KR101666727B1 - New compound for differentiation or regeneration of nerve cell, or treatment of neurological disorder or neurological damage, preparation method of the same and pharmaceutical composition comprising the same - Google Patents

Abstract

The present invention provides a compound having a benzoxazole and pyridinothiazole structure and a pharmaceutically acceptable salt thereof, a process for producing the same, a pharmaceutical composition for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases . Since the compound of the present invention has an effect of inducing the differentiation of embryonic stem cells into neurons, it can be used for the treatment of various degenerative neurological diseases or nerve damage diseases.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a novel compound having different effects on neuronal cell differentiation or regeneration, neuronal damage or neurological diseases, a method for producing the same, and a pharmaceutical composition comprising the same. preparation method of the same and pharmaceutical composition comprising the same < RTI ID = 0.0 >

The present invention relates to a substance for treating neuronal differentiation or regeneration, neuronal injury or neurological diseases.

The mammalian brain is able to perform complex functions by generating a systematic neural network through a series of processes such as neuronal stem cell division and differentiation, survival and death, and synapse formation. Even during adulthood, animal neuronal cells produce many substances necessary for nerve growth, causing axons and dendrites to grow, and constantly reconstructing synaptic connections and neural networks every time new learning and memory is made (synaptic remodeling), it can be said that the differentiation continues. If neurons do not receive target-derived survival factors such as nerve growth factor during cell differentiation and synapse formation, apoptosis will occur. Stress and cytotoxic agent-induced apoptosis will result from degenerative brain It is the main cause of the disease. Unlike the central nervous system, when the animal's peripheral nervous system is damaged, the axons regenerate over a long period of time. The axillary regeneration of the nerve injury area is degenerated by a process known as wallerian degeneration. The neuronal cell body resumes axonal regrowth, and the schwann cell regenerates the target nerve by its survival and death after division. And then regenerates again. Differentiation or Regeneration of Neuronal Cells, Treatment of Neuronal Damage or Neurological Disorders The most likely candidate for neuron regeneration is the neurotrophic factor. In the 1940s, Hamburger and Levi-Montalcini found NGF (nerve growth factor) as a crucial factor in the motor neuron survival in the process of chick embryo limb differentiation. After that, brain-derived neurotrophic factor (BDNF) -3 (neurotrophic factor-3) and other neurotrophins. In addition, some nerve growth factors that are essential for the survival of neuronal cell populations differentiated by some transgenic animal experiments have been identified. Recently, it has also been shown that a number of other substances, including cytokines, are involved in the survival of neurons. The nerve growth factor regulates the initiation and division of the dividing cells in the central nervous system and the peripheral nervous system by the death process and starts the differentiation. Induced neuronal death, regulates the survival of pre-synaptic neurons and regulates new synapse formation and remodeling. It is also presumed that adult neural survival, synaptic plasticity and regeneration during nerve injury will have similar functions.

On the other hand, known methods of treating nerve growth factor in the treatment of neurological diseases include a gene therapy method in which stem cells are transplanted directly into stem cells or a therapeutic gene is delivered using a virus as a gene transfer vector. For example, in Korean Patent Publication No. 2007-0060721, a recombinant adenovirus is a replication defective viral vector in which the E1B region is deleted. Recently, as a therapeutic gene for the neurological diseases, And it is effective in the treatment of degenerative neurological diseases or neurological damage diseases, and is useful for prevention and treatment of dementia, Parkinson's disease, Alzheimer's disease, epilepsy, paralysis, peripheral nerve damage, etc. Is useful.

However, the gene therapy method is disadvantageous in that the repetitive production process of the substance is difficult and expensive.

Accordingly, the present invention provides synthetic compounds for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases

Korean Patent Laid-Open Publication No. 2007-0060721 (June 13, 2007) Korean Patent Laid-Open Publication No. 2005-0007056 (January 17, 2005) Korean Patent Laid-Open Publication No. 2008-0027191 (March 26, 2008)

It is an object of the present invention to provide novel compounds for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases.

It is an object of the present invention to provide a method for producing a novel compound having neuronal differentiation or regeneration, neuronal injury or neuropathy.

It is an object of the present invention to provide a pharmaceutical composition comprising as an active ingredient a novel compound having neuronal differentiation or regeneration, nerve injury or neuropathy.

The present invention provides a compound of the general formula (1), an isomer thereof, a pharmaceutically acceptable salt, a solvate or a hydrate thereof.

[Chemical Formula 1]

In this formula,

X is -O- or -S-,

Y is -CH- or -N-,

R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO ₂ ), amino (-NH ₂ )

R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,

R ³ is -C (O) CH ₂ R ⁴ or hydrogen,

R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) is CH ₃ or -OC (O) CH ₂ CH ₃ .

Wherein Y is -CH- and R ¹ is selected from the group consisting of fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO ₂ ), nitro or an amino (-NH _2), and, R ² is a C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C ₄ alkoxy, -CH ₂ C (O ) OCH _3, may be _{-CH 2 C (O) OCH 2} CH 3, -OC (O) CH 3 or _{-OC (O) CH 2 CH 3} .

In Formula 1, when X is -S-, Y is -N-, R ¹ is hydrogen, R ² is C ₁ -C ₄ alkoxy, and R ³ may be hydrogen.

In the present invention, the compound of formula (I) may be any one selected from the following compounds:

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate; And

2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole.

In the present invention, the compound of formula (I) is preferably 1- (2- (5-chlorobenzo [ d ] oxazol-2- ylamino) -5-ethylphenyl) -2- methoxyethanone or 2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole.

In the present invention, pharmaceutically acceptable salts generally refer to inorganic acids and organic acid salts used by pharmaceutical manufacturers to produce pharmaceuticals, and inorganic acids such as hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid and the like can be used. Citric acid, acetic acid, lactic acid, tartaric acid, fumaric acid, formic acid, propionic acid, trifluoroacetic acid, methanesulfonic acid, benzenesulfonic acid, maleic acid, benzoic acid, gluconic acid, glycolic acid, succinic acid, 4-morpholineethanesulfonic acid, -Nitrobenzenesulfonic acid, hydroxy-O-sulfonic acid, 4-toluenesulfonic acid, curlucuronic acid, embolic acid, glutamic acid and aspartic acid.

In the present invention, the compound of Formula 1 may include its geometric isomers, stereoisomers, and racemic mixtures. Those skilled in the art will recognize that certain compounds of the present invention may include an asymmetric center, such an asymmetric center being independently an R or S coordination. Such isomers can be separated from the mixture using or employing known methods. Chiral chromatography techniques may be one means of separating isomers from mixtures and chiral recrystallization techniques may be attempted as another means of separating isomers from the mixture. The individual isomeric mixtures may optionally be made using chiral precursors.

In the present invention, a solvate means a physical association of one or more solvent molecules with a compound of the present invention, and a physical association includes a hydrogen bond. In certain instances, solvates may be separated when one or more solvent molecules are bound in the crystal lattice of the crystalline solid. Solvates include both solution-phase and separable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

The present invention also provides a process for preparing a compound of the following formula (1) by Friedel-Crafts acylation of a compound of the following formula (2) and a compound of the following formula (3).

(2)

(3)

[Chemical Formula 1]

In this formula,

X is -O-, Y is -CH-,

R ¹ is fluoro, chloro, bromo, iodo, and also, C ₁ -C ₄ alkyl, nitro (-NO ₂₎ or an amino (-NH _2), and, R ² is C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 Or -OC (O) CH ₂ CH ₃ .

In the production process of the present invention, the compound of the formula (2) used as a starting material can be directly prepared and used by a known method. For example, Korean Patent Publication Nos. 2008-0027191 and 2005-0007056, Heterocycles 70 , 571-580 (2006) and Bioorg. Med. Chem . 18 : 7580-7585 (2010), and the like.

In the production process of the present invention, the compound of formula (3) is commercially available and can be easily purchased and used, or can be directly prepared by known methods.

In the preparation process of the present invention, the Friedel-Craft acylation reaction is selected from the group consisting of AlCl _{3 ,} BF ₃ , SbF ₅ , ZnCl ₂ , SnCl ₄ , TiCl ₄ , HCl, H ₂ SO ₄ and PPA (Polyphosphoric acid) May be carried out in the presence of one or more catalysts.

In the production process of the present invention, the amount of the catalyst used in the Friedel-Craft acylation reaction may be 1 to 2 times as much as the mole of the compound of formula (3) ) Is preferably used.

In the production method of the present invention, the Friedel greater lift acylation reaction is dichloromethane, toluene (toluene), benzene (benzene), 1,2- dichloroethane _{(Cl-CH 2 CH 2 -Cl} ), nitromethane (CH ₃ NO ₂ ), nitrobenzene (PhNO ₂ ), and carbon disulfide (CS ₂ ). The amount of the solvent to be used may be appropriately selected depending on the amount of the solvent to be used in a reaction solvent used in the Friedrich- For example, 1 to 100 parts by volume relative to the weight of [Formula 2].

In the production process of the present invention, the reaction temperature may be 0 to 50 캜, preferably 15 to 30 캜 (room temperature).

In the production process of the present invention, the compound of formula (1) may be any one selected from the following compounds:

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone; And

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate.

The present invention also provides a pharmaceutical composition for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases comprising a compound of the following general formula (1), an isomer thereof, a pharmaceutically acceptable salt, a hydrate or a solvate thereof as an active ingredient do.

[Chemical Formula 1]

In this formula,

X is -O- or -S-,

Y is -CH- or -N-,

R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO ₂ ), amino (-NH ₂ )

R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,

R ³ is -C (O) CH ₂ R ⁴ or hydrogen,

R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) is CH ₃ or -OC (O) CH ₂ CH ₃ .

In the pharmaceutical composition of the present invention, the compound of the formula (1) is preferably selected from the following compounds.

