Jenkins PV (2010) Factor VIII and von Willebrand factor interaction: Biological, clinical and therapeutic importance. Haemophilia 16 (1): 3-13.

30. Iafrate AJ, et al. (2004) Detection of large-scale variation in the human genome. Nat Genet 36 (9): 949-951.

31. Redon R, et al. (2006) Global variation in copy number in the human genome. Nature 444 (7118): 444-454.

32. Stankiewicz P, Lupski JR (2010) Structural variation in the human genome and its role in disease. Annu Rev Med 61: 437-455.

33. Carlson DF, et al. (2012) Efficient TALEN-mediated gene knockout in livestock. Proc Natl Acad Sci USA 109 (43): 17382-17387.

34. Guptaa, et al. (2013) Targeted chromosomal deletions and inversions in zebrafish. Genome Res 23 (6): 1008-1017.

35. Kim H, Kim JS (2014) A guide to genome engineering with programmable nucleases. Nat Rev Genet 15 (5): 321-334.

36. Kim S, Lee MJ, Kim H, Kang M, Kim JS (2011) Preassembled zinc-finger arrays for rapid construction of ZFNs. Nat Methods 8 (1): 7.

37. Kim E, et al. (2012) Precision genome engineering with programmable DNA-nicking enzymes. Genome Res 22 (7): 1327-1333.

38. Kim Y, Kweon J, Kim JS (2013) TALENs and ZFNs are associated with different mutation signatures. Nat Methods 10 (3): 185.

39. Sung YH, et al. (2013) Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol 31 (1): 23-24.

40. Kim H, et al. (2011) Surrogate reporters for enrichment of cells with nuclease-induced mutations. Nat Methods 8 (11): 941-943.

41. Kim H, et al. (2013) Magnetic separation and antibiotics selection Enrichment of cells with ZFN / TALEN-induced mutations. PLoS ONE 8 (2): e56476.

42. Ramakrishna S, et al. (2014) Surrogate reporter-based enrichment of cells containing RNA-guided Cas9 nuclease-induced mutations. Nat Commun 5: 3378.

43. Nikiforova MN, et al. (2000) Proximity of chromosomal loci that participate in radiation-induced rearrangements in human cells. Science 290 (5489): 138-141.

44. Bondeson ML, et al. (1995) Inversion of the IDS gene resulting from recombination with IDS-related sequences is a common cause of the Hunter syndrome. Hum MoI Genet 4 (4): 615-621.

45. Guo J, Gaj T, Barbas CF, 3rd (2010) Directed evolution of an enhanced and highly efficient FokI cleavage domain for zinc finger nucleases. J Mol Biol 400 (1): 96-107.

46. Hu Y, Smyth GK (2009) ELDA: Extreme limiting dilution analysis for comparing depleted and enriched populations in stem cell and other assays. J Immunol Methods 347 (1-2): 70-78.

47. Kim DS, et al. (2010) Robust enhancement of neural differentiation from human ES and iPS cells regardless of their innate difference in differentiation propensity. Stem Cell Rev 6 (2): 270-281.

48. Jang J, et al. (2012) Disease-specific induced pluripotent stem cells: A platform for human disease modeling and drug discovery. Exp Mol Med 44 (3): 202-213.

49. Okita K, et al. (2011) A more efficient method to generate integration-free human iPS cells. Nat Methods 8 (5): 409-412.

50. Sugii S, et al. (2010) Human and mouse adipose-derived cells support feederindependent induction of pluripotent stem cells. Proc Natl Acad Sci USA 107 (8): 3558-3563.

51. Jang J, et al. (2011) Induced pluripotent stem cell models from X-linked adrenoleukodystrophy patients. Ann Neurol 70 (3): 402-409.

52. Si-Tayeb K, et al. (2010) Highly efficient generation of human hepatocyte-like cells from induced pluripotent stem cells. Hepatology 51 (1): 297-305.

