KR101653680B1

KR101653680B1 - Composition for inhibiting motility or increasing sensitivity against antibiotics containing volatile organic compound from Bacillus subtilis as effective component and uses thereof

Info

Publication number: KR101653680B1
Application number: KR1020150179168A
Authority: KR
Inventors: 류충민; 이수현; 김광선
Original assignee: 한국생명공학연구원
Priority date: 2015-12-15
Filing date: 2015-12-15
Publication date: 2016-09-02
Also published as: KR20160003590A

Abstract

본 발명은 고초균 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물, 고초균 유래의 휘발성 유기 화합물을 세균에 처리하여 세균의 운동성을 저해하거나 또는 항생제 감수성을 증가시키는 방법, 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 세균에 형질전환시켜 YpdB 유전자 발현이 조절된 세균에 고초균 유래의 휘발성 유기 화합물을 처리하는 단계를 포함하는 세균의 운동성 또는 항생제 감수성을 조절하는 방법 및 서열번호 2의 아미노산 서열로 이루어진 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는, 고초균 유래의 휘발성 유기 화합물 처리시 세균의 운동성 조절 또는 항생제 감수성 증가용 조성물을 제공한다.The present invention relates to a composition for inhibiting motility of a bacterium containing a volatile organic compound derived from Bacillus subtilis as an active ingredient or for increasing susceptibility to antibiotics, a method for inhibiting the motility of a bacterium by treating a bacterium with a volatile organic compound derived from Bacillus subtilis, , A method of regulating bacterial motility or antibiotic susceptibility including a step of transforming a recombinant vector comprising a YpdB protein coding gene derived from Escherichia coli into a bacterium and treating a bacterium whose YpdB gene expression is regulated with a volatile organic compound derived from Bacillus subtilis, There is provided a composition for controlling motility of a bacterium or increasing susceptibility to antibiotics when treating a volatile organic compound derived from Bacillus subtilis, which contains, as an active ingredient, a recombinant vector comprising an E. coli-derived YpdB protein coding gene comprising the amino acid sequence of SEQ ID NO:

Description

Composition for inhibiting motility or increasing sensitivity against antibiotics containing volatile organic compound from Bacillus subtilis as effective component and uses thereof

본 발명은 고초균 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물 및 이의 용도에 관한 것으로, 더욱 상세하게는 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물, 고초균 유래의 휘발성 유기 화합물을 세균에 처리하여 세균의 운동성을 저해하거나 또는 항생제 감수성을 증가시키는 방법, 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 세균에 형질전환시켜 YpdB 유전자 발현이 조절된 세균에 고초균 유래의 휘발성 유기 화합물을 처리하는 단계를 포함하는 세균의 운동성 또는 항생제 감수성을 조절하는 방법 및 서열번호 2의 아미노산 서열로 이루어진 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는, 고추균 유래의 휘발성 유기 화합물 처리시 세균의 운동성 조절 또는 항생제 감수성 증가용 조성물에 관한 것이다.The present invention relates to a composition for inhibiting motility or increasing antibiotic sensitivity of bacteria containing a volatile organic compound derived from Bacillus bacillus as an active ingredient, and to a use thereof, and more specifically, Bacillus subtilis ) composition for inhibiting motility or increasing antibiotic sensitivity of bacteria containing volatile organic compounds derived from Bacillus subtilis as an active ingredient, a method of inhibiting bacterial motility or increasing antibiotic sensitivity by treating bacteria with volatile organic compounds derived from Bacillus coli, E. coli A method for controlling motility or antibiotic sensitivity of bacteria comprising the step of treating a volatile organic compound derived from Bacillus bacillus into a bacterium whose YpdB gene expression is regulated by transforming a recombinant vector containing the derived YpdB protein-coding gene into a bacterium, and SEQ ID NO: It relates to a composition for controlling bacterial motility or increasing antibiotic susceptibility when treated with volatile organic compounds derived from Capsicum bacteria, containing a recombinant vector containing a YpdB protein-coding gene derived from E. coli consisting of the amino acid sequence of 2 as an active ingredient.

수많은 박테리아 종들이 그들의 기능을 조절하기 위해 서로 경쟁하거나 또는 협력하는 동적인 커뮤니티에 공존한다. 박테리아는 스트레스, 경쟁 및 숙주 방어와의 교전으로 인해 야기되는 자연적인 변화에 적응하기 위해 세포간 신호전달 시스템을 발달시켜 왔다. 몇가지 박테리아 의사소통(communication) 경로가 발견된 바 있다. 가장 널리퍼진 현상은 쿼럼 센싱(quorum sensing (QS))으로, 이는 QS 분자들의 분비 및 그들의 농도 의존적 신호전달 캐스캐이드를 포함하는 상호연결된, 다중층 조절 네트워크이다. 박테리아는 호모세린 락톤의 N-아실 유도체, 고리형 디펩티드 및 퀴놀론과 같은 화학물질을 이용하여 QS를 수행하여 외부 및 내부 신호뿐만 아니라 환경적인 신호를 감지하고 응답한다. 300종이 넘는 박테리아가 고체, 액체 및 기체의 비균질적 혼합물에 확산할 수 있는 광범위하게 다양한 생물학적-활성의 공중부유 휘발성 유기 화합물(airborne VOCs)을 방출하여, VOC 생산이 박테리아의 일반적인 현상임을 시사한다. 그러나, VOC-매개성의 박테리아간 의사소통, 활성 VOC의 동정 및 영향받는 세포의 행동에 내재하는 매커니즘은 일부의 경우를 제외하고는 대부분이 알려지지 않은 채 남아있다. 예를 들어, 기회감염성의 인간 병원균 녹농균(Pseudomas aeruginosa)에서, 2-아미노-아세토페논 VOC은 발병성 조절자 활성을 조절하고, 급성 발병 기능을 확률적으로 침묵시킴으로써 쌍안정의(bistable) 표현형을 촉진한다. 더욱 직접적으로는, VOC는 대장균(Escherichia coli)의 항생제 내성 표현형을 개질시킨다. 흥미롭게도, VOC는 박테리아와 진핵 세포들 사이의 계통-상호적인 상호작용에 역할을 한다는 것이 명백해지고 있다. 예를 들어, 비브리오 콜레라(Vibrio cholerae) O1은 기체 화합물인 2,3-부탄디올을 생산하는데, 이는 면역 조절자들의 유도를 억제함으로써 인간 면역계와 상호작용한다. 박테리아에서 생산된 VOC들은 또한 식물 생장을 촉진하고, 아라비돕시스(Arabidopsis)에서의 전반적인 내성을 유도하는 것으로 나타났다. 따라서, 동적인 다채로운 영향을 주는 상호작용에서의 박테리아 생존을 더욱 폭넓게 이해하기 위해서는 박테리아 VOC에 의해 행해지는 역할 및 그들이 작용하는 메커니즘을 완전하게 이해해야 할 필요가 있다. Numerous bacterial species coexist in dynamic communities that compete or cooperate with each other to regulate their function. Bacteria have developed intercellular signaling systems to adapt to natural changes caused by stress, competition and engagement with host defenses. Several bacterial communication pathways have been discovered. The most prevalent phenomenon is quorum sensing (QS), an interconnected, multilayered regulatory network comprising the secretion of QS molecules and their concentration dependent signaling cascade. Bacteria perform QS using chemicals such as N-acyl derivatives of homoserine lactones, cyclic dipeptides and quinolones to detect and respond to external and internal signals as well as environmental signals. More than 300 species of bacteria release a wide variety of biologically active airborne volatile organic compounds (VOCs) that can diffuse into a heterogeneous mixture of solids, liquids and gases, suggesting that VOC production is a common phenomenon in bacteria. However, the mechanisms underlying VOC-mediated interbacterial communication, identification of active VOCs and the behavior of affected cells remain largely unknown, except in some cases. For example, in the opportunistic human pathogen Pseudomas aeruginosa , 2-amino-acetophenone VOC modulates onset modulator activity and probably silences acute onset function, thereby suppressing the bistable phenotype. Promote. More directly, the VOC is Escherichia coli ) to modify the antibiotic resistance phenotype. Interestingly, it is becoming apparent that VOCs play a role in lineage-interactive interactions between bacteria and eukaryotic cells. For example, the V. cholera (Vibrio cholerae ) O1 produces the gaseous compound 2,3-butanediol, which interacts with the human immune system by inhibiting the induction of immune modulators. VOCs produced in bacteria have also been shown to promote plant growth and induce overall tolerance in Arabidopsis. Thus, in order to more broadly understand bacterial survival in dynamic and diverse influencing interactions, it is necessary to fully understand the role played by bacterial VOCs and the mechanisms by which they act.

그람-음성 및 그람-양성 박테리아는 그들의 구조에 있어서 상당히 상이한 것으로 보이나, 두 박테리아 종들 모두 피부, 소화관, 상피의 상처, 가축 및 토양과 같은 유사한 환경에서 발견된다. 따라서, 상이한 환경 인자들에 응답하는 상기 박테리아들의 능력들 중 의사소통은 해당 종들의 공존에 있어 주된 역할을 하는 것일 수 있다. 따라서, 박테리아의 공존을 가능케 하고, 그러한 가변적인 환경에서의 그들 자체의 생존을 유지하기 위한 두 박테리아군들 사이에는 수많은 잠재적인 의사소통 균형이 있다. 그러나, 그러한 가변적인 환경에서 그러한 의사소통들을 실험적으로 연구하기는 어려운 것으로 나타났다. 많은 연구들에서, 대장균 및 고초균(Bacillus subtilis)의 두 종들이 유사한 생태학적 적소를 공유하는 것으로 공지되어 있다. Gram-negative and Gram-positive bacteria appear to be quite different in their structure, but both bacterial species are found in similar environments such as skin, digestive tract, epithelial wounds, livestock and soil. Thus, communication among the bacteria's abilities to respond to different environmental factors may play a major role in the coexistence of the species. Thus, there are numerous potential communication balances between the two bacterial populations to enable the coexistence of bacteria and to maintain their own survival in such a variable environment. However, it turns out that it is difficult to study such communications experimentally in such a variable environment. In many studies, E. coli and Bacillus subtilis ) are known to share similar ecological sites.

따라서, 본 발명에서는 대장균 및 고초균이 그람-음성 및 그람-양성 종들 각각에서의 VOC의 역할 및 영향을 연구하기 위한 대표적인 모델로서 이용되었다. 본 발명에서, 마이크로어레이 분석을 대장균의 고초균 유래의 VOC에 대한 노출에서의 유전자 발현 검사에 이용하여, 해당 VOC들이 유전자 발현의 세포내 조절에 영향을 주는 방법을 이해하게 되었다. 흥미롭게도, VOC는 수용자 세포들의 표현형에 극적으로 영향을 주었고, 100개를 초과하는 유전자의 발현을 변경시켰다. 더욱이, 나노몰 내지 마이크로몰 농도의 2,3-부탄디온(2,3-BD) 및 글리옥살산(GA)은 운동성 및 항생제 내성 표현형과 연관된 전반적인 유전자 발현에서의 변화를 매개했다. 더욱 흥미롭게도, VOC-매개성 상호작용은 이제까지 규명되지 않은 ypdB 유전자 생성물 및 그의 하류방향 전사 인자들인 soxS, rpoS 또는 yjhU에 의해 조절되었다. Accordingly, in the present invention, E. coli and Bacillus bacillus were used as representative models for studying the role and effect of VOCs in each of Gram-negative and Gram-positive species. In the present invention, microarray analysis was used to test gene expression in exposure to VOCs derived from Bacillus Bacillus coli, to understand how the corresponding VOCs influence the intracellular regulation of gene expression. Interestingly, VOC dramatically affected the phenotype of recipient cells and altered the expression of more than 100 genes. Moreover, nanomolar to micromolar concentrations of 2,3-butanedione (2,3-BD) and glyoxalic acid (GA) mediated changes in overall gene expression associated with motility and antibiotic resistance phenotype. More interestingly, the VOC-mediated interaction was regulated by the so far unidentified ypdB gene product and its downstream transcription factors, soxS , rpoS or yjhU.

본 발명에서의 그러한 발견 사실들은 VOC가 유전자 발현에서의 변화를 촉발하는 박테리아들 사이의 신속한 감지를 위한 상호-특이적 신호를 대표한다는 점을 시사한다. 가장 중요한 점은, VOC-매개성 박테리아 의사소통이 심지어 물리적으로 분리되어 있는 박테리아의 자가-방어 및 운동성에 영향을 주는 개질을 유도할 수 있다는 점이다.Such findings in the present invention suggest that VOCs represent cross-specific signals for rapid detection among bacteria that trigger changes in gene expression. Most importantly, VOC-mediated bacterial communication can even lead to modifications that affect the self-defense and motility of physically isolated bacteria.

한편, 한국공개특허 제2009-0066412호에서는 '미생물 유래 대사물질을 이용한 식물 생장 촉진과 식물보호 방법'이 개시되어 있으나, 본 발명에서와 같이 고초균 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물 및 이의 용도에 대해서는 밝혀진 바가 없다.On the other hand, Korean Patent Application Publication No. 2009-0066412 discloses'a method for promoting plant growth and protecting plants using microbial-derived metabolites', but as in the present invention, bacteria containing a volatile organic compound derived from Bacillus bacillus as an active ingredient The composition for inhibiting motility or increasing the susceptibility to antibiotics and its use has not been found.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명자는 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물인 2,3-부탄디온(2,3-butanedione) 또는 글리옥실산(glyoxylic acid)이 대장균에 처리되었을 때, 대장균의 운동성이 저해되고 특정 항생제인 세푸록심(cefuroxime), 목사락탐(moxalactam) 또는 블라스티시딘 S(blasticidin S)에 대한 감수성이 증가되는 것을 확인하였다. 또한, 대장균의 YpdB 유전자 발현이 저해된 세균에 2,3-부탄디온 또는 글리옥실산을 처리하였을 때, 대장균의 운동성이 회복되고, 특정 항생제인 앰피실린에 대한 감수성이 증가되는 것을 확인함으로써, 본 발명을 완성하였다.The present invention was derived from the above requirements, and the inventors of the present invention are Bacillus subtilis ) When treated with 2,3-butanedione or glyoxylic acid, a volatile organic compound derived from Escherichia coli, the motility of Escherichia coli is inhibited and cefuroxime, a specific antibiotic. , It was confirmed that the susceptibility to moxalactam or blasticidin S was increased. In addition, by confirming that when 2,3-butanedione or glyoxylic acid was treated with bacteria whose YpdB gene expression of E. coli was inhibited, the motility of E. coli was restored and the sensitivity to ampicillin, a specific antibiotic, was increased. The invention was completed.

상기 과제를 해결하기 위해, 본 발명은 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물을 제공한다.In order to solve the above problems, the present invention Bacillus subtilis ) provides a composition for inhibiting the motility of bacteria or increasing the sensitivity of antibiotics containing a volatile organic compound derived as an active ingredient.

또한, 본 발명은 고초균 유래의 휘발성 유기 화합물을 세균에 처리하여 세균의 운동성을 저해하거나 또는 항생제 감수성을 증가시키는 방법을 제공한다.In addition, the present invention provides a method for inhibiting motility of bacteria or increasing sensitivity to antibiotics by treating volatile organic compounds derived from Bacillus bacillus on bacteria.

