KR101662755B1 - Pharmaceutical composition for treating cancer comprising expression or activity inhibitor of NOX5 - Google Patents

Abstract

The present invention relates to a pharmaceutical composition including an agent for inhibiting expression or activity of NOX5 for preventing or treating a cancer or cancer metastasis, a composition for diagnosing a cancer including an agent specifically bound to the NOX5, a method for providing information for diagnosing a cancer comprising the step of detecting NOX5 of an isolated biological sample by using an antibody of the NOX5 through antigen-antibody reaction, and an NOX5 antibody specifically bound to an antigenic region having an amino acid sequence of SEQ ID NO: 1. In the present invention, the role of NOX5-L is identified in skin cancer, breast cancer, and lung cancer. Specifically, it has been found that an antibody, siRNA, and shRHA of NOX5-L inhibit growth of cancer cells, thereby being useful as an anticancer agent.

Description

[0001] The present invention relates to a pharmaceutical composition for inhibiting the expression or activity of NOX5,

The present invention provides a pharmaceutical composition for preventing or treating cancer or cancer metastasis comprising an agent for inhibiting the expression or activity of NOX5, a composition for diagnosing cancer comprising the agent specifically binding to NOX5, and an antibody of NOX5 Detecting the NOX5 of the separated biological sample through an antigen-antibody reaction; and a method of providing information for diagnosis of cancer and a NOX5 antibody specifically binding to an antigenic region comprising the amino acid sequence of SEQ ID NO: 1 .

Active oxygen (ROS) was considered a harmful cellular by-product. However, it is now accepted as a signaling molecule that determines the growth or death of cancer cells during tumorigenesis (Pan et al., 2009, Reactive oxygen species: a double-edged sword in oncogenesis, World J. Gastroenterol. 1707). ROS regulates growth through several mechanisms. This can lead to cancer cell growth by inducing mutation, cancer initiation, and cancer promotion (Sablina et al., 2005, The antioxidant function of the p53 tumor suppressor. Nat. Med. 11, 1306-1313) . In addition, there is evidence that ROS is involved in the progression of cancer through regulation of intracellular signals including SIRT1-p53 and Ras-Erk mechanisms (Luo et al., 2001, Negative control of p53 by Sir2alpha promotes cell survival under stress. Cell 107, 137-148).

On the other hand, high levels of ROS are known to induce apoptosis through apoptosis induced by p38 MAPK mechanism. This mechanism is activated by antitumor substances that increase intracellular ROS (Benhar et al., 2001, Enhanced ROS production in oncogenically transformed cell potentiates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase activation and sensitization Genotoxic stress, Mol. Cell Biol., 21, 6913-6926).

Members of the NADPH oxidase (NOX) family are enzymes that produce ROS as a major product. They reduce oxygen molecules in an NADPH-dependent manner to produce peroxide anions. Considering the effect of multiple expression of ROS, NOX activity may be involved in not only cell growth but also death. However, to date, almost all studies have focused only on their role in NOX cell growth. For example, we have identified the role of NOX1 in cell growth, and have demonstrated the role of NOX1 in colon cancer and stomach cancer (Tominaga et al., 2007, Evidence for cancer-associated expression of NADPH oxidase 1 (Nox1) Biol., 43, 1627-1638). NOX4 has been implicated in the pathogenesis of pancreatic cancer (Vaquero et al., 2004, Reactive oxygen species produced by NAD (P) H oxidase inhibitor apoptosis in pancreatic cancer cells, J. Biol. Chem. 279, 34643-34654) and skin cancer (Yamaura et al. 2009, NADPH oxidase 4 contributes to transformation phenotype of melanoma cells by regulating G2-M cell cycle progression. Cancer Res. 69, 2647-2654). DUOX1 and DUOX2 have been reported to play an important role in the regulation of cell mobility in lung cancer (Luxen et al., 2008, Silencing of DUOX NADPH oxidases by promoter hypermethylation in lung cancer. Cancer Res. 68, 1037-1045).

Compared to the contribution of other NOX members, the effect of NOX5 on tumor formation is largely unknown, since NOX5 is not expressed in rodent experimental models (Fulton, 2009, Nox5 and the regulation of cellular function. Antioxid, Redox Signal, 11, 2443-2452).

NOX5 calcium to N- terminal - to be classified in two forms between those with and without a coupling portion EF ^{(Ca2 + -binding EF-hands)} : a long form is NOX5-L, the short form is NOX5-S. There is little research on the regulation of NOX5 in cancers, mainly focusing on NOX5-S (Fu et al., 2006, Nox5 and the regulation of cellular function, Antioxid.Redox Signal.11, 2443-2452). Until now, the role of NOX5-L in cancer cells has not been known.

