KR101666667B1 - Sugar-attached phenoxodiol compounds, preparing method thereof and pharmaceutical compositions containing the same as active ingredients - Google Patents

Abstract

(상기 식에서, R₁은 갈락토오스(galactose) 또는 2˝-디옥시-글루코오스(2˝-deoxy-glucose)임.)
본 발명에 따른 상기 화학식 1의 화합물, 또는 이의 약학적으로 허용가능한 염은 항산화 활성 및 전립선암과 난소암에 대하여 항암 활성 효과를 나타내어, 관련 질환의 예방 및 치료에 유용하게 사용될 수 있다.The present invention relates to a compound represented by the following formula (1), or a pharmaceutically acceptable salt thereof.
[Chemical Formula 1]

Wherein R ₁ is galactose or 2 " -deoxy-glucose.
The compound of formula (I) according to the present invention, or a pharmaceutically acceptable salt thereof, exhibits anticancer activity and anticancer activity against prostate cancer and ovarian cancer, and can be useful for prevention and treatment of related diseases.

Description

Sugar-attached phenoxodiol compounds, preparing method thereof and pharmaceutical compositions containing the same active ingredients, and a method for producing the same,

The present invention relates to a sugar-linked phenoxothiazole compound useful for the treatment or prevention of ovarian cancer and prostate cancer, a process for producing the same, and a pharmaceutical composition containing the same as an active ingredient. More particularly, ) Or a recombinant microbial bio-conversion (microbial bio-conversion) method.

With the rapid development of medicine and pharmacology and the accompanying aging of the global population, cancer is recognized as one of the leading causes of death in developed countries, and the development of a new anticancer chemotherapy drug is urgent.

Flavonoids, which have recently become a main ingredient of health functional foods, have various physiological activities such as antioxidant activity, anticancer activity, anti-inflammation and anti-allergic activity (see Non-Patent Document 1) Increasing pharmacological activity and development as candidate drug are recognized as key technologies for the development of new drugs. Among them, there is a preparation method by enzymatic or microbial bioconversion using a glycosyltransferase capable of transferring a sugar molecule to a hydroxyl group in a flavonoid chemical structure. The sugar binding of such a specific compound can increase its solubility and absorbability at the time of bioavailability compared with the original substance, thus not only contributing to the improvement of formulations of drugs, the development of new formulations and prodrugs, It is almost impossible with existing technology to prepare sugar-bound compounds by conventional chemical synthesis methods.

Isoflavonoids, a flavonoid present in vegetables and in many soybean plants, is one of the major plant hormones that can regulate the plant's growth cycle and death, and is believed to provide the same effect in animals (see Non-Patent Document 2 ). Among them, genistein (4 ', 5,7-trihydroxyisoflavone) regulates cell cycle progression, mitotic arrest, or apoptosis, (See Non-Patent Document 3). In particular, genistein is known to exhibit anticancer activity against multiple mammalian normal cells and tissues, such as low toxicity, ovarian cancer, prostate cancer, and stomach cancer. However, limited bioavailability and various pathway metabolism of genistein are difficult to maintain the proper concentration in the blood when administered to a living body, resulting in difficulties in clinical application (see Non-Patent Document 4).

The phenoxodiol (haganin E) 4 ', 7-dihydroxyisoflav-3-ene (Figure 1) is isoflavene series, a semi-synthetic derivative of genistein, Range activity and is known to induce mitotic arrest and apoptosis in cancer cell lines. The anticancer activity of phenoxodiol, which is an isoflavonoid semi-synthetic derivative, has been rapidly approved by the FDA in the US and has been approved for treatment of hormone-refractory prostate cancer and recurrent ovarian cancer. This is a chemosensitizer used in combination therapy of platinum / taxanes and has completed Phase 2 clinical trials (see Non-Patent Document 5).

The present inventors have found that, in the Korean patent application No. 10-2014-0080957 (the name of the invention: a phenoxodiol glucoside compound, a process for producing the same, and a pharmaceutical composition containing the same as an active ingredient) 4- O -glucoside (5'- O -glucoside) through the conversion activity of the recombinant sugar transferase MrGT1 expressed in Escherichia coli derived from a strain of Micromonospora rhodorangea using phenoxodiol as a substrate phenoxodiol-4'- O -glucoside) and Fe nokso diol -7- O - glucoside (phenoxodiol-7- O and filed an enzymatic method of producing pepper nokso diol glucoside compound bar -glucoside), ??? the above process for producing the page nokso prepared according when examining the antioxidant activity of the diol compound glucoside, ascorbic acid (ascorbic acid) the first positive control showed the IC ₅₀ to about 23 ug / ml, non- Soldier page nokso diol is compared versus the IC ₅₀ appeared to be about 33 ug / ml the page nokso diol glucoside compounds are found to be about 43 ug / ml. It was confirmed that phenoxodiol glucoside compounds showed antioxidative activities similar to ascorbic acid or phenoxodiol having strong antioxidative activity. On the other hand, when the phenoxodiol glucoside compounds were assayed for anticancer activity against human cancer cells, phenothiodol as a positive control group showed an IC ₅₀ value of about 31 μM against ovarian cancer cell line SKOV-3 as a prostate cancer cell line showed an IC ₅₀ value of about 20 μM with respect to DU-145, in the case of another positive control of cisplatin (cisplatin) chemotherapeutic agent (chemotherapy agent) the ovarian cancer cell line is approximately 36 μM, prostate cancer cell line is approximately 30 μM the exhibited IC ₅₀ value. In contrast, the phenoxodiol glucoside compounds showed IC ₅₀ values of about 33 μM and 23 μM for the ovarian cancer cell line and the prostate cancer cell line, respectively. The results showed that phenoxodiol glucoside compounds exhibited anticancer activities related to prostate and ovarian cancer and showed improved anticancer activity compared with cisplatin, which is a conventional chemotherapeutic agent. I could.

As described above, it is possible to provide novel flavonoid compounds through enzymatic reactions using flavonoids having various physiological activities as substrates, and to provide novel recombinant microorganism-cultured cells expressing the related sugar-transferase by adding flavonoids to sugar- To improve recombinant microbial biotransformation yield of sugar-bound flavonoid compounds through pathway redesign of glycosyl donor biosynthetic pathway in microorganisms, and to further improve physiological activity or formulation properties compared to conventional flavonoid compounds, The present invention can broaden the industrial applicability of a composition containing sugar-binding flavonoid compounds as a health functional food, a cosmetic product and a medicine.