또한, 본 발명은 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 세균에 형질전환시켜 YpdB 유전자 발현이 조절된 세균에 고초균 유래의 휘발성 유기 화합물을 처리하는 단계를 포함하는 세균의 운동성 또는 항생제 감수성을 조절하는 방법을 제공한다.In addition, the present invention is a bacterial motility or antibiotic sensitivity comprising the step of treating a volatile organic compound derived from Bacillus bacillus into a bacterium whose YpdB gene expression is regulated by transforming a recombinant vector containing the E. coli-derived YpdB protein-encoding gene into a bacterium. Provides a way to control.

또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 유효성분으로 함유하는, 고초균 유래의 휘발성 유기 화합물 처리시 세균의 운동성 조절 또는 항생제 감수성 증가용 조성물을 제공한다.In addition, the present invention provides a composition for controlling bacterial motility or increasing antibiotic susceptibility during treatment of volatile organic compounds derived from Bacillus bacillus, containing as an active ingredient a recombinant vector containing a gene encoding a YpdB protein derived from E. coli consisting of the amino acid sequence of SEQ ID NO: 2 to provide.

본 발명을 통해 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물인 2,3-부탄디온(2,3-butanedione) 또는 글리옥실산(glyoxylic acid) 처리시 세균의 특정 항생제에 대한 민감성이 증가하므로, 본 발명의 휘발성 유기 화합물은 다재내성의 슈퍼박테리아의 사멸에 유용하게 응용될 수 있다. Bacillus through the present invention subtilis ) volatile organic compounds derived from 2,3-butanedione or glyoxylic acid increases the sensitivity of bacteria to specific antibiotics, so the volatile organic compounds of the present invention are versatile. It can be usefully applied to the killing of resistant super bacteria.

또한, 병원성 세균의 운동성 관련 유전자는 병원성 인자로 알려져 있는데, 본 발명의 고초균(Bacillus subtilis) 유래의 휘발성 유기화합물인 2,3-부탄디온(2,3-butanedione) 또는 글리옥실산(glyoxylic acid) 처리시 세균의 운동성을 저해하므로, 상기 두 휘발성 물질을 이용하여 병원성 인자의 역할을 동정하는데 유용하게 응용될 수 있다.In addition, genes related to motility of pathogenic bacteria are known as pathogenic factors, and 2,3-butanedione or glyoxylic acid, a volatile organic compound derived from Bacillus subtilis of the present invention. Since the treatment inhibits the motility of bacteria, it can be usefully applied to identify the role of pathogenic factors using the two volatile substances.

도 1은　대장균 유전자 발현에 대한 고초균 VOC의 영향을 분석한 결과이다. (a) 2-구획 플레이트 검정 시스템(I-플레이트 시스템)을 보여준다. 대장균의 생장에 대해서, LB-아가를 이용했고, 시각적 자료를 위해서는 MacConkey 아가 플레이트의 사진을 제시했다. (b) 대장균의 상대적인 유전자 발현 분석. "발현 수준"을 나타내는 마이크로어레이 데이터에서 고초균 VOC에 대한 응답 발현에서 3-배를 초과하는 변화를 나타낸 세가지 유전자를 무작위로 선택하여, 대장균 세포를 VOC로 12시간 동안 처리한 후 RT-qPCR로 분석했다. 오차 막대는 s.e.m.로 정했다(n=3, P=0.05). (c) 마이크로어레이 데이터의 클러스터링. 마이크로어레이 데이터는 VOC를 이용한 처리에 의해 유도된 3배 초과하는 상향- 또는 하향-조절을 보여준다. 클러스터링 분석은 MeV(MultiExperiment Viewer)를 이용해 수행했다(Lee et al. 2012 Annu. Rev. Microbiol. 66:125-152). 세가지 처리 기간을 제시한다(6, 12 및 24 시간) (d) 클러스터링된 군의 유전자 발현 패턴. (c)에서의 각 군으로부터 2개의 유전자를 무작위로 선별하여, 유전자-특이적 프라이머를 이용한 RT-qPCR로 시험했다. 오차 막대는 s.e.m.로 정했다(n=3, P=0.05).
도 2는 박테리아 운동성에 대한 VOC의 영향을 나타낸다. (a) 운동성-관련 유전자 발현의 변화. 대장균 MG1655에서의 유전자 motA, cheA, cheW 또는 fliA의 발현은 VOC의 처리 후 RT-qPCR 방법으로 측정했다. 유전자 발현 수준은 VOC-처리 시료의 비처리 시료(대조군)에 대한 정규화된 유전자 수준을 나타낸다. 제시된 데이터는 평균값이다(n=5, P=0.05). 오차 막대는 s.e.m.로 정했다. 대장균의 (b) 수영 및 (c) 유주 운동성에서의 VOC-유도성 변화. (d) 그람-음성 및 -양성 박테리아에서의 유주 운동성의 보존. (e) 두가지 상이한 대장균 균주에서의 유주 운동성의 비교. 제시된 플레이트는 3회 반복에서 수득된 데이터의 대표값이다. (f) 유주 운동성이 VOC에 의해 변경되지 않은 대장균 돌연변이 균주.
도 3은 VOC에 의한 항생제에 대한 감수성의 조절을 나타낸다. (a) P=0.05로 n=3인 대장균 세포의 항생제 감수성의 대표적인 운동 역학적 분석. Phenotype Microarray

(PM) 패턴 (상단) 및 PM12 플레이트의 PM 운동 역학(하단) (b) (a)로부터의 PM 운동 역학의 정량적인 분석. (c) 대장균에서의 항생제 내성에 대한 VOC의 영향. 앰피실린 또는 테트라시클린에서의 VOC-처리 대 비처리 대장균의 상대적인 생존 비율을 제시한다. (d) VOC의 존재 및 부재 하에서의 hipA 및 hipB의 발현. 유전자 발현은 RT-qPCR로 모니터링했다. 오차 막대는 3회 반복실험으로부터의 s.e.m.로 정했다. (e) 앰피실린 상에서의 생장은 hipA 발현에 좌우된다. VOC는 hipA 넉아웃 균주에서는 생존을 개선시키지 않은 반면, VOC는 회복된(complemented) 균주에서의 생존을 개선시켰다. 플라스미드 pCA24N 및 ASKA-hipA를 사용했다.
도 4는 대장균 표현형에 영향을 주는 개별 VOC의 동정 및 특징분석을 나타낸다. 대장균 MG1655 및 BW25113에서의 (a) 유주 운동성 및 (b) 앰피실린 내성에 대한 개별 VOC의 영향(n=3, P=0.05). 항생제 내성 표현형은 앰피실린 상에서 생장시킨 VOC-처리 및 미처리 대장균의 생존 비율로 나타낸다. 대조군은 VOC 처리가 없음을 나타낸다. (c) 자연 증발(기체 상태) 또는 (d) 직접 첨가(액체 상태)에 의한 개별 VOC의 유효 농도의 결정. 별표(*)는 통계적으로 유의한 데이터(P=0.05)를 나타내고, 화살촉은 BW25113 및 MG1655 세포의 두가지 모두에서의 총 VOC와 동일한 표현형을 나타내는 개별 VOC를 나타낸다. 오차 막대는 s.e.m.로 정했다.
도 5는 ypdB 유전자 생성물에 의한 VOC-매개성 표현형의 주된 조절을 나타낸다. (a) 항생제 내성에 결부된 VOC-조절성 유전자의 동정이다. 앰피실린 존재 하에서 생장시킨 VOC-처리 대 미처리 게이오 컬렉션 돌연변이의 생존 비율(n=3). 별표 (*)는 통계적 유의성을 나타낸다(P=0.05). (b) 야생형 및 VOC에 의한 ypdB 넉아웃의 생장 표현형. 생장(OD₆₀₀)은 자연 증발에 의한 VOC의 부재 또는 존재 하에 모니터링했다. ypdB 넉아웃 및 야생형 대장균에서의 유주 운동성(c) 및 항생제 내성(d)에 대한 2,3-BD 및 GA의 영향 비교. (e) 앰피실린의 존재 하에 생장된 ypdB 넉아웃, 회복 넉아웃(complemented knockout) 및 야생형 세포에서의 VOC-처리 대 미처리 세포의 생존 비율. (f) 야생형 대장균 및 ypdB 넉아웃 세포에서의 VOC 처리의 존재 및 부재 하 hipA 발현에서의 상대적 변화(n=3, P=0.05). (g) 대장균 생리에 대한 VOC-매개성 변화에 대한 모델. 여기 제시된 모델은 본 발명의 결과 및 선행기술의 데이터에 근거한다. 오차 막대는 s.e.m.로 정했다. 1 is a result of analyzing the effect of Bacillus VOC on E. coli gene expression. (a) A two-compartment plate assay system (I-plate system) is shown. For the growth of E. coli, LB-agar was used, and pictures of MacConkey agar plates were presented for visual data. (b) Analysis of relative gene expression in E. coli. From the microarray data representing the "expression level", three genes that showed a change of more than 3-fold in the expression in response to Bacillus VOC were randomly selected, and E. coli cells were treated with VOC for 12 hours and then analyzed by RT-qPCR. did. Error bars were set as sem (n=3, P=0.05). (c) Clustering of microarray data. Microarray data show more than 3 fold up- or down-regulation induced by treatment with VOCs. Clustering analysis was performed using MeV (MultiExperiment Viewer) (Lee et al. 2012 Annu. Rev. Microbiol. 66:125-152). Three treatment periods are presented (6, 12 and 24 hours). (d) Gene expression patterns of clustered groups. Two genes were randomly selected from each group in (c) and tested by RT-qPCR using gene-specific primers. Error bars were set as sem (n=3, P=0.05).
Figure 2 shows the effect of VOC on bacterial motility. (a) Changes in motility-related gene expression. Expression of genes motA, cheA , cheW, or fliA in E. coli MG1655 was measured by RT-qPCR after treatment with VOC. The gene expression level represents the normalized gene level for the untreated sample (control) of the VOC-treated sample. Data presented are mean values (n=5, P=0.05). Error bars were set as sem. Escherichia coli VOC-induced changes in (b) swimming and (c) gliding motility. (d) Preservation of migratory motility in Gram-negative and -positive bacteria. (e) Comparison of migratory motility in two different E. coli strains. The plate shown is a representative of the data obtained in 3 replicates. (f) E. coli mutant strains in which migration motility was not altered by VOC.
3 shows the regulation of sensitivity to antibiotics by VOC. (a) Representative kinetic analysis of antibiotic sensitivity of E. coli cells with P=0.05 and n=3. Phenotype Microarray

(PM) Pattern (top) and PM kinetics of PM12 plate (bottom) Quantitative analysis of PM kinetics from (b) (a). (c) Effect of VOC on antibiotic resistance in E. coli. The relative survival ratio of VOC-treated versus untreated E. coli in ampicillin or tetracycline is presented. (d) Expression of hipA and hipB in the presence and absence of VOCs. Gene expression was monitored by RT-qPCR. Error bars were set as sem from 3 replicates. (e) Growth on ampicillin depends on hipA expression. VOCs did not improve survival in hipA knockout strains, while VOCs improved survival in complemented strains. Plasmids pCA24N and ASKA- hipA were used.
Figure 4 shows the identification and characterization of individual VOCs affecting the E. coli phenotype. Effects of individual VOCs on (a) migratory motility and (b) ampicillin resistance in E. coli MG1655 and BW25113 (n=3, P=0.05). The antibiotic resistance phenotype is expressed as the survival rate of VOC-treated and untreated E. coli grown on ampicillin. Control shows no VOC treatment. Determination of the effective concentration of individual VOCs by (c) natural evaporation (gas state) or (d) direct addition (liquid state). An asterisk (*) indicates statistically significant data (P=0.05), and arrowheads indicate individual VOCs showing the same phenotype as total VOCs in both BW25113 and MG1655 cells. Error bars were set as sem.
5 shows the main regulation of the VOC-mediated phenotype by the ypdB gene product. (a) Identification of VOC-regulatory genes linked to antibiotic resistance. Survival ratio of VOC-treated versus untreated Keio collection mutations grown in the presence of ampicillin (n=3). An asterisk (*) indicates statistical significance (P=0.05). (b) Growth phenotype of ypdB knockout by wild type and VOC. Growth (OD ₆₀₀ ) was monitored in the absence or presence of VOCs by natural evaporation. ypdB Comparison of the effects of 2,3-BD and GA on knockout and migration motility (c) and antibiotic resistance (d) in wild-type E. coli. (e) ypdB knockout grown in the presence of ampicillin, complemented knockout and VOC-treated vs. survival ratio of untreated cells in wild-type cells. (f) Relative changes in hipA expression with and without VOC treatment in wild-type E. coli and ypdB knockout cells (n=3, P=0.05). (g) Model for VOC-mediated changes in E. coli physiology. The model presented here is based on the results of the present invention and prior art data. Error bars were set as sem.

본 발명의 목적을 달성하기 위하여, 본 발명은 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물을 유효성분으로 함유하는 세균의 운동성 저해 또는 항생제 감수성 증가용 조성물을 제공한다.In order to achieve the object of the present invention, the present invention Bacillus subtilis ) provides a composition for inhibiting the motility of bacteria or increasing the sensitivity of antibiotics containing a volatile organic compound derived as an active ingredient.

본 발명의 일 구현 예에 따른 조성물에서, 상기 휘발성 유기 화합물은 고초균에서 생성되는 휘발성 유기 화합물일 수 있고, 바람직하게는 3-부탄디온(2,3-butanedione) 또는 글리옥실산(glyoxylic acid)일 수 있으나, 이에 제한되지 않는다.In the composition according to an embodiment of the present invention, the volatile organic compound may be a volatile organic compound generated from Bacillus bacillus, preferably 3-butanedione or glyoxylic acid. However, it is not limited thereto.

본 발명의 휘발성 유기 화합물을 액체 상태 또는 기체 상태로 세균에 처리하였을 때, 비처리 대조구 세균보다 수영(swimming) 및 유주(swarming) 운동성이 저해되며, 특정 항생제에 대한 감수성이 증가하였다.When the volatile organic compound of the present invention was treated with bacteria in a liquid or gaseous state, swimming and swarming motility was inhibited compared to the untreated control bacteria, and susceptibility to specific antibiotics was increased.

본 발명의 일 구현 예에 따른 조성물에서, 상기 항생제는 세푸록심(cefuroxime), 목사락탐(moxalactam) 또는 블라스티시딘 S(blasticidin S)일 수 있으나, 이에 제한되지 않는다.In the composition according to an embodiment of the present invention, the antibiotic may be cefuroxime, moxalactam, or blasticidin S, but is not limited thereto.

본 발명의 일 구현 예에 따른 조성물에서, 상기 세균은 대장균(Escherichia coli), 벼알마름병균(Burkholderia glumae), 녹농균(Pseudomonas aeruginosa) 또는 패니바실러스 폴리믹사(Paenibacillus polymyxa)일 수 있으나, 이에 제한되지 않는다.In the composition according to an embodiment of the present invention, the bacterium is Escherichia coli , Burkholderia glumae ), Pseudomonas aeruginosa ) or Paenibacillus polymyxa , but is not limited thereto.