In the present invention, it was confirmed that the antibody, siRNA, and shRNA of NOX5-L inhibited the growth of cancer cells, and the NOX5 antibody presented in the present invention can recognize both of NOX5-L and NOX5-S.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating cancer or cancer metastasis comprising an agent for inhibiting the expression or activity of NOX5.

It is still another object of the present invention to provide a composition for diagnosing cancer comprising the agent specifically binding to NOX5.

It is still another object of the present invention to provide a method for providing information for diagnosis of cancer, comprising the step of detecting NOX5 of an isolated biological sample through an antigen-antibody reaction using the antibody of NOX5.

Another object of the present invention is to provide a NOX5 antibody that specifically binds to an antigenic region comprising the amino acid sequence of SEQ ID NO: 1.

The present invention relates to a pharmaceutical composition for preventing or treating cancer or cancer metastasis comprising an agent for inhibiting the expression or activity of NOX5.

The present invention relates to a diagnostic composition for cancer comprising a preparation specifically binding to NOX5.

The present invention relates to a method for providing information for diagnosis of cancer, comprising the step of detecting NOX5 of an isolated biological sample through an antigen-antibody reaction using the antibody of NOX5.

Hereinafter, the present invention will be described in detail.

In order to achieve the above object, in one aspect, the present invention provides a pharmaceutical composition for preventing or treating cancer or cancer metastasis comprising an agent for inhibiting the expression or activity of NOX5.

In the present invention, the preparation comprises an antibody specifically binding to an antigenic region of NOX5 (NADPH oxidase 5) represented by the amino acid sequence of SEQ ID NO: 1 (QAEASPFQFWELLLTTRPG), siRNA or sequence of NOX5 represented by SEQ ID NO: 2 (GAUAGAAGUGGCACCAUCA) No. 3 (CCGGCGUGUGCAUCAUGGAAGUCAACUCGAGUUGACUUCCAUGAUGCACACGUUUUUG). Further, in the present invention, Skin cancer, breast cancer, lung cancer, prostate cancer, colon cancer, stomach cancer, pancreatic cancer or thyroid cancer, and is preferably skin cancer, breast cancer or lung cancer.

The present inventors confirmed that the NOX5 induces the growth of cancer cells and confirmed that when the NOX5 antibody or NOX5 siRNA or shRNA was treated, the growth of cancer cells and the migration and infiltration of cancer cells were inhibited. Thus, the NOX5 antibody or siRNA Or shRNA can be used as a pharmaceutical composition for preventing or treating cancer or cancer.

In one embodiment of the invention, the antibody, siRNA or shRNA of NOX5 is treated with SK-MEL-5 (skin malignant melanoma), SK-BR-3 (breast adenocarcinoma), HOP- Malignant melanoma) cells, the growth of these cancer cells was inhibited.

Further, in one embodiment of the present invention, tumors (p = 0.00075 in the IgG-purified anti-NOX5 antibody; affinity-positive antibody in the anti-NOX5 antibody) were obtained after 3 weeks of the anti-NOX5 antibody treatment using a mouse xenograft model, (p = 0.00005 in purified anti-NOX5 antibody) was significantly decreased (Fig. 6C).

In addition, in another embodiment of the present invention, when NOX5-L siRNA was used to inhibit NOX5, mobility and cell invasion of breast cancer cells were reduced by about 50% as compared with control cells. As a result, NOX5 inhibition Inhibited the migration and invasion (metastasis) of cancer cells (Fig. 3d).

Specifically, the present inventors produced an antibody specifically recognizing an antigenic region of NOX5 represented by the amino acid sequence of SEQ ID NO: 1, wherein the antigenic region of NOX5 is an extracellular portion of NOX5, an amino acid residue 295-313 , As the amino acid sequence QAEASPFQFWELLLTTRPG (SEQ ID NO: 1).

In the present invention, the term "NOX5" is divided into two types, the Ca2 ⁺ -binding EF-hands at the N-terminus and the Ca2 ⁺ -binding EF-hands. The long form is NOX5-L, and the short form is NOX5-S.