 Xiao, J., et al., Flavonoid glycosylation and biological benefits. Biotechnol. Adv. 2014. S0734-9750 (14) 00092-5.  Du, H., et al., Genetic and metabolic engineering of isoflavonoid biosynthesis. Appl. Microbiol. Biotechnol. 2010. 86 (5): p. 1293-312.  Banerjee, S., et al., Molecular evidence for increased antitumor activity of gemcitabine by genistein in vitro and in vivo using an orthotopic model of pancreatic cancer. Cancer Res. 2005. 65 (19): p. 9064-72.  Liu, Y., et al., Absorption and metabolism of flavonoids in the caco-2 cell culture model and a perused rat intestinal model. Drug Metab. Dispos. 2002. 30 (4): p. 370-7.  Gamble, J. R., et al., Phenoxodiol, an experimental anticancer drug, shows potent antiangiogenic properties in addition to its antitumour effects. Int. J. Cancer. 2006. 118 (10): p. 2412-20.

It is an object of the present invention to provide a sugar-linked phenoxothiazole compound exhibiting antioxidant and anticancer activity by an enzymatic or recombinant microorganism transfection method.

To this end, the inventors of the present invention have developed a recombinant glycosyltransferase (MrGT1), which expresses a glycoprotein encoding gene derived from micro-monospore rhododendron strain in E. coli, as a sugar receptor and a nucleotidyl uridine diphosphate galactose (UDP-Gal) or thymidine diphosphate 2'-deoxy-glucose (TDP-2'-deoxy-Glc) The sugar chain-bound phenoxothiol derivatives were biosynthesized, and then mass spectrometry and nuclear magnet resonance spectrometry analysis were performed to obtain phenoxodiol 7- O -galactoside ( phenoxodiol 7- O -galactoside) and Fe nokso diol 7- O -2˝- deoxy-glucoside (phenoxodiol 7- O -2˝-deoxy- glucoside) confirmed the structural novelty of the compound and, finally antioxidant activity and human cancer By confirming anticancer activity against pimples, a novel sugar-bonded phenoxothiazole compound having galactose and 2 " -dioxy-glucose sugar added to phenoxodiol, an isoplavene-based semi-synthetic compound, Completed.

In addition, the biosynthetic pathway per nucleic acid in E. coli was redesigned and mrGT1 Recombinant E. coli expressing the gene and hygK gene was further prepared and the yield of phenothioated 7- O -galactoside was improved by adding phenoxothiol to the recombinant E. coli culture.

In order to attain the above object, the present invention provides a compound represented by the following formula (1), or a pharmaceutically acceptable salt thereof.

[Chemical Formula 1]

Wherein R ₁ is galactose or 2 " -deoxy-glucose.

In addition, the compounds Fe nokso diol 7-0 - characterized in that the glucoside-galactosyl side or page nokso diol 7- O -2˝- deoxy.

The present invention also provides a pharmaceutical composition for the prophylaxis or treatment of prostate cancer or ovarian cancer, which comprises the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof.

The present invention also provides a pharmaceutical composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt and carrier thereof.

The present invention also provides a method for producing a recombinant herpes simplex virus, comprising the steps of 1) obtaining recombinant herpes simplex enzyme MrGT1 from Escherichia coli, and 2) reacting the recombinant herpes simplex enzyme obtained in the above step 1) with a phenoxothiazole and a nucleic acid sugar, To obtain a compound represented by the above formula (1).

Also, the nucleic acid sugar may be a uridine diphosphate galactose (UDP-Gal) or a thymidine diphosphate 2'-deoxy-glucose (TDP-2'-deoxy-Glc ).

The present invention also relates to an expression vector comprising the mrGT1 gene; an expression vector containing the hygK gene; There is provided a composition for preparing a compound represented by the above formula (1) including a host cell and a phenoxothiazole.

In addition, the gene is also mrGT1 ditch Jia derived mono spokes la micro, hygK the gene is characterized in that it is a Streptomyces spp Hi Hi Gloss nose kusu Gross nose kusu DSM 40578 strain derived.

The present invention also relates to a method for producing 1) E. coli BL21 (DE3)) and transforming the mrGT1 gene; 2) transforming the recombinant E. coli obtained in step 1) BL21 (DE3) ( mrGT1 )) and transforming hygK gene; and 3) transforming the final recombinant E. coli obtained in step 2) BL21 (DE3) ( mrGT1 : hygK )) culture medium containing a phenoxothiazole as a substrate.

In addition, the present invention: 1) the E. coli is an E. coli deficient galE gene obtained in step 2) the following steps: 1) for the defect in the galE gene (E. coli BL21 (DE3)) (E. coli Converting transformed by a gene mrGT1 in BL21 (DE3) (△ galE) ) expression, 3) a 2) recombinant E. coli obtained in step (E. coli BL21 (DE3) (△ galE: mrGT1)) recombinant E. coli obtained in the final stage, and 4) the 3) the step of transfection with the gene expressing the hygK (E. coli BL21 (DE3) (? GalE: mrGT1: hygK )) with a phenoxothiazole as a substrate.

The present invention also relates to a method for producing a recombinant Escherichia coli ( E. coli) BL21 (DE3) (? GalE : mrGT1 : hygK )).

The compound of formula (I) or a pharmaceutically acceptable salt thereof according to the present invention may further express an enzymatic reaction of the recombinant herbal mutant MrGT1 or the mrGT1 gene and the hygK gene encoding the glycoprotein , The antioxidant activity and anticancer activity against prostate cancer and ovarian cancer can be effectively used for the prevention and treatment of related diseases since they are produced by biodegradation by adding phenoxodiol to the redesigned recombinant E. coli culture broth.

1 is bonded per page nokso diol compound which are fetched nokso diol 7-0-a schematic diagram of an enzymatic method of producing glucoside-galactosyl side and page nokso diol 7- O -2˝- deoxy.
Fig. 2 shows a method for redesigning the metabolic pathway per nucleic acid in E. coli and a method for reassessing the mrGT1 < RTI ID = 0.0 > Is a schematic diagram for producing sugar-bound phenox diol compounds by the microbial biotransformation technique by further introduction of genes and hygK genes.
FIG. 3 is a representative HPLC-ESI-MS / MS chromatogram for confirming the productivity of sugar-bound phenoxothiol compounds in three kinds of cultures of recombinant E. coli.
The glucoside, the positive comparison soldier page nokso diol, a positive control - 4 is combined per page nokso diol compound, page nokso diol 7-0-galactosyl side and page nokso diol 7- O -2˝- deoxy Ascorbic acid and phenoxodiol glucoside compounds of the present invention.
The glucoside, the positive comparison soldier page nokso diol, the positive control-5 is coupled per page nokso diol compound, page nokso diol 7-0-galactosyl side and page nokso diol 7- O -2˝- deoxy A graph showing the anticancer activity of cisplatin chemotherapeutic agent and phenoscodiol glucoside compounds against prostate cancer or ovarian cancer-related cancer cell lines.

