KR101650098B1 - High-throughput screening system for inhibitor against pathogenicity of enterohemorrhagic or enteropathogenic Escherichia coli and recombinant Escherichia coli being used for the same - Google Patents

Abstract

The present invention relates to a high-speed search system capable of searching pathogenic inhibitors of pathogenic Escherichia coli through the search for a substance specifically inhibiting Ler protein, a recombinant Escherichia coli used in the high-speed search system, and a method for producing the same. , The pathogenic inhibitor of pathogenic Escherichia coli which can minimize the incidence of resistant bacteria by selectively inhibiting pathogenic properties such as biofilm formation ability and adherence ability of human colon cells without inhibiting the growth of pathogenic Escherichia coli, It is possible to search.

Description

TECHNICAL FIELD [0001] The present invention relates to a method for screening pathogenic inhibitors of pathogenic Escherichia coli and a recombinant Escherichia coli used for the same in a method for screening pathogenic inhibitors of Escherichia coli,

The present invention relates to a method for screening pathogenic inhibitors of pathogenic Escherichia coli and recombinant Escherichia coli used therefor.

Bacterial foodborne pathogens that record the highest number of cases and the number of patients in Korea are pathogenic Escherichia coli. According to statistical data on food poisoning occurrence, in Korea in the past 10 years, an average of 1,725 people have been infected with pathogenic Escherichia coli every year, accounting for about 23% of the total number of food poisoning cases. In 2012, there were 1,844 foodborne pathogens caused by pathogenic Escherichia coli and 31 cases were reported. Enterohemorrhagic E. coli O157: H7 ( E. coli O157: H7), a typical pathogenic Escherichia coli, was first reported in the US in 1982 as a food poisoning incident by a hamburger. In the United States, 73,000 people were infected annually, of which 2,000 It is estimated that 61 people were hospitalized and died causing more than $ 400 million in economic losses.

E. coli O157: H7 is contaminated mainly from uncooked beef crushed meat and infected by turkeys, sandwiches, crude oil, apple juice, and untreated water. In addition, biofilm formed by pathogenic Escherichia coli in foodstuffs, food manufacturing facilities, food factories, etc., has a great food hygiene problem due to resistance to various disinfectants and antibiotics as well as heat. E. coli O157: H7 is highly contagious and has a mean latency of 3-8 days, which is known to be difficult to prevent. Infection with this bacterium results in intestinal colitis or hemolytic uremic syndrome in the large intestine. Hemorrhagic uremic syndrome is a life-threatening condition that requires transfusion and kidney dialysis.

By the early part of the 20th century, these infectious diseases were always one of the greatest threats to human survival. However, with the development of vaccines and various antibiotics starting with the detection of penicillin by Fleming, the mortality rate from infectious diseases has started to decrease dramatically. However, penicillin, the first antibiotic, began to lose its strength against Staphylococcus aureus in the 1950s and emerged as a new superbacterium with resistance to other antibiotics since the 1990s, making infectious diseases a major problem in the public health sector It began to be recognized. The US Centers for Disease Control and Prevention (CDC) published a report in 1994 on the emerging infectious diseases - the US prevention strategy. In 1998, The budget for infectious diseases at the National Institute of Health (NIH) infectious disease allergy laboratory has increased from $ 39 million in 1993 to $ 4592 million in 2008.

When excessive use of antibiotics is used to kill food poisoning bacteria or to inhibit growth, food-borne bacteria become resistant to stress, resulting in the production of resistant microorganisms, ie, super bacteria. In particular, the abuse rate of antibiotics and antibiotics in Korea are among the highest among OECD countries.

Therefore, it is necessary to develop a new control method of food poisoning bacteria that minimizes the incidence of resistant bacteria by specifically inhibiting the expression of toxic factors at the molecular level, while maintaining the growth rather than sterilizing or bacterium. To this end, the infectious food poisoning bacteria are the first step to cause food poisoning, and they attach to the digestive tract cells and enter the human body. Therefore, a substance inhibiting this step has been explored using a cell culture model.