As used herein, the term "antibody" means a protein molecule that acts as a receptor that specifically recognizes an antigen, including immunoglobulin molecules immunologically reactive with specific antigens, and includes polyclonal antibodies, monoclonal antibodies, Whole antibody and antibody fragments are all included. The term also includes chimeric antibodies (e. G., Humanized murine antibodies) and bivalent or bispecific molecules (e. G., Bispecific antibodies), diabodies, triabodies and tetrabodies. The term further encompasses single chain antibodies, scabs, derivatives of antibody constant regions, and artificial antibodies based on protein scaffolds with binding function to FcRn. The whole antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. The whole antibody includes IgA, IgD, IgE, IgM and IgG, and IgG is a subtype and includes IgG1, IgG2, IgG3 and IgG4. The antibody fragment refers to a fragment having an antigen-binding function and includes Fd, Fab, Fab ', F (ab') 2, Fv, and the like. The Fd means the heavy chain portion contained in the Fab fragment. The Fab has one antigen-binding site in a structure having a variable region of a light chain and a heavy chain, a constant region of a light chain, and a first constant region (CH1 domain) of a heavy chain. Fab 'differs from Fab in that it has a hinge region that contains at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. The F (ab ') 2 antibody is produced when the cysteine residue of the hinge region of the Fab' forms a disulfide bond. Fv (variable fragment) refers to the smallest antibody fragment that has only a heavy chain variable region and a light chain variable region. The double disulfide Fv (dsFv) is linked by a disulfide bond to a light chain variable region and a light chain variable region. A short chain Fv (scFv) is generally linked to a variable region of a heavy chain and a variable region of a light chain through a peptide linker by a covalent bond. Such an antibody fragment can be obtained using a protein hydrolyzing enzyme (for example, an F (ab ') 2 fragment can be obtained by cutting a whole antibody into papain and obtaining a Fab and digesting with pepsin) Can be produced through recombinant DNA technology.

The antibody specifically binding to the antigenic region of NOX5 may be a clone antibody produced by using the polypeptide represented by the amino acid sequence of SEQ ID NO: 1 as an antigen.

The clone antibody of the present invention can be produced by administering to a mouse, rabbit, guinea pig, or chlorine by administering the polypeptide represented by the amino acid sequence of SEQ ID NO: 1 as an antigen, preferably by rabbit .

In one embodiment of the present invention, the NOX5 protein-specific polyclonal antibody of the present invention was prepared by intraperitoneally injecting the polypeptide represented by the amino acid sequence of SEQ ID NO: 1 in the rabbit three times in total (Example 3), and the produced polyclonal antibody Was used to confirm the detection of NOX5 protein through ELISA (Example 4). In addition, the NOX5 antibody was purified using two methods of serum IgG antibody purification and affinity antibody purification. (Example 5)

The composition of the present invention may also comprise a pharmaceutically acceptable carrier. The composition comprising a pharmaceutically acceptable carrier can be of various oral or parenteral formulations. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like, which may contain one or more excipients such as starch, calcium carbonate, sucrose or lactose lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the non-aqueous solvent and the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.

The pharmaceutical composition may be in the form of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories It can have one formulation.

The composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount " as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will vary depending on the species and severity, age, sex, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts.

The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without adverse effect, and can be easily determined by those skilled in the art.

The method of administration of the composition of the present invention is not particularly limited and may be parenterally (for example, intravenous, subcutaneous, intraperitoneal, or topical application) or oral administration according to a desired method, It can be administered through a patch type nose / respiratory system attached to the skin, and administration by intravenous injection may be preferable in order to obtain a rapid therapeutic effect. The dosage may vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate, and severity of the disease.

The dose for the more preferable effect of the composition of the present invention may preferably be 0.01 mg / kg to 1,000 mg / kg per day, more preferably 10 mg / kg to 500 mg / kg per day. The pharmaceutical composition of the present invention may be administered once a day or divided into several doses. Accordingly, the dosage is not limited in any way to the scope of the present invention.

In another aspect, the present invention relates to a diagnostic composition for cancer comprising an agent that specifically binds to NOX5.

In the present invention, the preparation refers to an antibody that specifically binds to the antigenic region of NOX5 represented by the amino acid sequence of SEQ ID NO: 1, and the diagnostic composition comprising an antibody specifically binding to NOX5 is used to detect NOX5 Cancer associated with the expression level or expression level can be diagnosed.

Further, in the present invention, Skin cancer, breast cancer, lung cancer, prostate cancer, colon cancer, stomach cancer, pancreatic cancer or thyroid cancer, and is preferably skin cancer, breast cancer or lung cancer.

In another aspect, the present invention relates to a method for providing information for diagnosis of cancer, comprising the step of detecting NOX5 of an isolated biological sample through an antigen-antibody reaction using the antibody of NOX5. That is, the NOX5 protein can be detected by reacting the antibody of the present invention with a biological sample and detecting the formation of an antigen-antibody complex, thereby providing information for diagnosis of cancer.