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate; And

2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole.

In the pharmaceutical composition of the present invention, the compound of the formula (I) is 1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2- methoxyethanone or 2- - [ N - (4-ethoxyphenyl)] aminopyridinothiazole.

In the present invention, the nerve injury or neurological disease may be any one of brain injury, brain disease, spinal cord injury, peripheral nerve injury, peripheral nerve disease, or amyotrophic lateral sclerosis, Is one of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, stroke, ischemic brain disease or degenerative brain disease. .

The present invention also relates to a method for the treatment of neural cell differentiation or regeneration by administering an effective amount of the compound of formula 1 or a pharmaceutically acceptable salt thereof to a mammal including a human, Or regenerating, or treating neurological damage or neurological disorders.

In addition, the present invention provides the use of the compound of formula (I) or a pharmaceutically acceptable salt thereof for the preparation of a pharmaceutical preparation for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases.

The pharmaceutical composition of the present invention may contain at least one active ingredient which exhibits the same or similar function in addition to the compound of the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof.

The pharmaceutical composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above components for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) according to a desired method, and the dose is appropriately determined depending on the patient's weight, age, , Diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dose of the compound of formula (I) of the present invention is about 10 to 1,000 mg / kg, preferably 50 to 500 mg / kg, more preferably once to several times a day.

The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy and biological response modifiers for the differentiation or regeneration of nerve cells, neuronal injury or neurological diseases.

The present invention provides a compound of the following formula (4), an isomer thereof, a pharmaceutically acceptable salt, a solvate or a hydrate thereof.

[Chemical Formula 4]

In this formula,

X is -O- or -S-,

Y is -CH- or -N-,

R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂ ), amino (-NH ₂ )

R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,

R ³ is -C (O) CH ₂ R ⁴ or hydrogen,

R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH ₃ and ,

R ⁵ is a C ₁ -C ₄ alkyl or hydrogen,

R ⁶ is C ₁ -C ₄ alkyl or hydrogen.

When X is -O-, Y is -CH- and R ¹ is selected from the group consisting of fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO _2), or amino (-NH _2), and, R ² is a C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C ₄ alkoxy _{, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH _3, and a, R ⁵ is C ₁ -C ₄ alkyl or hydrogen, R ⁶ can be a C ₁ -C ₄ alkyl or hydrogen.

When X is -S-, Y is -N-, R ¹ is hydrogen, R ² is C ₁ -C ₄ alkoxy, R ³ is hydrogen, R ⁵ is hydrogen , And R < ⁶ > may be hydrogen.

In the present invention, the compound of formula (IV) may be any one selected from the following compounds:

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole;

2- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2 - ((5-aminobenzo [ d ] oxazol-2-yl) amino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((4-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5- (tert-butyl) benzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate; And

2- (5-Butyl-2 - ((5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate.

In the present invention, the compound of formula (IV) may be methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate.

In the present invention, pharmaceutically acceptable salts generally refer to inorganic acids and organic acid salts used by pharmaceutical manufacturers to produce pharmaceuticals, and inorganic acids such as hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid and the like can be used. Citric acid, acetic acid, lactic acid, tartaric acid, fumaric acid, formic acid, propionic acid, trifluoroacetic acid, methanesulfonic acid, benzenesulfonic acid, maleic acid, benzoic acid, gluconic acid, glycolic acid, succinic acid, 4-morpholineethanesulfonic acid, -Nitrobenzenesulfonic acid, hydroxy-O-sulfonic acid, 4-toluenesulfonic acid, curlucuronic acid, embolic acid, glutamic acid and aspartic acid.

In the present invention, the compound of Formula 4 may include its geometric isomers, stereoisomers, and racemic mixtures. Those skilled in the art will recognize that certain compounds of the present invention may include an asymmetric center, such an asymmetric center being independently an R or S coordination. Such isomers can be separated from the mixture using or employing known methods. Chiral chromatography techniques may be one means of separating isomers from mixtures and chiral recrystallization techniques may be attempted as another means of separating isomers from the mixture. The individual isomeric mixtures may optionally be made using chiral precursors.

In the present invention, a solvate means a physical association of one or more solvent molecules with a compound of the present invention, and a physical association includes a hydrogen bond. In certain instances, solvates may be separated when one or more solvent molecules are bound in the crystal lattice of the crystalline solid. Solvates include both solution-phase and separable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

The present invention also provides a process for preparing a compound of the following formula (4) by Friedel-Crafts acylation of a compound of the following formula (5) and a compound of the following formula (3).

[Chemical Formula 5]

(3)

[Chemical Formula 4]

In this formula,

X is -O-, Y is -CH-,

R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂₎ or an amino (-NH _2), and, R ² is C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ and R ⁴ or hydrogen, R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH ₃ , -OC (O) CH ₃ or -OC (O) CH ₂ CH ₃ , R ⁵ is C ₁ -C ₄ alkyl or hydrogen and R ⁶ is C ₁ -C ₄ alkyl or hydrogen.

In the preparation method of the present invention, the compound of the formula (5) used as a starting material can be directly prepared and used by a known method. For example, Korean Patent Publication Nos. 2008-0027191 and 2005-0007056, Heterocycles 70 , 571-580 (2006) and Bioorg. Med. Chem . 18 : 7580-7585 (2010), and the like.

In the production process of the present invention, the compound of formula (3) is commercially available and can be easily purchased and used, or can be directly prepared by known methods.

In the preparation process of the present invention, the Friedel-Craft acylation reaction is selected from the group consisting of AlCl _3, BF ₃ , SbF ₅ , ZnCl ₂ , SnCl ₄ , TiCl ₄ , HCl, H ₂ SO ₄ and PPA (Polyphosphoric acid) May be carried out in the presence of one or more catalysts.

In the production process of the present invention, the amount of the catalyst used in the Friedel-Craft acylation reaction may be 0.1 to 2 times by mole, preferably 0.1 to 1 mole, Boulder can be used.

In the production method of the present invention, the Friedel greater lift acylation reaction is dichloromethane, toluene (toluene), benzene (benzene), 1,2- dichloroethane _{(Cl-CH 2 CH 2 -Cl} ), nitromethane (CH ₃ NO ₂ ), nitrobenzene (PhNO ₂ ), and carbon disulfide (CS ₂ ). The amount of the solvent to be used may be appropriately selected depending on the amount of the solvent to be used in a reaction solvent used in the Friedrich- For example, 1 to 100 parts by volume relative to the weight of [Formula 5].

In the production process of the present invention, the reaction temperature may be 0 to 50 캜, preferably 15 to 30 캜 (room temperature).

In the production process of the present invention, the compound of formula (4) may be any one selected from the following compounds:

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole;

2- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2 - ((5-aminobenzo [ d ] oxazol-2-yl) amino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((4-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5- (tert-butyl) benzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate; And

2- (5-Butyl-2 - ((5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate.

The present invention also provides a pharmaceutical composition for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases, comprising a compound of the following general formula (4), an isomer thereof, a pharmaceutically acceptable salt, hydrate or solvate thereof as an active ingredient do.

[Chemical Formula 4]

In this formula,

X is -O- or -S-,

Y is -CH- or -N-,

R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂ ), amino (-NH ₂ )

R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,

R ³ is -C (O) CH ₂ R ⁴ or hydrogen,

R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH ₃ and ,

R ⁵ is a C ₁ -C ₄ alkyl or hydrogen,

R ⁶ is C ₁ -C ₄ alkyl or hydrogen.

In the present invention, the nerve injury or neurological disease may be any one of brain injury, brain disease, spinal cord injury, peripheral nerve injury, peripheral nerve disease, or amyotrophic lateral sclerosis, Is one of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, stroke, ischemic brain disease or degenerative brain disease. .

The present invention also relates to a method for treating a neural cell, comprising administering an effective amount of the compound of the formula (4) or a pharmaceutically acceptable salt thereof to a mammal including a human, which requires neuronal differentiation or regeneration, Or regenerating, or treating neurological damage or neurological disorders.

In addition, the present invention provides the use of the compound of formula (4) or a pharmaceutically acceptable salt thereof for the preparation of a pharmaceutical preparation for the treatment of nerve cell differentiation or regeneration, nerve injury or neurological diseases.

The pharmaceutical composition of the present invention may contain at least one active ingredient which exhibits the same or similar functions in addition to the compound of the formula (4) or a pharmaceutically acceptable salt thereof.

The pharmaceutical composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above components for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, , And other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The pharmaceutical composition of the present invention can be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) according to a desired method, and the dose is appropriately determined depending on the patient's weight, age, , Diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dose of the compound of formula (IV) of the present invention and the compound selected from the compounds listed below, the isomer thereof, the pharmaceutically acceptable salt, the solvate or the hydrate thereof is about 10 to 1,000 mg / kg, 500 mg / kg, and it is more preferable to administer them once or several times a day.

The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy and biological response modifiers for the differentiation or regeneration of nerve cells, neuronal injury or neurological diseases.

The present invention also relates to a pharmaceutical composition for the treatment of neuronal differentiation or regeneration, neuronal injury or neurological diseases comprising a compound selected from the following compounds, isomers thereof, pharmaceutically acceptable salts, solvates or hydrates thereof as an active ingredient .

2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;

Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;

2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole;

2- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2 - ((5-aminobenzo [ d ] oxazol-2-yl) amino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((4-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5- (tert-butyl) benzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-Butyl-2 - ((5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;

2- (5-butyl-2 - ((5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate; And

N ² - (3-bromophenyl) benzo [ d ] oxazole-2,5-diamine.

Since the compound of the present invention has an effect of inducing the differentiation of embryonic stem cells into neurons, it can be used for the treatment of various degenerative neurological diseases or nerve damage diseases.