For example, Korean Patent Laid-Open Nos. 10-2013-0128141 and 10-2013-0063887 all disclose a compound that inhibits biofilm formation without inhibiting the growth of E. coli O157: H7, a microorganism that produces the compound For the search, E. coli O157: H7 was cultured and its ability to inhibit biofilm formation was confirmed. However, in this cell culture model, much time and expense is required for the experiment. Therefore, it is necessary to develop a more efficient high-speed search system to search for various substances at the same time.

The present invention relates to a method for selectively inhibiting the pathogenesis such as biofilm formation ability and adherence to human colon cells without inhibiting the growth of pathogenic Escherichia coli through the search for a substance specifically inhibiting Ler protein, thereby minimizing the incidence of resistant bacteria A high-speed search system capable of searching pathogenic inhibitors of pathogenic Escherichia coli, a recombinant Escherichia coli used in the high-speed search system, and a method for producing the same.

In order to achieve the above object, the present invention provides a recombinant vector comprising a locus of enterocyte effacement (LEE) operon promoter and a reporter gene; And a second recombinant vector comprising a sequence encoding a Ler operon master regulator (Ler) protein is co-transformed into Escherichia coli.

The present invention also provides a method for producing a recombinant vector, comprising the steps of: preparing a first recombinant vector to insert a locus of enterocyte effacement (LEE) operon promoter into a vector containing a reporter gene; A step of preparing a second recombinant vector in which a sequence encoding a Lie operon master regulator (Ler) protein is inserted into a substrate-dependent vector expressing a protein only in the presence of a specific substrate; And a step of preparing a recombinant Escherichia coli which co-transforms the first recombinant vector and the second combination vector into Escherichia coli.

The present invention also relates to a method for producing a recombinant Escherichia coli, comprising culturing the recombinant Escherichia coli in a medium supplemented with the substrate and a pathogenic inhibitory substance of pathogenic Escherichia coli; And detecting the expression level of the Ler protein through the expression level of the reporter gene, and a method for searching pathogenic inhibitors of pathogenic Escherichia coli.

The present invention also relates to a method for producing Escherichia coli coli ) KS02 (Deposit No. KCCM11527P) in a medium supplemented with a pathogenic inhibitor candidate of Arabidopsis and a pathogenic Escherichia coli; And confirming the expression level of the Ler protein through fluorescence analysis of luciferase. The present invention also provides a method for screening pathogenic inhibitors of Escherichia coli.

Through a search for a substance that specifically inhibits the Ler protein of the present invention, a high-speed search system capable of searching for a pathogenic inhibitor of pathogenic Escherichia coli, a recombinant Escherichia coli used in the rapid search system, It is possible to search pathogenic inhibitors of pathogenic Escherichia coli that can minimize the incidence of resistant bacteria by inhibiting only pathogenic factors such as biofilm formation ability and adherence ability of human colon cells without inhibiting growth, compared with the conventional culture method at a high speed.

FIG. 1A is a schematic diagram showing a process of constructing a ler out mutant strain in Production Example 1, FIG. 1B is a diagram showing the position of a primer and the size of a PCR product for identifying a mutation out mutant strain, FIG. And wild type pathogenic Escherichia coli as a template and using the respective primer pairs to confirm the size of the PCR product.
2 is a graph showing the growth curves of wild-type pathogenic Escherichia coli (WT) and KS01 mutant strain of Preparation Example 1 in Experimental Example 1 (1).
3A is a graph comparing biofilm formation capacities of wild-type pathogenic Escherichia coli (WT) and KS01 mutant strain of Production Example 1 in (2) of Experimental Example 1. FIG.
FIG. 3B is a graph comparing the adherence capacity of wild-type pathogenic Escherichia coli (WT) and KS01 mutant strain of Preparation Example 1 to human colon cells in Experiment 1 (3).
FIG. 4 is a schematic diagram illustrating a reporter strain (KS02 strain) constructed by co-transformation of the pKS1303 and pKS1304 vectors in Example 1, and a PCR product in which the pKS1303 and pKS1304 vectors were co-transformed.
5 is a graph showing the transcriptional activity of the target gene (LEE3 opreron) according to the expression level of each Ler by culturing KS02 strain constructed in Example 1 with varying arabinose concentration.
FIG. 6A is a graph showing the transcriptional activity of acylase, diosmin and isorhamnetin, which are candidates of a pathogenic inhibitor of pathogenic Escherichia coli, together with myristine, a negative control, and normylin, a negative control, to KS02 strain in Experimental Example 2 This is the graph I checked.
FIG. 6B shows the results of the experiment of Experimental Example 2 in which E. coli O157: H7 strain was treated with mucetin, a positive control myristin, a negative control nocarmillin, and acacetin, diosmin and isorhamnetin, which are candidate substances for pathogenic E. coli, Lt; RTI ID = 0.0 > transcriptional < / RTI > activity.
FIG. 7A is a graph comparing the biofilm forming ability of the KS02 strain in Experimental Example 3 when treated with the positive and negative controls of Experimental Example 2 and a candidate substance. FIG.
FIG. 7A is a graph comparing the adherence capacity of human colon cells to the KS02 strain in Experimental Example 3 when treated with the positive and negative control and the candidate substance of Experimental Example 2. FIG.