The term "biological sample " as used herein includes tissues, cells, whole blood, serum, plasma, tissue autopsy samples (brain, skin, lymph node, spinal cord etc.), cell culture supernatant, ruptured eukaryotic cells and bacterial expression systems But is not limited thereto. When these biological samples are not manipulated or manipulated, they are reacted with an antibody of the present invention to confirm the presence of NOX5 protein, and when expression of NOX5 is detected, diagnosis of skin cancer, breast cancer or lung cancer is possible.

As used herein, the term "antigen-antibody complex" refers to a NOX5 protein antigen in the sample and a conjugate of the antibody according to the present invention recognizing the same. The formation of such an antigen-antibody complex may be performed by a colorimetric method, is detected by any method selected from the group consisting of an electrochemical method, a fluorimetric method, a luminometry, a particle counting method, a visual assessment and a scintillation counting method. can do. However, various applications and applications are possible without being limited thereto.

In the present invention, various markers can be used for detecting an antigen-antibody complex. Specific examples include, but are not limited to, enzymes, chromophores, ligands, luminescent materials, microparticles, and radioactive isotopes.

Examples of the enzyme used as the detection label include acetylcholine esterase, alkaline phosphatase,? -D-galactosidase, horseradish peroxidase,? -Lactamase and the like, Eu3 +, Eu3 + chelate or cryptite, and the ligand includes a biotin derivative and the like. Examples of the luminescent material include an acridinium ester and an isoluminol derivative, and the fine particles include colloidal gold, colored Latex and the like, and radioactive isotopes include 57Co, 3H, 125I, 125I-Bonton Hunter reagent and the like.

Preferably, the antigen-antibody complexes can be detected using enzyme immunoassay (ELISA). Enzyme immunoassay (ELISA) includes direct ELISA using a labeled antibody that recognizes an antigen attached to a solid support, indirect ELISA using a labeled secondary antibody that recognizes the capture antibody in a complex of an antibody recognizing the antigen attached to a solid support , A direct sandwich ELISA using another labeled antibody that recognizes the antigen in the complex of the antibody and the antigen attached to the solid support, and the other antibody recognizing the antigen in the complex of the antibody and the antigen attached to the solid support, And indirect sandwich ELISA using labeled secondary antibodies recognizing the antibody. The antibody may have a detection label, and if it does not have a detection label, it can be detected by treating another antibody capable of capturing these antibodies and having a detection label.

In another aspect, the present invention relates to a NOX5 antibody that specifically binds to an antigenic region comprising the amino acid sequence of SEQ ID NO: 1.

In the present invention, the role of NOX5 in skin cancer, breast cancer, and lung cancer was demonstrated. Specifically, it was confirmed that the antibody, siRNA, and shRNA of NOX5 inhibit the growth of cancer cells.