Hereinafter, the present invention will be described in detail.

The present invention provides a compound represented by the following formula (1), or a pharmaceutically acceptable salt thereof:

[Chemical Formula 1]

In the above formula, R ₁ may be galactose or 2'-deoxy-glucose having the chemical structure shown in Table 1 below.

[Table 1]

Representative examples of the compound represented by the above formula (1) are as follows:

1) Fe nokso diol 7-0-galactosyl side, and

2) phenoxodiol 7- O- 2'-deoxy-glucoside.

The compound of formula (I) according to the present invention may be used in the form of a pharmaceutically acceptable salt. As the salt, an acid addition salt formed by a pharmaceutically acceptable free acid is useful. As the free acid, inorganic acid and organic acid can be used. As the inorganic acid, hydrochloric acid, bromic acid, sulfuric acid, phosphoric acid and the like can be used. As the organic acid, citric acid, acetic acid, lactic acid, maleic acid, pumaric acid, gluconic acid, Succinic acid, tartaric acid, 4-toluenesulfonic acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid and the like can be used. Sulfuric acid may be preferably used.

The compounds of formula (I) according to the present invention include not only pharmaceutically acceptable salts, but also all salts, hydrates and solvates which can be prepared by conventional methods.

In addition, the compound of Formula 1 according to the present invention may be prepared in crystalline form or amorphous form, and may be arbitrarily hydrated or solvated when the compound of Formula 1 is prepared in crystalline form.

The present invention also provides a pharmaceutical composition for the prophylaxis or treatment of prostate cancer or ovarian cancer, which comprises the compound represented by the formula (1) or a pharmaceutically acceptable salt thereof.

The term "prophylactic " used in the present invention means any action that inhibits or delays a cancerous disease by the administration of a pharmaceutical composition comprising the compound represented by the above-mentioned formula (1) or a pharmaceutically acceptable salt thereof. As used herein, the term "treatment" as used herein refers to all treatments for improving or ameliorating symptoms of cancer by administering a pharmaceutical composition comprising the compound represented by Formula 1 or a pharmaceutically acceptable salt thereof it means.

The compound of formula 1 of the present invention or a pharmaceutically acceptable salt thereof exhibits antioxidative activity (Experimental Example 1), exhibiting anticancer activity (Experimental Example 2) against prostate cancer and ovarian cancer-related cancer cell lines (Experimental Example 2) Or to prevent or treat ovarian cancer diseases.

The present invention also provides a pharmaceutical composition comprising the compound represented by Formula 1, or a pharmaceutically acceptable salt and carrier thereof.

The pharmaceutical compositions of the present invention may be formulated into oral or parenteral administration forms according to standard pharmaceutical practice. These formulations may contain, in addition to the active ingredient, an additive such as a pharmaceutically acceptable carrier, adjuvant or diluent.

When the composition of the present invention is used as a medicine, a pharmaceutical composition containing at least one compound represented by the formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient can be administered orally or parenterally But are not limited thereto.

The formulations for oral administration may be, for example, tablets, pills, hard capsules, soft capsules, liquids, suspensions, emulsions, syrups, granules, elixirs and the like, (E.g., silica, talc, magnesium salt of stearic acid, calcium salt of stearic acid, and / or polyethylene glycol), such as sodium chloride, dextrose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine have. The tablets may also contain binders such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, optionally mixed with starch, agar, alginic acid or its sodium salt The same disintegrating or boiling mixture and / or absorbing agent, coloring agent, flavoring agent, and sweetening agent.

Formulations for parenteral administration may include subcutaneous injection, intravenous injection, intramuscular injection, or intra-thoracic injection. In this case, in order to formulate the composition for parenteral administration, the pharmaceutical composition of the present invention contains at least one compound represented by the general formula (1) or a pharmaceutically acceptable salt thereof, which is mixed with water or a stabilizer or a buffer to prepare a solution or suspension, Which can be prepared in an ampoule or vial unit dosage form. The composition may be sterilized and / or contain preservatives, stabilizers, wettable or emulsifying accelerators, adjuvants such as salts and / or buffers for the control of osmotic pressure, and other therapeutically useful substances and may be mixed, granulated Or a coating method.

The dose of the compound of the present invention to the human body may vary depending on the patient's age, body weight, sex, dosage form, health condition, and disease severity. When the patient is 70 kg in body weight, And may be 0.01-100 mg / day, preferably 0.01-500 mg / day. Depending on the judgment of a doctor or pharmacist, it may be administered once to several times a day at intervals of a certain period of time.

The present invention also provides a method for producing a recombinant herpes simplex virus, comprising the steps of 1) obtaining recombinant herpes simplex enzyme MrGT1 from Escherichia coli, and 2) reacting the recombinant herpes simplex enzyme obtained in the above step 1) with a phenoxothiazole and a nucleic acid sugar, To obtain a compound represented by the above formula (1).

In one aspect of the present invention, the preparation method may further include a step of separating, purifying, or separating and purifying the enzyme reaction product obtained in the step 2) by a high pressure liquid chromatography (HPLC) method have.

In one aspect of the present invention, the stationary phase used in the high pressure liquid chromatography method may be reversed phase C18, but is not limited thereto.

In one aspect of the present invention, the mobile phase used in the high pressure liquid chromatography method may be a mixed liquid of acetonitrile: methanol: water: formic acid 40: 40: 19.8: 0.2 (v / v / v / v) It does not.

In one aspect of the present invention, the high pressure liquid chromatography retention time may be 15 to 18 minutes, but is not limited thereto.

In one aspect of the present invention, the nucleic acid sugar is selected from the group consisting of uridine diphosphate galactose (UDP-Gal) or thymidine diphosphate 2'-deoxy-glucose (TDP-2 Gt; -deoxy-Glc). ≪ / RTI >

The present invention also provides a composition for preparing a compound of the formula (1) containing the expression vector, host cells (E. coli, etc.) and Fe nokso diol containing an expression vector, containing the gene hygK mrGT1 gene.

In one aspect of the present invention, the mrGT1 gene is selected from the group consisting of Micromonospora rhodorangea ). < / RTI >

In one embodiment of the present invention, the hygK gene may be derived from Streptomyces hygroscopicus subsp. Hygroscopicus DSM 40578 strain, but is not limited thereto.