FIG. 1 is a photograph showing the neuronal differentiation effect of the compound 4b of the present invention. FIG.
FIG. 2 is a photograph showing the neuronal differentiation effect of the compound 4f of the present invention. FIG.
FIG. 3 is a photograph of the result of cell differentiation of DMSO used as a control group in Experimental Example.
Fig. 4 is a diagram showing the genes whose expression is induced by the compounds 4b and 4f of the present invention. Fig.
FIG. 5 is a photograph showing the effect of the compound 4b of the present invention on specific markers of neurons expressed in neurons. FIG.
FIG. 6 is a graph showing the effect of the compound 4b of the present invention on specific markers of neurons expressed in neurons. FIG.
Figure 7 In the differentiation of neural stem cells, bFGF was removed, DMSO was added at a concentration of 5 μM to induce differentiation, and the control group (-) and the compound of Example 3 and the compound of Example 18 were added. After 6 days from the induction of differentiation, Tuj1) and stellate cells (GFAP).
FIG. 8 is a graph (Tujl) and astrocyte (GFAP) after 6 days of induction of differentiation by adding the compound of Example 18 at a concentration of 5 [mu] M, respectively.

Hereinafter, preferred embodiments and experimental examples are provided to facilitate understanding of the present invention. The following examples and experimental examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples and experimental examples.

The ¹ H-NMR data were measured with a 400 MHz Varian FT-NMR spectrometer, and the mass data were measured using JMS-700 (Jeol , Japan) is a value measured by a machine.

One. N- Phenyl benzo [ d ] Oxazole-2-amine { N phenylbenzo [ d ] oxazol-2-amine} Derivative

end. The synthesis procedure of the N -phenylbenzo [ d ] oxazole-2-amine derivative is shown in Scheme 1. 2-aminophenol and phenyl isothiocyanate were reacted at room temperature to obtain phenylthiourea intermediates 2a and 2b . Then, 5 equivalents of KO ₂ were reacted to prepare benzooxazole ring materials 3a and 3b , and 4a to 4e were prepared by Friedel-Crafts acylation reaction.

[Reaction Scheme 1]

[Table 1] Synthesis of substituted (2- (substituted benzo [ d ] oxazol-2-ylamino) -5-ethylbenzene) rescue

I. The synthesis procedure of the N -phenylbenzo [ d ] oxazole-2-amine derivative is shown in Scheme 2. A 2-aminophenol and phenyl isothiocyanate were reacted at room temperature to obtain a phenylthiourea intermediate material. Then, 5 equivalents of KO ₂ were reacted to prepare a benzoxazole ring material, and 4a to 4e and Examples 7 to 17 were prepared by Friedel-Crafts acylation reaction.

[Reaction Scheme 2]

[Table 2] Synthesis of substituted (2- (substituted benzo [ d ] oxazol-2-ylamino) -5-ethylbenzene) rescue

2. Synthesis of Aminopyridinothiazole Derivatives

A step of synthesizing phenylthiourea by reacting 3-amino-2-hydroxypyridine and phenyl isothiocyanate and a ring closure reaction using an acid, To give an aminopyridinothiazole derivative compound (4f).

The structures of the compounds 4a to 4f and Examples 7 to 18 synthesized by the above methods are shown in [Table 3].

[Table 3] Structures of compounds 4a to 4f and Examples 7 to 18

< Manufacturing example  1 > 1- (5- Chloro -2- Hydroxyphenyl ) -3- (4- Ethyl phenyl ) Thiourea  Preparation of {1- (5-Chloro-2-hydroxyphenyl) -3- (4-ethylphenyl) thiourea} (2a)

4-ethylphenyl isothiocyanate (3.48 mmol, 1 eq) was added to 2-amino-4-chlorophenol (3.48 mmol, 1 eq) dissolved in 10 mL of methanol and the mixture was stirred for 24 hours at room temperature Lt; / RTI &gt; The organic solvent was evaporated under reduced pressure, and the precipitate was filtered under reduced pressure with n-hexane to obtain 1.01 g of substance 2a .

Brown solid (95%); _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 9.339 (s, 1H), 8.685 (s, 1H), 8.249 (dd, J = 14.2 Hz, 1H), 7.449-7.420 (m, 2H), 7.263 ( d, J = 8.4 Hz, 2H ), 7.036 (d, J = 8.8 Hz, 1H), 6.922 (d, J = 8.8 Hz, 1H), 2.649 (q, J = 7.6 Hz, 2H), 1.220 (t, J = 7.6 Hz, 3 H).

< Manufacturing example  2 > 1- (4- Ethyl phenyl ) -3- (2-hydroxy-5- Methylphenyl ) Thiourea  Preparation of {1- (4-Ethylphenyl) -3- (2-hydroxy-5-methylphenyl) thiourea} (2b)

Step 1: 2-Amino-4- Methylphenol  {2- Amino -4- methylphenol } Preparation of (1)

20 mL of methanol was slowly added dropwise to 4-methyl-2-nitrophenol (1.31 mmol, 1 eq) and 5% Pd / C (0.4 g), and then hydrogen was charged and stirred at room temperature (15 to 30 ° C) for 5 hours . The reaction solution was filtered through celite, and the filtrate solvent was removed under reduced pressure to obtain a substance 1.

Brown solid (96%); _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 6.582 (d, J = 8.0 Hz, 1H), 6.493 (s, 1H), 6.261 (d, J = 7.9 Hz, 1H), 2.115 (s, 3H) .

Step 2: Preparation of 1- (4-ethylphenyl) -3- (2-hydroxy-5-methylphenyl) thiourea )

4-ethylphenyl isothiocyanate (1.25 mmol, 1 eq) was added to 2-amino-4-methylphenol (1.25 mmol, 1 eq) dissolved in 3 mL of methanol and the mixture was stirred at room temperature Lt; / RTI &gt; The organic solvent was evaporated under reduced pressure, and the precipitate was filtered under reduced pressure with n-hexane to obtain 0.3 g of substance 2b .

Brown powder (95%); _{^{1 H NMR (DMSO- d 6,}} 400 MHz) δ 7.631 (d, J = 8.6 Hz, 2H), 7.313 (d, J = 8.0 Hz, 1H), 7.202 (m, 3H), 6.901 (d, J = 8.8 Hz, 1H), 2.570 (q, J = 7.4 Hz, 2H), 2.362 (s, 3H), 1.173 (t, J = 7.6 Hz, 3H).

PREPARATION EXAMPLE 3 Preparation of 5-chloro- N - (4-ethylphenyl) benzo [ d ] Oxazole-2-amine {5-Chloro- N - (4-ethylphenyl) benzo [ d ] oxazol-2-amine} (3a)

15 mL of acetonitrile was added slowly to KO ₂ (12.05 mmol, 5 eq) in an ice bath under nitrogen gas substitution. Subsequently, 1- (5-chloro-2-hydroxyphenyl) -3- (4-ethylphenyl) thiourea (2.41 mmol, 1 eq) dissolved in 20 mL of acetonitrile was slowly added. The reaction was carried out at room temperature (15 to 30 ° C) for 16 hours and then poured into ice water (35 ml) and diluted. Extraction with dichloromethane (30 ml) and washing twice with saturated aqueous NaCl solution (30 ml). After drying with MgSO ₄ , the solvent was removed under reduced pressure, and the resulting precipitate was filtrated under reduced pressure with EtOAc: hexane = 1: 10 (v / v) to obtain the title compound.

White powder (51%); _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 9.537 (s, 1H), 7.741 (d, J = 8.8 Hz, 2H), 7.426 (d, J = 1.0 Hz, 1H), 7.382 (d, J = 8.8 Hz, 1H), 7.246 ( d, J = 9.2 Hz, 2H), 7.123 (dd, J = 8.4 Hz, 1H), 2.633 (q, J = 7.6 Hz, 2H), 1.221 (t, J = 7.6 Hz , 3H).

&Lt; Preparation Example 4 & N - (4-ethylphenyl) -5-methylbenzo [ d ] Oxazole-2-amine { N - (4-ethylphenyl) -5-methylbenzo [ d ] oxazol-2-amine} (3b)

15 mL of acetonitrile was added slowly to KO ₂ (12.05 mmol, 5 eq) in an ice bath under nitrogen gas substitution. Subsequently, 1- (4-ethylphenyl) -3- (2-hydroxy-5-methylphenyl) thiourea (2.41 mmol, 1 eq) dissolved in 20 mL of acetonitrile was added slowly. The reaction was carried out at room temperature (15 to 30 ° C) for 16 hours and then poured into ice water (35 ml) and diluted. Extraction with dichloromethane (30 ml) and washing twice with saturated aqueous NaCl solution (30 ml). After drying with MgSO ₄ , the solvent was removed under reduced pressure, and the resulting precipitate was filtrated under reduced pressure with EtOAc: n-hexane = 1: 10 (v / v) to obtain the title compound.

White powder (98%); _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 9.318 (s, 1H), 7.757 (d, J = 9.2 Hz, 2H), 7.224 (m, 4H), 6.926 (d, J = 8.0 Hz, 1H) , 2.624 (q, J = 7.6 Hz, 2H), 2.392 (s, 3H), 1.217 (t, J = 7.6 Hz, 3H).

Example 1 Synthesis of 2- (2- (5-chlorobenzo [ d 2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate {2- (2- (5-Chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate} (4a)

AlCl ₃ (0.73 mmol, 2 eq) was added to 5-chloro- N- (4-ethylphenyl) benzo [ d ] oxazole-2-amine (0.37 mmol, 1 eq) dissolved in 10 mL of dichloromethane under nitrogen gas substitution The mixture was stirred at room temperature (15 to 30 ° C) for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added to the mixture in an ice bath, and the mixture was stirred at room temperature (15 to 30 ° C) for 5 hours. 10 mL of distilled water was added and extracted three times with 10 mL of EtOAc. The combined organic layers were washed twice with 10% aqueous HCl solution (10 ml) and twice with saturated aqueous NaCl solution (10 ml). After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. Subsequently, the precipitate was filtered under reduced pressure with n-hexane: EtOAc: ether = 5: 2: 1 (v / v / v) to obtain the title compound.