A first recombinant vector comprising a locus of enterocyte effacement (LEE) operon promoter and a reporter gene; And a second recombinant vector comprising a sequence encoding a Ler operon master regulator protein is co-transformed into Escherichia coli.

The Ler protein is present in all major pathogenic Escherichia coli that plays a key role in inducing food poisoning such as enterohemorrhagic E. coli (EHEC) and enteropathogenic E. coli (EPEC), and pathogenic Escherichia coli is present in gastrointestinal Attachment and effacing (A / E) A protein involved in the formation of lesions, activating transcription of the locus of enterocyte effacement (LEE, 35 Kb).

The second recombinant vector expresses the Ler protein only in the presence of a specific substrate. Isopropyl beta-D-1-thiogalactopyranoside (IPTG), arabinose and the like may be used as the substrate, and arabinose is preferably used as the araBAD promoter.

The LEE operon promoter may be selected from, but not limited to, a LEE2 operon promoter, a LEE3 operon promoter, a LEE4 operon promoter, and a LEE5 operon promoter.

The reporter gene may be, but is not limited to, a gene encoding luciferase, horse radish peroxidase (HRP), or alkaline phosphatase.

DH10B, DM1, JM109, TOP10, and DH5α may be used as the first recombinant vector and the second recombinant vector. However, the recombination vector may be modified by amber mutation codon UAG), which is most readily available commercially, inhibits E. coli DH5α, which is commonly used in recombinant vector amplification / maintenance and recombinant DNA cloning procedures .

The recombinant E. coli can be used for confirmation of LEE transcription repression by the Ler protein.

The recombinant E. coli may be Escherichia coli KS02 (Deposit No. KCCM11527P).

The present invention also provides a method for producing a recombinant vector, comprising the steps of: preparing a first recombinant vector for inserting a locus of enterocyte effacement (LEE) operon promoter into a vector containing a reporter gene; A step of preparing a second recombinant vector in which a sequence encoding a Lie operon master regulator (Ler) protein is inserted into a substrate-dependent vector expressing a protein only in the presence of a specific substrate; And a step of producing a recombinant Escherichia coli that co-transforms the first recombinant vector and the second combination vector into Escherichia coli.

The vector containing the reporter gene may be a pBBR- lux vector containing a promoterless lux operon.

The substrate-dependent vector may be pBAD24 whose expression level is regulated by changing the activity of the promoter depending on the concentration of arabinose.

It is preferable that the vector containing the reporter gene and the substrate-dependent vector have different antibiotic resistance.

The vector containing the reporter gene and the substrate-dependent vector preferably have different replicons and can coexist in one host strain.

The present invention also relates to a method for producing a recombinant Escherichia coli which comprises culturing a recombinant Escherichia coli in a medium supplemented with the substrate and a pathogenic inhibitory substance of pathogenic Escherichia coli; And determining the amount of expression of the Ler protein through the expression level of the reporter gene, and a method for screening pathogenic inhibitors of pathogenic Escherichia coli.

