KR101647491B1 - Auto-Cell Concentration Recognition Auto-Inducible Expression System For Which Inducer Is Not Required and Use Thereof - Google Patents

Abstract

The present invention relates to constructs for expressing self-inducible proteins or nucleic acid molecules which are induced by recognizing autologous cell concentrations and various uses of the constructs. The construct of the present invention is a self inducible expression construct induced by sensing cell concentration, and no separate inducer is required for gene expression. The construct of the present invention can be used in anticancer applications, infarction treatment applications and imaging of tumors or infarction tissues by introducing the constructs into host cells, particularly host cells of attenuated Salmonella genus. The use of the Salmonella genus host cell having the construct of the present invention can effectively produce and deliver the drug in vivo, thereby maximizing the therapeutic effect. In addition, by using the fermentation of the host cell containing the construct of the present invention, it is possible to produce the protein economically without adding the inducer.

Description

[0001] The present invention relates to a cell concentration recognizing self-inducing system, and more particularly to a cell concentration recognizing self-

The present invention relates to a construct for expressing a protein or a nucleic acid molecule, wherein the expression of the expression target protein or the target nucleic acid molecule for expression is self-induced by recognizing an autologous cell concentration, a recombinant vector comprising the same, Transformed host cells and their use in cancer or infarct therapy and imaging applications.

Cancer has become possible to treat with the development of modern medicine by using chemotherapy, early diagnosis, radiotherapy, hematopoietic stem cell transplantation, and immunotherapy but there are limitations to successful treatment because of several side effects.

Traditionally used chemotherapies have different methods of attacking cancer cells per drug, which is called cytotoxicity (cytotoxic effect). Cells that undergo rapid division are more likely to have this effect. However, since this method does not aim at capturing the characteristics of the tumor, the drugs used for treatment are usually administered by intravenous systemic method, and cells which are less proliferated than cancer cells but proliferate rapidly in normal cells, Blood cells, epithelial cells of the gastrointestinal tract including the oral cavity, hair cells, sperm, and reproductive cells that produce the oocyte. Therefore, after chemotherapy, anemia comes, the number of white blood cells and platelets decreases, the mouth can be torn down, nausea, vomiting, diarrhea, etc., hair is lost, and there are side effects such as impaired reproductive function. This side effect always results in dose reduction, delay of treatment, or even discontinuation of chemotherapy (Fennelly (1995) Clin. Cancer Res. 1: 575-582; Hanjani, et al. Ross and Small (2002) J. Urol. 167: 1952-1956; Markman, et al. (2002) J. Clin. Oncol. 20: 2365-2369; Sehouli, et al. (2002) Gynecol. Oncol. 85: 321-326).

In particular, virtually all chemotherapeutic drugs work effectively only on young cells because almost all anti-cancer drugs act during cell growth. Therefore, the longer the generation of tumor cells, that is, the cells with undifferentiated cells, the less susceptible to chemotherapy. In the case of solid tumors, there are cells that actually divide in the middle of the cancerous mass, and when the cell stops dividing, the drug can hardly act. In addition, the growing feature of solid tumors makes it difficult for the drug to reach the dividing cells, further reducing the susceptibility. At this time, surgical treatment or radiation therapy should be used.

Although this technique is effective in early surgical diagnosis due to the surgical treatment, this method is effective for the complete removal of the cancer, because the organ removal and extensive surrounding tissue and lymphadenectomy are performed at the same time, Acute complications such as damage, rectal rupture, pneumonia, pulmonary embolism occur, and chronic complications may be dysfunction of organs.

In addition, radiation therapy can be administered within a few weeks after treatment depending on the specific site or range of radiation applied, the amount of irradiated radiation, and the health condition of the patient, such as fatigue, skin problems, hematopoietic suppression, radiation necrosis, hormone secretion, Side effects can vary.

In the case of hematopoietic stem cell transplantation, hematopoietic stem cell transplantation may result in persistent deterioration of immune function for a long period of time. Repeated bacterial infections, viral infections, and fungal infections may occur. The immune function may be restored by the type of hematopoietic stem cell transplantation, The duration of the treatment, and so on.

Recently, many molecular biologic characteristics of cancer have been clarified, and a target therapeutic agent which attacks only specific cancer cells has been developed in order to solve the side effects of the above methods, and thus much attention has been paid. Targeted therapies inhibit the growth and spread of cancer by interfering with the activity of specific molecules involved in cancer growth and carcinogenesis. Molecular targets are signal transduction pathways, angiogenesis, , A cell matrix, a cell cycle regulator, and apoptosis. Focusing on molecular and cellular changes, target treatment minimizes side effects by minimally damaging normal cell damage while selectively attacking cancer cells. When some target therapies are combined with conventional chemotherapy, progressive colon / Many studies have been published that increase the survival rate in rectal cancer, breast cancer, and lung cancer. However, even with this effect, the target therapeutic agent only attacks specific target factors involved in the process of cancer development. Therefore, even the same kind of cancer may be effective only in patients who exhibit specific target factors, The use of targeted therapies to selectively treat patients with potentially high efficacy can reduce the cost of unnecessary medical expenditures, yet biomarkers for predicting their effects have not yet been established.

Another problem with these treatment methods is the analytical methods for monitoring the therapeutic effect and the high costs incurred during the entire treatment process. Cancer treatment depends heavily on the appropriate treatment and diagnosis according to the patient. Diagnosis of cancer by conventional image analysis is not suitable to be performed in patients without special symptoms because it takes much time and effort. In fact, the method of analyzing MRI or other images used for diagnosis of cancer is not appropriate as a method of screening a large number of patients, and since the diagnostic image analysis is less accurate for small cancer tissues, I miss the timing of treatment. In addition, anticancer therapy is costly for a long period of time, and the possibility of recurrence is high, resulting in additional costs and financial problems arising from the use of expensive medical equipment.

Therefore, it is required to develop cost-effective targeted tumor therapy and diagnosis while minimizing the damage of normal cells, and recently, anti-cancer therapy using anti-cancer drugs that can be expressed in bacteria has emerged as a new strategy.

Some bacterial species have been reported to prefer proliferation and accumulation in tumors. Moreover, since bacteria have advantageous properties including the ability to simultaneously carry and express multiple therapeutic proteins, and because they can be easily removed by antibiotics, this suggests that bacterial therapy is promising for cancer treatment (Nauts et al., Acta Med. Scand. Suppl. 276: 1-103, 1953). In addition, in order to alleviate the side effects caused by bacterial growth and bacterial toxins, the use of auxotrophic mutants, spores, and attenuated bacteria to induce a direct tumor killing effect, Attempts have been made to use germ as a cancer drug by delivering tumor-killer molecules to cancer tissues, and this approach has the advantage that the bacteria can travel to tumor tissues where the drug is not reaching effectively (Forbes, Nat. Biotechnol., 24: 1484-1485, 2006).

Among them, Salmonella typhimurium, which is useful for tumor targeting, is an invasive gram-negative bacterium with mobility and can be clustered in solid tumors (Pawelek et al., Cancer Res., 57: 4537-4544, 1997) (Kasinskas and Forbes, Biotechnol. Bioeng., 94: 710-721, 2006). ≪ / RTI > In vivo, salmonella has been shown to clusters primarily in nutrient-rich necrotic areas (Forbes et al., Cancer Res., 63: 5188-93, 2003). Salmonella has also been successfully used to deliver chemotherapeutic molecules such as prodrug-converting enzymes and antigens to tumors (King et al., Hum. Gene Ther., 13: 1225-1233, 2002). Regulation of expression of genes is very important in selectively transferring therapeutic polymers such as proteins and nucleic acid molecules to tumor tissues. In the related art, US Patent Publication No. 2008-0112928 discloses a therapeutic bacterium using sugar inducible promoter The method for regulating genes in plants has been disclosed. In particular, in the case of the above-mentioned patent documents, the results of experiments in which protein expression was successfully induced by treatment with arabinose after introducing the? X174 E protein or the luciferase gene operatively linked to pBAD, which is the promoter of arabinose operon derived from Escherichia coli, Lt; / RTI >

However, in the case of the conventional Arabidopsis induction system, arabinose operon, which contains a gene encoding an enzyme that converts arabinos to another sugar such as glucose by metabolic action, is present in an activated state in a Salmonella strain used as a host cell Therefore, there is a disadvantage in that the efficiency of gene expression induction is lowered because the administered arabinose is not used solely for expression of a foreign gene. In addition, inducers such as arabinose are rapidly clear in the blood during in vivo experiments (Rapid Clearance: Seri et al., 1996) or difficulties in permeation into the tissues and cellular consumption Foley et al., 1978; Loessner et al., 2007), the efficiency of chemical inducers is reduced. In addition, the amount of inducer may be allowed in a small animal such as a mouse, but stability may be a problem when administered to large animals such as dogs, monkeys, cows and horses. Even though the anti-cancer gene is expressed by the induction of arabinose, it is obvious that the anti-cancer effect of the anti-cancer drug having low secretion efficiency outside the bacteria is low. Therefore, it is required to develop a more effective drug production and delivery method in order to improve the anticancer effect and the bacterial delivery system in the bacterial-based therapy.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

US Patent Publication No. US2008 / 0112928 A1

Pawelek et al., Cancer Res., 57: 4537-4544, 1997

The present inventors have developed a self-inducible construct in which gene expression is induced by autologous cell concentration without a foreign inducer, unlike a conventional expression system that requires an exogenous inducer in gene expression, And to develop a new efficient gene expression system capable of various applications such as disease treatment and protein production using bacterial cells. As a result, the present inventors have completed the present invention by successfully producing a self-inducing expression system in which gene expression is induced by an autologous cell concentration without requiring any separate inducer, and confirming its operation.

Accordingly, an object of the present invention is to provide a construct in which induction of gene expression is self-induced by recognition of an autologous cell concentration without requiring an inducer.

It is another object of the present invention to provide a recombination vector comprising the construct.

It is still another object of the present invention to provide a host cell transformed with the recombinant vector.

It is still another object of the present invention to provide a pharmaceutical composition for the treatment of tumors or infarctions comprising the transformed host cells.

It is another object of the present invention to provide a composition for tumor or infarct tissue images comprising the transformed host cells.

It is still another object of the present invention to provide a method for producing a protein through fermentation of the host cell.

It is still another object of the present invention to provide a method for treating a tumor or an infarction comprising the step of administering the pharmaceutical composition to a subject.

It is yet another object of the present invention to provide a method of tumor or infarct imaging comprising the step of administering the composition for imaging.

It is another object of the present invention to provide a method for delivering the composition to a tumor or infarct tissue.

The objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a nucleic acid molecule comprising (i) an acyl homoserine lactone (AHL) binding protein encoding nucleotide sequence operatively linked to a promoter; (Ii) an AHL synthase encoding nucleotide sequence operatively linked to a promoter; And (iii) a protein or nucleic acid molecule encoding nucleotide sequence operatively linked to the promoter, wherein expression of the protein or nucleic acid molecule for expression is self-induced by autologous cell concentration recognition .

The present invention relates to a construct for expression of a protein or nucleic acid molecule in which the expression of a protein or nucleic acid molecule for expression is self-induced by self-recognition of cell concentration under the absence of an inducer.