White powder (83%), mp 174.1-175.5 C; _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 7.660 (d, J = 2.0 Hz, 1H), 7.522 (d, J = 8.8 Hz, 1H), 7.403 (d, J = 6.8 Hz, 2H), 7.369 (d, J = 6.8 Hz, 2H), 7.355 (dd, J = 8.8 Hz, 1H), 5.292 (s, 2H), 2.739 (q, J = 7.7 Hz, 2H), 2.085 (s, 3H), 1.277 (t, J = 7.4 Hz, 3 H).

Example 2 Synthesis of 1- (2- (5-chlorobenzo [d] oxazol-2-ylamino) -5-ethylphenyl) -2- methoxyethanone {1- (2- d] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone} (4b)

AlCl ₃ (0.73 mmol, 2 eq) was added to 5-chloro- N- (4-ethylphenyl) benzo [ d ] oxazole-2-amine (0.37 mmol, 1 eq) dissolved in 10 mL of dichloromethane under nitrogen gas substitution The mixture was stirred at room temperature (15 to 30 ° C) for 10 minutes. Then, methoxymethylcarbonyl chloride (0.73 mmol, 2 eq) was added in an ice bath, and the mixture was stirred at room temperature (15 to 30 ° C) for 5 hours. 10 mL of distilled water was added and extracted three times with 10 mL of EtOAc. The combined organic layers were washed twice with 10% aqueous HCl solution (10 ml) and twice with saturated aqueous NaCl solution (10 ml). After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. Subsequently, the precipitate was filtered under reduced pressure with n-hexane: EtOAc: ether = 5: 2: 1 (v / v / v) to obtain the title compound.

White powder (28%), mp 121.6-123 [deg.] C; _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 7.653 (d, J = 6.0 Hz, 1H), 7.533 (d, J = 8.8 Hz, 1H), 7.357 (m, 4H), 4.611 (s, 2H) , 3.367 (s, 3H), 2.728 (q, J = 7.6 Hz, 2H), 1.271 (t, J = 7.6 Hz, 3H). HR-FABMS Calcd for C ₁₈ H ₁₈ ClN ₂ O ₃ (M ⁺ + H): 345.1006, Found: 345.1004.

Example 3 Methyl 4- (2- (5-chlorobenzo [ d ] Oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate {Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate} (4c)

AlCl ₃ (0.73 mmol, 2 eq) was added to 5-chloro- N- (4-ethylphenyl) benzo [ d ] oxazole-2-amine (0.37 mmol, 1 eq) dissolved in 10 mL of dichloromethane under nitrogen gas substitution The mixture was stirred at room temperature (15 to 30 ° C) for 10 minutes. Then, methoxycarbonylethylcarbonyl chloride (0.73 mmol, 2 eq) was added in an ice bath, and the mixture was stirred at room temperature (15 to 30 ° C) for 5 hours. 10 mL of distilled water was added and extracted three times with 10 mL of EtOAc. The combined organic layers were washed twice with 10% aqueous HCl solution (10 ml) and twice with saturated aqueous NaCl solution (10 ml). After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. Subsequently, the precipitate was filtered under reduced pressure with n-hexane: EtOAc: ether = 5: 2: 1 (v / v / v) to obtain the title compound.

White powder (16%), mp 143-145 &lt; 0 &gt;C; _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 7.651 (d, J = 2.0 Hz, 1H), 7.548 (d, J = 8.8 Hz, 1H), 7.400-7.373 (m, 3H), 7.349 (dd, J = 8.4 Hz, 1H), 3.637 (s, 3H), 3.090 (t, J = 6.4 Hz, 2H), 2.736-2.678 (m, 4H), 1.268 (t, J = 7.6 Hz, 3H). _{HR-FABMS Calcd for C 20 H} 20 ClN 2 O 4 (M + + H): 387.1112, Found: 387.1108.

Example 4: Synthesis of 1- (2- (5-methylbenzo [ d 2-ylamino) -5-ethylphenyl) -2-methoxyethan e {1- (2- (5-Methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone} (4d)

AlCl ₃ (0.73 mmol, 2 eq) was added to N - (4-ethylphenyl) -5-methylbenzo [ d ] oxazole-2-amine (0.37 mmol, 1 eq) dissolved in dichloromethane The mixture was stirred at room temperature (15 to 30 ° C) for 10 minutes. Then, methoxymethylcarbonyl chloride (0.73 mmol, 2 eq) was added in an ice bath, and the mixture was stirred at room temperature (15 to 30 ° C) for 5 hours. 10 mL of distilled water was added and extracted three times with 10 mL of EtOAc. The combined organic layers were washed twice with 10% aqueous HCl solution (10 ml) and twice with saturated aqueous NaCl solution (10 ml). After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. Subsequently, the precipitate was filtered under reduced pressure with n-hexane: EtOAc: ether = 5: 2: 1 (v / v / v) to obtain the title compound.

White powder (12%), mp 107.8-108.8 캜; _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 7.438 (s, 1H), 7.372 (d, J = 3.2 Hz, 1H), 7.357-7.306 (m, 4H), 7.152 (d, J = 8.4 Hz, 1H), 4.575 (s, 2H), 3.355 (s, 3H), 2.714 (q, J = 7.6 Hz, 2H), 2.436 (s, 3H), 1.261 (t, J = 7.6 Hz, _{HR-FABMS Calcd for C 19 H} 21 N 2 O 3 (M + + H): 325.1552, Found: 325.1548.

Example 5 Methyl 4- (2- (5-methylbenzo [ d ] Oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate {Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate} (4e)

AlCl ₃ (0.73 mmol, 2 eq) was added to N - (4-ethylphenyl) -5-methylbenzo [ d ] oxazole-2-amine (0.37 mmol, 1 eq) dissolved in dichloromethane The mixture was stirred at room temperature (15 to 30 ° C) for 10 minutes. Then, methoxycarbonylethylcarbonyl chloride (0.73 mmol, 2 eq) was added in an ice bath, and the mixture was stirred at room temperature (15 to 30 ° C) for 5 hours. 10 mL of distilled water was added and extracted three times with 10 mL of EtOAc. The combined organic layers were washed twice with 10% aqueous HCl solution (10 ml) and twice with saturated aqueous NaCl solution (10 ml). After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. Subsequently, the precipitate was filtered under reduced pressure with n-hexane: EtOAc: ether = 5: 2: 1 (v / v / v) to obtain the title compound.

White powder; _{^{1 H NMR (Acetone- d 6,}} 400 MHz) δ 7.928 (s, 1H), 7.444 (s, 1H), 7.392 (d, J = 8.4 Hz, 1H), 7.374-7.324 (m, 2H), 7.202- 7.153 (m, 2H), 3.631 (s, 3H), 3.049 (t, J = 6.4 Hz, 2H), 2.719-2.671 (m, 2H), 2.589 (t, J = 4.0 Hz, 2H), 2.435 (s , 3H), 1.256 (t, J = 7.2 Hz, 3H).

Example 6 Synthesis of 2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole &lt; RTI ID = 0.0 &gt; {2- [ N - (4-Ethoxyphenyl)] aminopyridinothiazole} (4f)

Step 1: Synthesis of 3-amino-2-hydroxypyridine

Pd / C (4.2 mmol, 3eq mg) was added to the catalyst via 3-nitro-2-hydroxypyridine (1.4 mmol, 200 mg, 1 eq) and the air was completely removed by using a pump. 10 mL of MeOH was added to dissolve the reagent, and the hydrogen balloon was replaced with hydrogen. After vigorously stirring at room temperature (15 to 30 ° C) for 5 hours, the solution was filtered through celite to remove Pd / C, and the filtrate was concentrated under reduced pressure to obtain 140 mg (89%) of 2-amino-3-hydroxypyridine.

Step 2: N - (2-hydroxypyridino) - N '- (4-ethoxyphenyl) thiourea { N - (2-Hydroxypyridino) - N Synthesis of '- (4-ethoxylphenyl) thiourea}

(4-ethoxyphenyl isothiocyanate, 162.9 mg, 0.91 mmol) was added to 100 mg (0.91 mmol) of 3-amino-2-hydroxypyridine and the mixture was completely dissolved by adding 25 ml of MeOH. And the mixture was stirred at room temperature (15 to 30 ° C). The precipitate formed over time was filtered off under reduced pressure and the solvent was removed to give the title compound.

White powder, IR (KBr, cm -1) 3456, 1660, 1477, 1375, 1 H NMR (Acetone-d 6, 400MHz) δ 1.248 (t, J = 7.2Hz, 3H), 3.966 (q, J = 7.2 J = 2.0 and 6.8 Hz, 1H), 7.235-7.257 (m, 2H), 7.051 (m, 2H), 6.132 (t, J = 6.8 Hz, 1H), 6.835-6.885 (dd, J = 2.0 and 6.8 Hz, 1 H)

Step 3: 2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole &lt; RTI ID = 0.0 &gt; {2- [ N - (4-Ethoxyphenyl)] aminopyridinothiazole} (4f)

N - (2- hydroxypyridone dino) - N'- The mixture of (4-ethoxyphenyl) thiourea (100mg, 0.345mmol) and acetic acid (TFA) (5 mL) trifluoroacetic reflux for 24 hours And cooled to room temperature (15 to 30 DEG C). TFA was removed by rotary evaporation and the title compound was obtained by column chromatography (EtOAc: n-Hexane = 1: 3 (v / v)).