The present invention also relates to a method for producing 1) E. coli BL21 (DE3)) and transforming the mrGT1 gene; 2) transforming the recombinant E. coli obtained in step 1) BL21 (DE3) ( mrGT1 )) and transforming hygK gene; and 3) transforming the final recombinant E. coli obtained in step 2) BL21 (DE3) ( mrGT1 : hygK )) culture medium containing a phenoxothiazole as a substrate.

In addition, the present invention: 1) the E. coli is an E. coli deficient galE gene obtained in step 2) the following steps: 1) for the defect in the galE gene (E. coli BL21 (DE3)) (E. coli Converting transformed by a gene mrGT1 in BL21 (DE3) (△ galE) ) expression, 3) a 2) recombinant E. coli obtained in step (E. coli BL21 (DE3) (△ galE: mrGT1)) recombinant E. coli obtained in the final stage, and 4) the 3) the step of transfection with the gene expressing the hygK (E. coli BL21 (DE3) (? GalE: mrGT1: hygK )) with a phenoxothiazole as a substrate.

The present invention also relates to a method for producing a recombinant Escherichia coli ( E. coli) BL21 (DE3) (? GalE : mrGT1 : hygK )).

Hereinafter, embodiments for explaining the present invention in more detail will be presented.

However, the following examples are provided to more easily illustrate the present invention, and the present invention is not limited by the examples.

< Example  1 to 2> Sugar bond Phenoxodiol  Preparation of compounds

(One) Micro Monospore Rhodolajia  From the dielectric Transglycosylase  Isolation of the coding gene

In order to isolate the glycosyltransferase derived from the microorganism Monospora rhodorans strain, first, a genome separated from the microorganism monospora rhodoria strain was used as a template, and a sequence prepared based on the nucleotide sequence of the genome Polymerase chain reaction (PCR) was performed with the primers of SEQ ID NO: 1 and SEQ ID NO: 2 as follows. The N-terminal primer is the sequence of SEQ ID NO: 1 below and the C-terminal primer is the sequence of SEQ ID NO: 2 below.

SEQ ID NO: 1: 5' -GG CATATG AGCGAGCCTGACACGGGTG-3 '( Nde I restriction site)

SEQ ID NO: 2: 5 '- CGTGGTGGGCCGA CTCGAG GAGAACAC-3' ( Xho I restriction site)

The genomic DNA of the strain and the primers were mixed together with Taq DNA polymerase to perform a total of 32 cycles (initial inactivation at 98 [deg.] C for 5 min, gradient from 52.8 [deg.] C to 69.3 [deg.] C, Terminated after 5 minutes of reaction). PCR product was purified and ligated to pGEMR-T easy vector (pGEMR-T easy vector, Promega, Madison, Wis., USA) and then ligated to E. coli XL1 blue (XL1 blue, Stratagene, La Jolla, Lt; 0 &gt; C for 45 seconds, followed by transformation. After isolating and purifying the T-iso vector from the selected transformed E. coli, the nucleotide sequence thereof (SEQ ID NO: 3) and the amino acid sequence deduced therefrom (SEQ ID NO: 4) were determined.

SEQ ID NO: 3:

SEQ ID NO: 4:

(2) In E. coli  Recombination The party  enzyme MrGT1 Manifestation of

The mrGT1 DNA fragment obtained by treating the above T- isovector with NdeI and XhoI restriction enzymes was inserted into pET-28 (a +) (Novagen, Madison, Wis., USA), a protein expression vector treated with the same restriction enzymes , And then transformed into E. coli BL21 (DE3) (Stratagene, La Jolla, CA, USA). At this time, 50 ppm of kanamycin antibiotics was used for selection of transformants.

The recombinant Escherichia coli was inoculated into the LB medium (Luria Bertani) supplemented with 1 M of sorbitol and 2.5 mM betaine at a final concentration of 1%, and cultured at 37 ° C. D-thiogalactopyranoside (IPTG; Sigma, St.) was added to a final concentration of 0.5 mM to induce protein expression when growth was observed at an optical density between 0.6 and 0.8. Louis, MO, USA). The recombinant E. coli strain was further cultured at 20 DEG C for 24 hours. After culturing, the culture was centrifuged at 2000 rpm for 10 minutes to collect the cells, and the cells were suspended in 50 mM sodium phosphate lysis buffer (300 nM NaCl, 10 mM imidazole, 10% glycerol, 1% Triton X-100) And sonication was carried out. After centrifugation at 12000 rpm for 20 minutes, the supernatant was collected separately and analyzed by 12% SDS-PAGE to confirm the expression level of the recombinant MrGT1 enzyme. In order to purify the expressed recombinant protein, the supernatant was diluted with Talon-metal affinity resin (Clontech, Mountain View, Calif., USA) equilibrated with 50 mM phosphate buffer (0.3 M NaCl, 20 mM imidazole) CA, USA) and incubated at 4 ° C for one hour. After refrigerated centrifugation at 2000 rpm for 5 minutes, the resin was introduced into a disposable column and washed with phosphate buffer containing 20 mM imidazole in a volume of 10 times the resin. Finally, recombinant glycoconjugate enzyme MrGT1 bound to the resin was purified with 3 ml of a phosphate buffer solution containing 220 mM imidazole.

(3-1) By enzymatic reaction Sugar bond Phenoxodiol  Synthesis, separation and purification of compounds

(50 mM phosphate buffer, 10 mM magnesium chloride, 1 mg / ml bovine serum) was added to the reaction solution after dissolving 50 mM of phenoxothiazole (Sigma, St. Louis, MO, USA) Albumin) to give a final concentration of 1 mM. Then, 30 μM of the prodrug MrGT1 prepared in (1) and (2) of Examples 1 and 2 above and UDP-Gal (Sigma ) And 2 mM TDP-2'-deoxy-Glc (GeneChem, Daejeon, Korea) were added, respectively, and the enzyme reaction was carried out at 37 ° C for 3 hours (see FIG. After the reaction, an equal amount of ethyl acetate was added to terminate the reaction. Only the upper organic solvent layer was collected and vacuum dried. High pressure liquid chromatography (HPLC) analysis was performed to confirm the biosynthesis of the objective compound in the extract. Acquity CSH C18 (Waters, 50x1.0 mm) was added to the mobile phase at a rate of 150 μl / min in a mixture of acetonitrile: methanol: water: formic acid 40:40:19.8: 0.2 (v / v / v / v) 1.7 μm; Milford, Mass., USA).