As used herein, the term " construct " refers to a minimal element for expression involving a nucleotide sequence for expression purposes and an expression sequence, such as a promoter, that results in the expression of this sequence.

The term " promoter " as used herein refers to a DNA sequence capable of regulating the expression of a protein or nucleic acid molecule encoding nucleotide sequence or functional RNA.

As used herein, the term " operatively linked " means a functional linkage between a nucleic acid expression control sequence (e.g., a promoter sequence) and another nucleic acid sequence whereby the regulatory sequence is transcribed and / / ≪ / RTI >

As used herein, the term " N-acyl-homoserine lactone (AHL) " refers to a substance acting as an autoinducer in bacteria, and refers to a substance that binds to AHL binding protein, .

As used herein, the term " AHL binding protein " refers to a protein that acts as a transcription factor in association with the autoinducer acyl homoserine lactone (AHL) described above.

As used herein, the term " autologous cell concentration awareness " means that the construct of the invention recognizes the concentration of autologous cells that contain it.

As used herein, the term " self-inducing " means that gene expression in a construct is induced without a separate exogenous inducing substance. More specifically, the expression of self- .

According to a preferred embodiment of the present invention, the AHL-binding protein bound to the AHL in the construct binds to the promoter of (ii) and (iii) to transcribe the AHL synthase and protein or nucleic acid molecule Promote. The AHL-binding protein, that is, the AHL-AHL binding protein complex bound to AHL functions as a transcription factor that binds to the promoters of (ii) and (iii) and promotes transcription. AHL-AHL binding protein complex binds to the promoters of (ii) and (iii) to promote transcription of a protein or nucleic acid molecule operatively linked to the promoter, resulting in the expression of a protein or nucleic acid molecule Under the absence of the inducer, the self-induced cell concentration is recognized.

According to another preferred embodiment of the present invention, the AHL binding protein is a LuxR protein. The LuxR protein is a transcription factor that promotes the transcription of genes that constitute the lux operon, a cluster of genes responsible for bioluminescence in Vibrio fischeri. The LuxR protein binds to an auto-inducible acyl-homoserine lactone (AHL), which promotes transcription by allowing the RNA polymerase to bind to the promoter of the LuxI gene. Preferably, the LuxR protein comprises the amino acid sequence of SEQ ID NO: 33.

According to another preferred embodiment of the present invention, the AHL-synthesizing enzyme is a LuxI protein. The LuxI protein is a protein having activity to catalyze the synthesis of AHL, which is an autoinducer, by detecting cell density (cell concentration) in Vibrio fischeri. Preferably, the LuxI protein comprises the amino acid sequence of SEQ ID NO: 34.

According to another preferred embodiment of the present invention, in the construct of the present invention, the promoter of (i) is a LuxR promoter, and the promoter of (ii) and (iii) is a LuxI promoter. The LuxR promoter preferably comprises the nucleotide sequence of SEQ ID NO: 36 and the LuxI promoter preferably comprises the nucleotide sequence of SEQ ID NO: 37.

According to another preferred embodiment of the present invention, the protein or nucleic acid molecule for expression is an anti-cancer protein, a fluorescent protein, a luminescent protein, a cytolytic protein, an antisense nucleotide, siRNA, shRNA or miRNA.

In the present specification, " self-induced self-induced cell self-induction " is used in an equivalent sense to self-induced by the " quorum sensing " mechanism. The quorum sensing will be described in more detail below.

Mechanism of quorum sensing

When bacteria reach a certain level of cell density, bacteria use a chemical language (metabolite) that they produce to transmit signals to each other and thereby control the expression of specific genes by quorum sensing ) Gene expression logic. The quorum sensing mechanism is based on the fact that each bacterium secretes low molecular signal transduction substances such as autoinducer or pheromone-like molecule and peptide into the outside of cells to induce active proliferation, quorum) to induce gene expression, which is a mechanism of communication between bacteria using specific signaling substances. Through this process, bacteria regulate various physiological activities necessary for survival such as protein expression, biofilm formation, migration, symbiosis, and population control. Quorum sensing is a protein that synthesizes a signaling substance and a transcriptional regulatory protein that binds to the signaling substance and regulates gene expression. In the case of Gram-negative bacteria, N-acyl-homoserine lactone (AHL) is mainly used for the quorum sensing. Acyl homoserine lactone is synthesized by the LuxI protein and acts as a transcription inducer that binds to the LuxR protein and induces specific gene expression. Acyl homoserine lactone is known to have various structures depending on the length of hydrocarbon chains forming an acyl chain, and it is known that the length and shape of acyl groups and the number of carbon atoms used are very varied in each species. The quorum sensing mechanism used in the present invention is not limited to those of gram-negative bacteria, and the gene used for the mechanism is not limited to those derived from Vibrio fischeri .

A variety of proteins or nucleic acid molecules (such as microRNAs) can be expressed using the construct of the present invention, and the protein or nucleic acid molecule for expression purposes which can be used in the construct of the present invention is described in more detail below do.

Protein or nucleic acid molecule for treating disease

The protein or nucleic acid molecule for expression in the construct of the present invention may be a disease-treating protein or nucleic acid molecule, and preferably the disease is cancer or infarct tissue.

The cancer therapeutic protein may be a protein toxin, an antiangiogenic factor or an antibody specific for cancer antigen or a fragment thereof. The protein toxin, for example botulinum toxin (botulinum toxin), Te tanuseu toxin (tetanus toxin), Shiga toxin (shiga toxin), diphtheria toxin (diphtheria toxin, DT), ricin (ricin), Pseudomonas exotoxin (Pseudomonas exotoxin, PE ), Cytolysin A (ClyA), and r-Gelonin. The anti-angiogenic factors include anti-VEGF antibody, angiostatin, endostatin, Kringle V domain of apolipoprotein, and the like. In addition, the construct of the present invention can be used for the expression of a tumor suppressor gene that inhibits the development of a tumor, and the tumor suppressor gene is, for example, VHL (von hippel lindau), APC (adenomatous polyposis coli) differentiation 95), ST5 (suppression of tumorigenicity 5), YPEL3 (yippee like 3), ST7 (suppression of tumorigenicity 7), or ST14 (suppression of tumorigenicity 14).

The protein for treating infarction tissue is, for example, an angiogenic factor, and the angiogenic factors include vascular endothelial growth factor (VEGF), angiopoietin 1, Ang1, angiopoietin 2, (TGF-beta), integrin, VE-cadherin, plasminogen activator (PA), ephrin, AC-133 , Platelet-derived growth factor (PDGF), monocyte chemotactic protein-1 (MCP-1), fibroblast growth factor (FGF) or placenta growth factor (PIGF) But is not limited to.

The nucleic acid molecule for expression in the construct of the present invention includes, for example, DNA, RNA, aptamer, LNA (locked nucleic acid), PNA (peptide nucleic acid), morpholino, But are not limited to, anti-sense nucleotides, siRNAs, shRNAs or miRNAs that specifically bind to the target gene. The target gene may be a target gene whose expression is to be inhibited, for example, a gene whose overexpression is involved in the development and development of disease. Specific examples of the target gene include FIH-1 (factor inhibiting HIF) or prolyl hydroxylase-2 (PH2) in case of ischemic disease, oncogene in case of tumor, The oncogenic gene may be, for example, HER2 / neu.

Probing proteins or nucleic acid molecules

In the construct of the present invention, the target protein or nucleic acid molecule to be expressed may be a probe protein or nucleic acid molecule, and more specifically, a diagnostic marker protein or a labeled nucleic acid molecule. The term " diagnostic marker protein or nucleic acid molecule " is used to identify a target nucleic acid, to identify the target nucleic acid, to identify the cell or organism to which the target nucleic acid is derived, to identify the induction or transcription of the target gene, ≪ / RTI > The diagnostic marker protein or nucleic acid molecule known and used in the art of the present invention can be exemplified by, for example, a luminescent protein, a fluorescent protein, a marker protein for positron emission tomography, a gene encoding avidin or a receptor. The luminescent protein includes firefly luciferase, Renilla luciferase, Metridia luciferase, bacterial luciferase, and the like. The bacterial luciferase can be produced by a variety of methods including, for example, Vibrio harveyi (Belas et al., Science, 218: 791-793, 1982), Vibrio fischeri (Engebrecht et al., Cell, 32 (3): 773-781, 1983), Photobacterium phosphoreum Mancini et al, J. Biol Chem, 263 (28):... 14308-14314, 1988), P. leiognathi (Delong et al, Gene, 54 (2-3.): 203-210, 1987), P . luminescens (Frackman et al, J. Bacteriol, 172:.. 5767-5773, 1990) or Aliivibrio fisheri (Mel'kina et al, Mol Biol (Mosk), 45 (3):... 524-528, 2011 Lt; RTI ID = 0.0 > lux operon. ≪ / RTI > The fluorescent protein may be selected from the group consisting of green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), orange fluorescent protein (OFP) But are not limited to, cyan fluorescent protein (CFP), blue fluorescence protein (BFP), far-red fluorescent protein or tetracystein motif. The diagnostic marker protein or nucleic acid molecule of the present invention may also contain a selectable marker. Preferably, lucidase can be used as a diagnostic marker protein in the construct of the present invention.

AraC ^C  protein

The expressed protein of interest in the construct of the present invention may be illustratively AraC ^c . The AraC ^c protein refers to an inducible, non-dependent transcription factor AraC, which has been improved by the present inventors. The Ara operon is used as an energy source for x-5-p converted to an operon, which synthesizes three enzymes that convert arabinose to xylulose-5-phosphate. The three enzymes are isozyme, enzyme, and epimerase, which are encoded by the araB, araA, and araD genes, respectively. A major difference from the Lac operon is that the AraC protein produced by araC acts as a positive activator. The araC gene is expressed to produce an araC protein. When arabinos is absent, the araC dimers bind to araO1, araO2 and araI1, and araO2 and araI1 interact to form a loop of about 190 bp in the DNA. As a result, transcription of araB, A, and D does not occur. However, in the case of Arabidopsis, arabinose forms a complex with the araC dimer and binds with araI1 and I2 to induce transcription of araB, A and D. It also binds to araO1 and araO2 sites to form a ring, which in turn increases transcription of the araC gene. As used herein, the term " AraC ^c " refers to an improved transcription factor AraC that is inducible independent. The name AraC ^c is named after the fact that it can induce the constitutive expression of a gene only by the presence of protein without the need for an inducer. In order to construct a module in which AraC ^c induces transcription into the presence of this protein itself without the presence of a chemical inducing substance, a DNA binding domain was added to the N-terminus of the wild-type AraC, (Arabinose), it is possible to bind to the cis-element ( I1, I2 ) with a structure of a transcription inducible type. The structure and action mechanism of the " AraC ^c " transcription factor of the present invention is shown in Fig. Preferably the "AraC ^c" transcription factor protein comprises the amino acid sequence of SEQ ID NO: 35. Because of the transcription factor properties of recombinant AraC (AraC ^c ), which is improved in an induction-independent manner, gene expression is possible by the transcription factor itself, not the inducer. As a result of transfection of the gene construct subcloned so as to express the foreign protein in the presence of the recombinant AraC ^c transcription factor and the P _BAD promoter having the binding site thereof to Escherichia coli lacking the Arabidopsis metabolism-related gene, Showed up to 10 times higher protein expression and activity than constructs regulated from AraC. Therefore, it was confirmed that the recombinant protein AraC ^c performs a transcription-promoting function independently of an inducer. By constructing the construct of the present invention so as to express the AraC ^c , a self-induced cell by the quorum sensing mechanism can construct a system for continuously expressing a protein or nucleic acid molecule for expression through a positive control mechanism by AraC ^c do.