The pathogenic Escherichia coli may be enterohemorrhagic E. coli or enteropathogenic E. coli .

The pathogenicity inhibited by the pathogenic inhibitory candidate substance may be biofilm formation ability, human colon cell adhesion ability, or both.

The expression level of the reporter gene can be confirmed by fluorescence analysis of luciferase.

It is preferable that the expression amount of the Ler protein corrects the influence of the growth ability of the recombinant E. coli.

One of the preferred embodiments of the present invention is an Escherichia coli coli ) KS02 (Deposit No. KCCM11527P) in a medium supplemented with a pathogenic inhibitor candidate of Arabidopsis and a pathogenic Escherichia coli; And confirming the expression level of Ler protein through fluorescence analysis of luciferase. The present invention also relates to a method for screening pathogenic inhibitors of Escherichia coli.

Hereinafter, the present invention will be described in detail with reference to Examples, Experimental Examples and Preparation Examples. However, the following Examples, Experimental Examples and Preparation Examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following Examples, Experimental Examples and Production Examples.

Preparation Example 1: s  Construction and identification of knock-out mutants

A ler knock-out mutant was constructed using the λ Red recombination system for the toxicity evaluation of the LEE operon master regulator, Ler, which has EPEC as well as EHEC among the virulence factors of pathogenic Escherichia coli.

Red helper plasmid was introduced into pathogenic Escherichia coli and overexpressed Red recombinase by adding 0.3-0.4% L-arabinose. Red helper plasmid has RecE encoding 5 '→ 3' exonuclease and RecT encoding DNA annealing protein and serves as a catalyst for the homologous recombination process.

On the other hand, an FRT-flanked antibiotic resistance marker PCR product was prepared using a ler encoding region and a primer having 36 to 50 nucleotide homology at the end, and the product was electroporated into a pathogenic Escherichia coli and stained with LB and cultured in a stationary condition.

Colonies grown in medium containing 50 μg / ml kanamycin were assumed to have mutated FRT-flanked antibiotic resistance marker PCR product, and several strains were selected for PCR.

When neo is inserted between ler genes, the PCR product size is 1,637 bp longer than wild type (C1 and C4 primers). PCR products are also present if mutations are present in the neo region, but not in the wild type (C1 and C2 primers, C3 and C4 primers). At the same time, the ler gene has been completely deleted, so PCR with the LER primer does not yield product (LER (F) and LER (R) primers) at the mutation. The thus identified mutant strain was named KS01, and the sequence of the primers used for mutation confirmation is shown in Table 1 below.

Oligonucleotide ^a The base sequence, 5'-3 ' ^b Usage mutations (F) AATTGTTGGTCCTTCCTGATAAGGTCGCTAATAGCTTAAAATATTAAAGC AATTAACCCTCACTAAAGGGCG Construction of the ler mutant mutations (R) TATTATTTCATCTTCCAGCTCAGTTATCGTTATCATTTAATTATTTCATG TAATACGACTCACTATAGGGCTC C1 AAGGTCGCTAATAGCTTAAAATATT Confirmation of the ler mutant C2 CGAGACTAGTGAGACGTGCTAC C3 TATCAGGACATAGCGTTGGCTACC C4 TCCAAAGGGTGTTTCATTTTTTCA LER (F) AAT CCATGG CACGGAGATTATTTATTATG pKS1303 LER (R) TTA CCCGGG TTAAATATTTTTCAGCG PLEE3 (F) ATT ACTAGT GAGCCGTAGTGGTAAGTGCTAAT pKS1304 PLEE 3 (R) TTA GGATCC TATCAAATAAATAAAAATCATTTCC

^a The oligonucleotide is derived from the genomic sequence of E. coli O157: H7 [GenBank accession numbers AE005174.2].

^b The underlined portion of the oligonucleotide is a sequence that is not complementary to the genomic sequence of E. coli O157: H7.

Experimental Example 1: Characterization of KS01 strain

(1) Growth curve

Each overnight culture of wild-type pathogenic Escherichia coli and the KS01 mutant strain of Preparation Example 1 was seeded and cultured to a log phase (A ₆₀₀ = 0.5), diluted 1/100 in 200 μL medium, subcultured in a 96-well plate, Absorbance at 600 nm (A ₆₀₀ ) was measured using a microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) for 24 hours.