Meanwhile, a combination flash Rf MPLC system as described below was used for the isolation and purification of the desired sugar-bonded phenoxothiazole compound from the crude extract. To an MPLC system in which a mixed liquid of acetonitrile: methanol: water: formic acid 40: 40: 19.8: 0.2 (v / v / v / v) was flowed to a mobile phase at a rate of 7 ml per minute on a reversed- After injecting the above crude extract dissolved in 3 ml of the same mobile phase, the peak detected in the chromatogram was automatically collected. The individual fractions were again concentrated under reduced pressure and then analyzed for mass spectrum with an ion trap mass spectrometer (LCQ ion-trap mass spectrometer, ThermoFinnigan, San Jose, CA, USA) to isolate the desired sugar-bonded phenoxothiazole compound. The phenothiodiol used as the substrate was aliquoted at a retention time of 21 minutes on the MPLC system and the desired sugar bonded phenothioyl compounds were detected in the respective reactants between 16 and 17 minutes faster than the substrate. These purified sugar-bonded phenothioyl compounds are phenoxothiol-7- O -galactoside and phenoxodiol-7- O- 2'-deoxy-glucoside, respectively, Lt; / RTI &gt;

The compounds were finally purified to 3.3 mg and 2.0 mg, respectively. This result shows lower purification efficiency compared to the previous results using uridine diphosphate glucose (UDP-Glc) as the saccharide donor, indicating that the substrate flexibility of various sugar donors of the prior enzyme MrGT1 suggesting that substrate preference is somewhat lower for UDP-Gal or TDP-2'-deoxy-Glc than for UDP-Glc used in the earlier application. That is, the conversion yield to the sugar-bound peroxodiol compound through the individual sugar donor of the glycosyltransferase is about 72% for UDP-Gal, about 41% for TDP-2 "-deoxy-Glc %, Which is significantly lower than that of UDP-Glc (93%).

NMR samples were left standing and the solvent was dissolved in each of the compound 1 and compound 2 in CD ₃ OD of 200 ul, 5 mm Shigemi NMR Advanced Micro tube (Shigemi advanced NMR microtube, Sigma, St. Louis, MO) by . ¹³ C NMR spectra were acquired at 298 K using a Varian INOVA 500 spectrophotometer and chemical shifts were recorded in ppm using TMS as an internal standard. All NMR data were calculated using Mnova Suite 5.3.2 software and the ¹³ C-NMR spectra of Compound 1 and Compound 2 were compared to phenoxodiol, the original receptor of the receptor (see Table 2).

[Table 2] &lt; ¹³ &gt; C-NMR results of sugar bonded phenothioyl compounds

(3-2) Escherichia coli recombinant strain Live conversion  Through technology Sugar bond Phenoxodiol  Biosynthesis of compounds

One) Per nucleic acid  Biosynthetic pathway redesign or The party  enzyme MrGT1 Three strains of Escherichia coli recombinant strains were produced.

As a result of the present inventors' previous results, preparation of the phenoxodiol glucoside compound was carried out in the same manner as in Example 1, except that the saccharide donor peroxodiol and the sugar donor UDP- Glc was used. In order to overcome the time limitation due to the use of expensive nucleic acid and purification of enzyme, a production method of producing a desired compound by microbial fermentation rather than an enzyme reaction was required. In the present invention, in order to increase the content of the sugar donor UDP-Glc in the cells, which is essential for the production of the phenoxodiol glucoside compound in the biosynthetic pathway per nucleic acid in E. coli, UDP-Glc involved in the reversible reaction between UDP- defect was a galE gene that encodes the -Glc 4-epimerase in the dielectric (see FIG. 2). For this purpose, BL21 (DE3) (Stratagene, La Jolla, CA, USA) was used for E. coli and Quick & Easy E. coli Gene Deletion Kit (Gene Bridges GmbH, Heidelberg, Germany) was used for the defect. The primers used are as follows. The forward primer (GalE-F) is the sequence of SEQ ID NO: 5 below and the reverse primer (GalE-B) is the sequence of SEQ ID NO: 6 below.

SEQ ID NO: 5: 5'-GGTGGTAGCGGTTACATTGG-3 '

SEQ ID NO: 6: 5'-GTTACGCGCCAGTTCAGTTC-3 '

Meanwhile, pET-28 (+ a) (Novagen, Madison, Wis. USA) which is a protein expression vector containing mrGT1 as shown in (2) of Examples 1 and 2 was used for the expression of the enzyme in Escherichia coli Nde I and Xho I restriction enzymes. Inserting the DNA fragments obtained by mrGT1 the pGEX vector (Amersham Biosciences, Pollards Wood, UK) was treated by the same restriction enzymes, then, that the galE defect screen E. coli was transformed with the (E. coli BL21 (DE3) △ galE) Amphicillin 50 μg / mL was used to select the final recombinant strain ( E. coli BL21 (DE3) Δ galE : mrGT1 ) (see FIG. 2).

On the other hand, in order to prepare the phenoxothiazole 7- O -galactoside of the present invention 1 using the recombinant E. coli culture broth, a strain of hygromycin antibiotic-producing Streptomyces hygroscopicus The hygK gene isolated from the genome of the strain Streptomyces hygroscopicus subsp. Hygroscopicus DSM 40578 was further expressed in the E. coli BL21 (DE3)? GalE : mrGT1 . The hygK gene product is predicted to be a UDP-Glc 4-epimerase involved in biosynthesis of the UDP-Gal nucleic acid sugar necessary for hygromycin biosynthesis. First, the DNA of Streptomyces hygroscopicus subsp. Gigroscopicus DSM 40578 was used as a template and amplified by PCR using a pair of a forward primer (HygK-F) and a reverse primer (HygK-B). The forward primer (HygK-F) is the sequence of SEQ ID NO: 7 and the reverse primer (HygK-B) is the sequence of SEQ ID NO: 8.

SEQ ID NO: 7: 5'- GTG GAATTC ATCCTCGATCATCTCCTCCAG - 3 ', ( underlined Eco R1 restriction endonuclease cleavage sites)

SEQ ID NO: 8: 5'-CT GCGGCCGC GATCTACAACCTGGGCAACG-3 ', (underlined Not I restriction enzyme cleavage site)

The genomic DNA of the strain and the primers were mixed together with Taq DNA polymerase (Qiagen) to perform a total of 37 cycles (initial inactivation: 94 ° C for 3 minutes, gradient from 55 ° C to 69 ° C, 72 &Lt; / RTI &gt; for 5 minutes). The PCR product was digested with Eco R1- Not I, inserted into an E. coli expression vector pACYCDuet (Novagen) treated with the same restriction enzymes, and transformed into a recombinant strain ( E. coli BL21 (DE3)? GalE : mrGT1 ). 50 μg / mL of amphicillin and 50 μg / mL of chloramphenicol were used to select the final E. coli BL21 (DE3) Δ galE : mrGT1 : hygK strain (see FIG. 2).