Cytolytic protein

In the construct of the present invention, the expressed protein of interest may be a secretory-related protein or a cell lysis protein for efficiently delivering the drug to the target site.

The secretion related protein may be a secretion related protein. The secretion pathway may comprise, for example, an ABC path, a Path / Fla path and a Path / Vir path for single-step movement through both the plasma membrane and the outer membrane; Sec, Tat, MscL, and Holins pathways for migration through the plasma membrane; (FUP), Sec- plus autotransporter (AT), Sec- plus-to-partner (FUP) for two- two partner secretion (TPS), Sec- plus-main terminal branch (MTB), and Tat-plus-MTB pathway. Not all bacteria have the secretory pathway, and the secretory pathway is not limited to that presented above. More preferably, the secretion-related protein expressed in the construct of the present invention utilizes the (Holins) pathway, and the holin protein using the holin pathway is a membrane-passing protein that forms a hole in the cell membrane, The overall properties are hydrophobic and have a highly hydrophilic carboxy-terminal domain. Although it is possible to use the holin protein of Gram-positive bacteria as long as it can form a hole in the cell membrane of Gram-negative bacteria, it is more preferable to use the holin protein derived from Gram-negative bacteria. Class ⅠHolein is a protein with 95 amino acids, including the S protein of bacteriophage γ and the hol 15 protein of P68, and has three transmembrane domains in which the N-terminus is located in the periplasm and the C-terminus is located in the cytoplasm . Class ⅡHolein is a protein with 65 to 95 amino acids, which has two transmembrane domains with N-terminal and C-terminal cytoplasmic domains, and γ-phage 21 S protein and bacteriophage φ3236 Hol3626. Class III Holein is a protein with one hydrophobic membrane helices, unlike Class I and Class II holines, and T4 holin, which is encoded by bacteriophage T4.

The cell lysis protein or lytic protein expressed in the construct of the present invention includes a peptidoglycan hydrolase, and the endo-N-acetylglucose Acetylmuramylase (lysozyme) or an endopeptidase that acts on peptide bridges, or more commonly N-acetylmuramoyl-L, which hydrolyzes amide bonds linking sugar and peptide moieties - alanine amidase. More preferably, the cytolytic protein may be a bacteriophage-derived lysins protein that cleaves the chemical bond of the peptidoglycan. The lysine protein is a monomer, the N-terminal domain promotes the hydrolysis of the peptidoglycan, and the C-terminus binds to the cell wall substrate. Typically, the zolin protein forms pores in the cell membrane, allowing lytic proteins to access the cell wall peptidoglycan, resulting in the release of foreign genes. In particular, in the case of Gram negative bacteria having an outer membrane, the presence of the serine protein in combination with the lytic protein allows the lytic protein to more efficiently access the peptidoglycan, so that the lysis can be more likely to occur.

More specifically, the sequence of the secretory and lytic-related proteins can be determined by conventional techniques and rearranged the primary structure using techniques in the art such as mutagenesis, shuffling, The stability can be increased. In addition, shuffling allows complex enzymes ("chimeric enzymes") to possess at least one activity. By definition, shuffled enzymes are enzymes in which one or more sequences of one or more specific enzymes are truncated at one or more positions and rebuilt in a particular order or random order to increase enzyme activity or specificity. A chimeric enzyme is an enzyme in which two or more enzymes containing two or more active sites are combined, and these chimeric enzymes can independently act on the same or different molecules. This potentially allows for the simultaneous application of two or more sites of different lytic sites. However, the gene for a minuscule or the lytic gene that can be used in the present invention is not limited to those shown above.

Expression protein

The expression target protein in the construct of the present invention includes recombinant proteins, peptides and enzymes used industrially or medically. Such proteins include, but are not limited to, proteins used in fermentation processes, biofuels, antibodies, and protein medicaments. Expression systems in which the constructs of the invention can be used include, but are not limited to, E. coli based expression systems or Fungi expression systems. Such peptides include polypeptides or heterologous polypeptides. A polypeptide generally refers to a peptide or protein having about 100 amino acids or more. The heterologous polypeptide refers to a heterologous polypeptide to the host cell to be used. For example, a human protein produced by Escherichia coli to be. The polypeptide may be of a prokaryote or a eukaryote, but is preferably of a eukaryote, more preferably of a mammal. Examples of mammalian polypeptides include molecules such as renin; Growth hormone including human growth hormone and bovine growth hormone; Growth hormone releasing factor; Parathyroid hormone; Thyroid stimulating hormone; Lipoprotein; 1-antitrypsin; Insulin A-chain; Insulin B-chain; Proinsulin; Thrombopoietin; Follicle stimulating hormone; Calcitonin; Luteinizing hormone; Glucagon; Coagulation factors such as Factor VIIIC, Factor IX, tissue factor, and von Willebrands factor; Anti-coagulation factors, such as protein C; Atrial Sodium Excretion Enhancement Factor; Pulmonary surfactants; Plasminogen activators such as eukaryotic or human urine or tissue-type plasminogen activator (t-PA); Bombesh Shin; Thrombin; Hematopoietic growth factors; Tumor necrosis factor-alpha and -beta; Such as 2C4 (WO 01/00245; Hybridoma ATCC HB-12697), which binds to a region within the extracellular domain of ErbB2 (e.g., any one or more residues within the region of about 22 to about 584 residues of the contained ErbB2) An antibody to the domain (s), an eneparinase; Serum albumin, e. G., Human serum albumin; Muellerian-inhibiting substances; Rilacsin A-chain; Rilacsin B-chain; Prolylaxin; Mouse gonadotropin-related peptides; Microbial proteins such as beta-lactamase; DNase; Inhivin; Actibin; Vascular endothelial growth factor (VEGF); Receptors for hormones or growth factors; Integrin; Protein A or D; Rheumatic factor; (NT-3, NT-4, NT-5 or NT-6), or a neurotrophic factor, Nerve growth factors, such as NGF; Cardiotrophin (cardiac hypertrophy factor), such as cardiotropin-1 (CT-1); Platelet-derived growth factor (PDGF); Fibroblast growth factors such as aFGF and bFGF; Epidermal growth factor (EGF); TGF-alpha and TGF-beta (including TGF-I, TGF-2, TGF-3, TGF-4 or TGF-5); Insulin-like growth factors-I and -II (IGF-I and IGF-II); Des (1-3) -IGF-I (brain IGF-I), insulin-like growth factor binding protein; CD proteins, such as CD3, CD4, CD8 and CD19; Erythropoietin; Bone inducer; Immunotoxins; Bone Morphogenetic Protein (BMP); Interferons such as interferon-alpha, -beta and -gamma; Serum albumin such as human serum albumin (HSA) or bovine serum albumin (BSA); Colony stimulating factors (CSF) such as M-CSF, GM-CSF and G-CSF; Interleukins (IL), such as IL-1 to IL-10; Anti-HER-2 antibody; Apo2 ligand; Superoxide dismutase; T-cell receptors; Surface membrane protein; Deceleration Factor; A portion of a viral antigen, e. G., An AIDS envelope; Transport protein; Homing receptors; Addressin; Regulatory proteins; Antibody; And fragments of any of the polypeptides listed above.

In order to facilitate the secretion of the exogenous protein expressed by the construct of the present invention outside the host cell, preferably, the exogenous protein may further include a leader sequence (or a signal sequence). The leader sequence suitable for the present invention is not particularly limited and may additionally include leader sequences such as, for example, pelB, gene III, ompA, ompB, ompC, ompD, ompE, ompF, ompT, phoA and phoE. The expressed protein or peptide may be expressed in bacteria or surface expressed on the cell membrane, and the whole or the region showing the activity may be expressed alone or in the form of a fusion protein. Such proteins or peptides can act as ligands to signal the cells or to inhibit the function of various ligands.

According to another aspect of the present invention, there is provided a recombinant vector comprising the construct of the invention described above.

The recombinant vector of the present invention can be constructed as a vector for cloning with a prokaryotic host as a host or as a vector for expression. The recombinant vector of the present invention may contain a promoter or a selection marker capable of promoting transcription. The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, And resistance genes for tetracycline. The recombinant vector of the present invention comprises a nucleic acid sequence enabling proliferation in a prokaryotic host cell, particularly E. coli, and includes, for example, a cloning origin of a colE1 or p15A bacterial origin or a cloning origin of a bacteriophage such as f1 origin can do. However, the vectors that can be used in the present invention are not limited to those shown above.

The construct of the present invention may be included in the recombinant vector as described above, but may be inserted directly into the chromosome of the host cell. For such chromosome insertion, conventional homologous recombination methods, transposon-mediated gene insertion or Cre-LoxP recombination system can be used.

According to another aspect of the present invention, the present invention provides a host cell transformed with the above-described recombinant vector.

The host cell capable of continuously cloning and expressing the recombinant vector of the present invention in a stable manner can be any host cell known in the art. When the host cell of the present invention is a bacterium, Escehreichia sp. ), Salmonella sp., Helicobacter sp., Yersinia sp., Shigella sp., Enterobacter sp., Pseudomonas sp. Spores such as Legionella sp., Hemophilus sp., Neisseria sp., Serratia sp., Proteus sp., Brucellosis sp. Such as Brucella sp., Citrobacter sp., Stenotrophomonas sp., Moraxella sp., Bdellovibrio sp. Klebsiella sp., Preferably Salmonella spp., Heli < RTI ID = 0.0 > Escherichia spp., Yersinia spp., Schlegeli spp., More preferably Salmonella spp.

In the present invention, the host cell includes a bacterium transformed to be targeted to a specific cell or tissue, for example, a bacterium transformed to be targeted to a cancerous blood vessel, a cancer tissue, or a cancer cell. In addition, the bacteria used in the present invention include bacteria transformed to fuse with the cell membrane of the target cell. The bacterium may be transformed by material treatment or gene introduction, and may be transformed more than once. The bacterium may be transformed to inhibit the expression of one or more specific proteins. It may also be one that has been transformed to express at least one selected from the group consisting of a cell adhesion molecule, an antibody, a targeting protein, a cell membrane fusion protein, or a fusion protein thereof. But is not limited thereto. In addition, the host cells of the invention can be attenuated bacteria. The term " attenuated bacterium " means a bacterium that is capable of penetrating the host or its cells, but which is not pathogenic. In general, attenuated bacteria can be produced through a variety of methods known in the art. For example, attenuation is achieved by destroying or destroying the virulence factor that causes the bacteria to survive in the host cell. Such deletions and deletions are well known in the art and are carried out by methods such as homologous recombination, chemical mutagenesis, irradiation mutagenesis or transposon mutagenesis. The contents of attenuated bacteria are disclosed in detail in WO 96/40238, WO 2010/137900, which patent application is incorporated herein by reference. On the other hand, attenuation of the bacteria can be carried out by modifying the components of the bacteria which cause the toxicity of the bacteria. For example, LPS (lipopolysaccharide) and endotoxin are major etiologic agents of bacterial sepsis. Removal of lipid A from LPS results in attenuated bacteria. The attenuated strain may be, for example, a strain lacking the ability to produce ppGpp, and the strain lacking the ability to produce ppGpp may be a strain lacking the spoT and / or relA gene, more preferably both the spoT and relA genes May be a defective strain.