As shown in FIG. 2, the growth of wild type (WT) and KS01 mutant strains were compared and observed, and it was found that ler was not a factor affecting growth.

This implies that ler- specific inhibitors will not affect growth. Therefore, we have discovered that compounds that inhibit pathogenic Escherichia coli that are less likely to develop antibiotic-resistant bacteria can be searched through the search for ler- specific inhibitors.

(2) biofilm formation ability

The overnight culture of wild-type pathogenic Escherichia coli and the KS01 mutant strain of Preparation Example 1 was seeded and grown to a log phase (A ₆₀₀ = 0.5), and then subcultured in a 96-well plate containing 200 μL of medium at 1/100. After culturing for 24 ~ 48 hours, A ₆₀₀ was measured and recorded. The culture was discarded and washed with 220 μL of PBS. After immersing in 220 μL of 1% crystal violet solution and staining for 15 minutes, the wells were filled with distilled water, washed twice, air-dried for 5 minutes, and then solubilized with 220 μL of 100% ethanol to measure the A ₅₇₀ value. 3A.

3A shows that the biofilm formation ability of the KS01 mutant strain is decreased as compared with the wild type strain.

(3) human colon cell adhesion ability

Caco-2 cells in MEM + 10% FBS + 1% penicillin / streptomycin (GIBCO BRL, Grand Island, NY) were divided into 2 × 10 ⁶ cells / well on a 3.0 cm diameter tissue culture plate, C, 5% CO ₂ incubator. The Caco-2 cells generated from the monolayer were washed twice with prewarmed PBS, and the medium was exchanged with MEM + 1% FBS. MOI 10 was infected with the pathogenic Escherichia coli and cultured for 1, 2, and 3 hours. Each cell was washed twice with prewarmed PBS to remove unattached bacteria. In order to quantitate the attached bacteria, the bacterial cells were incubated on an LB agar plate and enumerated in 0.1% Triton X-100 at regular intervals for 5 minutes.

As in FIG. 3A, in FIG. 3B, it was confirmed that the cell adherence was also 2.8 times lower in the KS01 mutant strain than in the wild type strain.

On the other hand, when the mutant was complemented with pKS1303, as shown in FIGS. 3A and 3B, it was confirmed that the biofilm formation ability and cell adhesion ability were restored to the wild type level. Thus, it was found that the polar effect of the mutant strain did not decrease biofilm formation ability and cell adhesion ability I could. These results indicate that Ler plays an important role in pathogenicity of pathogenic Escherichia coli.

Example 1 Construction and Identification of a Reporter Strain

390 bp of the ler coding region of SEQ ID NO: 1 was amplified by PCR. NcoI and SmaI restriction enzyme linkers were added to the primers used to prevent the promoter from entering the opposite direction. At the same time, promoter activity was changed according to the concentration of L-arabinose, and pKS1101 derived from pBAD24 plasmid, whose expression amount was precisely controlled, was cut into the same enzyme and ligation was performed with the insert prepared above. The plasmid constructed above was prepared, and the insert size was confirmed by enzyme reaction and PCR (FIG. 4). The PCR error was confirmed by sequencing, and the plasmid was named pKS1303.

In addition, 420 bp of the promoter region of LEE3 operon of SEQ ID NO: 2 was amplified by PCR. The primers used for this purpose were added with SpeI and BamHI restriction enzyme linkers, respectively, so that the reporter plasmid was easily cloned and the promoter was not introduced into the subcloned plasmid. At the same time, the pBBR- lux plasmid carrying the promoterless lux operon was also prepared by cutting with SpeI and BamHI. The prepared inserts and vectors were ligated and transformed into E. coli DH5α cells. The plasmid constructed above was also prepared, and the insert size was confirmed by enzyme reaction and PCR (Fig. 4). After confirming the sequence, the plasmid was named pKS1304.