또한, 본 발명은 고초균(Bacillus subtilis) 유래의 휘발성 유기 화합물을 세균에 처리하여 세균의 운동성을 저해하거나 또는 항생제 감수성을 증가시키는 방법을 제공한다.In addition, the present invention Bacillus subtilis ) by treating a volatile organic compound derived from a bacterium to inhibit the motility of the bacterium or to increase the sensitivity of antibiotics.

본 발명의 일 구현 예에 따른 방법에서, 상기 휘발성 유기 화합물은 고초균에서 생성되는 휘발성 유기 화합물일 수 있고, 바람직하게는 3-부탄디온(2,3-butanedione) 또는 글리옥실산(glyoxylic acid)일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the volatile organic compound may be a volatile organic compound generated from Bacillus bacillus, preferably 3-butanedione or glyoxylic acid. However, it is not limited thereto.

본 발명의 일 구현 예에 따른 방법에서, 상기 항생제는 세푸록심(cefuroxime), 목사락탐(moxalactam) 또는 블라스티시딘 S(blasticidin S)일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the antibiotic may be cefuroxime, moxalactam, or blasticidin S, but is not limited thereto.

본 발명의 일 구현 예에 따른 방법에서, 상기 세균은 대장균(Escherichia coli), 벼알마름병균(Burkholderia glumae), 녹농균(Pseudomonas aeruginosa) 또는 패니바실러스 폴리믹사(Paenibacillus polymyxa)일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the bacteria are Escherichia coli , rice roe blight ( Burkholderia glumae ), Pseudomonas aeruginosa ) or Paenibacillus polymyxa , but is not limited thereto.

또한, 본 발명은 In addition, the present invention

대장균 유래 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 세균에 형질전환시켜 세균 내 YpdB 유전자 발현을 조절하는 단계; 및 Controlling YpdB gene expression in the bacteria by transforming the recombinant vector containing the E. coli-derived YpdB protein coding gene into bacteria; And

상기 YpdB 유전자 발현이 조절된 세균에 고초균 유래의 휘발성 유기 화합물을 처리하는 단계를 포함하는 세균의 운동성 또는 항생제 감수성을 조절하는 방법을 제공한다.It provides a method of controlling bacterial motility or antibiotic susceptibility, comprising the step of treating a volatile organic compound derived from Bacillus bacillus on the bacteria whose YpdB gene expression is regulated.

본 발명의 일 구현 예에 따른 방법에서, 상기 YpdB 유전자 발현을 저해하여 세균의 운동성을 회복시키거나 또는 항생제 감수성을 증가시킬 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the YpdB gene expression may be inhibited to restore bacterial motility or antibiotic sensitivity, but is not limited thereto.

본 발명의 YpdB 단백질은 투-컴포넌트 시스템(two-component system)의 LytTR 반응 조절자(RR)에 속하는 것으로, 기능에 대해서는 정확하게 밝혀지지 않았다.The YpdB protein of the present invention belongs to the LytTR response regulator (RR) of a two-component system, and its function has not been accurately identified.

본 발명에서 YpdB 유전자 발현이 저해된 돌연변이체에 고초균 유래의 휘발성 유기 화합물을 처리하면 돌연변이체의 운동성은 비처리 야생형 세균과 같이 운동성이 회복되고, 항생제에 대한 감수성을 증가시킬 수 있다(도 5c 및 도 5e).In the present invention, if the mutant whose YpdB gene expression is inhibited is treated with a volatile organic compound derived from Bacillus bacillus, the motility of the mutant recovers motility like untreated wild-type bacteria, and the susceptibility to antibiotics can be increased (Fig. 5c and Figure 5e).

본 발명에 따른 YpdB 단백질의 범위는 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 고초균 유래의 휘발성 물질 처리시 미생물의 세균의 운동성 조절 또는 항생제 감수성 증가 활성을 의미한다.YpdB according to the invention The protein range includes a protein having an amino acid sequence represented by SEQ ID NO: 2 and functional equivalents of the protein. The term "functional equivalent" is a result of the addition, substitution or deletion of amino acids, with the amino acid sequence represented by SEQ ID NO: 2 at least 70% or more, preferably 80% or more, more preferably 90% or more, even more preferably Refers to a protein that has 95% or more sequence homology and exhibits substantially the same physiological activity as the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" refers to the activity of controlling the motility of bacteria or increasing the sensitivity of antibiotics when treating volatile substances derived from Bacillus bacillus.

또한, 본 발명은 상기 YpdB 단백질을 암호화하는 유전자를 제공한다. 본 발명의 유전자는 YpdB 단백질을 암호화하는 게놈 DNA와 cDNA를 모두 포함한다. 바람직하게는, 본 발명의 유전자는 서열번호 1로 표시되는 염기서열을 포함할 수 있다. 또한, 상기 염기 서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.In addition, the present invention provides a gene encoding the YpdB protein. The gene of the present invention includes both genomic DNA and cDNA encoding the YpdB protein. Preferably, the gene of the present invention may include a nucleotide sequence represented by SEQ ID NO: 1. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene is a base sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, most preferably 95% or more, respectively, with the nucleotide sequence of SEQ ID NO: 1 Can include. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include additions or deletions (ie, gaps) compared to (not including).

용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로서 인위적인 수단에 의해 세포 내 재도입된 것이다.The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a protein encoded by a heterologous nucleic acid. Recombinant cells may express genes or gene segments that are not found in the natural form of the cell in either a sense or antisense form. In addition, recombinant cells can express genes found in cells in their natural state, but the genes are modified and reintroduced into cells by artificial means.

용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 기주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다. 용어 "발현 벡터"는 목적한 코딩 서열과, 특정 기주 생물에서 작동 가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다.The term "vector" is used to refer to a DNA fragment(s), a nucleic acid molecule, which is delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. The term “carrier” is often used interchangeably with “vector”. The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and an appropriate nucleic acid sequence essential for expressing the coding sequence operably linked in a particular host organism.

본 발명의 벡터는 전형적으로 클로닝 또는 발현을 위한 벡터로서 구축될 수 있다. 또한, 본 발명의 벡터는 원핵세포를 기주로 하여 구축될 수 있다. 예를 들어, 본 발명의 벡터가 발현 벡터이고, 원핵 세포를 기주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터 (예컨대, pLλ프로모터, trp 프로모터, lac 프로모터, T7 프로모터, tac 프로모터 등), 해독의 개시를 위한 리보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 기주 세포로서 대장균(E. coli)이 이용되는 경우, E. coli 트립토판 생합성 경로의 프로모터 및 오퍼레이터 부위, 그리고 파아지 λ의 좌향 프로모터(pLλ프로모터)가 조절 부위로서 이용될 수 있다.The vectors of the invention can typically be constructed as vectors for cloning or expression. In addition, the vector of the present invention can be constructed using prokaryotic cells as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is the host, a strong promoter capable of promoting transcription (e.g., pLλ promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.), It is common to include a ribosome binding site and a transcription/translation termination sequence for initiation of translation. When E. coli is used as the host cell, the promoter and operator site of the E. coli tryptophan biosynthetic pathway, and the left-facing promoter of the phage λ (pLλ promoter) may be used as the regulatory site.

한편, 본 발명에 이용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드 (예: pCA24N, pSC101, ColE1, pBR322,pUC8/9, pHC79, pGEX 시리즈, pET 시리즈 및 pUC19 등), 파지 (예: λgt4, λB, λ-Charon, λΔz1 및 M13 등) 또는 바이러스 (예: SV40 등)를 조작하여 제작될 수 있다.On the other hand, vectors that can be used in the present invention include plasmids often used in the art (e.g., pCA24N, pSC101, ColE1, pBR322, pUC8/9, pHC79, pGEX series, pET series and pUC19, etc.), phage (e.g., λgt4 , λB, λ-Charon, λΔz1 and M13, etc.) or a virus (eg, SV40, etc.).

본 발명의 벡터는 선택표지로서, 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함할 수 있으며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자가 있다.The vector of the present invention may contain an antibiotic resistance gene commonly used in the art as a selection marker, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin. And resistance genes for tetracycline.

본 발명의 벡터를 기주세포 내로 운반하는 방법은 CaCl₂ 방법(Cohen et al., 1973, Proc. Natl. Acac. Sci. USA 9: 2110-2114), 하나한 방법(Hanahan, 1983, Mol. Biol. 166: 557-580) 및 전기천공 방법(Dower et al., 1988, Nucleic. Acids Res. 16: 6127-6145) 등에 의해 실시될 수 있다.The method of transporting the vector of the present invention into host cells is the CaCl ₂ method (Cohen et al., 1973, Proc. Natl. Acac. Sci. USA 9: 2110-2114), Hanahan method (Hanahan, 1983, Mol. Biol). 166: 557-580) and the electroporation method (Dower et al., 1988, Nucleic. Acids Res. 16: 6127-6145).

본 발명의 일 구현 예에 따른 방법에서, 상기 항생제는 앰피실린일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the antibiotic may be ampicillin, but is not limited thereto.

본 발명의 일 구현 예에 따른 방법에서, 상기 세균은 대장균(Escherichia coli)일 수 있고, 바람직하게는 E. coli BW25113 또는 E. coli MG1655일 수 있으나, 이에 제한되지 않는다.In the method according to an embodiment of the present invention, the bacterium may be Escherichia coli , preferably E. coli BW25113 or E. coli MG1655, but is not limited thereto.

상기 조성물은 유효성분으로 서열번호 2의 아미노산 서열로 이루어진 YpdB 단백질 코딩 유전자를 포함하는 재조합 벡터를 함유하며, 상기 유전자를 미생물에 형질전환시킴으로써 YpdB 단백질 코딩 유전자가 결손된 돌연변이체의 경우, 고초균 유래의 휘발성 유기 화합물 처리시 세균의 운동성 회복 또는 항생제 감수성을 증가시킬 수 있는 것이다.
The composition is an active ingredient, YpdB protein coding consisting of the amino acid sequence of SEQ ID NO: 2 Contains a recombinant vector containing a gene, and encodes the YpdB protein by transforming the gene into a microorganism In the case of a mutant with a lack of a gene, treatment with a volatile organic compound derived from Bacillus bacillus can restore bacterial motility or increase antibiotic sensitivity.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

재료 및 방법Materials and methods

균주Strain

고초균 168, 대장균 MG1655 또는 BW25113을모 균주로 이용했다. 돌연변이 분석을 위해서는 게이오-컬렉션(Keio-collections)을 이용했다. 벼 알마름병균(B. glumae) BGR1, 녹농균(P. aeruginosa) PA14 또는 패니바실러스 폴리믹사(P. polymyxa) E681를 유주 운동성 검정에 이용했다.
Bacillus 168, Escherichia coli MG1655 or BW25113It was used as a parent strain. Keio-collections were used for mutation analysis. B. glumae BGR1, P. aeruginosa PA14 or P. polymyxa E681 was used for the migration motility assay.

화학물질chemical substance

고순도 개별 VOC(>99%)를 시그마-알드리치로부터 구매했다: 각 VOC는 하기의 두문자어와 같이 나타낸다: 3M1BOH (3-메틸-1-부탄올), IVA (이소발레르산), BD (2,3-부탄디올), 2,3-BD (2,3-부탄디온; 디아세틸), GA (글리옥실산; 디히드록시아세트산, 포르밀포름산 또는 옥소에탄산), 1PNOH (1-펜탄올), 및 2M1PAOL (2-메틸-1-프로판올).
High purity individual VOCs (>99%) were purchased from Sigma-Aldrich: each VOC is denoted by the following acronyms: 3M1BOH (3-methyl-1-butanol), IVA (isovaleric acid), BD (2,3- Butanediol), 2,3-BD (2,3-butanedione; diacetyl), GA (glyoxylic acid; dihydroxyacetic acid, formylformic acid or oxoethanic acid), 1PNOH (1-pentanol), and 2M1PAOL (2-methyl-1-propanol).

세포 배양 및 Cell culture and VOCVOC 의 노출Exposure of

플레이트 검정에서 대장균, 벼 알마름병균, 녹농균 또는 패니바실러스 폴리믹사에 대한 고초균 유래의 VOC의 영향에 대한 시험을 수행하기 위해, I-플레이트(Falcon, No. 351003)-매개성 검정을 이용했다. 상이한 배지 중에 고초균 또는 대장균 MG1655, BW25113, 벼 알마름병균, 녹농균 또는 패니바실러스 폴리믹사를 각각 접종함으로써 각 박테리아를 준비했다: 고초균 및 패니바실러스 폴리믹사에 대해서는, TSB(트립신처리 대두 브로쓰, Difco); 대장균 및 벼 알마름병균에 대해서는, LB 브로쓰; 녹농균에 대해서는, 영양물 브로쓰(NB)를 각각 이용했다. 추가로, 각 박테리아에 대한 배양 조건은 상이했다: 대장균, 고초균 및 녹농균은 37℃에서 16 내지 24시간 동안 배양한 반면, 벼 알마름병균 및 패니바실러스 폴리믹사는 30℃에서 24 내지 48시간 동안 배양했다. VOC 영향에 대한 추가 분석으로, 약 10⁵ 개 세포의 각 박테리아를 TSB-아가, LB-아가 또는 NB-아가 플레이트에 각각 도말했다. 모든 생장은 Ultrospec 2100 pro(AP Biotech)를 이용해 모니터링했다.
To carry out the test for the effect of VOCs derived from Bacillus bacillus on Escherichia coli, rice larvae, Pseudomonas aeruginosa or Panibacillus polymyxa in the plate assay, an I-plate (Falcon, No. 351003)-mediated assay was used . Each bacterium was prepared by inoculating Bacillus or Escherichia coli MG1655, BW25113, Pseudomonas aeruginosa, Pseudomonas aeruginosa or Panibacillus polymixa, respectively, in different media: TSB (trypsin-treated soybean broth, Difco) ; For Escherichia coli and rice larvae, LB broth; For Pseudomonas aeruginosa, nutrient broth (NB) was used, respectively. In addition, the culture conditions for each bacteria were different: E. coli, Bacillus aeruginosa and Pseudomonas aeruginosa were incubated at 37°C for 16 to 24 hours, while rice larvae and Panibacillus polymyx were incubated at 30°C for 24 to 48 hours. did. As a further analysis of VOC effects, approximately 10 ⁵ cells of each bacteria were plated on TSB-agar, LB-agar or NB-agar plates, respectively. All growth was monitored using Ultrospec 2100 pro (AP Biotech).

전사물Transcription 분석 analysis

2배 이상 또는 0.5배 이하의 발현 수준에서 VOC-의존성 차이를 나타내는 유전자들을 차별적으로 발현되는 유전자로 간주한 것을 제외하고, KRIBB Genome Encyclopedia of Microbes에 기재된 대장균 칩을 이용해 분석을 수행했다. 클러스터링 분석은 MeV (MultiExperiment Viewer)에 의해 수행했다.
The analysis was performed using the E. coli chip described in the KRIBB Genome Encyclopedia of Microbes, except that genes showing VOC-dependent differences at expression levels of 2 times or more or 0.5 times or less were regarded as differentially expressed genes. Clustering analysis was performed by MeV (MultiExperiment Viewer).