The method of delivering the recombinant vector of the present invention into a host cell can be carried out by a CaCl ₂ method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA , 9: 2110-2114 ), One method (Cohen, SN et al., Proc. Natl. Acac. Sci. USA , 9: 2110-2114 (1973), and Hanahan, D., J. Mol. Biol. , 166: 580 (1983)) and electroporation method (Dower, WJ et al., Nucleic Acids Res. , 16: 6127-6145 (1988)). In addition, when the host cell is a eukaryotic cell, microinjection (Capecchi, MR, Cell , 22: 479 (1980)), calcium phosphate precipitation (Graham, FL et al., Virology , 52: 456 electroporation (Neumann, E. et al, EMBO J., 1:. 841 (1982)), liposome-mediated transfection method (Wong, TK et al, Gene , 10:87 (1980).), DEAE- (Yang et al., Proc. Natl. Acad. Sci. , 87: 9568-9572 (1990)) and dextran treatment (Gopal, Mol. Cell Biol. , 5: 1188-1190 ) Or the like into the host cell.

According to still another aspect of the present invention, there is provided a pharmaceutical composition for treating tumors, comprising the above-described transformed host cell as an active ingredient.

According to still another aspect of the present invention, there is provided a pharmaceutical composition for treating infarction comprising the above-described transformed host cell as an active ingredient.

The pharmaceutical composition of the present invention may contain, in addition to the active ingredient, a pharmaceutically acceptable carrier. Such carriers are those conventionally used in the field of the art and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone , Cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like.

The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Meanwhile, the oral dose of the pharmaceutical composition of the present invention is preferably 0.001 to 1000 mg / kg (body weight) per day.

The pharmaceutical composition of the present invention can be administered orally or parenterally. When administered parenterally, it can be administered by intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, transdermal administration, and the like.

The concentration of the active ingredient contained in the composition of the present invention can be determined in consideration of the purpose of treatment, the condition of the patient, the period of time required, and the like, and is not limited to a specific range of concentration.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in an oil or aqueous medium, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

According to another aspect of the present invention, there is provided a composition for tumor or infarction tissue image comprising the above-described transformed host cell as an active ingredient.

In the present invention, the dose, administration method and application to the compositions for tumor or infarct tissue images are the same as those described above for the pharmaceutical composition, and are not duplicated in order to avoid excessive complexity of the specification.

The term " for image " in the present invention means that it can be used for " monitoring ". The term " monitoring " means that the activity can be observed or recorded in vitro or in vivo. Monitoring includes, for example, collecting information about the development or progression of a biological process in a cell, tissue or organ. Monitoring of a specific activity in a cell, tissue or organ can be accomplished by imaging of a protein or peptide that can be produced in the cell or incorporated into the cell, and the imageable protein or peptide can have a bioluminescent or fluorescent property have. Monitoring may be performed to ascertain the presence, absence, concentration, localization, or differentiation status of the cells or tissues. Non-limiting examples of techniques for monitoring proteins or peptides capable of imaging include optical imaging (fluorescence and bioluminescence), PET, MRI, or SPECT.

According to another aspect of the present invention, the present invention provides a method of producing a protein via cell fermentation comprising the steps of: (a) (i) contacting an acyl-homoserine lactone operatively linked to a promoter (AHL ) Binding protein encoding nucleotide sequence; (Ii) an AHL synthase encoding nucleotide sequence operatively linked to a promoter; And (iii) constructing a construct comprising a protein encoding nucleotide sequence operatively linked to a promoter for expression purposes; (b) preparing a recombinant vector comprising the constructed construct; (c) transforming the prepared recombinant vector into a host cell; And (d) culturing the transformed host cell to express the expressed protein of interest.

In the method of the present invention, the construct, expression vector, recombinant vector, host cell, and transformation are the same as those described in the other aspects of the present invention. Therefore, in order to avoid excessive complexity of the specification, I never do that.

The host cell can be cultured by a known cell culture method or a modified method thereof. For example, when the host cell is E. coli, the medium for culturing the transformed host cell may be a natural medium or a synthetic medium, if it contains carbon sources, nitrogen sources, inorganic salts, etc. that E. coli can efficiently utilize Can be used. Carbon sources that may be used include carbohydrates such as glucose, fructose, sucrose; Starch, hydrolyzate of starch; Organic acids such as acetic acid and propionic acid; Ethanol, propanol, alcohols such as glycerol, and the like. The nitrogen source may be ammonia; Ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate and ammonium phosphate; Peptone, meat extract, yeast extract, corn steep liquor, casein hydrolyzate, soybean extract, soy hydrolyzate; Various fermented cells and their degradation products and the like. Inorganic salts include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, manganese sulfate, copper sulfate, calcium carbonate and the like.

The cultivation is usually carried out under aerobic conditions such as by shaking culture or rotation by a rotator. The incubation temperature is preferably in the range of from 15 to 40 DEG C, and the incubation time is generally from 5 hours to 7 days. On the other hand, in the case of a host cell comprising the construct of the present invention, the expression of the protein is self-induced by recognizing the autologous cell concentration. Therefore, culture for up to a certain cell concentration is required for protein expression, The concentration of cultured cells can be determined. The pH of the medium is preferably maintained in the range of 3.0 to 9.0 in the culture. The pH of the medium can be adjusted with inorganic or organic acids, alkali solutions, urea, calcium carbonate, ammonia, and the like. Antibiotics such as ampicillin, streptomycin, chloramphenicol, kanamycin and tetracycline may be added during culture to maintain and express the recombinant vector if necessary. Host cells comprising the construct of the invention do not require the addition of inducers to the culture medium for expression of the protein.

According to another aspect of the present invention, there is provided a method for treating a tumor, comprising administering to a subject having a tumor a pharmaceutical composition for tumor therapy comprising the above-described transformed host cell as an active ingredient .

According to another aspect of the present invention, the present invention provides a pharmaceutical composition for treating infarction comprising the above-described transformed host cell as an active ingredient, to a subject having infarction disease, ≪ / RTI >

According to another aspect of the present invention, the present invention provides a method for imaging a tumor or infarction comprising administering to a subject a composition for tumor or infarct tissue image comprising the above-described transformed host cell as an active ingredient . ≪ / RTI >

The features and advantages of the present invention are summarized as follows:

(i) The present invention relates to a construct for expressing a self-inducible protein or nucleic acid molecule which is induced by recognizing an autologous cell concentration without a separate inducer.

(Ii) The present invention also relates to a recombinant vector comprising the construct, a host cell transformed with the recombinant vector, and a tumor or a pharmaceutical composition for treating infarction comprising the host cell as an active ingredient.

(Iii) The present invention also relates to a composition for tumor or infarction tissue image comprising the host cell as an active ingredient.

(Iv) The construct of the present invention may be introduced into attenuated Salmonella genus host cells and used for anticancer and infarction treatment.

(V) The construct of the present invention may be introduced into attenuated Salmonella genus host cells and used for tumor or use and infarcted tissue image applications.

(Vi) The construct of the present invention is a self-inducible construct in which the expression of a protein or a nucleic acid molecule is induced by sensing an autologous cell concentration, and no separate inducer is required for the expression of a protein or a nucleic acid molecule. Production and delivery are possible, and it is possible to produce economical protein through cell fermentation.

The present invention relates to a construct for expressing a self-inducible protein or nucleic acid molecule which is induced by recognizing an autologous cell concentration and various uses of the construct. The construct of the present invention is a self inducible expression construct induced by sensing cell concentration, and no separate inducer is required for gene expression. The construct of the present invention can be used in anticancer applications, infarction treatment applications and imaging of tumors or infarction tissues by introducing the constructs into host cells, particularly host cells of attenuated Salmonella genus. The use of the Salmonella genus host cell having the construct of the present invention can effectively produce and deliver the drug in vivo, thereby maximizing the therapeutic effect. Further, by using the fermentation of host cells containing the construct of the present invention, it is possible to produce economical protein without the addition of an inducer.