Pale brown powder, mp 138-139 ° C, ¹ H NMR (Acetone- d _{6 ,} 400 MHz)? 1.37 (t, J = 6.8 Hz, 3H), 4.05 (q, J = 6.8 Hz, 2H) 6.97 (m, 2H), 7.31 (dd, J = 8.0, 4.8 Hz, 1H), 7.70 ~ 7.729 (m, 2H), 7.79 (dd, J = 8.0, 1.6 Hz, 1H), 8.20 (dd, J = 4.8, 1.6 Hz, 1H); FABHRMS (m / z): 272.0858 (M + +1, requires C 14 H 14 N 3 OS: 272.0862)

Example 7 Synthesis of 2- (2- (5-methylbenzo [ d Ylamino) -5-ethylphenyl) -2-oxoethyl acetate {2- (2- (5- Methylbenzo [ d ] oxazol-2- ylamino ) -5- ethylphenyl ) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloromethane (dichloromethane), dissolved in 10 ml N- (4- ethylphenyl) -5-phenyl-benzo [d] oxazol-2-amine {N- (4-ethylphenyl) -5 -methylphenylbenzo [d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (28%), mp 113.5-114 [deg.] C; _{^{1 H NMR (Acetone- d 6,}} 400MHz) δ 7.442 (s, 1H), 7.387-7.365 (m, 2H), 7.352-7.326 (m, 2H), 7.144 (d, J = 8.4Hz, 1H), 5.261 (s, 2H), 2.724 (q, J = 7.6Hz, 2H), 2.434 (s, 3H), 2.079-2.040 (m, 3H), 1.266 (t, J = 7.6Hz, 3H). _{HR-FABMS Calcd for C 20 H} 21 N 2 O 4 (M + + H): 353.1501, Found: 353.1502.

Example 8 2- (5-Butyl-2 - ((5-nitrobenzo [ d 2-yl) amino) phenyl) -2-oxoethylacetate {2- (5-butyl- 2- (5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloromethane (dichloromethane), dissolved in 10 ml N- (4- butylphenyl) -5-nitro-phenyl-benzo [d] dioxol-2-amine {N- (4-butylphenyl) -5 -nitrophenylbenzo [d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

Pale yellow powder (18.3%), mp 89 ~ 90 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ8.522 (d, J = 2.4Hz, 1H), 8.213-8.241 (dd, J = 2.4Hz , J = 9.0Hz, 1H), 7.883 (d, J = 9.2Hz, 1H), 7.371 (s, 4H), 5.281 (s, 2H), 2.661 (t, J = 7.8Hz, 2H), 2.106 (s , 3H), 1.570 ~ 1.646 ( m, 2H), 1.306 ~ 1.399 (m, 2H), 0.928 (t, J = 7.4Hz, 3H), HR-FABMS Calcd for C 21 H 22 N 3 O 6 (m + + &Gt;): 413.1534, Found: 413.1543

Example 9 Synthesis of 2- (5-butyl-2 - ((5-methoxybenzo [ d 2-yl) amino) phenyl) -2-oxoethyl acetate {2- (5-butyl- 2- (5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

To a solution of N- (4-butylphenyl) -5-methoxyphenylbenzo [d] oxazole-2-amine, which was dissolved in 10 ml of dichloromethane under nitrogen gas substitution, d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

Brown powder (10%), mp 150 ~ 152 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.507 (d, J = 8.8Hz, 1H), 7.293 ~ 7.351 (m, 3H), 7.251 ( (d, J = 2.4 Hz, 1H), 6.887 (dd, J = 2.8 Hz, J = 9.2 Hz, 1H), 5.211 (s, 1H), 4.496 t, J = 7.6Hz, 2H) , 2.075 (d, J = 3.6Hz, 3H), 1.557 ~ 1.614 (m, 2H), 1.314 ~ 1.370 (m, 2H), 0.921 (t, J = 6.4Hz, 3H ), HR-FABMS Calcd for C 22 H 25 N 2 O 5 (M + + H): 397.1758, Found: 397.1764

< Example  10> 2- (2 - ((5- Aminobenzo [ d ] Oxazole Yl) amino) -5- Butylphenyl )-2- Oxoethyl acetate  {2- (2 - ((5- aminobenzo [ d ] oxazol-2- yl ) amino ) -5- butylphenyl ) -2-oxoethylacetate}

In a nitrogen gas substitution was dissolved in 10 ml of dichloromethane (dichloromethane) N- (4- butylphenyl) -5-phenyl-benzo [d] oxazol-2-amine {N- (4-butylphenyl) -5 -aminophenylbenzo [d ] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

Dark brown powder (40.74%), mp 170 ~ 172 ℃ 1 H-NMR (DMSO-d6, 400MHz) δ7.690 (d, J = 1.6Hz, 1H), 7.619 (dd, J = 2.0Hz, J = 6.8 Hz, 1H), 7.401 (d , J = 8.8Hz, 1H), 7.252 (dd, J = 2.0Hz, J = 8.8Hz, 1H), 7.182 (d, J = 8.4Hz, 2H), 5.223 (s, 2H), 4.654 (s, 2H), 4.523 (s, 2H), 2.545 (t, J = 7.8 Hz, 2H), 2.132 (d, J = 1.6 Hz, 3H), 1.504 ~ 1.580 1.279 ~ 1.353 (m, 2H) , 0.900 (t, J = 7.2Hz, 3H), HR-FABMS Calcd for C 21 H 24 N 3 O 4 (M + + H): 382.1761, Found: 382.1768

< Example  11 > 2- (5-Butyl-2 - ((4- Methylbenzo [ d ] Oxazole Yl) amino) Phenyl )-2- Oxoethyl acetate  {2- (5- butyl -2 - ((4- methylbenzo [ d ] oxazol-2- yl ) amino ) phenyl ) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloromethane (dichloromethane), dissolved in 10 ml N- (4- butylphenyl) -4-phenyl-benzo [d] oxazol-2-amine {N- (4-butylphenyl) -4 -methylphenylbenzo [d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (27.13%), mp 82 ~ 83 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.405 (dd, J = 1.2Hz, J = 7.6Hz, 1H), 7.327 (d, J = 2H), 2.642 (t, J = 7.6 Hz, 2H), 2.070 (s, 3H), 1.554-1.630 (m, 2H) 1.293 ~ 1.385 (m, 2H) , 0.917 (t, J = 7.4Hz, 3H), HR-FABMS Calcd for C 22 H 25 N 2 O 4 (m + + H): 381.1809, Found: 381.1811

Example 12: Synthesis of 2- (5-butyl-2 - ((6-methylbenzo [ d 2-yl) amino) phenyl) -2-oxoethylacetate {2- (5-butyl- 2- ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloromethane (dichloromethane), dissolved in 10 ml N- (4- butylphenyl) -6-phenyl-benzo [d] oxazol-2-amine {N- (4-butylphenyl) -6 -methylphenylbenzo [d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (10%), mp 82 ~ 83 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.544 (d, J = 8.4Hz, 1H), 7.438 (s, 1H), 7.290 ~ 7.347 ( m, 4H), 7.185 (d , J = 8.8Hz, 1H), 5.169 (s, 2H), 2.641 (t, J = 7.6Hz, 2H), 2.397 (s, 3H), 2.069 (s, 3H), 1.552 ~ 1.629 (m, 2H) , 1.291 ~ 1.384 (m, 2H), 0.917 (t, J = 7.4Hz, 3H), HR-FABMS Calcd for C 22 H 25 N 2 O 4 (m + + H): 381.1809, Found: 381.1815

Example 13 Preparation of 2- (5-butyl-2 - ((5- (tert-butyl) benzo [ d 2-yl) amino) phenyl) -2-oxoethyl acetate To a solution of {2- (5-butyl-2- ) -2-oxoethylacetate}

Butyl (4-butylphenyl) -5-tert-butylphenylbenzo [ d ] oxazole-2-amine -butylphenylbenzo [ d ] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (7.6%), mp 82 ~ 83 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.762 (d, J = 1.6Hz, 1H), 7.510 (d, J = 8.4Hz, 1H) , 7.376 (dd, J = 2.4 Hz, J = 8.8 Hz, 1H), 7.288-7.349 (m, 3H), 5.217 (s, 2H), 2.643 (t, J = 7.6 Hz, 2H) 3H), 1.556 ~ 1.631 (m , 2H), 1.359 (d, J = 7.6Hz, 2H), 1.295 (s, 9H), 0.920 (t, J = 7.2Hz, 3H), HR-FABMS Calcd for C 25 H ₃₁ N ₂ O ₄ (M &lt; ⁺ & gt ^; + H): 423.2278, Found: 423.2283

Example 14 Synthesis of 2- (2- (benzo [ d ] Oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate {2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloro-N- (4- butylphenyl) benzo [d] oxazol-2-amine {N- (4-butylphenyl) benzo [d] oxazol-2-amine} was dissolved in methane (dichloromethane) 10 ml ( 0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq), and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (12%), mp 66 ~ 68 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.664 ~ 7.688 (m, 1H), 7.601 ~ 7.624 (m, 1H), 7.305 ~ 7.387 (m J = 7.6 Hz, 2H), 2.080 (s, 3H), 1.588 (d, J = 7.2 Hz, 2H), 1.342 (q, J = 7.6 Hz, , 2H), 0.921 (t, J = 7.6Hz, 3H), HR-FABMS Calcd for C 21 H 23 N 2 O 4 (M + + H): 367.1652, Found: 367.1658

Example 15 2- (5-Butyl-2 - ((5-fluorobenzo [ d 2-yl) amino) phenyl) -2-oxoethyl acetate {2- (5-butyl- 2- (5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