단일-카피 프로모터-Single-copy promoter- gfpgfp 융합의 구축 Construction of convergence

백본 플라스미드 pGEM-T-GFPCm의 제조는 3개의 연속적인 단계에서 수행했다. 먼저, GFP 영역을 pDSK-GFPuv로부터 프라이머 GFP-F(5'-AGTAAAGGAGAAGAACTTTTCACTGGAGTT-3' : 서열번호 3)를 이용해 증폭했다. 두번째로, 클로람페니콜(Cm) 카셋트 절편을 프라이머 GFP-P1-F(5'-CACATGGCATGGATGAGCTCTACAAAGTGTAGGCTGGAGCTGCTTC-3' : 서열번호 4)및 GFP-P2 (5'-ATGGGAATTAGCCATGGTCC-3' : 서열번호 5)를 이용해 증폭했다. 최종적으로, GFP-Cm 생성물을 융합 PCR 방법으로 제조한 후, PCR 생성물을 pGEM-T-easy 벡터(Promega)에 클로닝하여, 그 결과 pGEM-T-GFPCm를 수득했다. 염색체의 ycfR, aaeX 또는 hyaF 프로모터 융합은 pGEM-T-GFPCm 및 하기의 각 유전자에 대한 프라이머를 이용한 대장균 단일 유전자 넉아웃 방법으로 수행했다: ycfR-HL (5’-cttctgtaaccggtccgaataccctccatggaacagcagtaatttataaaagtaaaggagaagaacttttcactggagttg-3’: 서열번호 6), ycfR-HR (5'-gcatgtcgcggggaaaaaatcagcagtagcaggcattaat gagggttaatatgggaattagccatggtcc-3' : 서열번호 7), aaeX-HL (5’-acaccgcgctctattgctgcttgttttatttgatatcgcgactgttcgttagtaaaggagaagaacttttcactggagttg-3': 서열번호 8), aaeX-HR (5'-ccgtgatggccgtacgggagaattttcttattagtgttttcacttcaaccatgggaattagccatggtcc-3': 서열번호 9), hyaF-HL (5'-cgcagcggcttagcgaggtatgtcagtggctggcggaagctgcaccgacgagtaaaggagaagaacttttcactggagttg-3': 서열번호 10) 또는 hyaF-HR (5'-attcgccgattgcgatattcataagactgaaagcgatacttaccgtctttatgggaattagccatggtcc-3' : 서열번호 11). 구축은 유전자 특이적 프라이머 ycfR-192-F (5'-atcacctccgttcaccagtc-3': 서열번호 12, aaeX-76-F (5'-agagaagggcatggaaagc-3': 서열번호 13)또는 hyaF-181-F (5'-aactgtcatcgttcggttgc-3': 서열번호 14), 또는 유니버설 프라이머 GFP-R (5'-tttgtagagctcatccatgccatgtg-3': 서열번호 15)에 의해 확인했다.
The preparation of the backbone plasmid pGEM-T-GFPCm was carried out in three successive steps. First, the GFP region was amplified from pDSK-GFPuv using primer GFP-F (5'-AGTAAAGGAGAAGAACTTTTCACTGGAGTT-3': SEQ ID NO: 3). Second, the chloramphenicol (Cm) cassette fragment was amplified using primers GFP-P1-F (5'-CACATGGCATGGATGAGCTCTACAAAGTGTAGGCTGGAGCTGCTTC-3': SEQ ID NO: 4) and GFP-P2 (5'-ATGGGAATTAGCCATGGTCC-3': SEQ ID NO: 5). . Finally, the GFP-Cm product was prepared by a fusion PCR method, and then the PCR product was cloned into a pGEM-T-easy vector (Promega), and as a result, pGEM-T-GFPCm was obtained. The fusion of the ycfR , aaeX or hyaF promoter of the chromosome was carried out by a single gene knockout method in E. coli using pGEM-T-GFPCm and primers for each of the following genes: ycfR -HL (5'-cttctgtaaccggtccgaataccctccatggaacagcagtaatttataaaagtaaaggagaactttt: sequence number 6 ), ycfR -HR (5'-gcatgtcgcggggaaaaaatcagcagtagcaggcattaat gagggttaatatgggaattagccatggtcc-3 ': SEQ ID NO: 7), aaeX -HL (5'- acaccgcgctctattgctgcttgttttatttgatatcgcgactgttcgttagtaaaggagaagaacttttcactggagttg-3': SEQ ID NO: 8), aaeX -HR (5'- ccgtgatggccgtacgggagaattttcttattagtgttttcacttcaaccatgggaattagccatggtcc-3 ': SEQ ID NO: 9), hyaF -HL (5'-cgcagcggcttagcgaggtatgtcagtggctggcggaagctgcaccgacgagtaaaggagaagaacttttcactggagttg-3': SEQ ID NO: 10) or hyaF -HR (5'-attcgccgattgcgatattggattaccactgaaagcgatacttactgaaagcgatacttactggt. Construction is a gene-specific primer ycfR -192-F (5'-atcacctccgttcaccagtc-3': SEQ ID NO: 12, aaeX -76-F (5'-agagaagggcatggaaagc-3': SEQ ID NO: 13) or hyaF -181-F (5 It was confirmed by'-aactgtcatcgttcggttgc-3': SEQ ID NO: 14) or universal primer GFP-R (5'-tttgtagagctcatccatgccatgtg-3': SEQ ID NO: 15).

VOCVOC 표현형을 조절하는 전사 인자들의 동정 Identification of transcription factors that regulate phenotype

VOC에 의해 영향받는 전사-조절 인자들의 스크리닝을 대장균의 형광 전사 리포터의 라이브러리(Open Biosystems)를 이용해 수행했다. EcoCyc 및 마이크로어레이 데이터의 두가지 모두에서 용어 "전사 인자 또는 DNA 결합 전사 조절자"를 이용함으로써 60가지의 이용가능한 리포터 유전자가 선별되었다(데이터 미제시). 개별 전사 리포터를 포함하는 대장균 세포의 밤새 배양물을 14시간 동안 37℃에서의 2,3-BD 또는 GA (최종적으로 1μM)의 증발 조건에서의 96-웰 플레이트 상에 카나마이신(50㎍/mL)을 포함하는 신선한 LB 배지 (1/100 희석)에 접종했다. 프로모터 활성을 2104 EnVision 멀티라벨 플레이트 검독기(PerkinElmer)를 이용해 모니터링하고 분석했다. 리포터 시스템의 대조군 벡터에 대해 정규화된 프로모터 활성(형광/OD₆₀₀)을 3회 반복 실험으로부터 모든 64개 유전자에 대해 분석했다(n=3, P=0.05).
Screening of transcription-regulatory factors affected by VOC was performed using a library of E. coli fluorescent transcription reporters (Open Biosystems). Sixty available reporter genes were selected by using the term “transcription factor or DNA binding transcriptional regulator” in both the EcoCyc and microarray data (data not shown). An overnight culture of E. coli cells containing individual transcription reporters kanamycin (50 μg/mL) on a 96-well plate under evaporation conditions of 2,3-BD or GA (finally 1 μM) at 37° C. for 14 hours. It was inoculated in fresh LB medium (1/100 dilution) containing. Promoter activity was monitored and analyzed using a 2104 EnVision multilabel plate reader (PerkinElmer). _{Promoter activity (fluorescence/OD 600} ) normalized to the control vector of the reporter system was analyzed for all 64 genes from 3 replicate experiments (n=3, P=0.05).

수영 및 유주 운동성 검정Swimming and running motility test

수영 운동성 검정을 위해, TSB 아가 또는 LB-아가 (0.3%) 플레이트를 I-플레이트의 각 측면에서 따로따로 제조했다. 고초균 또는 대장균(약 10⁵ 세포)을 TSB 아가 또는 LB 아가 플레이트에 각각 도말한 후, 37℃에서 12시간 동안 인큐베이션하고, 결과를 촬영했다. 유주 운동성은 플레이트 상의 수용자 박테리아의 생장을 위해 상이한 레시피를 이용해 수행했다: LB 아가 (LB 브로쓰+0.5% 아가+0.5% 글루코오스)는 대장균 및 벼 알마름병균을 위한 것이었고; NB 아가 (NB 브로쓰+0.5% 아가+0.5% 글루코오스)는 녹농균을 위한 것이었고; TSB-아가 (TSB+0.9% 아가)는 고초균 및 패니바실러스 폴리믹사를 위한 것이었다. 검정을 위해 고초균(약 10⁵) 세포를 TSB-아가 상에 도말하고, 각 박테리아를 상기 기재된 종-특이적 아가 상에 접종했다. 플레이트를 30℃ 또는 37℃에서 12 내지 48시간 동안 인큐베이션하고 촬영했다. 개별 기상 VOC의 영향을 살펴보기 위해, 특정 농도(각각의 도면의 설명에 표기)인 표시 농도의 2,3-BD 또는 GA 용액을 방출자 고초균 세포 대신 TSB 아가 플레이트 상에 점적했다.
For swimming motility assays, TSB agar or LB-agar (0.3%) plates were prepared separately on each side of the I-plate. Bacillus or Escherichia coli (about 10 ⁵ cells) were plated on TSB agar or LB agar plate, respectively, and then incubated at 37°C for 12 hours, and the results were photographed. Migratory motility was performed using different recipes for the growth of recipient bacteria on the plate: LB agar (LB broth+0.5% agar+0.5% glucose) was for E. coli and rice rot; NB agar (NB broth+0.5% agar+0.5% glucose) was for Pseudomonas aeruginosa; TSB-Agar (TSB+0.9% Agar) was for Bacillus Bacillus and Panibacillus polymyxa. For the assay, Bacillus (about 10 ⁵ ) cells were plated on TSB-agar, and each bacteria was inoculated on the species-specific agar described above. Plates were incubated at 30° C. or 37° C. for 12 to 48 hours and photographed. In order to examine the effect of individual gaseous VOCs, a 2,3-BD or GA solution at the indicated concentration at a specific concentration (indicated in the description of each figure) was instilled on TSB agar plates instead of emitter Bacillus cells.

VOCVOC 처리에 의한 항생제 내성의 스크리닝 Screening for antibiotic resistance by treatment

VOC 처리에 의해 내성 표현형을 나타내는 항생제를 동정하기 위해, 대장균 세포를 PM 분석에 적용했다(PM 플레이트 No. 11-20). 대장균 MG1655 세포를 고초균(약 10⁵ 세포) 유래의 전체 VOC의 존재 또는 부재 하에 16시간 동안 37℃에서 처리했다. 결과로서 수득한 세포를 긁어내어, PM 배지 중에 OD₆₀₀=0.3 가 되도록 희석하고, PM에 의한 분석에 24시간 동안 37℃에서 적용시켰다.
In order to identify antibiotics exhibiting a resistance phenotype by VOC treatment, E. coli cells were subjected to PM analysis (PM plate No. 11-20). E. coli MG1655 cells were treated at 37° C. for 16 hours in the presence or absence of total VOCs derived from ^{Bacillus bacillus (about 10 5 cells).} The resulting cells were scraped off, _{diluted to an OD 600} =0.3 in PM medium, and subjected to analysis by PM at 37° C. for 24 hours.

항생제 내성 검정Antibiotic resistance test

앰피실린 및 테트라사이클린 항생제 두가지 모두에 대한 VOC-매개성 내성을 확인하기 위해, 고초균 유래의 VOC의 증발 존재 또는 부재 하의 대장균 세포를 I-플레이트에서 12시간 동안 배양했다. 세포를 긁어모아 수합하고, LB 브로쓰 중에 OD₆₀₀=0.1 이 되도록 희석했다. 앰피실린(100㎍/mL) 또는 테트라사이클린(10㎍/mL)을 배양물에 첨가하고, 추가로 격렬한 교반과 함께 3시간 동안 37℃에서 생장시켰다. 배양물의 분획을 LB 플레이트에 도말하고, LB 플레이트 상의 콜로니를 계수하여 생존 비율을 결정했다. VOC-처리 및 비-VOC 처리의 생존 비율을 3회 반복 실험에서 비교했다(n=3, P=0.05).
To confirm VOC-mediated resistance to both ampicillin and tetracycline antibiotics, E. coli cells with or without evaporation of VOCs derived from Bacillus bacillus were cultured in I-plates for 12 hours. The cells were collected by scraping and diluted so that _{OD 600 =0.1 in LB broth.} Ampicillin (100 μg/mL) or tetracycline (10 μg/mL) was added to the culture and further grown at 37° C. for 3 hours with vigorous stirring. Fractions of the culture were plated on an LB plate, and colonies on the LB plate were counted to determine the survival rate. The survival rates of VOC-treated and non-VOC treated were compared in 3 replicate experiments (n=3, P=0.05).

정량적 Quantitative RTRT -- PCRPCR ( ( RTRT -- qPCRqPCR ))

대장균 유래의 전체 RNA를 제조사의 프로토콜에 따라 RNeasy plus mini kit(Qiagen)를 이용해 제조했다. cDNA 합성은 다음과 같이 수행했다: 전체 RNA(0.5㎍)를 ReverTraAce

qPCR RT Master Mix with gDNA Remover(Toyobo) 를 이용한 역전사(RT) 반응을 위한 주형으로 이용했다. CFX 커넥터 실시간 qPCR 시스템(Bio-Rad)을 qRT-PCR에 이용했다. 반응 혼합물은 cDNA, IQ^TM SYBR®Green Supermix(Bio-Rad) 및, 하기 표 1에 열거된 1 pM의 각 프라이머로 이루어졌다. PCR 파라미터는 다음과 같았다: 최초 폴리머라아제 활성화, 3분간 95℃, 이어서 40회 순환하여 10초간 95℃, 10초간 60℃ 및 30초간 72℃. 조건은 일련의 희석된 RT 생성물, 이어서 비-RT 주형 대조군 및 각 프라이머쌍에 대한 비-주형 대조군 중에서의 역치 값을 비교하여 결정했다. 상대적인 RNA 수준을 보정하고, rrsB(16s rDNA) RNA의 수준에 대해 정규화했다.Total RNA derived from E. coli was prepared using RNeasy plus mini kit (Qiagen) according to the manufacturer's protocol. cDNA synthesis was carried out as follows: total RNA (0.5 μg) was transferred to ReverTraAce

It was used as a template for reverse transcription (RT) reaction using qPCR RT Master Mix with gDNA Remover (Toyobo). The CFX connector real-time qPCR system (Bio-Rad) was used for qRT-PCR. The reaction mixture consisted of cDNA, IQ ^™ SYBR® Green Supermix (Bio-Rad), and 1 pM of each primer listed in Table 1 below. PCR parameters were as follows: initial polymerase activation, 95° C. for 3 minutes, followed by 40 cycles to 95° C. for 10 seconds, 60° C. for 10 seconds, and 72° C. for 30 seconds. Conditions were determined by comparing the threshold values among a series of diluted RT products followed by a non-RT template control and a non-template control for each primer pair. Relative RNA levels were corrected and normalized to the level of rrsB (16s rDNA) RNA.