FIG. 1 shows an embodiment in which the recombinant plasmid of the present invention expresses a target gene by self-induction in bacteria. Panel A shows that when the concentration of acyl homoserine lactone (AHL, N-acylhomoserine lactone), which is the product of the lux I gene, exceeds the threshold value as the cell concentration increases, it binds to the luxR gene product in the cell and induces transcription of the target gene. Induces the mechanism by which the target protein is over-expressed by induction. Panel B shows the mechanism by which expression of the AraC ^C protein, which is a positive regulator of the P _BAD promoter, is induced by cell concentration recognizing induction, so that the target protein is stably and continuously expressed.
Fig. 2 shows the structure of an expression construct produced according to the method described in Example 3. Fig. MCherry, asparaginase, holin & lysin, TGF? PE38, lucifsrase, il32 ?, il32? And the like are exemplified as target proteins.
Fig. 3 shows a photograph of a strain of E. coli XL1-blue derived from a single colony selected in Example 4 at 37 ° C and 200 rpm for 12 hours. In Fig. 3, A is a strain containing pBAD24 (empty vector) (control group), B in Fig. 3 is a strain containing pBAD24-luxI-mCherry vector, and C in Fig. 3 is pBAD24-luxR-luxI-mCherry vector Lt; / RTI >
FIG. 4 shows the results of 10% SDS-PAGE analysis of the expression of mCherry protein in E. coli XL1-Blue transformed with pBAD24 and pBAD24-luxR-luxI-mCherry plasmid over time. As the marker, a protein ladder purchased from GenDEPOT was used, and the box represents self-induced mCherry protein.
FIG. 5 shows the expression of mCherry protein in E. coli XL1-Blue transformed with pBAD24, pBAD24-luxR-mCherry, pBAD24-luxI-mCherry and pBAD24-luxR-luxI-mCherry plasmid through Native-PAGE . Lane 1, a protein lysate of E. coli having pBAD24 as a control; Lane 2, protein lysate of E. coli with pBAD24 including luxI-mCherry; Lane 3, a protein lysate of E. coli with pBAD24, including luxR-mCherry; Lane 4, a protein lysate of E. coli with pBAD24 containing luxR-luxI-mCherry, and box represents self-induced mCherry protein.
Figure 6 shows the results of culturing E. coli XL1-Blue transformed with uninoculated medium (control), pBAD24, pBAD24-luxI-mCherry, or pBAD24-luxR-luxI-mCherry plasmid at 37 ° C and 200 rpm The medium was sampled and the absorbance at OD ₆₀₀ was measured and the intensity of fluorescence was measured at an emission wavelength of 610 nm after irradiating light at an excitation wavelength of 580 nm. The growth curve (graph A) and fluorescence intensity ).
FIG. 7 is a graph showing fluorescence intensity and absorbance of E. coli XL1-Blue transformed with pBAD24-luxR-luxI-mCherry plasmid by subculturing culture medium at 37.degree. C. and 200 rpm over time.
FIG. 8 shows the fluorescence intensity of the autoinducer synthesis of E. coli XL1-Blue strains containing the construct luxR-mCherry, luxI-mCherry, or luxR-luxI-mCherry of the present invention .
FIG. 9 shows the results of fractionation of E. coli XL1-Blue strain transformed with pBAD-luxR-lux I-ASP (asparaginase) recombinant plasmid into total protein and soluble protein to obtain asparaginase Overexpression was confirmed by 10% SDS-PAGE.
FIG. 10 shows the results of analysis of total protein while culturing Salmonella typhimurium strain transformed with pBAD24-luxR-luxI-ASP recombinant plasmid. The expression of asparaginase (ASP) in the culture medium having OD ₆₀₀ = 1.04 or more is remarkably increased.
FIG. 11 shows the results of SDS-PAGE analysis of secreted proteins in culture after culturing Salmonella typhimurium strain transformed with pBAD24-luxR-luxI-ASP recombinant plasmid. It was confirmed that secretion of asparaginase (ASP), which is an anti-cancer protein, occurs very well.
FIG. 12 shows the results obtained by inoculating and culturing Salmonella typhimurium: SMR2130 (luxR-ASP, luxI-ASP, luxR-luxI-ASP) in a culture medium of mouse colon cancer cell line CT26 cells and mouse breast cancer cell line MDA- SDS-PAGE analysis. It was confirmed that overexpression of asparaginase (ASP), an anticancer protein, occurs very well.
FIG. 13 shows the results obtained by inoculating Salmonella typhimurium: SMR2130 (luxR-ASP, luxI-ASP, luxR-luxI-ASP) into CT26 cells of mouse colorectal cancer cell line and MDA-MB435 cell line of mouse breast cancer cell line, And the cell viability of the strain was measured.
FIG. 14 shows the results of experiments in which 10% SDS-PAGE induction of expression of E. coli XL1-Blue strains into which pBAD-luxR-luxI-PspTGFαPE38 recombinant plasmid was introduced. Psp TGF [alpha] PE38 was overexpressed.
FIG. 15 shows viable cell count, absorbance, and fluorescence microscopic results of viable cell number of E. coli XL1-Blue transformed with pBAD24-luxR-luxI-holin & lysins plasmid.
FIG. 16 shows experimental results of 10% SDS-PAGE induction of expression of E. coli XL1-Blue strains transformed with pBAD-luxR-luxI-araC ^C -ASP-araC ^C plasmid. It was confirmed that AraC ^C and ASP (Asparaginase) were overexpressed.
17 shows in vivo experiments in which S. typhimurium was transformed with pBAD24 plasmid into which luxR-luxI-ASP and luxR-luxI-pspTGFαPE38 constructs were respectively inserted into colon cancer cell CT26 cells Time, and size of the tumor.
18 shows the results of an analysis of luciferase activity of E. coli XL1-Blue transformed with pBAD-luxR-luxI-luciferase plasmid. Panel A shows the luciferase activity compared to the control group after 7 hours, Panel B shows the activity of luciferase induced by induction of the cell concentration recognizer of the cells sampled over time .
FIG. 19 is a photograph showing the degree of luminescence by exposure to IVIS 200 for 1 minute, and it can be confirmed that luminescence is induced by self-induced luciferase in the vicinity of cancer cells.
20 shows experimental results of Western blot analysis of E. coli XL1-Blue strains transformed with pBAD-luxR-luxI-il32? Or pBAD-luxR-luxI-il32? Plasmid. Overexpression of cytokines overexpressed by self-induction.
Fig. 21 shows the structure and action mechanism of the " AraC ^c " transcription factor of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1: Bacterial strain, medium and culture conditions

In the experiment of the present invention, Escherichia coli XL1-Blue [endA1 gyrA96 (nalR) thi-1 recA1 relA1 lacglnV44 F ':: Tn10 proAB + lacI? (LacZ) M15] hsdR17 (rK- mK +) was used as a host cell for gene cloning Salmonella typhimurium SMR2130 (hisG xyl rpsL glamS :: kan, kanr) and Salmonella typhimurium ppGpp (glms negative mutant) were used as host cells for protein expression and bacterial therapy studies. The E. coli and S. typhimurium strains used in this experiment were cultured at 37 ° C in a Luria-Bertani (LB) medium (Difco Laboratories, USA) containing 1% NaCl. And 50 μg / ml of ampicillin was added.

Example 2: Preparation and transformation of competent cells

E. coli ( Escherichia coli XL1-Blue) Competent cells were prepared as follows. First, the cells were cultured in LB agar medium, transferred to LB liquid medium, inoculated, and cultured at 18 ° C. in SOC medium supplemented with 20 mM MgCl ₂ . When the OD ₆₀₀ value was 0.5, the cells were recovered and washed with an Inoue transformation buffer to prepare transgenic cells. The transformants were mixed with competent cells and allowed to stand in ice for 30 minutes, followed by heat shock at 42 ° C for 90 seconds. The prepared samples were allowed to stand on ice for 2 minutes, then cultured at 37 ° C, and then plated on LB plates containing antibiotics.

Competent cells of Salmonella ( Salmonella typhimurium SMR2130 and Salmonella typhimurium ppGpp) were prepared as follows. First, the cells were cultured in LB agar medium and then re-inoculated into LB liquid medium. When the absorbance (OD ₆₀₀ ) value of the culture reached 2.0, it was inoculated to 1% of the present culture. After OD ₆₀₀ was 0.6, the cells were washed three times with 10% ) Were prepared. Recombinant plasmids were added to 40 μl of the prepared cells, respectively, and the cells were loaded on an electroporation apparatus (Bio-Rad, USA). Then, a 2.5 kV current was applied for 4.8 ms for transformation. Subsequently, 1 ml SOC medium was added and cultured at 37 ° C for 1 hour, and clones having ampicillin resistance were selected on a solid medium.

Example 3: Preparation of recombinant plasmid

Primers were prepared and amplified by polymerase chain reaction (PCR) using luxR, luxI, mCherry, asparaginase, holin and lysin, luciferase, araC ^C , PspTGFα-PE38, il32β, His-tag il32β, il32γ and His- . The primers used in this experiment are shown in Tables 1 to 7 below. The PCR was carried out for 30 cycles at 95 ° C for 30 seconds (denaturation), 53 ° C for 45 seconds (annealing, annealing) and 72 ° C for 90 seconds (extension). Overlapping PCR was performed by mixing the amplified genes at the same ratio. Overlapping PCR was performed for 20-30 cycles at 95 ° C for 30 seconds (denaturation), 53 ° C for 45 seconds (annealing) and 72 ° C for 2 minutes and 30 seconds (extension). Each amplified gene was cloned into a pBAD24 plasmid digested with restriction enzymes such as BamH1 and SalI, EcoR1 and Nco1, EcoR1 and XmaI, Nsi1 and MluI, and finally ligated with luxR-luxI-mCherry, luxR-mCherry, luxI-mCherry , luxR-luxI-ASP, luxR -ASP, luxI-ASP, luxR-luxI-holin & lysin, luxR-luxI-araC C, luxR-luxI-luciferase, luxR-luxI-PspTGFαPE38, luxR-luxI-il32β, luxR-luxI- PBAD24 plasmid recombinant vectors containing constructs of His tag il32?, LuxR-luxI-il32?, And luxR-luxI-His tag il32? Structures were constructed. On the other hand, in order to prevent plasmid curing in an in-vivo environment without antibiotics, the glmS gene was inserted into the Cla I restriction site of the pBAD plasmid (Kim et al., PLOS one, Volume: e60511, 2013).

Name of the primer The primer sequence (5 '- > 3') luxR-1 (Forward) CGCGGATCCTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 1) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward-1) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-2 (Forward-2) CGCGGATCCCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 4) luxI-3 (Reverse) CTTGCTCACCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC (SEQ ID NO: 5) mCherry-1 (Forward) GTCTTAAATTAAAAAGGAGGACAGCTATGGTGAGCAAGGGCGAG (SEQ ID NO: 6) mCherry-2 (Reverse) CGCGGATCCTTACTACTTGTACAGCTCGTCC (SEQ ID NO: 7)

The primers in Table 1 are primers used in the construction of luxR-mCherry, luxI-mCherry, and luxR-luxI-mCherry constructs.

Name of the primer The primer sequence (5 '- > 3') luxR-1 (Forward) CGCGGATCCTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 1) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-4 (Reverse) TGAAAAACTCCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC
(SEQ ID NO: 8) luxI Promoter-asp
(Reverse) GAAAAACTCCATACCAACCTCCCTTGCGTTTATTC (SEQ ID NO: 9) IP asn (Forward) AGGGAGGTTGGTATGGAGTTTTTCAAAAAGACGGCAC (SEQ ID NO: 10) Asparaginase (Forward) GTCTTAAATTAAAAAGGAGGACAGCTATGGAGTTTTTCAAAAAGACGGCAC (SEQ ID NO: 11) Asparaginase (Reverse) CGCGGATCC TTAGTACTGATTGAAGATCTGCTG (SEQ ID NO: 12)

The primers of Table 2 are primers used in the construction of luxR-ASP, luxI-ASP and luxR-luxI-ASP constructs.

Name of the primer The primer sequence (5 '- > 3') luxR-3 (Forward) ATATGGATCCTTAATTTTTAAAGTATGGGCAATCAATTG (SEQ ID NO: 13) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI (Forward) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-H & L (Reverse) CCATTTCGCTCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC (SEQ ID NO: 14) luxI-H & L (Forward) GTCTTAAATTAAAAAGGAGGACAGCTATGAGCGAAATGGAACGGGAAC (SEQ ID NO: 15) H & Lsal1 (Reverse) ATATGTCGAC TTAATCCTTTCGACGCATCCAC (SEQ ID NO: 16)

The primer of Table 3 is a primer used in the construction of luxR-luxI-holin & lysin construct.

Name of the primer The primer sequence (5 '- > 3') luxR EcoR1 (Forward) TTAAGAATTCTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 17) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward-1) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-3 (Reverse) CTTGCTCACCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC
(SEQ ID NO: 5) Luciferase (Forward) GTCTTAAATTAAAAaggaggacagctATGGCTTCCAAGGTGTACG (SEQ ID NO: 18) Luciferase Nco1 (Reverse) attaCCATGGTTATCAATGATGATGATGATGATGGTC (SEQ ID NO: 19)

The primers in Table 4 are primers used in the construction of the luxR-luxI-luciferase construct.

Name of the primer The primer sequence (5 '- > 3') luxR NsiI (Forward) ttaaATGCATTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 20) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-araC ^C (Reverse) CGCTTCAGCCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC
(SEQ ID NO: 21) araC ^C (Forward) GTCTTAAATTAAAAAGGAGGACAGCT ATGGCTGAAGCGCAAAATGATC (SEQ ID NO: 22) araC ^C Mlu1 (Reverse) attaACGCGTTTATGACAACTTGACGGCTACATC (SEQ ID NO: 23)

The primer in Table 5 is a primer used in the construction of luxR-luxI-araC ^C construct.