To a solution of N- (4-butylphenyl) -5-fluorophenylbenzo [ d ] oxazole-2-amine in 10 ml of dichloromethane under nitrogen gas substitution, d ] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (7.4%), mp 67 ~ 69 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.638 ~ 7.671 (m, 1H), 7.568 (dd, J = 2.4Hz, J = 8.8Hz, 1H), 7.364-7.315 (m, 3H), 7.194-7.141 (m, IH), 5.237 (s, 2H), 2.650 (t, J = 7.8Hz, 2H) (m, 2H), 1.317 ~ 1.373 (m, 2H), 0.924 (t, J = 7.4Hz, 3H), HR-FABMS Calcd for C 21 H 22 FN 2 O 4 (M + + H): 385.1558, Found : 385.1550

Example 16: Synthesis of 2- (5-butyl-2 - ((5-chlorobenzo [ d 2-yl) amino) phenyl) -2-oxoethylacetate {2- (5-butyl- 2- (5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

In a nitrogen gas substitution was dissolved in 10 ml of dichloromethane (dichloromethane) N- (4- butylphenyl) -5-chloro-phenyl-benzo [d] oxazol-2-amine {N- (4-butylphenyl) -5 -chlorophenylbenzo [d ] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

Ivory powder (41.48%), mp 85 ~ 88 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.787 (d, J = 2.0Hz, 1H), 7.658 (d, J = 8.8Hz, 1H) , 7.316 ~ 7.368 (m, 4H ), 5.235 (s, 2H), 4.485 (s, 1H), 2.649 (t, J = 8.0Hz, 2H), 2.088 (s, 3H), 1.560 ~ 1.636 (m, 2H ), 1.298 ~ 1.390 (m, 2H), 0.922 (t, J = 7.6Hz, 3H), HR-FABMS Calcd for C 21 H 22 N 2 O 4 (M + + H): 401.1263, Found: 401.1266

Example 17: Synthesis of 2- (5-butyl-2 - ((5-methylbenzo [ d Yl) amino) phenyl) -2-oxoethyl acetate {2- (5-butyl- 2- (5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethylacetate}

In a nitrogen gas-substituted dichloromethane (dichloromethane), dissolved in 10 ml N- (4- butylphenyl) -5-phenyl-benzo [d] oxazol-2-amine {N- (4-butylphenyl) -5 -methylphenylbenzo [d] oxazol-2-amine} (0.37 mmol, 1 eq) was added AlCl ₃ (0.073 mmol, 0.2 eq) and the mixture was stirred at room temperature for 10 minutes. Then, acetoxyacetyl chloride (0.73 mmol, 2 eq) was added in an ice bath and the mixture was stirred at room temperature for 5 hours. 10 ml of distilled water was added and extracted three times with 10 ml of EtOAc. The organic layers were combined and washed twice with 10% aqueous HCl and twice with saturated aqueous NaCl solution. After drying over MgSO ₄ , the solvent was concentrated under reduced pressure. The precipitate was then filtered under reduced pressure with hexane: EtOAc: ether = 5: 2: 1 to give the title compound.

White powder (51.6%), mp 94 ~ 95 ℃, 1 H-NMR (DMSO- d 6, 400MHz) δ7.465 ~ 7.486 (m, 1H), 7.291 ~ 7.350 (m, 4H), 7.120 ~ 7.147 (m 2H), 1.293 (s, 3H), 2.064 (t, J = 8.0 Hz, 3H), 1.554-1.631 1.367 (m, 2H), 0.919 (t, J = 7.4Hz, 3H), HR-FABMS Calcd for C 22 H 25 N 2 O 4 (M + + H): 381.1809, Found: 381.1813

Example 18: Synthesis of N ² - (3-bromophenyl) benzo [ d ] Oxazole-2,5-diamine {N ² - (3-bromophenyl) benzo [ d ] oxazole-2,5-diamine}

The method of synthesizing the compound of Example 18 is shown in Reaction Scheme 3 below.

[Reaction Scheme 3]

Step 1: Synthesis of phenylthiourea intermediate 2

3-Bromophenyl isothiocyanate (3.244 mmol, 1 eq) was added to 2-amino-4-nitrophenol (3.244 mmol, 1 eq) dissolved in methanol (10 mL) and the mixture was stirred at room temperature for 24 hours. The organic solvent was evaporated under reduced pressure, and the precipitate was filtered under reduced pressure with n-hexane to obtain substance 2.

Step 2: Synthesis of benzoxazole ring material 3

10 mL of acetonitrile was added slowly to KO ₂ (6.302 mmol, 5 eq) in an ice bath under nitrogen gas substitution. The thiourea material 2 (1.2604 mmol, 1 eq) dissolved in 20 mL of acetonitrile was slowly added. After reacting at room temperature for 16 hours, it was poured into ice water and diluted. Extracted three times with 20 mL of dichloromethane and washed with saturated aqueous NaCl solution. After drying with MgSO ₄ , the solvent was removed under reduced pressure.

Step 3: Reduction of benzoxazole ring material 3

To 3 g (0.3531 mmol) of 5% Pd / C was added 0.2 g of methanol, and 10 mL of methanol was slowly added dropwise, followed by charging with hydrogen and stirring at room temperature for 16 hours. The reaction solution was filtered through celite, and the filtrate solvent was removed under reduced pressure to obtain the title compound of the following structure.

Yield: 85.93%, melting point: 247 ~ 249 ° C,

Rf: 0.214 [Nucleic acid: ethyl acetate (1: 1)]

_{^{1 H-NMR (Acetone- d 6}} , 400MHz): δ9.718 (brs, 1H), 7.870 (d, J = 7.6Hz, 2H), 7.513 (d, J = 8.4Hz, 1H), 7.404 (t, J = 8.0 Hz, 2H), 7.095 (t, J = 7.2 Hz, 2H)

<Experimental Example 1>

1) Preparation of Green Fluorescent Protein (GFP) expressing cell line using R1 cell, embryonic stem cell of mouse

Plasmid expressing GFP through the Oct4 gene promoter was inserted into 1X10 ⁶ mouse-derived R1 cells (provided by Dr Andras Negy, Mount Sinai Hospital, New York, New York, USA) using electroporation. The GFP expression plasmid is a frismid containing an 18 kb (promoter) gene fragment containing the promoter of the Oct4 gene (GOF-18 DELTA PE, provided by Dr. Hans R. Scholler, Max-Planck-Gesellshaft, Munster, Germany) (Yeom, YI , et al., Germline regulatory element of Oct-4 specific for the totipotent cycle of embryonal cells. Development, 1996. 122 (3): 881-94). To select antibiotics, Pgk-neoPA plasmid (Hirofumi Suemori, Kyoto University, Japan) containing anti-neomycin gene was added to the cells for electroporation. The electroporated cells were cultured on a mouse embryonic fibroblast (MEF) cell of a mouse expressing the anti neomycin gene using a stem cell medium containing 0.2 mg / ml of neomycin. The proliferated colonies were separated and cultured in a large amount, and GFP detected only in a pluripotency state through a glow-light microscope. Identified cell lines were named R1-GFP and stored in liquid nitrogen and taken out when needed.

2) induction of differentiation of R1-GFP cell line

The mouse embryonic stem cell, R1, was cultured on mouse embryonic fibroblast (MEF). For the differentiation experiments, R1-GFP cells were cultured in a 0.1% gelatin-coated culture dish for 2 hours to remove MEF and transferred to a Petri dish to induce embryoid body (EB) formation. For EB formation compensation body (EB) formed was cultured in R1-GFP cells for 6 days 37 ℃ in Petri dishes, 5% CO ₂ cell incubator are about 15 to 20 each 96 well-angle of the plate (well-plate) And dispensed into wells. Leukemia inhibitory factor (LIF), which is added to the medium as a differentiation inhibitor of mouse stem cells, was excluded from the culture medium for the induction of differentiation. Compound 4b synthesized in Example 2 and compound 4f synthesized in Example 6 were added to the medium at a concentration of 5 μM, respectively, and then added to each well to induce differentiation. The same amount of dimethyl sulfoxide (DMSO) was used as a control. The culture medium containing each compound was continuously incubated at 37 ° C and 5% CO ₂ while being replaced with fresh medium at intervals of 24 hours.

3) Immunohistochemistry

Cells differentiated were fixed with 4% aldehyde and cell identification was performed using primary antibody. Anti-tubulin β-III (AB cam) and anti-myosin heavy chain (Millipore) were used as primary antibodies to stain R1-GFP cells And phalloidin (Invitrogen) conjugated with Alexa 555 was used to stain F-actin. Fixed cells were treated with 1 ml of phosphate-buffered saline (PBST) containing 0.1% triton-X100 for 10 minutes and then treated with 5% skim milk-PBST containing the antibody for 12 hours at 4 ° C. After washing three times with PBST, the cells were incubated at room temperature (15 to 30 ° C) for 2 hours with PBST supplemented with a secondary antibody conjugated with a fluorescent substance. The cells were then washed three times with PBST, covered with Gold Antifade mounting solution (Invitrogen), covered with cover glass and amplified 100 times by confocal fluorescence microscopy.

4) Confirmation of neuronal differentiation induction

R1 EB colonies dispensed into each well of a 96-well plate were treated with 5 μM of Compound 4b synthesized in Example 2 and 4f synthesized in Example 6, respectively, It was observed that a morphological form was formed. Cells showed distinct dendritic and axonal structures of nerve cells, which formed active connections between nerve cells. In addition, by confirming the expression of beta-III tubulin specific to neurons, the differentiated cells were identified as neurons (FIGS. 1 and 2). On the other hand, no specific pattern of differentiation was observed in the cells treated with DMSO (Fig. 3). In Figs. 1 to 3, a scale bar = 200 m.