Figure 1 shows ELISA results using primary sera.
FIG. 2 shows an antibody purification process. FIG. 2A shows an IgG purification, and FIG. 2B shows an affinity purification process.
3 is a graph showing that NOX5-L induces the growth of skin cancer, breast cancer, and lung cancer cells.
(a) NOX5 mRNA expression in normal and skin cancer, breast cancer, and lung cancer tissues. Expression was measured using the GENT database (Shin et al., 2011). The boxes represent the 75th percentile, the median, and the 25th percentile. Points represent extreme values.
(b) Cell growth analysis of skin cancer, breast cancer and lung cancer cells expressing control or NOX5 shRNA. Knockdown of NOX5-L was confirmed by immunoblotting. Tubulin was used as a loading control (see illustration).
(c) Cell growth analysis of skin cancer and breast cancer cells expressing control or NOX5-L siRNA. Knockdown of NOX5-L was confirmed by immunoblotting. Tubulin was used as a loading control (see illustration).
(d) The mobility and invasiveness of breast cancer cells expressing control or NOX5-L siRNA was confirmed by immunoblotting. Knockdown of NOX5-L was confirmed by immunoblotting. Tubulin was used as a loading control (see illustration).
Figure 4 shows immunohistochemical analysis of NOX5.
(a) Immunohistochemical analysis of NOX5 in skin cancer, breast cancer and lung cancer tissues. (aa and ab) facial basal cell carcinoma; (ac and ad) breast-invasive ductal cancer; (ae) lung cancer; (af) pulmonary squamous cell carcinoma. Scale bars = 50 占 퐉 (aa, ab, ad, and af) or 100 占 퐉 (ac and ae).
(b) Immunohistochemical analysis of NOX5 in bronchial epithelium. Arrows indicate grown reserve cells expressing NOX5. An asterisk indicates normal epithelial cells. Scale bar = 100 탆.
FIG. 5 is a graph showing the caspase-3 activity of SK-MEL-5, SK-BR-3, and HOP-92 cells expressing control or NOX5 shRNA.
6 is a graph showing the inhibition of cancer cell growth of cancer cells or cancer cells transplanted with anti-NOX5 antibody.
(a) Cell growth analysis of G-361 cells treated with a control or anti-NOX5 antibody.
(b) weight change of control or anti-NOX5-treated xenografted nude mice.
(c) The effect of anti-NOX5 antibody on the growth of G-361 xenograft tumors. Data are presented as mean tumor volume ± SEM and mean tumor weight ± SEM, and photographs of control or anti-NOX5-treated xenografted nude mice were shown.
Figure 7 is a graph showing that the increase in NOX5-L by STAT5A in breast cancer promotes tumor formation.
(a) Immunoblot of NOX5-L and STAT5A from SK-BR-3 cells expressing control vector or STAT5A. Actin was used as a loading control.
(b) immunoblots of NOX5-L and STAT5A from SK-BR-3 cells expressing the control vector, wild-type STAT5A, STAT5A (N642H), or STAT5A (? 713). The arrow indicates endogenous STAT5. The asterisk indicates 75 kDa.
(c) RT-PCR of quantitative RT-PCR of NOX5 and STAT5A from SK-BR-3 cells expressing control or STAT5A shRNA.
(d) Immunoblot of NOX5-L and STAT5A from STAT5A-removed SK-BR-3 cells.
(e) Above: graphically depicts the location of consensus binding sites on the four estimates of STAT5A; The constructs (NOX5-L-luc) containing the pGL3-promoter (control), the 2012bp promoter of the NOX5-L promoter, or the constructs in which four putative STAT5- NOX5-L DELTA STAT5-luc). ≪ / RTI > The deletion part (arrow) is 1162 bp.
(f) ChIP assay of the endogenous NOX5-L promoter in SK-BR-3 cells and STAT5A expressing HOP-92 cells. A primer of the promoter portion of GAPDH was used as a control.
(g) Immunohistochemical analysis of p-STAT5 and NOX5 in invasive ductal carcinoma tissue. Scale bar = 100 탆

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Example  One: NOX5 -L antigenic polypeptide selection

In order to select an antigenic polypeptide of NOX5-L, i) whether it is exposed to the outside of the cell membrane, ii) domain exclusion analysis (the possibility of cross-reacting with a protein other than the target protein when a peptide antibody is produced in a specific domain part having high similarity) Iii) Excluding the part that changes after translation. (The region containing the glycosylation site, myristoylation site, and phosphorylation site does not have the same structure as the synthesized peptide, (Iv) hydrophobicity and antigenicity analysis (low hydrophobicity, high antigenicity, possibility of production of specific antibody), (iv) hydrophobicity and antigenicity analysis And it is highly likely to be exposed to the outside from tertiary structure. The amino acid sequence was determined by the antigen QAEASPFQFWELLLTTRPG for NOX5 through tenderness).

Example  2: NOX5  Synthesis of Polypeptides

The extracellular portion of NOX5 (NADPH oxidase 5) selected in Example 1 was synthesized as 590 mg of the amino acid sequence QAEASPFQFWELLLTTRPG (SEQ ID NO: 1) with a purity of 70% or more as the amino acid residue 295-313.

Example  3: NOX5 -L polypeptide NOX5  Specific Polyclone  Preparation of antibodies

The NOX5 polypeptide obtained in Example 2 was injected into the abdominal cavity three times in total to prepare a polyclonal antibody. First, 2 μl of 10% SDS was added to 1 mg of the purified NOX5 polypeptide (200 μl), followed by boiling for 2 minutes, followed by ultrasonic disruption in 200 μl of the complete adjuvant. Thereafter, 500 μg of the purified NOX5 polypeptide was injected first into the abdominal cavity of the rabbit, and two weeks later, the rabbit abdominal injection was performed in the same manner. After one week, the serum was withdrawn from the tail vein, Serum was used for ELISA as described in Example 4 below.

After one week, rabbits were injected in the same manner (total of 3 abdominal injections) (total of 3 abdominal injections), and one week later, rabbits were sacrificed and whole blood was sacrificed.