Name of the primer The primer sequence (5 '- > 3') luxR EcoR1 (Forward) TTAAGAATTCTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 24) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-PE38 (Reverse) CTTCAAACCCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC
(SEQ ID NO: 25) PE38 (Forward) GTCTTAAATTAAAAAGGAGGACAGCTATGGGTTTGAAGATGAAGAAAAGATC (SEQ ID NO: 26) PE38 Xma1 (Reverse) ATTTACCCGGGTTACTTCAGGTCCTCGCGC (SEQ ID NO: 27)

The primer in Table 6 is a primer used in the construction of luxR-luxI-Psp-TGFα-PE38 construct.

Name of the primer The primer sequence (5 '- > 3') luxR EcoR1 (Forward) TTAAGAATTCTTAATTTTTAAAGTATGGGCAATCAATTGC (SEQ ID NO: 24) luxR-2 (Reverse) AAGGATAAAGAGATGGGTATGAAAGACATAAATGCC (SEQ ID NO: 2) luxI-1 (Forward) TTTCATACCCATCTCTTTATCCTTTATCCTTACCTATTG (SEQ ID NO: 3) luxI-il32 his tag (Reverse) TGAAAAACTCCATAGCTGTCCTCCTTTTTAATTTAAGACTGCTTTTTTAAACTGTTC
(SEQ ID NO: 28) luxI-il32 (Reverse) GAAAAACTCCATACCAACCTCCCTTGCGTTTATTC (SEQ ID NO: 29) his tag il32 (Forward) AGGGAGGTTGGTATGGAGTTTTTCAAAAAGACGGCAC (SEQ ID NO: 30) il32 (Forward) GTCTTAAATTAAAAAGGAGGACAGCTATGGAGTTTTTCAAAAAGACGGCAC (SEQ ID NO: 31) il32 (Reverse) CGCGGATCCTTAGTACTGATTGAAGATCTGCTG (SEQ ID NO: 32)

The primers of Table 7 are primers used for the construction of luxR-luxI-il32 ?, luxR-luxI-His tag il32 ?, luxR-luxI-il32 ?, and luxR-luxI-His tag il32? Constructs.

Example 4: Autoinduction of luxR-mCherry, luxI-mCherry or luxR-luxI-mCherry construct in E. coli

E. coli competent cells and pBAD24 plasmid introduced with luxR-mCherry, luxI-mCherry, or luxR-luxI-mCherry construct were respectively mixed to confirm that the self-induction system was operated in this embodiment, and in Example 2 And transformed as described. Single colonies grown on a solid medium were pre-cultured in a 15-ml test tube, inoculated 1% in a 100-ml Erlenmeyer flask, and cultured at 37 ° C and 200 rpm. 3 is a photograph of a single colony cultured at 37 DEG C and 200 rpm for 12 hours. As shown in FIG. 3, mCherry protein was expressed by a quorum sensing mechanism without an inducing substance. In order to confirm protein expression by SDS-PAGE, when the expression of mCherry protein in E. coli XL1-Blue transformed with pBAD24 and pBAD24-luxR-luxI-mCherry was sampled over time, MCherry protein was expressed after 6 hours (Fig. 4). Finally, it was confirmed through the native page that the fluorescent protein mCherry was overexpressed by self-induction in the recombinant plasmid pBAD24-luxR-luxI-mCherry of the present invention (FIG. 5).

Example 5 Growth Assay and Fluorescence Intensity Measurements of E. coli Including Control, luxI-mCherry or luxR-luxI-mCherry Construct

In order to understand when the expression of the gene in the construct is self-induced in this embodiment, E. coli transformed with pBAD24 recombinant plasmid into which a control, luxI-mCherry, or luxR-luxI-mCherry construct was introduced Were cultured as in Example 4 above. Samples were sampled over time to measure the absorbance at OD ₆₀₀ and the fluorescence intensity was measured at excitation wavelength 580 nm and emission wavelength 610 nm. Based on this, a graph of fluorescence intensity according to a growth curve and protein expression was prepared (Fig. 6). As a result, the transformed Escherichia coli showed a typical growth curve with lag phase, log phase, and stationary phase without growth inhibition. In addition, it was confirmed that the fluorescence intensity rapidly increased in the late phase of the exponential phase (log phase). From the above results, it was found that the mCherry fluorescent protein was overexpressed in the late phase of the exponential phase (log phase) by self-induction.

Example 6: Passage of Escherichia coli containing luxR-mCherry, luxI-mCherry, or luxR-luxI-mCherry construct

In this example, Escherichia coli transformed with pBAD24 recombinant plasmid introduced with luxR-mCherry, luxI-mCherry, or luxR-luxI-mCherry construct was pre-cultured and then inoculated in a 125 ml Erlenmeyer flask at a concentration of 1% And subcultured continuously at 37 DEG C and 200 rpm. During the subculture, the culture was sampled over time to measure the absorbance at OD ₆₀₀ , and the growth curves and fluorescence intensities were plotted on the basis thereof. Growth curves and fluorescence intensities are shown in Fig. As a result, the intensity of mCherry fluorescent protein induced by self-induction periodically showed a sharp increase pattern in the late log phase. Therefore, it was confirmed that the expression target gene in the construct of the present invention is very stable and repeatedly expressed.

Example 7: Growth analysis of E. coli including luxR-mCherry, luxI-mCherry, or luxR-luxI-mCherry construct and confirmation of the synthesis of autoinducer

E. coli transformed with the recombinant plasmid pBAD-luxR-luxI-mCherry was cultured for 12 hours in the same manner as in Example 4, in order to examine whether the construct of the present invention synthesized an autoinducer. The prepared sample was centrifuged at 6000 rpm for 10 minutes, and the supernatant was taken and filtered with a membrane (0.2 mu m) to remove residual solids. The cells were added to LB medium supplemented with the pBAD24 vector, pBAD24-luxR-mcherry, or pBAD24-luxR-luxI-mcherry, respectively, in the presence of 0%, 20% and 40% Respectively. The culture solution was sampled every 60 minutes to measure the absorption and fluorescence intensities (FIG. 8). As a result of adding the above sample to E. coli transformed with pBAD24-luxR-mcherry, the fluorescence intensity rapidly increased in E. coli including pBAD24-luxR-mcherry plasmid. From these results, it was confirmed that there is an autoinducer in the cell culture.

Example 8: Expression of asparaginase in E. coli transformed with pBAD-luxR-luxI-ASP (asparaginase) recombinant plasmid

In order to express the anticancer gene by the self-induction mechanism using the construct of the present invention, Escherichia coli competent cells and the recombinant plasmids pBAD-luxR-ASP (asparaginase), pBAD-luxI-ASP pBAD-luxR-luxI-ASP were respectively mixed and transformed by the method described in Example 2, and then cultured by the method described in Example 4. [ SDS-PAGE was performed to confirm the expression of asparaginase, and asparaginase was overexpressed by the self-inducing mechanism even when no inducer was present (FIG. 9).

Example 9: Identification of expression of asparaginase in salmonella including luxR-ASP, luxI-ASP, or luxR-luxI-ASP construct

Protein analysis of Salmonella (S. typhimurium) transformed with pBAD24-luxR-luxI-ASP

Salmonella (S. typhimurium) competent cells and pBAD24-luxR-ASP, pBAD24-luxI-ASP and pBAD24-luxR-luxI-ASP recombinant plasmids were mixed according to the method described in Example 2 and transformed into Salmonella , And a single colony selected was subjected to SDS-PAGE by taking samples over time while incubating them as described in Example 4. As a result, it was confirmed that the expression of asparaginase was remarkably increased in the culture medium of OD ₆₀₀ = 1.04 or more of the Salmonella strain transformed with the pBAD24-luxR-luxI-ASP recombinant plasmid (FIG. 10).

② Secretory protein analysis of Salmonella (S. typhimurium) transformed with pBAD24-luxR-luxI-ASP

Salmonella strains transformed with the recombinant plasmid pBAD24-luxR-luxI-ASP were sampled over time and centrifuged at 12,000 rpm for 2 minutes. The supernatant was collected and the protein was recovered using the TCA protein precipitation protocol to obtain asparaginase And the degree of secretion was confirmed (Fig. 11). As a result, it was confirmed that the secretion of the anti-cancer protein asparaginase was very effective. Since the secretion of anticancer proteins in tumor tissues greatly affects the anticancer effect, the expression system of the present invention will be usable in-vivo as a useful anticancer agent expression module.

Example 10: Expression of asparaginase after animal cell culture and Salmonella (S. typhimurium) treatment

It was confirmed that the salmonella cells transformed with the plasmid containing the expression construct of the present invention normally grow in the animal cell culture medium and induce the expression of the target protein. Mouse colorectal cancer cell line CT26 cells were cultured in DMEM (high-glucose Dulbecco's modified Eagle) medium supplemented with 10% FBS and 1% penicillin / streptomycin. The mouse breast cancer cell line MDA-MB435 cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin / And cultured in RPMI medium supplemented with streptomycin in an incubator maintained at 37 ° C, 5% CO ₂ and 95% or more humidity. Each cell line was treated with trypsin EDTA to obtain cells. The cells were transferred to 48-wells for 10 ⁴ cells, cultured for 24 hours, and transformed with a plasmid carrying the expression construct, The cells were cultured to a state before operation (OD ₆₀₀ = 0.2 - 0.3), and then concentrated 10 times and mixed at 1%. SDS-PAGE (Fig. 12) for confirmation of protein expression and viable cell count for viable cell count were performed (Fig. 13). The viable cell count was measured by counting the number of surviving colonies formed after 14 hours after 20 占 퐇 of the cell culture solution sampled every hour was diluted by 1/10 and plated on the plate. As a result of experiments, it was found that asparaginase was overexpressed from salmonella when inoculated with animal cell culture broth and inoculated with salmonella transformed with pBAD24-luxR-ASP, pBAD24-luxI-ASP or pBAD24-luxR-luxI-ASP plasmid (Fig. 12). This means that the expression constructs of the present invention are efficiently run without inducing agents by induction of cell concentration recognizers in animal cell or culture conditions. In addition, it was confirmed that when the salmonella of the present invention co-cultured with animal cells, it proliferated up to 10 ⁹ cells, which is a cell number for inducing a cell concentration recognizer (FIG. 13). From these experimental results, it can be seen that the construct of the present invention can be well expressed and operated in in-vivo.

Example 11 Growth of Bacteria Transformed with pBAD24-luxR-luxI-PspTGFαPE38 or pBAD24-luxR-luxI-PspTGFαPE38 Plasmid and Expression of Psp-TGFα-PE38 Fusion Protein

In order to confirm the expression of the fusion protein-encoding gene fused with the protein domain for the anticancer therapy in this Example, recombinant plasmids pBAD24-luxR-luxI-PspTGFαPE38 were mixed with E. coli competent cells and Salmonellacompetent cells, Respectively. Also, as in Example 4, samples were taken at different times during the main culture and subjected to SDS-PAGE. As a result of the experiment, it was confirmed that the Psp-TGFα-PE38 protein was effectively expressed without inducing the induction of cell concentration in each strain as in the expression of asparaginase (FIG. 14). Depending on the purpose, the Psp-TGFα-PE38 protein can be increased by loading it with the holin & lysin protein as shown below.