<Experimental Example 2>

1) Microarray experiment

R1 cells were treated with compound 4b synthesized in Example 2 and compound 4f synthesized in Example 6 with each compound at a concentration of μM for 1 week and total RNA was isolated. As a control, total RNA extracted from R1 cells treated with the same amount of DMSO for the same period was used. CDNA was prepared using the obtained RNA and applied to Agilent's mouse cDNA microarray chip to screen for the genes whose expression was induced by the compounds 4b and 4f. The gene expressed at a higher concentration was selected in the cells treated with the compound as compared to the control treated with DMSO, and the criterion was that the amount of the gene expressed by the compound was log ₂ scale smaller than the expression level in the DMSO- 2 or more.

2) Comparative analysis of induction of gene expression

The genes that were induced to be expressed by the compounds 4b and 4f synthesized in Example 2 and Example 6 were confirmed by microarray method. The genes expressed in the R1 cells treated with the compounds 4b and 4f, respectively, were not only mutually superimposed but also genes that were uniquely expressed by each compound were present (Fig. 4). The genes expressed by compound 4b and compound 4f are summarized in Table 4. Many of these genes are known to be expressed in neurons.

[Table 4]

<Experimental Example 3>

1) Culture of ENSTem-A human neuroblastoma

ENSTem-A neural progenitor cells and media for their cultures and media additives were purchased from Millipore and cultured and stored according to the manufacturer's recommendations.

2) induction of differentiation of ENSTem-A human neuroblastoma

The medium was removed from the neural cells grown in the ENStem-A ™ Neural expansion medium (Millipore), and the compounds 4b and 4f synthesized in Example 2 and Example 6, respectively, were inoculated into the neural differentiation medium ENTEM-A ™ Neural differentiation medium, (Millipore)) and cultured at 37 ° C and 5% CO ₂ . Control cells were cultured under the same conditions in differentiation medium supplemented with the same amount of DMSO as the above compound. Then, the cells were continuously supplied with fresh differentiation medium to which the compound or DMSO was added every 3 days. At 3 weeks after induction of differentiation, 1 μM of AraC was added to the medium to remove the cells that did not differentiate and proliferate.

3) Confirmation of induction of immunohistochemistry and neuronal differentiation

Specific markers of neurons expressed in differentiated neurons were detected by immunohistochemistry using antibodies. First, AraC was added to human neuroblastoma inducing differentiation to remove proliferating cells and cultured for 1 week. Cells with differentiation were fixed with 4% aldehyde and cell identification was performed using primary antibody. In order to stain ENSTem-A cells, anti-ChAT antibodies (markers for cholinergic neurons), anti-DARPP32 antibodies (markers for dopaminergic neurons), anti-VGluT1 antibodies (for glutamine antibodies to the respective differentiation markers of anti-HB9 antibodies (markers of glutaminergic neurons), anti-HB9 antibodies (markers of motor neurons), and anti-GAD65 antibodies (markers of GABAergic neurons). Fixed cells were treated with 1 ml of phosphate-buffered saline (PBST) containing 0.1% triton-X100 for 10 minutes and then treated with 5% skim milk-PBST containing the antibody for 12 hours at 4 ° C. After washing three times with PBST, the cells were incubated at room temperature (15 to 30 ° C) for 2 hours with PBST supplemented with a secondary antibody conjugated with a fluorescent substance. The cells were then washed three times with PBST, covered with Gold Antifade mounting solution (Invitrogen), covered with cover glass and amplified 100 times by confocal fluorescence microscopy.

In the case of neuroblastoma treated with DMSO, various types of neuronal markers were expressed. A relatively large amount of markers of dopaminergic neurons, markers of cholinergic neurons, and glutaminergic neurons were expressed, and markers of GABAergic neurons were observed even though they were small in number , And the markers of motor neurons were very low in expression. In contrast, neuroblastoma treated with compound 4b was characterized in that only the markers of cholinergic neurons and glutaminergic neurons were expressed in most differentiated cells, and the marker expression of cholinergic neurons (Fig. 5).

4) Real-Time qPCR experiment and induction of neuronal differentiation induction

In order to identify the differentiated neurons, RNA was extracted from the differentiated cells through real-time quantitative polymerase chain reaction (RT-qPCR) as well as the immunohistochemical method, Marker gene expression was quantitatively analyzed. The RT-qPCR was obtained from Applied Biosystem's Power SYBR  Green PCR Master Mix. The base sequence of the used primer is as follows. GAPDH (Forward: 5'ATGGAAATCCCATCACCATCTT3 ', Reverse: 5'GCCCCACTTGATTTTGG3'), ChAT (Forward: GATGAAACCTACCTGATGAGCAACC3 ', Reverse: CAGCTGTGAAAGCTAGAGATGCAGA3'), TH (Forward: 5'TCACCAAGTTCGACCCTGACC3 ', Reverse: 5'GCGATCTCAGCAATCAGCTTC3', DARPP32 (Forward: 5 'AGGCACCATCTCAAGTCGAAG3', Reverse: 5'AGACTGCAGGTGAGACTCAGCAA3 ').

The change in gene expression by treatment with compound 4b and DMSO was evaluated by measuring the expression ratio (Induction Fold) (gene / GAPDH) using Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) The results are shown in Fig.

Analysis of RT-qPCR revealed that neurons differentiated by compound 4b had a higher level of expression of chAT, a cholinergic neuron marker, than DMSO-treated cells. In contrast, DARPP32, a dopaminergic neuron marker, and TH, a noradrenergic neuron marker, were low (FIG. 6). Thus, compound 4b shows that ENSTem-A human neuroblast cells are distinctively differentiated into cholinergic neurons.

<Experimental Example 4>

Rat embryonic cortices at embryonic day 14 (E14) were cultured in 30,000 cells per cm ² (24-well plate pre-coated with polyornithine / fibronectin (Nunc) ) At an initial density of 3 * 10 ⁴ / well and cultured in serum-free N2 medium supplemented with bFGF (20 ng / ml; R & D system) for 3 days at 37 ° C and 5% CO ₂ . After the cells were excluded from the culture medium, cell differentiation was induced by culturing (culture without bFGF in the culture medium). In order to exclude bFGF from the medium, cell differentiation was induced for 6 days while changing the serum-free N2 medium to the differentiation medium every other day.

The cultured cells were fixed with 4% paraformaldehyde (PFA), blocked with 0.1% BSA / 0.3% Triton X-100 and incubated with primary antibody (Tuj1 (1: 500, Covance) / GFAP Biomedicals) at 4 &lt; 0 &gt; C overnight. A secondary antibody labeled with Alexa 488- (1: 200, Invitrogen) and Cy3- (1: 200, Jackson Immunoresearch Laboratories) was applied and 4,6-diamidino-2 -phenylindole) (DAPI, Vector Laboratories, INC.) on VECRASHIELD ^® . Immunoreactive cells were analyzed under fluorescence microscope. Cell counting was performed under a microscope using an eye-piece grid at a final magnification of 200. More than 10 microscopic fields were randomly selected and quantified in each well.

Immunocytohistochemistry (immunocytochemistry) showed that the marker Tuj1 of the neuron and the marker GFAP expression pattern of astrocytes (see FIG. 7) were counted to obtain an accurate numerical value.

Figure 7 In the differentiation of neural stem cells, bFGF was removed, and the control group (-) induced by differentiation by adding DMSO and the compound of Example 3 and the compound of Example 18 were added at a concentration of 5 μM, respectively. After 6 days of induction of differentiation, Tuj1) and stellate cells (GFAP).

FIG. 8 is a graph (Tujl) and astrocyte (GFAP) after 6 days of induction of differentiation by adding the compound of Example 18 at a concentration of 5 [mu] M.

In FIG. 7, treatment of the compound of Example 3 compared to the control (-) resulted in more expression of the neurocyte marker Tuj1, and when the compound of Example 18 was treated, the astrocytic marker GFAP It can be confirmed that the expression is higher. Specifically, when the compound of Example 3 was treated at a concentration of 5 μM as compared to the control (-) supplemented with DMSO at differentiation induction, the differentiation of neurons increased from 44% to 67% as shown in the figure. In contrast, astrocytes decreased from 36% to 22%. As a result, it can be seen that the compound of Example 3 is involved in the determination of fate of neural stem cells into neural stem cells. It has been demonstrated that neural stem cells are normally present in adult brain tissue and new neuronal cells are formed. And such new neuronal cell production is known to increase during brain injury. However, in neurodegenerative diseases such as Parkinson's disease and Alzheimer's disease, differentiation into neurons from neural stem cells is insufficient. In order to treat such diseases, stimulation of neural stem cells existing in brain injury sites promotes differentiation into neurons Is the most central treatment strategy. In addition, neural stem cells are differentiated into astrocytes, and differentiated astrocytes serve to help nerve cells function. Therefore, in the treatment of neurodegenerative diseases, differentiation from neural stem cells into neurons is important as well as differentiation into astrocytes that can help and protect neuronal functions. Therefore, it was confirmed through the above experiments that the compounds of the present invention, for example, the compound of Example 3 and the compound of Example 18 can be used for the treatment of various neurodegenerative diseases or nerve damage diseases.