2) Through recombinant E. coli strain Sugar bond Phenoxodiol  Biosynthesis of compounds

The three recombinant E. coli strains, E. coli BL21 (DE3) (? GalE ), E. coli BL21 (DE3) (? GalE : mrGT1 ) and E. coli BL21 (DE3) (? GalE : mrGT1 : hygK ) was cultured in Luria-Bertani (LB) medium for 12 hours. Then, the cells were inoculated on a new LB medium and cultured until the absorbance reached to 0.8 at 650 nm. Then, IPTG was added to the culture at a concentration of 1 mM and further cultured at 18 ° C for 18 hours. The recombinant E. coli culture was centrifuged at 3000 rpm for 5 minutes by refrigerated centrifuge, and the supernatant was discarded. The recovered E. coli cells were inoculated with M9 medium (50 μg / mL ampicillin, 50 μg / mL chloramphenicol) supplemented with 2% 3 &quot;.&lt; / RTI &gt; To the cell suspension, phenoxodiol was added to a final concentration of 50 mM and shaken at 250 rpm for 2 hours at 30 ° C. After the bioconversion reaction, an equal amount of ethyl acetate was added to collect only the upper organic solvent layer, followed by vacuum drying. High pressure liquid chromatography (HPLC) analysis was carried out to confirm the biosynthesis of the objective compound in the extract (see (3-1) in Examples 1 and 2).

recombinant E. coli E. coli lacking galE gene The biotransformation was carried out using BL21 (DE3) (? GalE ). As expected, no biosynthesis reaction product of phenoxothiol appeared. On the other hand, the enzyme dangjeon MrGT1 recombinant expression at the same time that the galE gene-deficient Escherichia coli E. coli The phenoxodiol biosynthesis reaction product using BL21 (DE3) (? GalE : mrGT1 ) was confirmed to be a phenoxothiazole oligosaccharide compound, phenoxodiol-4'- O -glucoside and phenoxodi All-7- O -glucoside was biosynthesized (see Fig. 3). The above results show that the recombinant herbicide MrGT1 and the phenoxodiol were reacted with each other to produce a phenoxodiol glucoside compound, which is an enzyme reaction product, Glucoside &lt; / RTI &gt;

In addition, the biotransformation using the recombinant strain may include two sugar-linked phenoxothiazole compounds of the present invention, namely, phenoxodiol-7- O -galactoside or phenoxodiol-7- O- No dioxy-glucoside was detected.

Next, recombinant E. coli E. coli , in which the galE gene was deficient and MrGT1 and HygK were simultaneously expressed BL21 (DE3) (? GalE : mrGT1 : hygK ) was subjected to a biotransformation technique using phenoxodiol as a substrate. As a result, it was found that besides the phenoxodiol glucoside compound, the glycosylated phenoxodiol compound 1 phenoxodiol- - O - galactoside was biosynthesized in small amounts (see FIG. 3). The above results showed that the conversion yield was lower than that of Compound 1 through the enzymatic reaction, but it was suggested that the production of phenoxothiazol-7- O -galactoside could be achieved by the microbial biotransformation technique.

< Experimental Example  1> Sugar bond Phenoxodiol  Identification of antioxidant activity of compounds

To examine the antioxidative activity of the two compounds produced by the above examples, namely phenoxothiolated-7- O -galactoside and phenoxothiazol-7- O- 2'-deoxy-glucoside, DPPH 2,2-diphenyl-1-picrylhydrazyl). The purified compounds were diluted with methanol to 5 sections between 20 and 1,000 ug / ml. To each 0.1 ml of each sample was added 1.9 ml of DPPH reagent (methanol) (100 μM), and the mixture was shaken for 5 seconds. Lt; / RTI &gt; Thereafter, the absorbance was measured at 515 nm in a UV-VIS spectrophotometer. L-ascorbic acid (Sigma, St. Louis, Mo.) was used as a positive control group, phenothiodol was used as a positive control group, and the same five sections as above were used Respectively. Also, the phenothiodiol-4'- O -glucoside and the phenoxothiazol-7- O -glucoside compounds of the present invention described in the prior patent were also measured in the same manner as above, And the antioxidant activity of. The activity assay was expressed as the concentration of compound required to reduce the concentration of DPPH by 50% (IC ₅₀ ), and the results are shown in FIG.

As shown in FIG. 4, the ascorbic acid as a positive control group had an IC ₅₀ of about 24 ug / ml, the comparison group phenothiodol had an IC ₅₀ of about 35 ug / ml, Compound 2 was found to be about 46 ug / ml. Particularly, these phenothiodiol-7- O -galactosides and phenoxothiazol-7- O- 2'-deoxy-glucoside have been reported to be present in about 44 ug / ml of the phenoxodiol glucoside compounds of glucose, galactose or 2˝- deoxy added to the bar, page nokso diol hydroxyl group showed results similar to the IC ₅₀ value-structural changes in glucose was confirmed to not affect the enhancement of antioxidant activity.

< Experimental Example  2> Sugar bond Phenoxodiol  Person of compound Cancer cell  Confirmation of anti-cancer activity

SKOV-3, a human ovarian cancer cell line, and DU-145, a human prostate cancer cell line, were tested for their anticancer activity by the MTT method in order to test the anticancer activity of the two compounds produced by the above examples. As a positive comparison group, phenothiodol, which has already been reported to have anticancer activity against the cancer cell lines, was used at the same concentration, and as another positive control group, cisplatin, which is frequently used as a chemotherapy agent, Respectively. In addition, phenothiodiol-4'- O -glucoside and phenoxothiazol-7- O -glucoside compounds described in the present invention's prior patent were also treated in the same way to the cancer cell lines, The anticancer activities of the compounds were compared.

First, SKOV-3 and DU-145, two types of human cancer cell hosts, were activated. Each cell line was pre-cultured in RPMI 1640 medium (0.2% sodium bicarbonate, 10% fetal calf serum, 100 ppm of streptomycin, 10 ppm of penicillin, 4 mM of glutamine), centrifuged and dispensed into T- Day. Culture conditions were carried out in a 5% CO 2 atmosphere at 37 ° C. On the third day of incubation, the compound (phenoxodiol-7- O -galactoside, phenoxodiol-7- O- 2'-deoxy-glucoside) Each of the ricosyl diol glucoside compounds was dissolved in 20% DMSO to obtain final levels of 1, 3, 10, 30, and 100 μM, followed by further incubation for 2 days. Sampling was performed. After treatment of phenoxodiol, cisplatin control and phenothiodiol glucoside compounds described in the prior patent, the color reaction was carried out with final MTT to obtain individual IC ₅₀ (50% cell line) for each cancer cell line Concentration of compound causing growth inhibition) was measured, and the results are shown in Fig.