PrimerPrimer Sequence (5'to 3')(서열번호)Sequence (5'to 3') (SEQ ID NO) Q-cheA_LQ-cheA_L CCTTGCTGGTGGATCAATT(16)CCTTGCTGGTGGATCAATT(16) Q-cheA_RQ-cheA_R GGGACTTTGCGATAGTTACTT(17)GGGACTTTGCGATAGTTACTT(17) Q-cheW_LQ-cheW_L ACCCTTGGTGATGAAGAGTA(18)ACCCTTGGTGATGAAGAGTA(18) Q-cheW_RQ-cheW_R CCTGGCTGAACTTAATTCGTA(19)CCTGGCTGAACTTAATTCGTA(19) Q-cysS_LQ-cysS_L CAAATCGCTGGGTAACTTCT(20)CAAATCGCTGGGTAACTTCT(20) Q-cysS_RQ-cysS_R AGGTTCTCTTCGCTGTAGT(21)AGGTTCTCTTCGCTGTAGT(21) Q-dppD_LQ-dppD_L CGGTAAGTCGGTCAGTTCA(22)CGGTAAGTCGGTCAGTTCA(22) Q-dppD_RQ-dppD_R GTCATCGGGTCCTGGAAG(23)GTCATCGGGTCCTGGAAG(23) Q_flgG_LQ_flgG_L GTCAGCGTAACCCAACAA(24)GTCAGCGTAACCCAACAA(24) Q_flgG_RQ_flgG_R ACCAGAGGATTGCGTTTC(25)ACCAGAGGATTGCGTTTC(25) Q_fliA_LQ_fliA_L TATTAACCCTCTATTACCAGGAAGA(26)TATTAACCCTCTATTACCAGGAAGA(26) Q_fliA_RQ_fliA_R TGGCTGTGTAACTGACTGA(27)TGGCTGTGTAACTGACTGA(27) Q_fliM_LQ_fliM_L CCTCAACGGTCAGTATGC(28)CCTCAACGGTCAGTATGC(28) Q_fliM-RQ_fliM-R TCATTTGGGCTGTTCCTC(29)TCATTTGGGCTGTTCCTC(29) Q-gabP_LQ-gabP_L TTGTGTTGGTAGTGATGCTATT(30)TTGTGTTGGTAGTGATGCTATT(30) Q-gabP_RQ-gabP_R ACAGATAATCCCTATCGCTAATAAG(31)ACAGATAATCCCTATCGCTAATAAG(31) Q-glpT_LQ-glpT_L ACTGGTCACCGACTTATCT(32)ACTGGTCACCGACTTATCT(32) Q-glpT_RQ-glpT_R GAAGACTTTATCCGACATCCA(33)GAAGACTTTATCCGACATCCA(33) Q-hipA_LQ-hipA_L AATACCCGAAGACGAAACC(34)AATACCCGAAGACGAAACC(34) Q-hipA_RQ-hipA_R CAACCGAGATGCGAAAGT(35)CAACCGAGATGCGAAAGT(35) Q-hipB-FQ-hipB-F ATTAAGCAGGCGACGATTTC(36)ATTAAGCAGGCGACGATTTC(36) Q-hipB-RQ-hipB-R GTCGCATAGCGTCATTGAGA(37)GTCGCATAGCGTCATTGAGA(37) Q-malE_LQ-malE_L TATAACGGTCTCGCTGAAGT(38)TATAACGGTCTCGCTGAAGT(38) Q-malE_RQ-malE_R GCAACCTGTGGGAATTTCT(39)GCAACCTGTGGGAATTTCT(39) Q-motA_LQ-motA_L CCCCATTAGCGACTGTTTT(40)CCCCATTAGCGACTGTTTT(40) Q-motA_RQ-motA_R CAGATTAGAAAGCAGAGTGACT(41)CAGATTAGAAAGCAGAGTGACT(41) Q-puuA_LQ-puuA_L CGCTTCTGCCATGTCTATC(42)CGCTTCTGCCATGTCTATC(42) Q-puuA-RQ-puuA-R CAATTTCTGTTTCTGTGATGAGG(43)CAATTTCTGTTTCTGTGATGAGG(43) Q-puuE_LQ-puuE_L TTCCATCAGCGTCGTCTT(44)TTCCATCAGCGTCGTCTT(44) Q-puuE_RQ-puuE_R TGCCCTCAACATCCTTCA(45)TGCCCTCAACATCCTTCA(45) Q-relB_LQ-relB_L AAATGGGTGTAACTCCTTCTG(46)AAATGGGTGTAACTCCTTCTG(46) Q-relB_RQ-relB_R AAGCCGTTCTTTCACTATCTC(47)AAGCCGTTCTTTCACTATCTC(47) Q-rrsB_LQ-rrsB_L CACGGTCCAGACTCCTAC(48)CACGGTCCAGACTCCTAC(48) Q-rrsB_RQ-rrsB_R TAACTTTACTCCCTTCCTCCC(49)TAACTTTACTCCCTTCCTCCC(49) Q-tgt_LQ-tgt_L CTCAACACCATTCATAACCTT(50)CTCAACACCATTCATAACCTT(50) Q-tgt_RQ-tgt_R CTCTCTAATTTACCCTCTTCAA(51)CTCTCTAATTTACCCTCTTCAA(51) Q-yefM_LQ-yefM_L ATCCTTATTACTCGTCAGAATGG(52)ATCCTTATTACTCGTCAGAATGG(52) Q-yefM-RQ-yefM-R GCAGTAGATAAGCCGTCTC(53)GCAGTAGATAAGCCGTCTC(53) Q-ycfR_LQ-ycfR_L TGCGGCGATTTTAAGCTCCA(54)TGCGGCGATTTTAAGCTCCA(54) Q-ycfR-RQ-ycfR-R ATTTTGCGCCCATCTCATCC(55)ATTTTGCGCCCATCTCATCC(55) Q-aaeX_LQ-aaeX_L TCCCGTTATCGTGGTGTTTGG(56)TCCCGTTATCGTGGTGTTTGG(56) Q-aaeX-RQ-aaeX-R GCAATAGAGCGCGGTGTTGAA(57)GCAATAGAGCGCGGTGTTGAA(57) Q-hyaF_LQ-hyaF_L TGATGGCCTGATGAATGGCCTACC(58)TGATGGCCTGATGAATGGCCTACC(58) Q-hyaF_RQ-hyaF_R AATATTTCCCGGCCCACAGAGACG(59)AATATTTCCCGGCCCACAGAGACG(59) Q-ypdB_FQ-ypdB_F cgaagcgcacgagaaaatga(60)cgaagcgcacgagaaaatga(60) Q-ypdB_RQ-ypdB_R cacggttcgatttcgcgtattt(61)cacggttcgatttcgcgtattt(61) Q-yjhU_FQ-yjhU_F TACAGGCAGAGCCTATTATTCGAT(62)TACAGGCAGAGCCTATTATTCGAT(62) Q-yjhU_RQ-yjhU_R ATAGAAGCGACCACAAATGACAC(63)ATAGAAGCGACCACAAATGACAC(63) Q-soxS_FQ-soxS_F CAGGCTATTCAAAGTGGTACTTGC(64)CAGGCTATTCAAAGTGGTACTTGC(64) Q-soxS_RQ-soxS_R GAGACATAACCCAGGTCCATTG(65)GAGACATAACCCAGGTCCATTG(65) Q-rpoS_FQ-rpoS_F GCAGAGCATCGTCAAATGGCTGTT(66)GCAGAGCATCGTCAAATGGCTGTT(66) Q-rpoS_RQ-rpoS_R ATCTTCCAGTGTTGCCGCTTCGTA(67)ATCTTCCAGTGTTGCCGCTTCGTA(67)

통계적 분석Statistical analysis

통계적 분석은 류 등의 방법에 기재된 바와 같이 JMP 소프트웨어를 이용해 수행했다(Ryu, C. M. et al. Plant Physiol. 134, 1017-1026 (2004)). 오차 막대는 모든 데이터 분석에서 s.e.m.로 정했다.
Statistical analysis was performed using JMP software as described in the method of Ryu et al. (Ryu, CM et al. Plant Physiol. 134, 1017-1026 (2004)). Error bars were set as sem for all data analysis.

실시예Example 1. 고초균 1. Bacillus bacillus VOCVOC 가 대장균 유전자의 발현을 변경시킨다Alters the expression of the E. coli gene ..

종간 상호작용에서의 박테리아 대사물에 의해 유도되는 표현형 개질에 내재하는 메커니즘을 조사하기 위해 모델 시스템을 고안했다. 고초균 168및 대장균 K12 균주들을 각각 방출자 및 수용자 박테리아로 이용했다. 고초균은 항생제 및 VOC를 포함하는 확산성의 2차 대사물을 생성하는 것으로 공지되어 있다. 상기 생성물들은 광범위한 병원체에 대항하는 선천적 면역성을 이끌어냄으로써 식물 자가-방어에 영향을 줄 수 있다.A model system was devised to investigate the mechanisms underlying phenotypic modification induced by bacterial metabolites in interspecies interactions. Bacillus Bacillus 168And E. coli K12 strains were used as emitter and recipient bacteria, respectively. Bacillus bacillus is known to produce diffuse secondary metabolites including antibiotics and VOCs. These products can affect plant self-defense by eliciting innate immunity against a wide range of pathogens.

고초균에 의해 생성된 VOC가 특정 대장균 유전자의 발현 프로파일 및 기능을 조절한다는 가설을 세웠다. 박테리아의 동시다발적인 생장을 위해 2-구획 Petri 플레이트 (I-플레이트) 검정을 이용했다(도 1a). 상기 시스템에서, LB-아가 상에서 생장시킨 대장균을 종간 접촉없이 트립신-처리 대두 브로쓰(TSB)-아가 상에서 고초균 168 세포 현탁액 유래의 고초균 VOC에 노출시켰다. 대장균 세포를 다양한 노출 기간(6, 12 및 24시간) 후 수합하고, 대장균 유전자 발현의 전사 프로파일 조사를 4440가지의 ORF의 마이크로어레이 분석을 이용해 수행했다. 그러한 6, 12 및 24시간 처리는 각각 137, 569 및 93개 유전자의 상이한 발현(3배를 초과하는 변화)을 나타냈다(데이터 미제시). 흥미롭게도, 유전자 발현에서의 최대 변화는 고초균 VOC에 대한 노출 12시간 후 일어났다. 고초균 VOC에 대한 상기 유전자들의 응답성을 확인하기 위해, 마이크로어레이 분석으로 동정된 상위 50개 유전자들 중 세가지(ycfR, aaeX 및 hyaF)를 추가 분석용으로 선별했다. 유전자 발현은 RT-qPCR로 시험했고, 예상한 바와 같이 모든 세 유전자가 고초균 VOC의 존재 하에 증가되는 발현을 나타냈으며(도 1b), ycfR가 최대 변화를 나타냈다. Gene Ontology (GO) 웹사이트 툴 또는 KEGG (Kyoto Encyclopedia of Genes and Genomes) 정보를 이용해 추가 분석을 수행했다. 강력하게 영향받는 유전자들은 운동성, 펩티드 수송, 독소-항독소(TA) 시스템, 단백질 합성, 폴리아민 대사 및 당 수송과 같은 기능 군들로 묶었다 (도 1c). 마이크로어레이 데이터를 입증하기 위해, 2가지 상이한 전사물을 각 군으로부터 선별하고, 발현 프로파일을 RT-qPCR로 결정했다. 상기 데이터는 마이크로어레이의 GO 패턴에 가깝게 맞아떨어졌다(도 1d). 따라서, 마이크로어레이 결과는 고초균 VOC에 의해 조절되는 대장균 유전자를 동정했고, 그들의 기능적 클러스터는 상기 수용자의 생리학적 응답에 내재하는 메커니즘에 대한 실마리를 제공할 수 있다.
It was hypothesized that VOCs produced by Bacillus Bacillus regulate the expression profile and function of certain E. coli genes. A two-compartment Petri plate (I-plate) assay was used for simultaneous growth of bacteria (Fig. 1A). In this system, E. coli grown on LB-agar was exposed to Bacillus VOC from Bacillus 168 cell suspension on trypsin-treated soybean broth (TSB)-agar without interspecies contact. E. coli cells were harvested after various exposure periods (6, 12 and 24 hours), and the transcription profile investigation of E. coli gene expression was performed using microarray analysis of 4440 ORFs. Such 6, 12 and 24 hour treatments resulted in different expressions (>3-fold change) of 137, 569 and 93 genes, respectively (data not shown). Interestingly, the maximal change in gene expression occurred 12 hours after exposure to Bacillus VOCs. In order to confirm the response of the genes to Bacillus VOC, three of the top 50 genes identified by microarray analysis ( ycfR , aaeX, and hyaF ) were selected for further analysis. Gene expression was tested by RT-qPCR, and as expected, all three genes showed increased expression in the presence of Bacillus VOC (Fig. 1b), and ycfR showed the greatest change. Further analysis was performed using the Gene Ontology (GO) website tool or KEGG (Kyoto Encyclopedia of Genes and Genomes) information. Strongly affected genes were grouped into functional groups such as motility, peptide transport, toxin-antitoxin (TA) system, protein synthesis, polyamine metabolism, and sugar transport (Fig. 1c). To verify the microarray data, two different transcripts were selected from each group and the expression profile was determined by RT-qPCR. The data fit closely to the GO pattern of the microarray (Fig. 1D). Thus, microarray results have identified E. coli genes regulated by Bacillus VOCs, and their functional clusters can provide clues about the mechanisms underlying the physiological responses of the recipients.

실시예Example 2. 2. VOCVOC 는 운동성-관련 유전자의 발현을 변화시킨다Alters the expression of motility-related genes ..

마이크로어레이 데이터로부터, VOC 처리가 대장균의 주화성 또는 운동성 표현형과 연관된 모든 30가지 유전자의 발현을 감소시켰다. 특히, 운동성-관련 유전자는 VOC-매개성 생리학적 변화와 연관된 주된 클러스터들 중 하나이다(도 1d). 일부 운동성 유전자들(motA, cheA, cheW, 및 fliA)의 발현의 RT-qPCR를 이용한 조사는 추가로 마이크로어레이 데이터를 확인시켜줬다(도 2a). 운동성 표현형과 상관성이 있는 유전자 발현의 변화를 밝혀내기 위해, VOC-처리 대장균 세포의 수영 및 유주 능력을 측정했다. 수영(swimming) 및 유주(swarming) 능력은 각각 32% 또는 약 60% 감소되었다(도 2b 및 도 2c). 표현형이 대장균으로 제한되는지 또는 여타 박테리아 종들의 일반적인 형질로 제한되는지 여부를 조사하기 위해, 고초균의 VOC를 벼 알마름병균(Burkholderia glumae) BGR1 및 녹농균 PA14와 같은 여타 그람-음성 박테리아 및 그람-양성 박테리아 패니바실러스 폴리믹사(Paenibacillus polymyxa) E681에 처리하고, 운동성 표현형의 대표값으로서 각 수용자 박테리아의 유주 운동성을 측정했다. 도 2d에 제시한 바와 같이, 시험한 모든 종들에 대한 유주 운동성은 VOC에 의해 감소되어, VOC가 박테리아 운동성을 변경시키는 일반적인 신호전달 분자라는 점을 시사했다. 유주 능력이 수영 능력보다도 VOC에 의해 더욱 강력하게 영향받는 것으로 나타났기 때문에, 그 활성에 대한 변화를 더욱더 상세히 시험했다. From the microarray data, VOC treatment reduced the expression of all 30 genes associated with the chemotactic or motility phenotype of E. coli. In particular, motility-related genes are one of the main clusters associated with VOC-mediated physiological changes (Fig. 1D). Investigation using RT-qPCR of the expression of some motility genes ( motA , cheA , cheW , and fliA ) further confirmed microarray data (FIG. 2A). To uncover changes in gene expression correlated with the motility phenotype, the swimming and migration ability of VOC-treated E. coli cells was measured. The swimming and swarming abilities were reduced by 32% or about 60%, respectively (FIGS. 2B and 2C). To investigate whether the phenotype is restricted to E. coli or to a common trait of other bacterial species, VOCs from Bacillus Bacillus were used as Burkholderia (Burkholderia). glumae ) BGR1 and other Gram-negative bacteria such as Pseudomonas aeruginosa PA14 and Gram-positive bacteria Paenibacillus polymyxa ) E681 was treated, and migration motility of each recipient bacteria was measured as a representative value of the motility phenotype. As shown in Figure 2d, migratory motility for all species tested was reduced by VOC, suggesting that VOC is a general signaling molecule that alters bacterial motility. Since the ability to run was found to be more strongly influenced by VOCs than by the ability to swim, the change in its activity was tested in more detail.