Example 12: Effect of holin & lycin on the growth of E. coli transformed with pBAD24-luxR-luxI-holin & lysins plasmid

In this example, E. coli competent cells and pBAD24-luxR-luxI-holin & lysin recombinant plasmids were mixed in order to confirm that the strain having the plasmid containing the expression construct efficiently expresses the gene of interest and secretes the protein, 2. Then, as in Example 4, the cell culture was sampled at different times during the main culture, and the absorbance was measured. The Holin & lysin protein used in the experiment is a protein involved in host dissolution cycle of phage, and has an activity of destroying the cell wall of bacteria. As a result, the cell lysis was observed when the cell concentration was above a certain level by the holin & lysin protein expressed by the self-inducing mechanism in the recombinant strain compared with the control group, and the number of viable cells was decreased by more than 99% . Live-death cell staining with a microscope also confirmed the lysis phenomenon (Fig. 15). In the live-death cell staining experiment, cell lysis began at the initial lysis stage, and the cell wall was no longer robust, and it was confirmed to be round in the microscope. Through the activity of the holin & lysin protein as described above, when the holin & lysin gene is loaded with the poorly secreted anti-cancer gene, the cancer drug can be efficiently secreted into the tumor tissue, thereby greatly enhancing the drug effect. In addition, the lytic time of bacteria can be controlled by the expression (rate) of holin & lysin by self-induction mechanism. This means that it is possible to design / control the lysis point according to the timing necessary for the production of the drug protein in vivo in the process of transferring the drug protein. Regulation of the expression rate is controlled by the amount of LuxR transcription factor, regulation of LuxI expression level of the autoinducer production gene, and the method of controlling the affinity of the promoter which is a cis-acting element to which LuxR transcription factor binds. But is not limited thereto. In this experiment, a method of regulating the expression level of luxR transcription factor using different luxR promoter regions was used. The LuxR promoter was prepared by fusing CEM and tac promoters to produce recombinant promoters, and transformants were transformed in the same manner as above to select recombinant strains. Absorbance was measured and compared with the control group. As a result, as shown in FIG. 15, it was confirmed that the lytic time was differentiated by the differential expression rate of the holin & lysin protein in the two constructs. These results indicate that the time point of ligation of the drug protein in vivo using the transformed bacterial cells can be controlled, and thus the delivery level of the expressed drug protein can be controlled as necessary.

Example 13: pBAD24-luxR-luxI-AraC ^C -ASP-AraC ^C  Identification of cell density in E. coli transformed with recombinant plasmid and expression of the drug by positive feedback

A recombinant strain having a plasmid containing the construct of the present invention has an expression cone having a constitution of luxR-luxI-AraC ^C- ASP (asparaginase) -AraC ^C to induce stable and constant expression of the target gene The tread was manufactured. Escherichia coli competent cells and pBAD24 plasmid with luxR-luxI-AraC ^C- ASP-AraC ^C construct were mixed and transformed as in Example 2. Then, SDS-PAGE was carried out after 12 hours of culturing as in Example 4. As a result, it was confirmed that asparaginase, an anticancer gene, and AraC ^C protein as a positive feedback regulator were overexpressed (FIG. 16). This means that the construct of the present invention induces the expression of AraC ^C protein, which is a positive regulator of the P _BAD promoter by cell concentration recognizing induction, so that the anti-cancer protein is stably and continuously expressed.

Example 14. In-vivo anticancer efficacy using Salmonella

The effect of the present invention was confirmed in an animal mouse in which solid tumors were induced to examine whether Salmonella having the plasmid containing the anti-cancer protein expression construct of the present invention exhibited the anti-cancer effect in vivo. Male Black 6 mice, 5 to 6 weeks of age, were purchased from Multiscience, and mouse growth, experimentation, and euthanasia were performed according to the regulations approved by Chonnam National University Animal Research Committee. First, subcutaneous tumors were induced in the experimental animals as follows. The tumor cells cultured in vitro through the method described in Example 10 were harvested by centrifugation, suspended in 100 μl of PBS, and injected subcutaneously to the right side of the mouse. CT26 cells as a colon cancer cell line and MDA-MB435 mouse breast cancer cell line were used as 5 x 10 ⁵ cells, respectively. Anticancer Protein Expression of the Present Invention Salmonella was cultured overnight and suspended in PBS. 4.5 x 10 ⁷ cells were injected into the vein portions of three mouse tails in which tumors were formed in each experimental group using 1 cc of insulin syringe. 23 days after administration of colon cancer cells, the size of colon cancer tissue was measured. Tumor size (mm ³ ) was determined by applying the volume formula (width x height x height) / 2. As a result, when Salmonella expressing the anti-cancer protein was administered compared to the control group administered with PBS, the size of the colon cancer tissue was decreased (Fig. 17). Therefore, it has been confirmed that cancer cells are efficiently treated by inducing cell concentration recognizing agent in animal, without inducing substance, to treat cancer cells.

Example 15: Growth of E. coli transformed with recombinant plasmid pBAD24-luxR-luxI-luciferase and expression of luciferase

Luciferase is a reporter protein used to study the regulation and function of genes in vitro and in vivo, generating light by catalyzing an oxidation reaction using oxygen. The luxR-luxI-luciferase construct was constructed to confirm expression of the gene of interest in the gene expression system of the present invention in the in-vivo cancer cell region. Escherichia coli competent cells and recombinant plasmid pBAD24-luxR-luxI-luciferase were mixed and transformed as described in Example 2. Then, the cells were cultured for 12 hours in the manner described in Example 4, and sampled by time to analyze luciferase activity. The cell culture was centrifuged at 4,000 rpm for 5 minutes to remove supernatant, and then washed with phosphate buffered saline (PBS) at pH 7.0. To measure Renilla luciferase activity, 0.5 mg of coelenterazine was added to 100 ml of phosphate buffered saline (PBS) at pH 7.0, and then incubated with a luminometer (model infinite M200; TECAN, austria) After photon counting for 10 seconds, 100 占 퐇 of cell culture was analyzed. As a result, it was found that luciferase activity was significantly increased after 7 hours of cell culture, and that the expression of luciferase by self-induction increased the activity of luciferase at a specific time (FIG. 18). Thus, it was confirmed that luciferase was expressed and exhibited activity by the self-induction system of the present invention.

Example 16: Monitoring of in-vivo tumor cells using Salmonella

The distribution of cancer cells was confirmed in an animal mouse in which solid tumor cells were induced as in Example 10 above. Luciferase-expressing salmonella transformed with the pBAD24-luxR-luxI-luciferase plasmid prepared in Example 15 was suspended in PBS overnight, and then 3.7 x 10 ⁷ cells were inoculated with 1 cc of insulin syringe. And injected into the vein portion of the formed mouse tail. In this case, the in-vivo emission image monitoring method is as follows. D-luciferin was dissolved in PBS to a concentration of 3 mg / ml and filtered using a 0.2 탆 syringe filter. 100 μl of 3 mg / ml D-luciferin was intraperitoneally injected into the experimental animal rats using a 30-gauge needle. After 15 minutes, isoflurane (2%) or ketamine (xylazine, 10 mg / kg) and IVIS 200 for 1 min to measure the degree of luminescence. As a result, luminescence by self-induced luciferase could be confirmed in the vicinity of cancer cells (Fig. 19). Therefore, the present invention can specifically detect the proliferation and metastasis of cancer cells in vivo, and can be very useful for in vivo activity analysis of anti-cancer drugs.

Example 17: Expression of il32?, His-tag il32?, Il32?, And His-tag il32? Protein in Escherichia coli using the construct of the present invention