, Positive comparison soldier page nokso as shown in 5-diol is showed an IC ₅₀ value of about 29 μM, prostate cancer cell line IC ₅₀ value of about 20 μM with respect to DU-145 against the ovarian cancer cell line SKOV-3 , And the positive control group, cisplatin chemotherapy, had an IC ₅₀ value of about 35 μM in the ovarian cancer cell line and about 31 μM in the prostate cancer cell line. On the other hand, in the case of phenothiodiol-4'- O -glucoside and phenoxothiazol-7- O -glucoside compounds described in the prior patent of the present inventor, the ovarian cancer cell line was similarly subjected to IC ₅₀ And an IC ₅₀ value of about 25 μM for the prostate cancer cell lines. On the other hand, the peroxodiol-7- O -galactoside, which is a sugar-bound phenoxothiocyanate compound of the present invention, can be obtained by subjecting the above ovarian cancer and prostate cancer cell lines to the above-mentioned phenoxothiazol-4'- O -glucoside Showed the same IC ₅₀ values as phenoxodiol-7- O -glucoside compounds. On the other hand, in the case of phenoxodiol-7- O- 2'-deoxy-glucoside, an IC ₅₀ value of about 26 μM against the ovarian cancer cell line SKOV-3 and about 20 μM the IC ₅₀ value and the bar, all the pages nokso die presenting -7- O -2˝- deoxy-glucoside, which is at the same time represents the anticancer activity is increased compared to the conventional chemotherapeutic agent cisplatin, the page nokso die original material The improved anti - cancer activity was confirmed by ovarian cancer cell line.

As shown in the above-mentioned results, it is possible to improve the existing drug through structural modification by the sugar transfer of the existing pharmacological compound, and as such, the possibility of substitution of the existing drug into the prodrug and the possibility of application as a new dosage form And to identify the potential for pharmacological applications. In addition to the conventional method for producing glycoconjugates through the enzymatic sugar transfer method, the glycosyltransferase-related enzymes are additionally expressed in microorganisms that have been redesigned for metabolic pathways, .

The two compounds (Compound 1 and Compound 2) produced in the above Example were formulated as follows.

< Formulation example  1> Purification (direct pressurization)

After 5.0 mg of Compound 1 and Compound 2 were sieved, 14.1 mg of lactose, 0.8 mg of crospovidone (USNF) and 0.1 mg of magnesium stearate were mixed and pressed to prepare tablets.

< Formulation example  2> Purification (wet assembly)

After 5.0 mg of Compound 1 and Compound 2 were sieved, 16.0 mg of lactose and 4.0 mg of starch were mixed. After 800.3 mg of polysorbate was dissolved in pure water, an appropriate amount of this solution was added to make it finely-ground. After drying, the granules were sieved and mixed with 2.7 mg of colloidal silicon dioxide and 2.0 mg of magnesium stearate. The mixture was pressurized to prepare tablets.

< Formulation example  3> Powder and Capsule

5.0 mg of Compound 1 and Compound 2 were sieved and then mixed with 14.8 mg of lactose, 10.0 mg of polyvinylpyrrolidone and 0.2 mg of magnesium stearate. The mixture was filtered through a hard No. 5 gelatin capsules.

< Formulation example  4> injection

180 mg of mannitol, 26 mg of Na ₂ HPO _{4 12} H ₂ O and 2974 mg of distilled water were added to 100 mg of the active ingredient to prepare an injection.

A novel sugar-linked phenoxothiazole compound exhibiting anticancer activity against the prostate cancer or ovarian cancer cell line of the present invention, an enzyme reaction of the same, or a method for producing a microbial biotransformation and a pharmaceutical composition comprising the same, As shown in FIG.