상기 현상이 조절되는 방법을 이해하기 위해, 해당 표현형에 영향을 주는 유전자(들)의 동정이 필요하다. 따라서, 대장균 유전자의 돌연변이 라이브러리의 스크리닝을 적용하여 유주 운동성에 대한 VOC의 영향을 평가했다. 게이오 컬렉션이 균주 대장균 BW25113으로부터 개발되었고, 상이한 대장균 균주들이 상이한 운동성을 나타냈기 때문에, MG1655를 이용했을 경우 표현형들의 유주 운동성에 대한 VOC의 영향력은 대장균의 일반적인 표현형으로서 제시되는 BW25113을 이용했을 경우와 비교해야 할 필요가 있다. VOC에 대한 노출은, 유주 운동성에서 MG1655을 이용했을 경우와 마찬가지로 대장균 BW25113을 이용했을 경우 현저한 감소를 초래하여(도 2e), 그 영향력이 대장균의 일반적인 표현형임을 시사했다. 따라서, BW25113 백그라운드 세포가 추가로 도 2e에서 시험한 운동성-관련 유전자를 밝혀내기 위해 이용되었다. motA, cheA, cheW 및 fliA의 돌연변이는 세포를 VOC에 노출시켰을 때 운동성 변화를 나타내지 않아, 이들이 유주 능력에 필수적이라는 점을 시사했다(데이터 미제시). 유주 능력에서의 VOC-매개성 변화를 담당할 가능성이 있는 조절 유전자(들)을 밝혀내기 위해, 게이오 컬렉션 유래의 돌연변이를 스크리닝하여 VOC 처리의 존재 또는 부재 하에 유주 운동성에서 현저한 변화를 보이지 않은 VOC-매개성 유전자의 넉아웃을 밝혀냈다. 5가지 돌연변이(ybgL, ybjL, ypdB, ykgH 및 yfbK)를 밝혀냈다(도 2f, 표 1). 상기 데이터는 VOC가 아직까지 규명되지 않은 운동성-관련 유전자를 통해 대장균 운동성에 영향을 준다는 점을 시사한다.In order to understand how this phenomenon is regulated, it is necessary to identify the gene(s) that influence the phenotype. Therefore, screening of a mutant library of E. coli genes was applied to evaluate the effect of VOC on migratory motility. Since the Keio collection was developed from the strain E. coli BW25113, and different E. coli strains showed different motility, the effect of VOC on the migration motility of phenotypes when using MG1655 was compared with the case of using BW25113, which is presented as a general phenotype of E. coli. You need to do it. Exposure to VOC caused a remarkable decrease when E. coli BW25113 was used in the same manner as when MG1655 was used in migratory motility (Fig. 2e), suggesting that the influence is a general phenotype of E. coli. Thus, BW25113 background cells were used to further reveal the motility-related genes tested in FIG. 2E. Mutations of motA , che A, cheW and fliA did not show a change in motility when cells were exposed to VOCs, suggesting that they were essential for migration ability (data not shown). To identify the regulatory gene(s) likely to be responsible for VOC-mediated changes in migratory capacity, mutations from the Keio collection were screened to show no significant change in migratory motility in the presence or absence of VOC treatment. The knockout of the mediating gene was revealed. Five mutations ( ybgL , ybjL , ypdB , ykgH and yfbK ) were identified (Fig. 2F, Table 1). These data suggest that VOCs influence E. coli motility through motility-related genes that have not yet been identified.

실시예Example 3. 항생제 내성 표현형은 3. The antibiotic resistance phenotype is TATA 유전자에 의해 By genes 매개된다Mediated . .

마이크로어레이 데이터로부터, 27가지 상이한 TA-관련 모듈이 VOC에 의해 상향조절되었다(데이터 미제시). 특히, 독소 relE(5.9-배), yafQ(7.8-배) 및 yoeB(6.8-배)가 영속자 세포(persister cell)에서 강력하게 유도되었다. 대표적인 TA 시스템인 hipBA를 이용한 대장균의 정상 배양이 치사량 농도의 항생제로 처리 후에도 생존하는 박테리아의 하위집단(정상 상태에서 약 1%)을 나타냈다는 점이 공지되어 있다(Lewis, K. In Bacterial Biofilms. (ed. Romeo, T.) 107-131 (Springer-Verlag, Berlin, Germany, 2008)). 본 발명에서 고초균 VOC가 다중약물 내성을 조절할 수도 있다는 가설을 세웠다. 우선, 영속자 세포에 대한 VOC 처리의 영향을 240가지 시판 항생제에 대한 감수성에 대해 분석했다. 그러한 목적을 위해, 상이한 세포 표현형의 사전배치된 웰 어레이를 이용한 다수 세포 표현형의 동시적인 시험을 위한 고속 기술인 Phenotype Microarray®(PM) 기법 및 어레이의 모든 웰에서의 세포의 응답을 모니터링/기록하는 자동화된 기기를 이용했다(Bochner et al. 2001 Genome Res. 11, 1246-1255). 대장균의 상이한 항생제에 대한 감수성에 대한 고초균 VOC의 영향은 다양했다. VOC가 PM11-20 플레이트에 노출된 박테리아 세포에 현격한 영향을 발휘하긴 하지만, 이들은 시험한 모든 항생제에 대한 내성을 개선시키지는 않았다(도 3a).From microarray data, 27 different TA-related modules were upregulated by VOC (data not shown). In particular, the toxins relE (5.9-fold), yafQ (7.8-fold) and yoeB (6.8-fold) were strongly induced in persister cells. It is known that normal culture of E. coli using hipBA , a representative TA system, showed a subgroup of bacteria (about 1% in normal state) that survived even after treatment with a lethal dose concentration of antibiotics (Lewis, K. In Bacterial Biofilms.(Lewis, K. In Bacterial Biofilms.(Lewis, K. In Bacterial Biofilms.(Lewis, K. In Bacterial Biofilms. ed. Romeo, T.) 107-131 (Springer-Verlag, Berlin, Germany, 2008)). In the present invention, it was hypothesized that Bacillus VOC may control multidrug resistance. First, the effect of VOC treatment on persistent cells was analyzed for susceptibility to 240 commercially available antibiotics. For that purpose, the Phenotype Microarray® (PM) technique, a high-speed technique for simultaneous testing of multiple cell phenotypes using pre-positioned well arrays of different cell phenotypes, and automation of monitoring/recording the responses of cells in all wells of the array. (Bochner et al. 2001 Genome Res. 11, 1246-1255). The effects of Bacillus VOC on the sensitivity of E. coli to different antibiotics were varied. Although VOCs exert a marked effect on bacterial cells exposed to PM11-20 plates, they did not improve resistance to all antibiotics tested (FIG. 3A ).

RA(Respiration Area) > +100 또는 < -100인 13가지 항생제를 PM12 플레이트로부터 동정해내고, 대장균 세포가 10가지 항생제에 대해서는 내성을, 3가지 항생제에 대해서는 감수성을 나타냈다(표 3). 13 antibiotics with RA (Respiration Area)> +100 or <-100 were identified from the PM12 plate, and E. coli cells showed resistance to 10 antibiotics and susceptibility to 3 antibiotics (Table 3).

계열line 항생제Antibiotic RARA CephalosporinCephalosporin CefazolinCefazolin 201201 CefriaxoneCefriaxone 129129 CephalothinCephalothin 178178 CefuroximeCefuroxime -181-181 MoxalactamMoxalactam -282-282 Ampicillin/Penicillin GAmpicillin/Penicillin G Penicillin GPenicillin G 275275 CarbenicillinCarbenicillin 539539 OxacillinOxacillin 291291 TetracyclinesTetracyclines TetracyclineTetracycline 366366 PenimepicyclinePenimepicycline 218218 OthersOthers PatulinPatulin 323323 NovobiocinNovobiocin 236236 Blastidin SBlastidin S -102-102

페니실린/앰피실린 및 테트라사이클린 군에서 내성 표현형들만이 검출되었다(도 3b). 상기 데이터는 상기 군들에서의 항생제에 대한 내성이 VOC 처리에 좌우될 수 있다는 점을 시사한다. PM 데이터는 VOC-처리 및 VOC-미처리 대장균을 앰피실린 및 테트라사이클린 상에서 생장시켜 입증했다. VOC는 앰피실린- 및 테트라사이클린-내성 세포의 수를 각각 8.7 및 2.3배 증가시키는 것으로 나타났다(도 3c).Only resistance phenotypes were detected in the penicillin/ampicillin and tetracycline groups (Fig. 3b). The data suggests that resistance to antibiotics in these groups may depend on VOC treatment. PM data was verified by growing VOC-treated and VOC-untreated E. coli on ampicillin and tetracycline. VOC was found to increase the number of ampicillin- and tetracycline-resistant cells by 8.7 and 2.3 times, respectively (Fig. 3c).

마이크로어레이 데이터(도 1)는 VOC가 hipA 및 hipB 유전자의 발현을 각각 2.62- 및 4.65-배 유도한다는 것을 보여줬다. 상기 유전자들의 VOC-매개성 유도는 RT-qPCR로 확인했다(도 3d).Microarray data (Figure 1) shows that the VOC is hipA And hipB It was shown to induce the expression of the gene 2.62- and 4.65-fold, respectively. VOC-mediated induction of the genes was confirmed by RT-qPCR (Fig. 3d).

hipA 발현은 영속성을 매개하는 것으로 공지되어 있다. 돌연변이 hipA7 세포는 매우 높은 빈도의 영속자 형성을 나타내고, 야생형 hipA의 과발현은 영속성을 부여한다. 대장균에서의 앰피실린 내성에 대한 VOC의 영향은 hipA의 발현에 대해 시험하여 hisA가 VOC-매개성 내성 표현형에서 역할을 하는지 여부를 조사했다. VOC는 앰피실린 상에서 생장하는 야생형 세포 콜로니의 갯수를 2.8배 증가시켰지만, 그러한 효과가 대조군 플라스미드를 이용한 hipA 결실 균주에서는 관찰되지 않았는데, 여기서 앰피실린-내성 콜로니의 갯수가 약 30% 감소했다(도 3e). 그러한 효과는 넉아웃 균주에서 hipA 유전자의 과다생산자에 의해 완전히 회복되어, hipA가 VOC-유도 항생제 내성 조절에 필수적인 인자라는 점을 시사한다. 상기 결과들은 TA-관련 유전자가 VOC-의존성 항생제 내성에 결부되어 있는 한편, 추가적인 세포 인자들이 밝혀져야만 VOC-유도성 TA 시스템의 완전한 이해를 구할 수 있음을 나타낸다.
hipA expression is known to mediate persistence. Mutant hipA7 cells show a very high frequency of persistent formation, and overexpression of wild-type hipA confers persistence. The impact of VOC on published Amphitheater resistance in E. coli are tested for the expression of hipA hisA were investigating whether the acts in VOC- mediated resistance phenotype. VOC increased the number of wild-type cell colonies growing on ampicillin by 2.8-fold, but such an effect was not observed in the hipA deletion strain using the control plasmid, where the number of ampicillin-resistant colonies decreased by about 30% (Figure 3e). ). Such an effect is completely restored by the overproducer of the hipA gene in the knockout strain, suggesting that hipA is an essential factor in regulating VOC-induced antibiotic resistance. The above results indicate that TA-related genes are linked to VOC-dependent antibiotic resistance, while additional cellular factors must be identified to obtain a full understanding of the VOC-inducible TA system.

실시예Example 4. 박테리아 표현형에 영향을 주는 4. Influencing the bacterial phenotype VOCVOC 의 동정Sympathy of

고초균은 약 30가지의 상이한 VOC를 방출하는 것으로 나타났으나, 얼마나 많은 또는 어떤 특이적 VOC가 신규하게 동정되는 표현형을 조절할 수 있는가 하는 의문은 밝혀져야 할 과제로 남아 있다. 따라서, 운동성 및 항생제 내성에서의 변화에 대한 개별적인 고초균 휘발물질의 영향을 시험했다. 그러한 목적을 위해, 약 30가지의 VOC들 중에서 7가지의 시판하여 입수가능한 VOC를 선별하고, 유주 운동성 및 항생제 내성 표현형의 VOC-매개성 유도를 조사했다.Bacillus Bacillus has been shown to release about 30 different VOCs, but the question of how many or what specific VOCs can modulate the newly identified phenotype remains a task to be elucidated. Thus, the effect of individual Bacillus volatiles on changes in motility and antibiotic resistance was tested. For that purpose, seven commercially available VOCs were selected out of about 30 VOCs, and VOC-mediated induction of migratory motility and antibiotic resistance phenotypes were investigated.

스크리닝으로부터, 고초균 GB03 및 GA 유래의 주요 케톤들 중 하나이며, 고초균 GB03 유래의 두번째로 많이 생성되는 산인 2,3-BD에 대한 노출이 유주 운동성을 재현가능하게 감소시켰고(도 4a), 상기 VOC들은 두 균주들에서 총 VOC-유도성 표현형과 유사한 앰피실린에 대한 내성 응답성을 도출하였다(도 4b). 흥미롭게도, 3M1BOH 및 2M1PAOL에 의해 유도되는 항생제 내성의 수준은 두 균주에서 극적으로 상이했다(도 4b). 상기 데이터는 VOC, 특히 2,3-BD 및 GA가 대장균 세포에서의 유주 운동성 및 항생제 내성을 조절한다는 것을 강력하게 시사한다.
From the screening, exposure to 2,3-BD, which is one of the major ketones derived from Bacillus GB03 and GA, and the second most produced acid derived from Bacillus GB03, reduced migration motility reproducibly (FIG. 4A ), and the VOC They derive a resistance response to ampicillin similar to the total VOC-induced phenotype in both strains (Fig. 4b). Interestingly, the level of antibiotic resistance induced by 3M1BOH and 2M1PAOL was dramatically different in the two strains (Figure 4b). These data strongly suggest that VOCs, especially 2,3-BD and GA, regulate migratory motility and antibiotic resistance in E. coli cells.