The two plasmids thus constructed were transformed into E. coli DH5α cells and reporter strains were prepared. The strains were transformed into Escherichia coli KS02, deposited at the Korean Microorganism Conservation Center on April 16, 2014, and assigned the deposit number KCCM11527P.

Ampicillin and chloramphenicol were added to the medium at 100 μg / ml and 20 μg / ml, respectively, in order to keep the two plasmids of the KS02 strain, and both antibiotics were added in the future experiment using the reporter strain.

In order to confirm whether the KS02 strain is suitable for high-throughput screening system, the transcription activity of the target gene (LEE3 opreron) according to the amount of Ler expression was checked by changing the concentration of L-arabinose. L-arabinose was treated with final concentrations of 0, 0.00005, 0.0001, 0.00015, and 0.0002% in a reporter strain grown up to the log phase (A ₆₀₀ = 0.5) and microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) The RLU was measured at each time point and corrected to A ₆₀₀ to exclude the effect of growth.

As shown in FIG. 5, when L-arabinose 0.0001% was treated, the RLU value was more than tripled compared to 0%, proving direct LEE3 operon activation by Ler. This confirms that the reporter strain can be used for the screening of low molecular compounds which inhibits Ler activity and inhibits LEE3 operon activation. On the other hand, at 0.0001% concentration above, there was no significant difference in RLU value, so 0.0001% was used for screening in the future.

Table 2 shows the characteristics and references of the strains and plasmids used in the experiments.

Strain or plasmid Relevant characteristics ^a Reference or source E. coli EDL933 Wild-type O157: H7 O'Brien et al. (1983) E. coli DH5α supE44? lacU169 ( ? 80 lacZ? M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Laboratory collection E. coli KS01 EDL933 with ? Km ^r This study E. coli KS02 DH5α containing pKS1303 and pKS1304; Ap ^r , C m ^r This study pBAD24 ColE1 ORi ; araBAD promoter; Ap ^r Guzman et al. (1995) pBBR- lux Broad host range vector within promoterless luxCDABE ; Cm ^r Lenz et al. (2004) pKS1101 pBAD24 with oriT of RP4; Ap ^r Kim et al. (2012) pKS1303 pKS1101 with 390-bp ler; Ap ^r This study pKS1304 pBBR- lux with 420-bp fragment of LEE3 upstream region; Cm ^r This study

Km ^r is kanamycin resistance, Ap ^r is ampicillin resistance, and C m ^r is chloramphenicol resistance.

Experimental Example 2: Detection of pathogenic inhibitors of pathogenic Escherichia coli using KS02 strain

To verify whether the KS02 strain can be used in a high-throughput screening system, myricetin 100 μM ( eae, flhD, pfs ) expression inhibitor (Lee et al., FEMS Microbiol Lett. 2011) and nomilin 100 μM (Vikram et al., Int J Food Microbiol. 2010) reported to have no effect on expression of toxic genes ( escU, escR, escJ, sepZ, cesD ) And at the same time, several other phytochemicals were also processed.

First, KS02 strain was grown overnight and then diluted to 1/100, and cultured to the log phase (A ₆₀₀ = 0.5). L-arabinose 0.0001% and various phytochemicals including myricetin and nomilin were added at 100 μM each, And absorbance (A ₆₀₀ ).

As shown in FIG. 6A, it was confirmed that myricetin decreased the RLU value by about half when 100 μM myricetin was treated, and thus it was confirmed that myricetin decreased the expression level of LEE3 operon twice (P <0.005). Acacetin, diosmin and isorhamnetin showed similar effects to myricetin among the other phytochemicals treated at the same time. However, the nomilin treated with negative control showed RLU values similar to those of DMSO treatment.

On the other hand, when the candidate substance of the same concentration was directly treated with E. coli O157: H7, which is not the strain KS02 of the present invention (FIG. 6b), the expression level of LEE3 operon decreased as in the case of treatment with strain KS02 But there was no significant difference between the two groups. This is probably due to the fact that the Ler specific inhibitory activity of E. coli O157: H7 was not accurately measured by the action of several other LEE3 regulators.