<110> Industry-University Cooperation Foundation Sunmoon University <120> Sugar-attached phenoxodiol compounds, preparing method thereof          and pharmaceutical compositions containing the same as active          ingredients <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 27 <212> DNA <213> Unknown <220> <223> Unknown <400> 1 ggcatatgag cgagcctgac acgggtg 27 <210> 2 <211> 27 <212> DNA <213> Unknown <220> <223> Unknown <400> 2 cgtggtgggc cgactcgagg agaacac 27 <210> 3 <211> 1200 <212> DNA <213> Micromonospora rhodorangea <400> 3 atgaatatca aacatatcgc gatttttaat attccggctc acggccatat taatccaacg 60 ctagctttaa cggcaagcct tgtcaaacgc ggttatcggg taacatatcc ggtgacggat 120 gagtttgtga aggctgttg ggaaactggg gcagagccgc tcaactaccg ctcaacttta 180 aatatcgatc cgcagcaaat tcgggagctg atgaaaaata aaaaagatat gtcgcaggct 240 ccgctgatgt ttatcaaaga aatggaggag gttcttcctc agcttgaagc gctctatgag 300 aatgacaagc cagaccttat cctttttgac tttatggcca tggcgggaaa actgctggct 360 gagaagtttg gaatagaggc ggtccgcctt tgttctacat atgcacagaa cgaacatttt 420 acattcagat ccatttctga agagtttaag atcgagctga cgcctgagca agaggatgct 480 ttgaaaaatt cgaatcttcc gtcatttaac tttgaggata tgttcgagcc tgcaaaattg 540 aacattgtct ttatgcctcg tgcttttcag ccttacggcg aaacgtttga tgagcggcat 600 tcttttgttg gtccttctct tgccaaacgc aagtttcagg aaaaagaaac gccgattatt 660 tcggacagcg gccgtcctgt catgctgata tctttaggga cggcgttcaa tgcctggccg 720 gaattttatc atatgtgcat agaagcattc agggacacga agtggcaggt tatcatggct 780 gttggcacga caatcgatcc tgaaagcttt gatgacatac ctgagaactt ttcgattcat 840 cagcgcgttc ctcagctgga gatcctgaag aaagcggagc tgttcatcac ccatgggggt 900 atgaacagta cgatggaagg gttgaatgcc ggtgtaccgc tcgttgccgt tccgcaaatg 960 cctgaacagg aaatcactgc ccgccgcgtc gaagagcttg ggcttggcaa gcatttgcag 1020 ccggaagaca caacagcagc ttcactgcgg gaagccgtct ctcagacgga tggtgacccg 1080 catgtcctga aacggataca ggacatgcaa aagcacatta aacaagccgg aggggccgag 1140 aaagccgcag atgaaattga ggcattttta gcacccgcag gagtaaaagg acataaataa 1200                                                                         1200 <210> 4 <211> 399 <212> PRT <213> Micromonospora rhodorangea <400> 4 Met Pro Leu Lys His Ile Ala Ile Phe Asn Ile Pro Ala His Gly His   1 5 10 15 Ile Asn Pro Thr Leu Ala Leu Thr Ala Ser Leu Val Lys Arg Gly Tyr              20 25 30 Arg Val Thr Tyr Pro Val Thr Asp Glu Phe Val Lys Ala Val Glu Glu          35 40 45 Thr Gly Ala Glu Pro Leu Asn Tyr Arg Ser Thr Leu Asn Ile Asp Pro      50 55 60 Gln Gln Ile Arg Glu Leu Met Lys Asn Lys Lys Asp Met Ser Gln Ala  65 70 75 80 Pro Leu Met Phe Ile Lys Glu Met Glu Glu Val Leu Pro Gln Leu Glu                  85 90 95 Ala Leu Tyr Glu Asn Asp Lys Pro Asp Leu Ile Leu Phe Asp Phe Met             100 105 110 Ala Met Ala Gly Lys Leu Ala Glu Lys Phe Gly Ile Glu Ala Val         115 120 125 Arg Leu Cys Ser Thr Tyr Ala Gln Asn Glu His Phe Thr Phe Arg Ser     130 135 140 Ile Ser Glu Glu Phe Lys Ile Glu Leu Thr Pro Glu Glu Glu Asp Ala 145 150 155 160 Leu Lys Asn Ser Asn Leu Pro Ser Phe Asn Phe Glu Asp Met Phe Glu                 165 170 175 Pro Ala Lys Leu Asn Ile Val Phe Met Pro Arg Ala Phe Gln Pro Tyr             180 185 190 Gly Glu Thr Phe Asp Glu Arg His Ser Phe Val Gly Pro Ser Leu Ala         195 200 205 Lys Arg Lys Phe Gln Glu Lys Glu Thr Pro Ile Ile Ser Asp Ser Gly     210 215 220 Arg Pro Val Met Leu Ile Ser Leu Gly Thr Ala Phe Asn Ala Trp Pro 225 230 235 240 Glu Phe Tyr His Met Cys Ile Glu Ala Phe Arg Asp Thr Lys Trp Gln                 245 250 255 Val Ile Met Ala Val Gly Thr Thr Ile Asp Pro Glu Ser Phe Asp Asp             260 265 270 Ile Pro Glu Asn Phe Ser Ile His Gln Arg Val Pro Gln Leu Glu Ile         275 280 285 Leu Lys Lys Ala Glu Leu Phe Ile Thr His Gly Gly Met Asn Ser Thr     290 295 300 Met Glu Gly Leu Asn Ala Gly Val Pro Leu Val Ala Val Pro Gln Met 305 310 315 320 Pro Glu Gln Glu Ile Thr Ala Arg Arg Val Glu Glu Leu Gly Leu Gly                 325 330 335 Lys His Leu Gln Pro Glu Asp Thr Thr Ala Ala Ser Leu Arg Glu Ala             340 345 350 Val Ser Gln Thr Asp Gly Asp Pro His Val Leu Lys Arg Ile Gln Asp         355 360 365 Met Gln Lys His Ile Lys Gln Ala Gly Gly Ala Glu Lys Ala Ala Asp     370 375 380 Glu Ile Glu Ala Phe Leu Ala Pro Ala Gly Val Gly His Lys Lys 385 390 395 <210> 5 <211> 20 <212> DNA <213> Unknown <220> <223> Unknown <400> 5 ggtggtagcg gttacattgg 20 <210> 6 <211> 20 <212> DNA <213> Unknown <220> <223> Unknown <400> 6 gttacgcgcc agttcagttc 20 <210> 7 <211> 30 <212> DNA <213> Unknown <220> <223> Unknown <400> 7 gtggaattca tcctcgatca tctcctccag 30 <210> 8 <211> 30 <212> DNA <213> Unknown <220> <223> Unknown <400> 8 ctgcggccgc gatctacaac ctgggcaacg 30

Claims (11)

Claims 1. A compound represented by the following formula (1): &lt; EMI ID =
[Chemical Formula 1]

Wherein R ₁ is galactose or 2 &quot; -deoxy-glucose. delete A pharmaceutical composition for the prophylaxis or treatment of prostate cancer or ovarian cancer, comprising the compound of claim 1. 4. The pharmaceutical composition according to claim 3, further comprising a carrier. 1) obtaining a recombinant glycosyltransferase MrGT1 comprising the amino acid sequence of SEQ ID NO: 4 in E. coli; And
2) reacting the recombinant glycoprotein obtained in the above step 1 with a phenoxothiazole and a nucleic acid sugar to obtain a glycophenol diol compound as an enzyme reaction product
Lt; RTI ID = 0.0 &gt; 1. &Lt; / RTI &gt; 6. The method of claim 5,
The nucleic acid sugar may be a uridine diphosphate galactose (UDP-Gal) or a thymidine diphosphate 2'-deoxy-glucose (TDP-2'-deoxy-Glc) Lt; RTI ID = 0.0 &gt; 1 &lt; / RTI &gt; delete delete 1) cleaving the galE gene in E. coli BL21 (DE3);
2) transforming the mrGT1 gene comprising the nucleotide sequence of SEQ ID NO: 3 into Escherichia coli ( E. coli BL21 (DE3) (? GalE )) lacking the galE gene obtained in the above step 1);
3) transforming the hygK gene into the recombinant E. coli BL21 (DE3) (? GalE: mrGT1 ) obtained in the step 2); And
4) adding phenothiole to the final recombinant E. coli BL21 (DE3) (? GalE: mrGT1: hygK ) obtained in the step 3) as a substrate;
Lt; RTI ID = 0.0 &gt; 1. &Lt; / RTI &gt; 10. The method of claim 9,
The method according to claim 1 , wherein the mrGT1 gene is derived from micro Monospora rhodograna , and the hygK gene is derived from Streptomyces hygroscopicus subsp. Higroscopicus DSM 40578 strain. the galE gene is defective; MrGT1 gene comprising the nucleotide sequence of SEQ ID NO: 3, and the recombinant Escherichia coli (E. coli BL21 (DE3) ( △ galE: mrGT1: hygK)) containing hygK gene.

Images