Example  4: 1 ^ST  Using serum NOX -L Confirm protein detection ability ( ELISA  Experiment)

ELISA was performed to confirm NOX-L protein detection ability of NOX-L protein-specific polyclonal antibody. First, the antigen was diluted to a concentration of 2 ug / ml with the coating buffer and dispensed into each well. After 3 hours of reaction at 37 ° C, blocking was performed at 37 ° C for 1 hour with 250 μl of 2% Skim milk / TBS-T Respectively. Thereafter, the cells were reacted at 37 ° C. for 2 hours using a primary serum containing 100 μl of a NOX-L protein-specific polyclonal antibody, washed three times with TBS-T buffer, and washed with horseradish peroxidase (Goat anti-rabbit IgG (Fc) HRP) was diluted 1: 5,000 in the blocking solution and reacted at 37 ° C for 30 minutes and washed five times with TBS buffer. As a final step, 50 μl TMB (color reagents) were added and the NOX-L protein was detected using an ELISA reader. As a result, FIG. 1 shows the ELISA data of the 1st serum. It was confirmed that the OD value was 1.0 or more at the 1: 1000 dilution fold, and the NOx-L protein could be detected.

Example  5: Antibody purification ( IgG antibody 정화 ( Protein  A, G) / Affinity  antibody 정화 )

Example  5-1: IgG antibody 정화 ( Protein  A, G)

As a method for separating and purifying IgG from serum, it was purified using Protein A or Protein G resin.

Specifically, Protein A (or Protein G) resin was added to the column, washed 5 times with cold DW, washed with binding buffer, and then rabbit IgG serum was filtered. After the filtration, the filter was washed with a binding buffer of 2-3 times the volume of the resin, the filtered rabbit IgG serum was loaded, covered with a cap, and then rotated with a rotator at room temperature for 1 hour. The bottom was then removed and the passage was collected and washed with binding buffer. After washing, elution buffer was added, and the eluted fractions were collected and neutralized with neutralizing solution. The collected antibodies were confirmed by gel staining and Western blotting by SDS-PAGE.

Example  5-2: Affinity Antibody Purification

Antigen affinity column was prepared by separating and purifying only the antibody having affinity to the antigen in the serum. The antibody was purified by affinity chromatography.

Specifically, Affigel-10 was used for coupling with an antigen having pI 7-11.0. The disposable column was packed with 1 ml Affigel bead, washed with 10 ml D.W, and then washed again with coupling buffer (HEPES). 5 mg antigen (1 mg / ml) was overnight diluted with 1 L buffer (HEPES or PBS) at 4 째 C. The beads and antigens were mixed and reacted at 4 ° C for 4 hours with shaking. After coupling, the passing solution was collected and blocked with blocking buffer for 1 hour. And then washed with D.W and coupling buffer. Serum was poured into the column and reacted. After collecting the supernatant (serum), the resin was washed with a washing solution (1 × HEPES + 0.1% Triton X-100) and eluted buffer ((0.1 M citric acid pH 3.0) And then neutralized with a solution (1 M Tris pH 9.0).

< Experimental Example  1> NOX5 -L induction of cancer cell growth

1-1. NOX5 -L induces the proliferation of skin cancer, breast cancer and lung cancer cells.

To identify cancer therapeutic targets, cancer outlier profile analyzes were applied to the GENT database containing 40,700 microarray samples (Shin et al., 2011). Because ROS is associated with carcinogenesis (Kamata, 2009), we focused on ROS-related genes among cancer expression candidates.

Among the ROS-related genes, the NOX5 gene was selected to compare NOX5 mRNA levels in normal tissues, skin cancer, breast cancer, and lung cancer tissues. As a result, it was confirmed that the expression of NOX5 mRNA was increased in skin cancer, breast cancer and lung cancer tissues compared with normal tissues (FIG. 3A).

Next, shRNAs for NOX5 were added to SK-MEL-5 (skin malignant melanoma), SK-BR-3 (breast adenocarcinoma), and HOP-92 (lung cancer) cells derived from skin cancer, breast cancer, Lentivirus was infected. The SK-MEL-5 (malignant melanoma), SK-BR-3 (breast adenocarcinoma) and HOP-92 (lung cancer) cells selected herein had higher endogenous NOX5 expression compared to other NOX family members. As a result of infecting these cancer cells with shRNA lentivirus against NOX5, it was confirmed that the growth of these cancer cells was inhibited (Fig. 3B).