53. Jia F, et al. (2010) A nonviral minicircle vector for deriving human iPS cells. Nat Methods 7 (3): 197-199.

54. Yoo CH, et al. (2013) Endothelial progenitor cells from human dental pulp-derived iPS cells as a therapeutic target for ischemic vascular diseases. Biomaterials 34 (33): 8149-8160.

55. Desbordes SC, et al. (2008) High-throughput screening assay for the identification of compounds with regulating self-renewal and differentiation in human embryonic stem cells. Cell Stem Cell 2 (6): 602-612.

<110> Industry Academia Cooperation Foundation Yonsei University <120> Endonuclease for Targeting Blood Coagulation Factor 8 and          Composition for Treating Hemophilia Comprising the Same <130> PN140653 <160> 31 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> homo sapiens <400> 1 taaagtataa tgaaaactgt 20 <210> 2 <211> 20 <212> DNA <213> homo sapiens <400> 2 gagagactgg ccaatctata 20 <210> 3 <211> 650 <212> PRT <213> Artificial Sequence <220> <223> left TAL effector <400> 3 Leu Asn Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn Ile Gly   1 5 10 15 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys              20 25 30 Gln Asp His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn          35 40 45 Gly Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val      50 55 60 Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala  65 70 75 80 Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu                  85 90 95 Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val Val Ala             100 105 110 Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg         115 120 125 Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val     130 135 140 Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val 145 150 155 160 Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Glu                 165 170 175 Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala Leu Glu             180 185 190 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr         195 200 205 Pro Glu Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala     210 215 220 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly 225 230 235 240 Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn Asn Gly Gly Lys                 245 250 255 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp             260 265 270 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Asn Gly         275 280 285 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys     290 295 300 Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser His 305 310 315 320 Asp Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val                 325 330 335 Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala             340 345 350 Ser His Asp Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu         355 360 365 Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asp Gln Val Val Ala     370 375 380 Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 385 390 395 400 Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Ala Gln Val                 405 410 415 Val Ala Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val             420 425 430 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala         435 440 445 Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala Leu Glu     450 455 460 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr 465 470 475 480 Pro Asp Gln Val Val Ala Ile Ala Ser His Asp Gly Gly Lys Gln Ala                 485 490 495 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly             500 505 510 Leu Thr Pro Glu Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys         515 520 525 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala     530 535 540 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser His Asp Gly 545 550 555 560 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys                 565 570 575 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn             580 585 590 Gly Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val         595 600 605 Leu Cys Gln Ala His Gly Leu Thr Pro Glu Gln Val Val Ala Ile Ala     610 615 620 Ser His Asp Gly Gly Lys Gln Ala Leu Glu Ser Ile Val Ala Gln Leu 625 630 635 640 Ser Arg Pro Asp Pro Ala Leu Ala Ala Leu                 645 650 <210> 4 <211> 648 <212> PRT <213> Artificial Sequence <220> <223> right TAL effector <400> 4 Leu Asn Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Ile Gly   1 5 10 15 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys              20 25 30 Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn          35 40 45 Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val      50 55 60 Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala  65 70 75 80 Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu                  85 90 95 Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asp Gln Val Val Ala             100 105 110 Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg         115 120 125 Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Ala Gln Val     130 135 140 Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala Leu Glu Thr Val 145 150 155 160 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala                 165 170 175 Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu             180 185 190 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr         195 200 205 Pro Glu Gln Val Val Ala Ile Ala Ser Asn Gly Gly Gly Lys Gln Ala     210 215 220 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly 225 230 235 240 Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys                 245 250 255 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp             260 265 270 His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn Ile Gly         275 280 285 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys     290 295 300 Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn 305 310 315 320 Gly Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val                 325 330 335 Leu Cys Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala             340 345 350 Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu         355 360 365 Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val Val Ala     370 375 380 Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 385 390 395 400 Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asp Gln Val                 405 410 415 Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val             420 425 430 Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Ala         435 440 445 Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu     450 455 460 Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr 465 470 475 480 Pro Ala Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala                 485 490 495 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly             500 505 510 Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser His Asp Gly Gly Lys         515 520 525 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala     530 535 540 His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala Ser Asn Gly Gly 545 550 555 560 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys                 565 570 575 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn             580 585 590 Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val         595 600 605 Leu Cys Gln Asp His Gly Leu Thr Pro Glu Gln Val Val Ala Ile Ala     610 615 620 Ser Gly Gly Lys Gln Ala Leu Glu Ser Ile Val Ala Gln Leu Ser Arg 625 630 635 640 Pro Asp Pro Ala Leu Ala Ala Leu                 645 <210> 5 <211> 1041 <212> DNA <213> homo sapiens <400> 5 cagttgtcag tatgtgaaca atgttggaaa catgttattt tgtctgattt cctttgggag 60 aattcattgc cagctataaa tctgtggaaa cgctgccaca caatcttagc acacaagatt 120 ggcagaaaat cgcttagaaa cactgaaaac atgtgacaaa gtgctttccg tgaaaagggt 180 ggatgcgaag cagtaaggac ccccttcatg aagcacgcgg tcaccctcca gccaccagaa 240 ccagaggaac gctgtggtaa ctgagggaaa acgcatctag gcacacgtca cggtggcacc 300 ttccagcagg tccccggggt tgtgcccctg gagctctgac aaagagtgtg gcccggaaat 360 gtgatgtttg gactgcaagt tttggtgaga aataacaatg catcaggttg cagacaaagc 420 agaccctgct ctgtgcgttt atgggagccg cgcccaacag gaaccacagg gaatgatcga 480 aaggagaggg acggacacaa acagacacac cagagagagg ttctcaggag gaggctctgt 540 ggcctccaga ccacgtcaaa gccaaggcag aaaggatgaa ctgaggaaag gaggaaaatt 600 tccccttaag gaaggtaaaa tccagaaggg atccctaaaa tggtgagcag tttaaaccta 660 gcagttttgc attaattcac ataaagtata atgaaaactg ttggacacac aaggagagac 720 tggccaatct atagtcacag aggaagacct tcacacccct tcacaggatc tcgcagcaga 780 ttggctgaaa agtctccttg aaactgcaga cctctctcaa ggagacccac tgagttgggc 840 aaaggtgggg ccgacttaat tcttgcctcc ctgctctccc acgtagccct gcatttcact 900 ccattccagg gtttctggga cacccgagaa agcacgtagt ccagggagca cgtctgccaa 960 ctgaaggcct tgacaaatga ctttctgtac tggctgaggg ccagggccca gcgtactgat 1020 aaggaagctc ttccagaaaa a 1041 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> homolog 1-1 F <400> 6 aaatcaccca aggaagcaca 20 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> homologous 1 R <400> 7 tggcattaac gtattacttg gaga 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> homolog 2-2F <400> 8 ggcagggatc ttgttggtaa a 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> homologous 2-2R <400> 9 tgctgagcta gcaggtttaa tg 22 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F <400> 10 cccctcaagg gcatcctggg cta 23 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R <400> 11 gaggtccacc accctgttgc tgta 24 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oct4-F <400> 12 cctcacttca ctgcactgta 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Oct4-R <400> 13 caggttttct ttccctagct 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Sox2-F <400> 14 cccagcagac ttcacatgt 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sox2-R <400> 15 cctcccattt ccctcgtttt 20 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Lin28-F <400> 16 agccaagcca ctacattc 18 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Lin28-R <400> 17 agatacgtca ttcgcaca 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog-F <400> 18 tgaacctcag ctacaaacag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Nanog-R <400> 19 tggtggtagg aagagtaaag 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> F8-F <400> 20 ctgctttagt gccaccagaa ga 22 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F8-R <400> 21 gactgacagg atgggaagcc 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FOXA2-F <400> 22 ctacgccaac atgaactcca 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FOXA2-R <400> 23 aaggggaaga ggtccatgat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sox17-F <400> 24 agcgcccttc acgtgtacta 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Sox17-R <400> 25 cttgcacacg aagtgcagat 20 <210> 26 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-F for iPSC generation <400> 26 gaacatcatc cctgcctcta ctg 23 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> GAPDH-R for iPSC generation <400> 27 caggaaatga gcttgacaaa gtgg 24 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBNA-1-F <400> 28 atggacgagg acggggaaga 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> EBNA-1-R <400> 29 gccaatgcaa cttggacgtt 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 293-F <400> 30 gagcagggag gcaagaatta 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 293-R <400> 31 tgagggaaaa cgcatctagg 20