실시예Example 5. 표현형에 대한 유효 5. Valid for phenotype VOCVOC 농도의 결정 Determination of concentration

본 발명의 데이터는 물리적으로 분리되어 있는 박테리아 유래의 전체 및 개별 공중부유 VOC의 수용자 박테리아의 표현형에 대한 영향을 명백하게 보여준다. 그러나, 기체의 VOC가 수용자 박테리아에 영향을 미치는 방법은 명백하지 않다. 가능한 경로는, 기체의 VOC가 대장균의 배양 배지에 녹아 들어가고, 그 양이 기능에 영향을 준다는 것이다. 따라서, 박테리아 표현형에 유효한 2,3-BD 또는 GA의 작용 농도의 결정이 물리적으로 분리되어 있는 박테리아의 생리학에 대한 두가지 공중부유 VOC의 생리학적 관련성에 대한 대답이 될 것이다.The data of the present invention clearly show the effect of physically separated bacteria-derived total and individual floating VOCs on the phenotype of recipient bacteria. However, it is not clear how gaseous VOCs affect recipient bacteria. A possible route is that gaseous VOCs dissolve into the culture medium of E. coli, and the amount affects function. Thus, the determination of the active concentration of 2,3-BD or GA effective for the bacterial phenotype will be the answer to the physiological relevance of the two floating VOCs to the physiology of physically separated bacteria.

VOC 효과의 지수를 결정하기 위해, 고초균 VOC의 자연 증발에 의한 2,3-BD 또는 GA의 대장균 세포에 대한 유효 농도를 측정했다. 그러한 목적을 위해, 유주 운동성을 상이한 농도(10 nM 내지 100 mM)의 2,3-BD 또는 GA의 16시간 동안의 처리 후 측정했다. 도 4c에 제시한 바와 같이, 도 1에 기재된 방법에 의해 10 nM의 2,3-BD 또는 GA가, 전체 VOC에 의해서는 운동성이 약 50% 감소하는 조건에서, 변경된 유주 운동성을 나타냈다(VOC가 없는 것에 비해 약 22 내지 25% 감소). 상기 정보는 "VOC 처리 시간 대비 운동성의 백분율 변화(%/h)'와 같은 잠정적인 휘발성을 정의할 수 있도록 했다. 따라서, 2,3-BD 및 GA의 휘발성은 약 22 내지 25%/h인 한편, 전체 VOC에 대해서는 50%/h이다. 배지 내에 얼마나 많은 양의 2,3-BD 또는 GA가 표현형에 직접적으로 영향을 주는지 결정하기 위해, 1nM 내지 1μM의 2,3-BD 또는 GA 를 직접 대장균 세포 배양물에 첨가했다. 1 nM의 2,3-BD 또는 GA가 선형적으로 감소되는 유주 운동성을 보여줬고, 1μM의 2,3-BD 또는 GA가 각각 약 62%/h 또는 45%/h의 휘발성을 보여줬다(도 4d). 그러한 조건에서, 대장균의 생장은 증가된 농도의 개별 VOC에 의해 영향받지 않았고, 심지어 피코몰(최종) 농도의 2,3-BD 및 GA의 직접적인 첨가에서도 대장균은 내성이었다(데이터 미제시).In order to determine the index of the VOC effect, the effective concentration of 2,3-BD or GA against E. coli cells by natural evaporation of Bacillus VOC was measured. For that purpose, migration motility was measured after 16 hours of treatment with different concentrations (10 nM to 100 mM) of 2,3-BD or GA. As shown in Figure 4c, by the method described in Figure 1, 10 nM of 2,3-BD or GA, under the condition that the motility is reduced by about 50% by the total VOC, exhibited the changed migratory motility (VOC is About 22-25% reduction compared to none). The above information is We made it possible to define a potential volatility, such as "percent change in motility versus time of VOC treatment (%/h)". Thus, the volatility of 2,3-BD and GA is about 22-25%/h, while overall For VOC, it is 50%/h To determine how much 2,3-BD or GA in the medium directly affects the phenotype, 1 nM to 1 μM of 2,3-BD or GA is directly cultured in E. coli cells. 1 nM of 2,3-BD or GA showed a linearly reduced migration motility, and 1 μM of 2,3-BD or GA showed a volatility of about 62%/h or 45%/h, respectively. In such conditions, the growth of E. coli was not affected by increased concentrations of individual VOCs, and even with the direct addition of 2,3-BD and GA at picomolar (final) concentrations, E. coli was resistant ( Data not shown).

모든 결과에 의하면, 수용자 박테리아가 VOC를 생리학적으로 밀접한 조건인 pM 내지 μM로 포함할 때, 기체 및 액체 상태의 VOC가 모두 운동성 및 항생제에 대한 감수성의 두가지 모두에 유효하게 영향을 준다.
According to all the results, when the recipient bacteria contain VOCs in a physiologically close condition of pM to μM, both gaseous and liquid VOCs effectively affect both motility and sensitivity to antibiotics.

실시예Example 6. 6. VOCVOC -유도성 경로에 대한 메커니즘 연구-Mechanism study for inductive pathways

본 발명에서 수득된 데이터는 나아가 VOC가 박테리아의 세포 표현형과 연관된 유전자 군들의 발현에 영향을 준다는 점을 나타낸다. 추가로 제기되는 의문은 VOC가 표현형에 영향을 주는 방법이다. 세포의 경로가 일반적으로 복합 시스템에 의해 매개되기 때문에, 마스터 조절 유전자(들)이 전사 인자(들)을 조절함으로써 VOC-매개성 표현형을 조절한다는 것이 추측될 수 있다. 마스터 조절자(들)을 동정하기 위해, 유주 운동성 또는 항생제 내성과 같은 VOC-관련 표현형을 더이상 나타내지 않는 VOC-조절 유전자들의 넉아웃 돌연변이들을 추가 조사용으로 선별했다. VOC들이 다섯가지 후보자 넉아웃 돌연변이(ybgL, ybjL, ypdB, ykg 및 yfbK; 도 2e; 표 2)의 유주 운동성에 아무런 변화를 제공하지 않았다. 상기 돌연변이들의 항생제 내성에 대한 VOC의 영향을 연구할 때, ypdB의 부재만이 감소된 항생제 내성을 결과로 제공한 반면(도 5a), ypdB 돌연변이는 박테리아 생장에 대해 야생형 세포와 동일한 영향을 나타냈다(도 5b). The data obtained in the present invention further indicate that VOC affects the expression of gene groups associated with the bacterial cell phenotype. An additional question is how VOCs affect phenotypes. Since cellular pathways are generally mediated by complex systems, it can be speculated that the master regulatory gene(s) regulate the VOC-mediated phenotype by regulating transcription factor(s). To identify the master modulator(s), knockout mutations of VOC-regulatory genes that no longer exhibit VOC-related phenotypes such as migratory motility or antibiotic resistance were selected for further investigation. VOCs provided no change in migratory motility of the five candidate knockout mutations ( ybgL , ybjL , ypdB , ykg and yfbK; Figure 2e; Table 2). When studying the effect of VOC on antibiotic resistance of the mutations, only the absence of ypdB resulted in reduced antibiotic resistance (FIG. 5A ), whereas the ypdB mutation showed the same effect as wild-type cells on bacterial growth ( Fig. 5b).

ypdB 넉아웃에서의 유주 운동성은 미처리 대조군과 유사했고, 2,3-BD, GA 또는 전체 VOC에 대한 노출 후에 아무런 유의한 변화를 나타내지 않았다(도 5c). ypdB 넉아웃 세포의 생존 비율은 VOC의 부재 하에서는 야생형 세포와 유사했다. 그러나, 2,3-BD 및 전체 VOC에 대한 노출 후에는 ypdB 넉아웃 세포의 생존 비율이 야생형 세포보다 더 낮았다(도 5d). 추가적으로, VOC-유도성 항생제 내성은 ypdB 결실에 의해 제거되었고, 넉아웃 균주에서의 ypdB의 이소성 유도(ectopic induction)에 의해 회복되었다(도 5e). 더욱이, hipA 발현은 ypdB 넉아웃에서 심하게 감소되어(도 5f), ypdB 유전자 생성물이 hipA 발현에 대한 상류 활성제(upstream activator) 또는 전사 인자로서 기능할 수 있다는 점을 시사한다. 따라서, ypdB는 대장균에서의 VOC-매개성 유효성의 마스터 조절자일 수 있다. The migratory motility in the ypdB knockout was similar to that of the untreated control group, and did not show any significant change after exposure to 2,3-BD, GA or total VOC (FIG. 5C ). The survival rate of ypdB knockout cells was similar to that of wild-type cells in the absence of VOCs. However, after exposure to 2,3-BD and total VOC, the survival rate of ypdB knockout cells was lower than that of wild-type cells (FIG. 5D ). Additionally, inductive VOC- antibiotic resistance was was removed by ypdB deletion, it recovered by the induction of ectopic ypdB in knockout strain (ectopic induction) (Fig. 5e). Moreover, hipA expression is ypdB It is severely reduced in knockout (FIG. 5F), suggesting that the ypdB gene product may function as an upstream activator or transcription factor for hipA expression. Thus, ypdB may be a master regulator of VOC-mediated effectiveness in E. coli.

화학물질(chemicals)이 특이적 유전자의 전사를 위한 신호로서 작용한다는 수많은 연구가 있어 왔다. 따라서, VOC에 의한 유전자 발현 변화가 전사의 개질된 활성의 반영이라는 가설을 세웠다. 상기 가설을 조사하기 위해, 전사 활성, 즉 VOC에 의한 일부 상향조절되는 유전자들의 프로모터 활성을 조사했다. 그러한 목적을 위해, VOC에 의해 전사 수준에 있어서 3배를 초과하는 변화를 나타내는 세가지 유전자(ycfR, aaeX 및 hyaF)의 염색체 프로모터-GFP 융합을 생성하여, 고초균 VOC에 노출된 대장균 세포 또는 대조군(고초균 없는 것) 사이의 하이브리드-GFP 단백질의 발현을 측정했다. 모든 선별된 유전자들이 고초균 VOC에 대한 응답에서 GFP의 증가된 발현을 나타내어, VOC가 프로모터 활성을 변경시켜 표적 유전자의 전사에 영향을 줄 수 있다는 점을 시사한다.Numerous studies have shown that chemicals act as signals for the transcription of specific genes. Therefore, it was hypothesized that the change in gene expression by VOCs is a reflection of the modified activity of transcription. To investigate this hypothesis, transcriptional activity, i.e., promoter activity of genes that are partially upregulated by VOCs, was investigated. For that purpose, by generating a chromosomal promoter-GFP fusion of three genes (ycfR , aaeX and hyaF ) showing a change of more than 3 fold in the level of transcription by VOC, E. coli cells or controls exposed to Bacillus VOC (Bacillus bacillus None) was measured for expression of the hybrid-GFP protein. All of the selected genes showed increased expression of GFP in response to Bacillus VOCs, suggesting that VOCs may alter the promoter activity and thus affect the transcription of target genes.

따라서, 얼마나 많은 또는 어떠한 특이적인 공지된 또는 비공지된 전사-관련 인자(들)이 표현형과 관련이 있는지 조사했다. 그러한 목적을 위해, 해당 표현형에 대한 상기 인자들의 스크리닝을 위해 형광 프로모터 라이브러리를 도입했다. 상기 라이브러리에서, 60가지의 이용가능한 프로모터 리포터가 EcoCyc 및 마이크로어레이 데이터의 유전자 세부사항의 두가지 모두로부터의 전사 또는 DNA 결합 전사 조절의 키워드에 의한 필터링 후 전사-관련 라이브러리로 선별되었다(데이터 미제시). 1μM의 2,3-BD, GA, 또는 고초균 VOC (10⁵ 세포 유래)의 37℃에서의 14시간 동안의 자연 증발을 이용한 96-웰-플레이트 기반의 스크리닝에 의해, 대장균 프로모터 리포터 유래의 형광으로서의 프로모터 활성을 형광/OD₆₀₀로 모니터링했다. 60가지 상이한 프로모터의 결과로부터, 4가지 상이한 유전자(yjhU, soxS 또는 rpoS) 유래의 활성은 시험한 모든 VOC들(2,3-BD, GA, 또는 고초균 VOC)에 의해 재현가능하게 유도되었다(표 4). Thus, it was investigated how many or any specific known or unknown transcription-related factor(s) were phenotype related. For that purpose, a fluorescent promoter library was introduced for screening of these factors for the phenotype in question. In this library, 60 available promoter reporters were selected as transcription-related libraries after filtering by keywords of transcription or DNA binding transcriptional regulation from both EcoCyc and genetic details of microarray data (data not shown). . 1 μM of 2,3-BD, GA, or Bacillus VOC (from 10 ⁵ cells) at 37°C for 14 hours By 96-well-plate based screening using natural evaporation, the promoter activity as fluorescence derived from the E. coli promoter reporter was monitored _{by fluorescence/OD 600.} From the results of 60 different promoters, the activity from 4 different genes (yjhU , soxS or rpoS ) was reproducibly induced by all VOCs tested (2,3-BD, GA, or Bacillus VOC) (Table 4).

따라서, 상기 유전자들은 ypdB 생성물에 의한 VOC-매개성 응답성의 상류 또는 하류 유전자일 수 있다. 상기 가설은 ypdB 또는 개별 VOC(2,3-BD)의 존재 또는 부재 하에서의 RT-qPCR에 의한 상기 전사 인자들의 정상 상태 수준(steady-state level)의 분석에 의해 추가로 확인되었다. 세가지 유전자 soxS, yjhU 및 rpoS 유전자 수준이 2,3-BD의 처리에 의해 증가되었음을 발견했다(도 2). 추가로, 모든 표적들의 유전자 발현이 ypdB 유전자의 부재 하에 감소하여, 상기 유전자들이 ypdB 유전자 생성물에 의해 활성화되고, ypdB의 하류에 위치한다는 점을 시사했다. 상기 데이터로 ypdB 생성물 및 그의 하류 전사 인자들이 VOC-매개성 표현형의 조절 캐스캐이드에 포함된다는 결론을 맺게 되었다.Therefore, the genes are ypdB It may be an upstream or downstream gene of a VOC-mediated response by the product. The hypothesis was further confirmed by analysis of the steady-state levels of the transcription factors by RT-qPCR in the presence or absence of ypdB or individual VOCs (2,3-BD). It was found that the levels of the three genes soxS , yjhU and rpoS were increased by treatment with 2,3-BD (Fig. 2). In addition, by reducing the gene expression of any target gene in the absence of ypdB, and it suggests that the genes are activated by a gene product ypdB, located downstream of the ypdB. YpdB with the above data It was concluded that the product and its downstream transcription factors were included in the regulatory cascade of the VOC-mediated phenotype.