Since NOX5-L has not been shown to play a role in the growth of cancer cells, experiments were conducted focusing on NOX5-L. Cells were transfected with siRNA specifically inhibiting NOX5-L, but not NOX5-S. As a result, NOX5-L was detected in SK-BR-3 (breast adenocarcinoma) and G-361 (skin malignant melanoma) cells And inhibited cell growth (Fig. 3C).

In addition, since ROS is known to play a role in promoting the progression and metastasis of breast and lung cancer (Luanpitpong et al., 2010; Pelicano et al., 2009), the effects of NOX5-L on cancer cell mobility and cell invasion did. As expected, the mobility and cellular invasion of NOX5-L-inhibited breast cancer cells was reduced by almost 50% compared to control cells (FIG. 3D).

To confirm these results in cancer tissue, the amount of NOX5 was measured by immunohistochemistry in 156 cancer samples. Of these, 23 (57.5%) out of 40 skin cancer tissues showed a strong positive reaction to NOX5 (Table 1). In addition, 23 (41.1%) of 56 invasive breast carcinoma tissues were strongly positive for NOX5, and 32 of 53 (53.3%) of lung cancer tissues were positive for NOX5 (Table 1).

A representative NOX5-positive case shown in Table 1 is shown in Figure 4A. In lung tissue, NOX5 was expressed in basal reserve cells of growing bronchial epithelium, but not in normal bronchial epithelial cells located on reserve cells (Fig. 4B). This suggests that NOX5 is essential for the early stages of tumorigenesis and is the cause of lung cancer.

NOX5-S knockdown has been reported to increase apoptosis in esophageal adenocarcinoma cells. Therefore, it was examined whether the cell growth inhibition by cell suicide was inhibited in the cells in which NOX5-L was removed. For this, when NOX5-L was removed by infecting shRNA lentivirus against NOX5 in SK-MEL-5, SK-BR-3 and HOP-92 cells, caspase-3 activity was increased in these cells, (Fig. 5).

To confirm the possibility of NOX5-L as an anticancer target, G-361 cells were transfected with anti-NOX5 antibody (SEQ ID NO: 2) using antibodies purified in Example 5 against 295 to 313 residues of the NOX5 second extracellular domain , The growth of G-361 cells was reduced (FIG. 6A).

Next, we evaluated the anti-cancer drug efficacy by repeated intravenous administration of IgG-purified antibody and affinity-purified antibody in a nude mouse xenograft model of human skin cancer cell (G361).

The human skin cancer cell line G361 (skin melanoma cancer), which was kept frozen in liquid nitrogen, was thawed and incubated for an appropriate period of time in a CO ₂ incubator (Forma, USA) at a temperature of 37 ° C and a CO ₂ concentration of 5%.

On the last day of culture, all cancer cells were collected and counted, and the cell concentration was adjusted to 4.5 × 10 ⁷ cells / ml using serum-free media. The regulated cell culture was injected subcutaneously into the axillary region between the right clavicular and chest wall by 0.2 ml (9 × 10 ⁶ cells / mouse) per mouse.

(SPF) and female nude mice (4 weeks old) were supplied from Nara Biotech as the test animals, and the antibody (IgG-purified antibody, affinity-purified antibody) prepared in Example 5 and the control antibody (normal rabbit IgG) was administered at 6 weeks. Normal rabbit IgG, IgG-purified antibody (more than 4 mg / ml) and normal rabbit IgG affinity-purified antibody (more than 1 mg / ml) (days 0, 4, 7, 11, 14, and 18) in a total of 6 doses with a daily dose of 1 mg / kg / day.

To evaluate the toxicity of the rabbit IgG, IgG-purified antibody (40 mg / kg) and normal rabbit IgG and affinity-purified antibody (10 mg / kg) And general changes in body weight and body weight were observed. As a result, no unusual general symptoms and statistically significant weight loss were observed in all treatment groups during the test period (FIG. 6b).

On the last day (day 21), 27.7% (p <0.001) and 40.1% (p <0.001) of the IgG-purified and affinity-purified antibody-treated groups were statistically significant Tumor growth inhibition was observed (Figure 6c).

On day 21 post-antibody treatment, G361 tumor was excised and weighed 28.3% (p <0.001) and 42.0% (p <0.001) of the IgG-purified antibody and affinity-prurified antibody-treated group respectively compared with the same dose of normal rabbit IgG p &lt; 0.001) (Fig. 6C).

Therefore, when NOX5 was inhibited using shRNA, siRNA and antibody, it was confirmed that cancer cell growth was inhibited, and it was found that NOX5 could be a target of cancer treatment.