Experimental Example 3: Screening result of pathogenic inhibitor of pathogenic Escherichia coli using KS02 strain

Using the toxicity evaluation method of ler out mutant strain in Experimental Example 1, in Experimental Example 2, candidate substances that were expected to exhibit biofilm formation inhibitory activity and human colonic adhesion inhibitory activity regardless of the growth of pathogenic Escherichia coli The effect of the inventive method was verified by directly confirming whether the pathogenic E. coli O157: H7 effectively inhibited biofilm formation and inhibited human colon adhesion.

First to see the ability to form biofilm-inhibiting effect of the candidate substance E. coli O157: H7 overnight seeding a culture and to log phase (A ₆₀₀ = 0.5) and then raised, each candidate was diluted to 1/100 in BHI medium material 100 μM Were dispensed into a 96-well plate containing 200 μL each. After culturing for 24 ~ 48 hours, A ₆₀₀ value was measured to confirm whether the phytochemical was sterilized. Culture was discarded, washed with 220 μL of PBS, and 220 μL of 1% crystal violet solution was added and stained for 15 minutes. Thereafter, the distilled water was filled in the wells, washed twice, air-dried for 5 minutes, eluted with 220 uL of 100% ethanol, and measured for A _570, which is shown in FIG.

Next, the effect of the candidate substances on the inhibition of adherence of human colon cells was examined. Caco-2 cells were divided into 2 × 10 ⁶ cells / well on a 3.0 cm diameter tissue culture plate and cultured in a 5% CO ₂ incubator at 37 ° C for 24 hr. Caco-2 cells generated from the monolayer were washed twice with prewarmed PBS, and then exchanged for MEM medium with no antibiotics and FBS concentration reduced to 1%. The cells were incubated for 1 hr, 2 hr, and 3 hr with 100 μM each of MOI 10, E. coli O157: H7, and washed twice with prewarmed PBS to remove unattached bacteria. In order to quantitate the attached bacteria, the cells were incubated with 0.1% Triton X-100 for 5 minutes, and the bacterial cells were counted on an LB agar plate.

From the results of FIGS. 7A and 7B, it was found that the treatment of E. coli O157: H7 with 100 μM of myricetin, acacetin, diosmin and isorhamnetin reduced biofilm formation ability and cell adhesion ability compared to the control (DMSO treatment) And cell adhesion were similar to those of DMSO treatment.

Although direct reduction of the expression level of LEE3 operon by the direct phytochemical treatment of E. coli O157: H7 was small and no significant difference was obtained as in Experimental Example 2, in the search method using the KS02 strain of the present invention, And the cell adhesion ability. Thus, it was confirmed that the KS02 strain of the present invention can be used as a method for searching for a compound that inhibits the pathogenicity of pathogenic Escherichia coli.

Korea Microorganism Conservation Center (overseas) KCCM11527P 20140416

<110> KOREA FOOD RESEARCH INSTITUTE <120> High-throughput screening system for inhibitor against          pathogenicity of enterohemorrhagic or enteropathogenic          Escherichia coli and recombinant Escherichia coli being used for          the same <130> HPC4835 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 390 <212> DNA <213> Escherichia coli <400> 1 atgcggagat tatttattat gaatatggaa aataattcac atacaacaag tccatacatt 60 cagcttatag agcaaattgc agttctacag caggaagcaa agcgactgcg agagcaggaa 120 gttcaaagtg taattgagtc gattcagaag cagattactt attacaatat aaccttacaa 180 gagctgggat atactaatgt gcctgatgat ggactcgctc gccggaactc atcgaaaggt 240 gtttactacc gcaatgaaga agggcagacc tggtcgggcg taggccgaca gccacgctgg 300 cttaaagaag cactgttgaa tggaatgaag aaagaagatt ttcttgtgaa ggacactgaa 360 gaagaaataa taccgctgaa aaatatttaa 390 <210> 2 <211> 420 <212> DNA <213> Escherichia coli <400> 2 gagccgtagt ggtaagtgct aatccggcta taactctaac ggtgcgattt gttccatttt 60 ctggtttaat cactcctgtc ttctcatcca ctgagttatt tccactgagt gaggtcgcca 120 gcggcattac tgcaccagaa ggacttaaat ttgctgcttc cattgatctt tctccttttg 180 tctaatttag acatttacct ggttataaat aaccaaatta tcccataggc aactattata 240 ttatttaaat agttgcaatg tacataaagt acatatactg tatatattat ccaatacgct 300 ttttcaagca ataatattca cacgtatact tacttcagag cctgcagatg aatcttttag 360 ttaaaagaaa cgttgaagag tttttaagat tattgggaaa tgatttttat ttatttgata 420                                                                          420