Claims (22)

Compounds of formula 1, stereoisomers, pharmaceutically acceptable salts, solvates or hydrates thereof:
[Chemical Formula 1]

In this formula,
X is -O- or -S-,
Y is -CH- or -N-,
R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO ₂ ), amino (-NH ₂ )
R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,
R ³ is -C (O) CH ₂ R ⁴ or hydrogen,
R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) is CH ₃ or -OC (O) CH ₂ CH ₃ .
Provided that X is -S-; Y is -N-; R ¹ is H, R ² is -OCH ₂ CH ₃ , R ³ is H,
X is -O-; Y is -CH-; R ¹ is -NH ₂ ; R ² is -CH ₂ CH ₃ ; R ³ is H,
X is -O-; Y is -CH-; R ¹ is -CH ₃ ; R ² is -CH ₂ CH ₃ ; R ³ is H,
X is -S-; Y is -N-; R ¹ is H; R ² is -CH ₂ CH ₃ ; R ³ is H, and
X is -S-; Y is-CH; R ¹ is H; R ² is -CH ₂ CH ₃ ; R ³ is H; The compound of claim 1, wherein when X is -O-, Y is -CH- and R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO _2), or amino (-NH _2), and, R ² is a C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C ₄ alkoxy, _{-CH 2 C (O) OCH 3} , -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH _3, a compound of formula 1. 2. Compounds of formula I according to claim 1, wherein when X is -S-, Y is -N-, R ¹ is hydrogen, R ² is methoxy, propoxy or butoxy and R ³ is Lt; 1 &gt; is hydrogen. The compound of claim 1, wherein the compound of formula (1) is any one of the following compounds:
2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate; And
2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole. The compound of claim 1, wherein the compound of Formula 1 is 1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5- [ N - (4-ethoxyphenyl)] aminopyridinothiazole. A compound of the following formula (1), a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a solvent thereof, a compound of the following formula (2) and a compound of the following formula (3) by Friedel-Crafts acylation Method for producing cargo or hydrate:
(2)

(3)

[Chemical Formula 1]

In this formula,
X is -O-, Y is -CH-,
R ¹ is fluoro, chloro, bromo, iodo, and also, C ₁ -C ₄ alkyl, nitro (-NO ₂₎ or an amino (-NH _2), and, R ² is C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 Or -OC (O) CH ₂ CH ₃ . 7. The process of claim 6, wherein the Friedel-Craft acylation reaction is carried out in the presence of one or more compounds selected from the group consisting of AlCl _3, BF ₃ , SbF ₅ , ZnCl ₂ , SnCl ₄ , TiCl ₄ , HCl, H ₂ SO ₄ and PPA (Polyphosphoric acid) Or a pharmaceutically acceptable salt, solvate or hydrate thereof, wherein the compound is carried out in the presence of a catalyst, a stereoisomer, a pharmaceutically acceptable salt, a solvate or a hydrate thereof. The method according to claim 7, wherein the amount of the catalyst to be used is an equimolar amount based on the mole of the compound of formula (III), a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a solvent A method for producing cargo or hydrate. The method of claim 6, wherein the Friedel greater lift acylation reaction is dichloromethane, toluene (toluene), benzene (benzene), 1,2- dichloroethane _{(Cl-CH 2 CH 2 -Cl} ), nitromethane (CH ₃ NO ₂ ), Nitrobenzene (PhNO ₂ ) and carbon disulfide (CS ₂ ), a stereoisomer, a pharmaceutically acceptable salt, a solvate thereof, or a mixture thereof. &Lt; / RTI &gt; The method according to claim 6, wherein the compound of formula (1) is any one of the following compounds, stereoisomers, pharmaceutically acceptable salts, solvates or hydrates thereof.
2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate. A treatment selected from the group consisting of brain damage, spinal cord injury, peripheral nerve injury, and neurological diseases containing, as an active ingredient, a compound of the following formula 1, a stereoisomer thereof, a pharmaceutically acceptable salt, a solvate or a hydrate thereof Pharmaceutical composition:
[Chemical Formula 1]

In this formula,
X is -O- or -S-,
Y is -CH- or -N-,
R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, nitro (-NO ₂ ), amino (-NH ₂ )
R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,
R ³ is -C (O) CH ₂ R ⁴ or hydrogen,
R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) is CH ₃ or -OC (O) CH ₂ CH ₃ . 12. The therapeutic pharmaceutical composition according to claim 11, wherein the compound of formula (I) is any one selected from the group consisting of brain injury, spinal cord injury, peripheral nerve injury,
2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate; And
2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole. 13. The compound of claim 12, wherein the compound of formula (I) is 1- (2- (5-chlorobenzo [ d ] oxazol- And [ N - (4-ethoxyphenyl)] aminopyridinothiazole, brain injury, spinal cord injury, peripheral nerve injury, and neurological disease. 12. The pharmaceutical composition according to claim 11, wherein the neurological disease is brain disease, peripheral neuropathy, or amyotrophic lateral sclerosis. 15. The method of claim 14, wherein the brain disease is selected from the group consisting of dementia, Parkinson's disease, Alzheimer's disease, Huntington's disease, epilepsy, stroke, Wherein the compound is selected from the group consisting of a neurodegenerative disease and a degenerative brain disease. Compounds of formula 4, stereoisomers, pharmaceutically acceptable salts, solvates or hydrates thereof:
[Chemical Formula 4]

In this formula,
X is -O- or -S-,
Y is -CH- or -N-,
R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂ ), amino (-NH ₂ )
R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,
R ³ is -C (O) CH ₂ R ⁴ or hydrogen,
R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH ₃ and ,
R ⁵ is a C ₁ -C ₄ alkyl or hydrogen,
R ⁶ is C ₁ -C ₄ alkyl or hydrogen.
Provided that X is -S-; Y is -N-; R ¹ , R ³ , R ⁵ and R ⁶ are H and R ² is -OCH ₂ CH ₃ ,
X is -O-; Y is -CH-; R ¹ is -NH ₂ ; R ² is -CH ₂ CH ₃ ; R ³ , R ⁵ and R ⁶ are H,
X is -O-, Y is -CH-, R ¹ is -CH ₃ , R ² is -CH ₂ CH ₃ , R ³ is H, R ⁵ and R ⁶ are H,
X is -S-, Y is -N-, R ¹ , R ³ , R ⁵ , and R ⁶ are H; R ² is -C ₂ H ₅ , and
X is -S-; Y is -CH-; R ¹ , R ³ , R ⁵ and R ⁶ are H; Compounds in which R ² is -CH ₂ CH ₃ are excluded. 17. The method of claim 16, when the compound of Formula 4; X is -O-, Y is -CH-, R ¹ is iodo, fluoro, chloro, bromo, a C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO _2), or amino (-NH _2), and, R ² is a C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ R ⁴ a, R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH ₃ a, R ⁵ is a C ₁ -C ₄ alkyl or hydrogen, R ⁶ is C ₁ -C ₄ alkyl or hydrogen compound of the formula 4]. 17. Compounds of formula I according to claim 16, wherein when X is -S-, Y is -N-, R ¹ is hydrogen, R ² is methoxy, propoxy or butoxy and R ³ is Hydrogen, R &lt; ⁵ &gt; is hydrogen and R &lt; ⁶ &gt; is hydrogen. 17. The compound of claim 16, wherein the compound of formula (4) is any one of the following compounds:
2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole;
2- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (2 - ((5-aminobenzo [ d ] oxazol-2-yl) amino) -5-butylphenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((4-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5- (tert-butyl) benzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate; And
2- (5-Butyl-2 - ((5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate. A compound of the following formula (5) and a compound of the following formula (3) by Friedel-Crafts acylation to prepare a compound of the following formula (4), a stereoisomer thereof, a pharmaceutically acceptable salt thereof, Method for producing cargo or hydrate:
[Chemical Formula 5]

(3)

[Chemical Formula 4]

In this formula,
X is -O-, Y is -CH-,
R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂₎ or an amino (-NH _2), and, R ² is C ₁ -C ₄ alkyl, R ³ is -C (O) CH ₂ and R ⁴ or hydrogen, R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH ₃ , -OC (O) CH ₃ or -OC (O) CH ₂ CH ₃ , R ⁵ is C ₁ -C ₄ alkyl or hydrogen and R ⁶ is C ₁ -C ₄ alkyl or hydrogen. There is provided a pharmaceutical composition for treatment of any one selected from the group consisting of brain damage, spinal cord injury, peripheral nerve damage and neurological diseases containing, as an active ingredient, a compound of the following formula 4, a stereoisomer thereof, a pharmaceutically acceptable salt, a solvate or a hydrate thereof Pharmaceutical composition:
[Chemical Formula 4]

In this formula,
X is -O- or -S-,
Y is -CH- or -N-,
R ¹ is fluoro, chloro, bromo, iodo, C ₁ -C ₄ alkyl, C ₁ -C ₄ alkoxy, nitro (-NO ₂ ), amino (-NH ₂ )
R ² is C ₁ -C ₄ alkyl or C ₁ -C ₄ alkoxy,
R ³ is -C (O) CH ₂ R ⁴ or hydrogen,
R ⁴ is C ₁ -C _{4 alkoxy, -CH 2 C (O) OCH} 3, -CH 2 C (O) OCH 2 CH 3, -OC (O) CH 3 or -OC (O) CH ₂ CH ₃ and ,
R ⁵ is a C ₁ -C ₄ alkyl or hydrogen,
R ⁶ is C ₁ -C ₄ alkyl or hydrogen. Any one selected from the group consisting of brain damage, spinal cord injury, peripheral nerve damage and neurological diseases containing as active ingredients a compound selected from the following compounds, stereoisomers, pharmaceutically acceptable salts, solvates or hydrates thereof Therapeutic pharmaceutical composition:
2- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
1- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-chlorobenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
1- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-methoxyethanone;
Methyl 4- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -4-oxobutanoate;
2- [ N - (4-ethoxyphenyl)] aminopyridinothiazole;
2- (2- (5-methylbenzo [ d ] oxazol-2-ylamino) -5-ethylphenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5-nitrobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((5-methoxybenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (2 - ((5-aminobenzo [ d ] oxazol-2-yl) amino) -5-butylphenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((4-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((6-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5- (tert-butyl) benzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (2- (benzo [ d ] oxazol-2-ylamino) -5-butylphenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((5-fluorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-Butyl-2 - ((5-chlorobenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate;
2- (5-butyl-2 - ((5-methylbenzo [ d ] oxazol-2-yl) amino) phenyl) -2-oxoethyl acetate; And
N ² - (3-bromophenyl) benzo [ d ] oxazole-2,5-diamine.

Images