Claims (15)

Composition for inversion of blood coagulation factor VIII (F8) gene in a human derived inducible pluripotent stem cell comprising a polypeptide comprising the following or a nucleotide encoding said polypeptide:
(a) a pair of FokI endonuclease; And
(b) a pair of transcriptional activator-like (TAL) effector domains, each of which is linked to one of the endonuclease and comprises an amino acid sequence that specifically recognizes the inversion site of the F8 gene; And,
The inverse of the F8 gene is the inverse of the F8 gene in intron 1, and the pair of transcriptional activator-like (TAL) effector domains are respectively in a first position and a second position contained within the nucleotide sequence of SEQ ID No. 5 Wherein the nucleotide sequences at the first and second positions are 15-25 bp in length and are 10-20 bp apart from each other,
The nucleotide sequence at the first position and the second position is the nucleotide sequence of the first and second sequences of the sequence listing,
Wherein the amino acid sequence that specifically binds to the nucleotide sequence of the first sequence of the sequence listing comprises the amino acid sequence of the third sequence of the sequence listing,
The amino acid sequence that specifically binds to the nucleotide sequence of the second sequence of the sequence listing includes the amino acid sequence of the fourth sequence of Sequence Listing.
delete delete delete delete delete A method for producing an induced pluripotent stem cell in which the inverse of the blood coagulation factor VIII (F8) gene comprising the following steps is calibrated:
(a) reverse-differentiating somatic cells isolated from patients suffering from type A hemophilia to obtain induced pluripotent stem cells; And
(b) contacting the inducible pluripotent stem cell with the composition of claim 1 or transforming the gene transduction product into which the composition is inserted.
The method according to claim 7, wherein the step (a) comprises transforming somatic cells isolated from the patient with type A hemophilia by one or more genes selected from the group consisting of OCT4, NANOG, SOX2, LIN28, KLF4 and c-MYC Lt; / RTI &gt;
An induced pluripotent stem cell produced by the method of claim 7.
A composition for treating type A hemophilia comprising the induced pluripotent stem cell of claim 9 as an active ingredient.
A composition for inducing inversion of the blood coagulation factor VIII (F8) gene in a human derived inducible pluripotent stem cell comprising a polypeptide comprising the following or a nucleotide encoding said polypeptide:
(a) a pair of FokI endonuclease;
(b) a transcription activator-like effector domain comprising an amino acid sequence linked to one of (a) and specifically binding to a nucleotide sequence at a first position on the F8 gene; and
(c) a transcription activator-like (TAL) effector domain comprising an amino acid sequence linked to one of the abovementioned (a) and specifically binding to a nucleotide sequence at a second position on the F8 gene, The two positions are 15-25 bp long, 10-20 bp apart from each other,
Wherein the nucleotide sequence at the first and second positions is contained within the nucleotide sequence of SEQ ID NO: 5,
Wherein the nucleotide sequence at the first position and the second position consists of a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO:
An amino acid sequence that specifically binds to the nucleotide sequence at the first position and an amino acid sequence that specifically binds to the nucleotide sequence at the second position each include an amino acid sequence of SEQ ID No. 3 and SEQ ID No. 4,
The inverse of the F8 gene is the inverse of the F8 gene in the intron 1.
delete delete delete delete

Images