Claims (19)

A first recombinant vector comprising LEE (locus of enterocyte effacement) operon promoter and reporter gene; And a second recombinant vector comprising a sequence encoding a Ler operon master regulator protein is co-transformed into Escherichia coli. 2. The recombinant E. coli according to claim 1, wherein the second recombinant vector expresses the Ler protein only in the presence of a specific substrate. 3. The recombinant E. coli according to claim 2, wherein the specific substrate is arabinose. The recombinant Escherichia coli according to claim 1, wherein the LEE operon promoter is any one or more promoters selected from LEE2 operon promoter, LEE3 operon promoter, LEE4 operon promoter and LEE5 operon promoter. The recombinant mutant Escherichia coli according to claim 1, wherein the reporter gene is a gene coding for luciferase, HRP (horse raddish peroxidase) or alkaline phosphatase. The recombinant mutant Escherichia coli according to claim 1, wherein the Escherichia coli is E. coli DH5α. The recombinant Escherichia coli according to claim 1, which is used for confirming LEE transcription repression by Ler protein. The recombinant Escherichia coli according to claim 1, wherein the recombinant Escherichia coli is Escherichia coli KS02 (Deposit No. KCCM11527P). Preparing a first recombinant vector to insert a locus of enterocyte effacement (LEE) operon promoter into a vector comprising a reporter gene;
A step of preparing a second recombinant vector in which a sequence encoding a Lie operon master regulator (Ler) protein is inserted into a substrate-dependent vector expressing a protein only in the presence of a specific substrate; And
And a step of producing recombinant E. coli which co-transforms the first recombinant vector and the second recombinant vector into Escherichia coli. [Claim 11] The method according to claim 9, wherein the vector comprising the reporter gene is a pBBR- lux vector comprising a promoterless lux operon. [Claim 11] The method according to claim 9, wherein the substrate-dependent vector is pBAD24 whose expression amount is regulated by changing the activity of the promoter according to the concentration of arabinose. 10. The method according to claim 9, wherein the vector comprising the reporter gene and the substrate-dependent vector have different antibiotic resistance. [Claim 11] The method according to claim 9, wherein the vector comprising the reporter gene and the substrate-dependent vector have different replication units and can coexist in one host cell. A recombinant Escherichia coli produced by any one of the methods selected from the recombinant Escherichia coli of claims 2 or 3 or any one of claims 9 to 13 is characterized in that (i) the Ler protein in the second recombinant vector transformed into said recombinant Escherichia coli (Ii) a medium in which a pathogenic inhibitory candidate of a pathogenic Escherichia coli is added; And
And determining the expression level of the Ler protein through expression amount of the reporter gene. 15. The method according to claim 14, wherein the pathogenic Escherichia coli is enterohemorrhagic E. coli or enteropathogenic E. coli . 15. The method for screening pathogenic inhibitors of pathogenic Escherichia coli according to claim 14, wherein the pathogenic agent inhibited by the pathogenic inhibitory substance is biofilm formation ability, human colon cell adhesion ability, or both. 15. The method according to claim 14, wherein the expression level of the reporter gene is confirmed by fluorescence analysis of luciferase. 15. The method according to claim 14, wherein the expression amount of the Ler protein corrects the influence of the growth ability of the recombinant E. coli on pathogenic inhibitors of pathogenic Escherichia coli. Escherichia coli ) KS02 (Deposit No. KCCM11527P) in a medium supplemented with a pathogenic inhibitor candidate of Arabidopsis and a pathogenic Escherichia coli; And
And identifying the amount of Ler protein expression by fluorescence analysis of luciferase.

Images