1-2. STAT5A  Mediated NOX5 Upregulation of -L promotes tumor formation in breast cancer.

To determine the mechanism by which NOX5-L is regulated, we found the common binding site of the transcription factor in the NOX5-L promoter. The NOX5-L promoter contains the STAT5 binding site. Therefore, STAT-A and control vector were infected with SK-BR-3 cells to confirm the effect of STAT5 on NOX5-L expression. As a result, it was confirmed that NOX5-L level was increased through STAT5A expression in SK-BR-3 cells (Fig. 7A).

Next, we examined whether STAT5A increases NOX5-L expression. The N642H mutant form of STAT5A has been reported to be essentially active (Ariyoshi et al., 2000). The expression of STAT5A (N642H) in SK-BR-3 cells was found to increase NOX5-L levels (Fig. 7B). The expression level of STAT5A (N642H) is lower than that of wild-type STAT5A (Fig. 7b). The higher expression of NOX5-L in STAT5A-expressing cells (N642H-infected cells) than in cells expressing wild-type STAT5A, Lt; RTI ID = 0.0 &gt; NOX5-L &lt; / RTI &gt;

In contrast, truncation mutation STAT5A (-713) is known to be dominant negative STAT5A (Yamashita et al., 2003). In cells expressing STAT5A (? 713), NOX5-L expression levels were lower than endogenous levels in vector control (Fig. 7b). This result indicates that when STAT5A is knocked down using STAT5A-specific shRNA or siRNA, the expression of NOX5-L in RNA (FIG. 7C) and protein (FIG. 7D) 3 cells (Fig. 7C and Fig. 7D).

Next, it was confirmed whether consensus binding sites of STAT5A were involved in the increase of NOX5-L level. The 5 'promoter portion of the NOX5-L gene was analyzed between -2012 and -1 from ATG and the four promoter regions of STAT5A using TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH.html) (Fig. 7E). The induction of NOX5-L by STAT5A was demonstrated by the promotion of transcription by STAT5A of the NOX5-L promoter / luciferase reporter gene construct. Deletion of four potential STAT5A binding sites (? STAT5) over 1162 bp in the NOX5-L promoter reduced activity in half (Figure 7e). These results confirmed STAT5A mediated NOX5-L expression. Because deletion of the four putative STAT5A binding sites was not expected to completely inhibit luciferase activity since STAT5 retained other binding sites of STAT5A. Thirteen other potential sites were predicted through TFBIND (http://tfbind.hgc.jp/) (Tsunoda and Takagi, 1999).

In addition, chromatin immunoprecipitation in SK-BR-3 cells and HOP-92 cells expressing STAT5 showed that activated STAT5 (p-STAT5) aggregates in the 5 'promoter portion of NOX5-L (Fig. 7f).

To confirm the relationship between NOX5 and p-STAT5 in cancer tissues, coexpression of NOX5 and p-STAT5 was measured by immunohistochemistry in 30 invasive breast cancer samples. NOX5 expression was observed in 56.7% of the samples (17 tissues) and p-STAT5 expression was observed in 60% (18 tissues). All NOX5-expressing breast cancer tissues co-express p-STAT5, and only one p-STAT5-positive tissue was free of NOX5 expression. Representative p-STAT5-positive and NOX5-positive cases are shown in Figure 7g.

<110> Korea Research Institute of Bioscience and Biotechnology <120> A pharmaceutical composition for delivering cancer          expression or activity inhibitor of NOX5 <130> KPA140804-KR <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> NOX5 antigen region <400> 1 Gln Ala Glu Ala Ser Pro Phe Gln Phe Trp Glu Leu Leu Leu Thr Thr   1 5 10 15 Arg Pro Gly             <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> NOX5 siRNA <400> 2 gauagaagug gcaccauca 19 <210> 3 <211> 58 <212> RNA <213> Artificial Sequence <220> <223> NOX5 shRNA <400> 3 ccggcgugug caucauggaa gucaacucga guugacuucc augaugcaca cguuuuug 58

Claims (13)

delete A skin cancer, a breast cancer, or a lung cancer, or a pharmaceutical composition for preventing or treating metastasis of cancer, which comprises an siRNA or an shRNA that inhibits the expression of NOX5 or an antibody that inhibits the activity of NOX5, Wherein the siRNA is an siRNA of NOX5 represented by SEQ ID NO: 2, and the shRNA is an shRNA of NOX5 represented by SEQ ID NO: 3. 2. The pharmaceutical composition according to claim 1, delete delete delete delete delete delete delete delete delete delete delete

Images