<110> Korea Research Institute of Bioscience and Biotechnology <120> Composition for inhibiting motility or increasing sensitivity against antibiotics containing volatile organic compound from Bacillus subtilis as effective component and uses thereof <130> PN15446 <160> 67 <170> KopatentIn 2.0 <210> 1 <211> 735 <212> DNA <213> Escherichia coli <400> 1 gtgaaagtca tcattgttga agacgaattc ctggcacaac aggaactgag ctggctaatt 60 aaagagcaca gccagatgga gattgtcggc acctttgacg acggtctgga cgtgttgaag 120 tttttgcagc ataaccgcgt cgacgccatt tttctggata tcaatattcc gtcgctggat 180 ggcgtgttgc tggcgcaaaa catcagccag ttcgcccata aaccgtttat tgtgttcatc 240 accgcgtgga aagaacatgc ggtagaagcg tttgaactgg aggcgtttga ctacattctc 300 aaaccgtatc aggagtcacg tattaccggg atgctgcaaa aactggaagc ggcctggcaa 360 caacagcaga ccagcagtac gcctgccgcg acggtaacgc gtgagaatga caccattaat 420 ctggtgaaag atgagcgaat aatcgtcacg ccaattaacg atatctatta cgccgaagcg 480 cacgagaaaa tgacctttgt ctatacgcgg cgtgaatcct acgtaatgcc gatgaacatt 540 accgaatttt gcagcaaact gccgccgtcg cattttttcc gctgccatcg ctcattttgt 600 gtcaatctga acaaaatacg cgaaatcgaa ccgtggttta ataacaccta cattctgcga 660 ctgaaagatc tggattttga agtgccggtc agccgcagca aagtgaaaga atttcgccag 720 ttaatgcatc tttaa 735 <210> 2 <211> 244 <212> PRT <213> Escherichia coli <400> 2 Met Lys Val Ile Ile Val Glu Asp Glu Phe Leu Ala Gln Gln Glu Leu 1 5 10 15 Ser Trp Leu Ile Lys Glu His Ser Gln Met Glu Ile Val Gly Thr Phe 20 25 30 Asp Asp Gly Leu Asp Val Leu Lys Phe Leu Gln His Asn Arg Val Asp 35 40 45 Ala Ile Phe Leu Asp Ile Asn Ile Pro Ser Leu Asp Gly Val Leu Leu 50 55 60 Ala Gln Asn Ile Ser Gln Phe Ala His Lys Pro Phe Ile Val Phe Ile 65 70 75 80 Thr Ala Trp Lys Glu His Ala Val Glu Ala Phe Glu Leu Glu Ala Phe 85 90 95 Asp Tyr Ile Leu Lys Pro Tyr Gln Glu Ser Arg Ile Thr Gly Met Leu 100 105 110 Gln Lys Leu Glu Ala Ala Trp Gln Gln Gln Gln Thr Ser Ser Thr Pro 115 120 125 Ala Ala Thr Val Thr Arg Glu Asn Asp Thr Ile Asn Leu Val Lys Asp 130 135 140 Glu Arg Ile Ile Val Thr Pro Ile Asn Asp Ile Tyr Tyr Ala Glu Ala 145 150 155 160 His Glu Lys Met Thr Phe Val Tyr Thr Arg Arg Glu Ser Tyr Val Met 165 170 175 Pro Met Asn Ile Thr Glu Phe Cys Ser Lys Leu Pro Pro Ser His Phe 180 185 190 Phe Arg Cys His Arg Ser Phe Cys Val Asn Leu Asn Lys Ile Arg Glu 195 200 205 Ile Glu Pro Trp Phe Asn Asn Thr Tyr Ile Leu Arg Leu Lys Asp Leu 210 215 220 Asp Phe Glu Val Pro Val Ser Arg Ser Lys Val Lys Glu Phe Arg Gln 225 230 235 240 Leu Met His Leu <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 agtaaaggag aagaactttt cactggagtt 30 <210> 4 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cacatggcat ggatgagctc tacaaagtgt aggctggagc tgcttc 46 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 atgggaatta gccatggtcc 20 <210> 6 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cttctgtaac cggtccgaat accctccatg gaacagcagt aatttataaa agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 7 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gcatgtcgcg gggaaaaaat cagcagtagc aggcattaat gagggttaat atgggaatta 60 gccatggtcc 70 <210> 8 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 acaccgcgct ctattgctgc ttgttttatt tgatatcgcg actgttcgtt agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgtgatggc cgtacgggag aattttctta ttagtgtttt cacttcaacc atgggaatta 60 gccatggtcc 70 <210> 10 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgcagcggct tagcgaggta tgtcagtggc tggcggaagc tgcaccgacg agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 attcgccgat tgcgatattc ataagactga aagcgatact taccgtcttt atgggaatta 60 gccatggtcc 70 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atcacctccg ttcaccagtc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agagaagggc atggaaagc 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aactgtcatc gttcggttgc 20 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tttgtagagc tcatccatgc catgtg 26 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccttgctggt ggatcaatt 19 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gggactttgc gatagttact t 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 acccttggtg atgaagagta 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cctggctgaa cttaattcgt a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 caaatcgctg ggtaacttct 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 aggttctctt cgctgtagt 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 cggtaagtcg gtcagttca 19 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gtcatcgggt cctggaag 18 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gtcagcgtaa cccaacaa 18 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 accagaggat tgcgtttc 18 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tattaaccct ctattaccag gaaga 25 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tggctgtgta actgactga 19 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cctcaacggt cagtatgc 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tcatttgggc tgttcctc 18 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ttgtgttggt agtgatgcta tt 22 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 acagataatc cctatcgcta ataag 25 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 actggtcacc gacttatct 19 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gaagacttta tccgacatcc a 21 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 aatacccgaa gacgaaacc 19 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 caaccgagat gcgaaagt 18 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 attaagcagg cgacgatttc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 gtcgcatagc gtcattgaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tataacggtc tcgctgaagt 20 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gcaacctgtg ggaatttct 19 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 ccccattagc gactgtttt 19 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 cagattagaa agcagagtga ct 22 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 cgcttctgcc atgtctatc 19 <210> 43 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 caatttctgt ttctgtgatg agg 23 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ttccatcagc gtcgtctt 18 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 tgccctcaac atccttca 18 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 aaatgggtgt aactccttct g 21 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 aagccgttct ttcactatct c 21 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 cacggtccag actcctac 18 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 taactttact cccttcctcc c 21 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 ctcaacacca ttcataacct t 21 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 ctctctaatt taccctcttc aa 22 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 atccttatta ctcgtcagaa tgg 23 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 gcagtagata agccgtctc 19 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 tgcggcgatt ttaagctcca 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 attttgcgcc catctcatcc 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 tcccgttatc gtggtgtttg g 21 <210> 57 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 gcaatagagc gcggtgttga a 21 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 tgatggcctg atgaatggcc tacc 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 aatatttccc ggcccacaga gacg 24 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 cgaagcgcac gagaaaatga 20 <210> 61 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 61 cacggttcga tttcgcgtat tt 22 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 62 tacaggcaga gcctattatt cgat 24 <210> 63 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 63 atagaagcga ccacaaatga cac 23 <210> 64 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 64 caggctattc aaagtggtac ttgc 24 <210> 65 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 65 gagacataac ccaggtccat tg 22 <210> 66 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 66 gcagagcatc gtcaaatggc tgtt 24 <210> 67 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 67 atcttccagt gttgccgctt cgta 24 <110> Korea Research Institute of Bioscience and Biotechnology <120> Composition for inhibiting motility or increasing sensitivity against antibiotics containing volatile organic compound from Bacillus subtilis as effective component and uses thereof <130> PN15446 <160> 67 <170> KopatentIn 2.0 <210> 1 <211> 735 <212> DNA <213> Escherichia coli <400> 1 gtgaaagtca tcattgttga agacgaattc ctggcacaac aggaactgag ctggctaatt 60 aaagagcaca gccagatgga gattgtcggc acctttgacg acggtctgga cgtgttgaag 120 tttttgcagc ataaccgcgt cgacgccatt tttctggata tcaatattcc gtcgctggat 180 ggcgtgttgc tggcgcaaaa catcagccag ttcgcccata aaccgtttat tgtgttcatc 240 accgcgtgga aagaacatgc ggtagaagcg tttgaactgg aggcgtttga ctacattctc 300 aaaccgtatc aggagtcacg tattaccggg atgctgcaaa aactggaagc ggcctggcaa 360 caacagcaga ccagcagtac gcctgccgcg acggtaacgc gtgagaatga caccattaat 420 ctggtgaaag atgagcgaat aatcgtcacg ccaattaacg atatctatta cgccgaagcg 480 cacgagaaaa tgacctttgt ctatacgcgg cgtgaatcct acgtaatgcc gatgaacatt 540 accgaatttt gcagcaaact gccgccgtcg cattttttcc gctgccatcg ctcattttgt 600 gtcaatctga acaaaatacg cgaaatcgaa ccgtggttta ataacaccta cattctgcga 660 ctgaaagatc tggattttga agtgccggtc agccgcagca aagtgaaaga atttcgccag 720 ttaatgcatc tttaa 735 <210> 2 <211> 244 <212> PRT <213> Escherichia coli <400> 2 Met Lys Val Ile Ile Val Glu Asp Glu Phe Leu Ala Gln Gln Glu Leu 1 5 10 15 Ser Trp Leu Ile Lys Glu His Ser Gln Met Glu Ile Val Gly Thr Phe 20 25 30 Asp Asp Gly Leu Asp Val Leu Lys Phe Leu Gln His Asn Arg Val Asp 35 40 45 Ala Ile Phe Leu Asp Ile Asn Ile Pro Ser Leu Asp Gly Val Leu Leu 50 55 60 Ala Gln Asn Ile Ser Gln Phe Ala His Lys Pro Phe Ile Val Phe Ile 65 70 75 80 Thr Ala Trp Lys Glu His Ala Val Glu Ala Phe Glu Leu Glu Ala Phe 85 90 95 Asp Tyr Ile Leu Lys Pro Tyr Gln Glu Ser Arg Ile Thr Gly Met Leu 100 105 110 Gln Lys Leu Glu Ala Ala Trp Gln Gln Gln Gln Thr Ser Ser Thr Pro 115 120 125 Ala Ala Thr Val Thr Arg Glu Asn Asp Thr Ile Asn Leu Val Lys Asp 130 135 140 Glu Arg Ile Ile Val Thr Pro Ile Asn Asp Ile Tyr Tyr Ala Glu Ala 145 150 155 160 His Glu Lys Met Thr Phe Val Tyr Thr Arg Arg Glu Ser Tyr Val Met 165 170 175 Pro Met Asn Ile Thr Glu Phe Cys Ser Lys Leu Pro Pro Ser His Phe 180 185 190 Phe Arg Cys His Arg Ser Phe Cys Val Asn Leu Asn Lys Ile Arg Glu 195 200 205 Ile Glu Pro Trp Phe Asn Asn Thr Tyr Ile Leu Arg Leu Lys Asp Leu 210 215 220 Asp Phe Glu Val Pro Val Ser Arg Ser Lys Val Lys Glu Phe Arg Gln 225 230 235 240 Leu Met His Leu <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 agtaaaggag aagaactttt cactggagtt 30 <210> 4 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 cacatggcat ggatgagctc tacaaagtgt aggctggagc tgcttc 46 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 atgggaatta gccatggtcc 20 <210> 6 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cttctgtaac cggtccgaat accctccatg gaacagcagt aatttataaa agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 7 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gcatgtcgcg gggaaaaaat cagcagtagc aggcattaat gagggttaat atgggaatta 60 gccatggtcc 70 <210> 8 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 acaccgcgct ctattgctgc ttgttttatt tgatatcgcg actgttcgtt agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 9 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 ccgtgatggc cgtacgggag aattttctta ttagtgtttt cacttcaacc atgggaatta 60 gccatggtcc 70 <210> 10 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgcagcggct tagcgaggta tgtcagtggc tggcggaagc tgcaccgacg agtaaaggag 60 aagaactttt cactggagtt g 81 <210> 11 <211> 70 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 attcgccgat tgcgatattc ataagactga aagcgatact taccgtcttt atgggaatta 60 gccatggtcc 70 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 atcacctccg ttcaccagtc 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 agagaagggc atggaaagc 19 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aactgtcatc gttcggttgc 20 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tttgtagagc tcatccatgc catgtg 26 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccttgctggt ggatcaatt 19 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 gggactttgc gatagttact t 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 acccttggtg atgaagagta 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cctggctgaa cttaattcgt a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 caaatcgctg ggtaacttct 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 aggttctctt cgctgtagt 19 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 cggtaagtcg gtcagttca 19 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gtcatcgggt cctggaag 18 <210> 24 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gtcagcgtaa cccaacaa 18 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 accagaggat tgcgtttc 18 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 tattaaccct ctattaccag gaaga 25 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 tggctgtgta actgactga 19 <210> 28 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 cctcaacggt cagtatgc 18 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 tcatttgggc tgttcctc 18 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 ttgtgttggt agtgatgcta tt 22 <210> 31 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 acagataatc cctatcgcta ataag 25 <210> 32 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 actggtcacc gacttatct 19 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 gaagacttta tccgacatcc a 21 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 aatacccgaa gacgaaacc 19 <210> 35 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 caaccgagat gcgaaagt 18 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 attaagcagg cgacgatttc 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 gtcgcatagc gtcattgaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tataacggtc tcgctgaagt 20 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gcaacctgtg ggaatttct 19 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 ccccattagc gactgtttt 19 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 cagattagaa agcagagtga ct 22 <210> 42 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 cgcttctgcc atgtctatc 19 <210> 43 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 caatttctgt ttctgtgatg agg 23 <210> 44 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 ttccatcagc gtcgtctt 18 <210> 45 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 tgccctcaac atccttca 18 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 aaatgggtgt aactccttct g 21 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 aagccgttct ttcactatct c 21 <210> 48 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 cacggtccag actcctac 18 <210> 49 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 taactttact cccttcctcc c 21 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 ctcaacacca ttcataacct t 21 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 ctctctaatt taccctcttc aa 22 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 atccttatta ctcgtcagaa tgg 23 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 gcagtagata agccgtctc 19 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 tgcggcgatt ttaagctcca 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 attttgcgcc catctcatcc 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 tcccgttatc gtggtgtttg g 21 <210> 57 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 gcaatagagc gcggtgttga a 21 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 tgatggcctg atgaatggcc tacc 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 aatatttccc ggcccacaga gacg 24 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 cgaagcgcac gagaaaatga 20 <210> 61 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 61 cacggttcga tttcgcgtat tt 22 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 62 tacaggcaga gcctattatt cgat 24 <210> 63 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 63 atagaagcga ccacaaatga cac 23 <210> 64 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 64 caggctattc aaagtggtac ttgc 24 <210> 65 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 65 gagacataac ccaggtccat tg 22 <210> 66 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 66 gcagagcatc gtcaaatggc tgtt 24 <210> 67 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 67 atcttccagt gttgccgctt cgta 24

Claims

2,3-butanedione or glyoxylic acid was treated with E. coli mutants in which the expression of the YpdB protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2 was inhibited to determine the mobility of E. coli outside the human body Or to increase the sensitivity of ampicillin.

delete