In the above examples, it was confirmed that the expression construct of the present invention induces overexpression of the target gene in a soluble form. Human-derived cytokines were overexpressed using the expression construct system of the present invention in order to stably overexpress the proteins used for industrial and medical purposes. Escherichia coli competent cells were mixed with pBAD24 plasmid containing constructs of luxR-luxI-il32?, LuxR-luxI-His-tag il32 ?, luxR-luxI-il32 ?, and luxR-luxI-His-tag il32? Respectively. Subsequently, the cells were cultured for 12 hours as in Example 4, and proteins transferred to nitrocellulose membranes (Amersham Biosciences) using SDS-PAGE and purified anti-human anti-human IL-32αβδ (50/100, BioLegend, num: 513601) Western blotting was performed by treating the ECL (enhanced chemoluminescence) kit (Amersham Biosciences). As a result, it was confirmed that il32 proteins, which express very little or omnipotent expression, are overexpressed in a soluble form without an inducer by a typical method (Fig. 20). Since the fermentation process using the bacteria transformed with the recombinant expression vector uses an induction system which requires an expensive inducer, for example, a synthetic compound inducer such as IPTG (isopropyl-β-D-thiogalactopyranoside) And it is not economical to use it for mass production of low-priced industrial enzymes. Therefore, when the construct of the present invention is used, it is expected that the target protein can be overexpressed without inducing substance, thereby lowering the production cost of the fermentation process. In addition, when the self-induced holin & lysin expression system of the present invention is applied in the fermentation process, the cell disruption process is omitted, and the process for separating useful proteins can be performed more efficiently.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Industry Foundation of Chonnam National University <120> Auto-Cell Concentration Recognition Auto-Inducible Expression          System For Which Inducer Is Not Required and Use Thereof <130> PN140185 <160> 37 <170> Kopatentin 2.0 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 1 cgcggatcct taatttttaa agtatgggca atcaattgc 39 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 2 aaggataaag agatgggtat gaaagacata aatgcc 36 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 3 tttcataccc atctctttat cctttatcct tacctattg 39 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 4 cgcggatccc tctttatcct ttatccttac ctattg 36 <210> 5 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 5 cttgctcacc atagctgtcc tcctttttaa tttaagactg cttttttaaa ctgttc 56 <210> 6 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 6 gtcttaaatt aaaaaggagg acagctatgg tgagcaaggg cgag 44 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 7 cgcggatcct tactacttgt acagctcgtc c 31 <210> 8 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 8 tgaaaaactc catagctgtc ctccttttta atttaagact gcttttttaa actgttc 57 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 9 gaaaaactcc ataccaacct cccttgcgtt tattc 35 <210> 10 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 10 agggaggttg gtatggagtt tttcaaaaag acggcac 37 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 11 gtcttaaatt aaaaaggagg acagctatgg agtttttcaa aaagacggca c 51 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 12 cgcggatcct tagtactgat tgaagatctg ctg 33 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 13 atatggatcc ttaattttta aagtatgggc aatcaattg 39 <210> 14 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 14 ccatttcgct catagctgtc ctccttttta atttaagact gcttttttaa actgttc 57 <210> 15 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 15 gtcttaaatt aaaaaggagg acagctatga gcgaaatgga acgggaac 48 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 16 atatgtcgac ttaatccttt cgacgcatcc ac 32 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 17 ttaagaattc ttaattttta aagtatgggc aatcaattgc 40 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 18 gtcttaaatt aaaaaggagg acagctatgg cttccaaggt gtacg 45 <210> 19 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 19 attaccatgg ttatcaatga tgatgatgat gatggtc 37 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 20 ttaaatgcat ttaattttta aagtatgggc aatcaattgc 40 <210> 21 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 21 cgcttcagcc atagctgtcc tcctttttaa tttaagactg cttttttaaa ctgttc 56 <210> 22 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 22 gtcttaaatt aaaaaggagg acagctatgg ctgaagcgca aaatgatc 48 <210> 23 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 23 attaacgcgt ttatgacaac ttgacggcta catc 34 <210> 24 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 24 ttaagaattc ttaattttta aagtatgggc aatcaattgc 40 <210> 25 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 25 cttcaaaccc atagctgtcc tcctttttaa tttaagactg cttttttaaa ctgttc 56 <210> 26 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 26 gtcttaaatt aaaaaggagg acagctatgg gtttgaagat gaagaaaaga tc 52 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 27 atttacccgg gttacttcag gtcctcgcgc 30 <210> 28 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 28 tgaaaaactc catagctgtc ctccttttta atttaagact gcttttttaa actgttc 57 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 29 gaaaaactcc ataccaacct cccttgcgtt tattc 35 <210> 30 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 30 agggaggttg gtatggagtt tttcaaaaag acggcac 37 <210> 31 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 31 gtcttaaatt aaaaaggagg acagctatgg agtttttcaa aaagacggca c 51 <210> 32 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> PCR primer <400> 32 cgcggatcct tagtactgat tgaagatctg ctg 33 <210> 33 <211> 252 <212> PRT <213> Vibrio fischeri <400> 33 Met Gly Met Lys Asp Ile Asn Ala Asp Asp Thr Tyr Arg Ile Ile Asn   1 5 10 15 Lys Ile Lys Ala Cys Arg Ser Asn Asn Asp Ile Asn Gln Cys Leu Ser              20 25 30 Asp Met Thr Lys Met Val His Cys Glu Tyr Tyr Leu Leu Ala Ile Ile          35 40 45 Tyr Pro His Ser Met Val Lys Ser Asp Ile Ser Ile Leu Asp Asn Tyr      50 55 60 Pro Lys Lys Trp Arg Gln Tyr Tyr Asp Asp Ala Asn Leu Ile Lys Tyr  65 70 75 80 Asp Pro Ile Val Asp Tyr Ser Asn Ser Asn His Ser Pro Ile Asn Trp                  85 90 95 Asn Ile Phe Glu Asn Asn Ala Val Asn Lys Lys Ser Pro Asn Val Ile             100 105 110 Lys Glu Ala Lys Thr Ser Gly Leu Ile Thr Gly Phe Ser Phe Pro Ile         115 120 125 His Thr Ala Asn Asn Gly Phe Gly Met Leu Ser Phe Ala His Ser Glu     130 135 140 Lys Asp Asn Tyr Ile Asp Ser Leu Phe Leu His Ala Cys Met Asn Ile 145 150 155 160 Pro Leu Ile Val Pro Ser Leu Val Asp Asn Tyr Arg Lys Ile Asn Ile                 165 170 175 Ala Asn Asn Lys Ser Asn Asn Asp Leu Thr Lys Arg Glu Lys Glu Cys             180 185 190 Leu Ala Trp Ala Cys Glu Gly Lys Ser Ser Trp Asp Ile Ser Lys Ile         195 200 205 Leu Gly Cys Ser Glu Arg Thr Val Thr Phe His Leu Thr Asn Ala Gln     210 215 220 Met Lys Leu Asn Thr Thr Asn Arg Cys Gln Ser Ile Ser Lys Ala Ile 225 230 235 240 Leu Thr Gly Ala Ile Asp Cys Pro Tyr Phe Lys Asn                 245 250 <210> 34 <211> 193 <212> PRT <213> Vibrio fischeri <400> 34 Met Thr Ile Met Ile Lys Lys Ser Asp Phe Leu Ala Ile Pro Ser Glu   1 5 10 15 Glu Tyr Lys Gly Ile Leu Ser Leu Arg Tyr Gln Val Phe Lys Gln Arg              20 25 30 Leu Glu Trp Asp Leu Val Val Glu Asn Asn Leu Glu Ser Asp Glu Tyr          35 40 45 Asp Asn Ser Asn Ala Glu Tyr Ile Tyr Ala Cys Asp Asp Thr Glu Asn      50 55 60 Val Ser Gly Cys Trp Arg Leu Leu Pro Thr Thr Gly Asp Tyr Met Leu  65 70 75 80 Lys Ser Val Phe Pro Glu Leu Leu Gly Gln Gln Ser Ala Pro Lys Asp                  85 90 95 Pro Asn Ile Val Glu Leu Ser Arg Phe Ala Val Gly Lys Asn Ser Ser             100 105 110 Lys Ile Asn Asn Ser Ala Ser Glu Ile Thr Met Lys Leu Phe Glu Ala         115 120 125 Ile Tyr Lys His Ala Val Ser Gln Gly Ile Thr Glu Tyr Val Thr Val     130 135 140 Thr Ser Thr Ala Ile Glu Arg Phe Leu Lys Arg Ile Lys Val Pro Cys 145 150 155 160 His Arg Ile Gly Asp Lys Glu Ile His Val Leu Gly Asp Thr Lys Ser                 165 170 175 Val Val Leu Ser Met Pro Ile Asn Glu Gln Phe Lys Lys Ala Val Leu             180 185 190 Asn     <210> 35 <211> 419 <212> PRT <213> Artificial Sequence <220> <223> AraCc <400> 35 Met Ala Glu Ala Gln Asn Asp Pro Leu Leu Pro Gly Tyr Ser Val Arg   1 5 10 15 Glu Ala Cys Gln Tyr Ile Ser Asp His Leu Ala Asp Ser Asn Phe Asp              20 25 30 Ile Ala Ser Val Ala Gln His Val Cys Leu Ser Ser Ser Ser Leu Ser          35 40 45 His Leu Phe Arg Gln Gln Leu Gly Ile Ser Val Leu Ser Trp Arg Glu      50 55 60 Asp Gln Arg Ile Ser Gln Ala Lys Leu Leu Leu Ser Thr Thr Arg Met  65 70 75 80 Pro Ile Ala Thr Val Gly Arg Asn Val Gly Phe Asp Asp Gln Leu Tyr                  85 90 95 Phe Ser Arg Val Phe Lys Lys Cys Thr Gly Ala Ser Pro Ser Glu Phe             100 105 110 Arg Ala Gly Cys Glu Glu Lys Val Asn Asp Val Ala Val Lys Leu Ser         115 120 125 Asn Glu Ser Leu His Pro Gly Pro Pro Met Asp Asn Arg Phe Asn Ala     130 135 140 His Leu Val Ala Gly Leu Thr Pro Ile Glu Ala Asn Gly Tyr Leu Asp 145 150 155 160 Phe Phe Ile Asp Arg Pro Leu Gly Met Lys Gly Tyr Ile Leu Asn Leu                 165 170 175 Thr Ile Arg Gly Gln Gly Val Val Lys Asn Gln Gly Arg Glu Phe Val             180 185 190 Cys Arg Pro Gly Asp Ile Leu Leu Phe Pro Pro Gly Glu Ile His His         195 200 205 Tyr Gly Arg His Pro Glu Ala Arg Glu Trp Tyr His Gln Trp Val Tyr     210 215 220 Phe Arg Pro Arg Ala Tyr Trp His Glu Trp Leu Asn Trp Pro Ser Ile 225 230 235 240 Phe Ala Asn Thr Gly Phe Phe Arg Pro Asp Glu Ala His Gln Pro His                 245 250 255 Phe Ser Asp Leu Phe Gly Gln Ile Ile Asn Ala Gly Gln Gly Glu Gly             260 265 270 Arg Tyr Ser Glu Leu Leu Ale Ile Asn Leu Leu Glu Gln Leu Leu Leu         275 280 285 Arg Arg Met Glu Ala Ile Asn Glu Ser Leu His Pro Pro Met Asp Asn     290 295 300 Arg Val Glu Ala Cys Gln Tyr Ile Ser Asp His Leu Ala Asp Ser 305 310 315 320 Asn Phe Asp Ile Ala Ser Val Ala Gln His Val Cys Leu Ser Ser Ser                 325 330 335 Arg Leu Ser His Leu Phe Arg Gln Gln Leu Gly Ile Ser Val Leu Ser             340 345 350 Trp Arg Glu Asp Gln Arg Ile Ser Gln Ala Lys Leu Leu Leu Ser Thr         355 360 365 Thr Arg Met Pro Ile Ala Thr Val Gly Arg Asn Val Gly Phe Asp Asp     370 375 380 Gln Leu Tyr Phe Ser Arg Val Phe Lys Lys Cys Thr Gly Ala Ser Pro 385 390 395 400 Ser Glu Phe Arg Ala Gly Cys Glu Glu Lys Val Asn Asp Val Ala Val                 405 410 415 Lys Leu Ser             <210> 36 <211> 79 <212> DNA <213> Vibrio fischeri <400> 36 ctctttatcc tttatcctta cctattgttt gtcgcaagtt ttgcgtgtta tatatcatta 60 aaacggtaat ggattgaca 79 <210> 37 <211> 140 <212> DNA <213> Vibrio fischeri <400> 37 tttgattcta ataaattgaa tttttgtcac actattgtat cgctgggaat acaattactt 60 aacataagca cctgtaggat cgtacaggtt tacgcaagaa aatggtttgt tatagtcgaa 120 taaacgcaag ggaggttggt 140

Claims (22)

(I) a LuxR protein encoding nucleotide sequence which is an acyl homoserine lactone (AHL) binding protein operatively linked to the LuxR promoter; (Ii) a LuxI protein encoding nucleotide sequence which is an AHL synthase operatively linked to a LuxI promoter; (Iii) an AraC ^c protein encoding nucleotide sequence consisting of the amino acid sequence of SEQ ID NO: 35 operatively linked to the LuxI promoter; And (iv) a protein or nucleic acid molecule encoding nucleotide sequence operatively linked to the P _BAD promoter, wherein the expression of the protein or nucleic acid molecule for expression is self-induced by autologous cell concentration recognition, Wherein the second component is a second component.
The method according to claim 1, wherein the LuxR protein, which is an AHL binding protein in combination with the AHL, binds to the LuxI promoter in (ii) and (iii) to promote transcription of LuxI protein and AraC ^c protein, Wherein the AraC ^c protein binds to the P _BAD promoter of (iv) to promote transcription of a protein or nucleic acid molecule for expression purposes.
delete The construct of claim 1, wherein the protein or nucleic acid molecule for expression is an anti-cancer protein, a fluorescent protein, a luminescent protein, a cytolytic protein, an antisense nucleotide, siRNA, shRNA or miRNA.
delete delete 2. The construct of claim 1, wherein the Ara B ^c protein encoding nucleotide sequence is further operatively linked to the P _BAD promoter of (iv).
delete The construct of claim 1, wherein the protein of expression purpose operatively linked to the P _BAD promoter of (iv) comprises Holin & lysin protein.
The construct of claim 9, wherein the expressed protein of interest operatively linked to the P _BAD promoter of (iv) further comprises an anti-cancer anti-cancer protein.
A recombinant vector comprising the construct of any one of claims 1, 2, 4, 7, 9 and 10.
12. A host cell transformed with the recombinant vector of claim 11.
13. The host cell of claim 12, wherein said host cell is a bacterial.
14. The method of claim 13, wherein the bacteria is selected from the group consisting of Escehreichia sp., Salmonella sp., Helicobacter sp., Yersinia sp., Shigella sp. , Enterobacter sp., Pseudomonas sp., Legionella sp., Hemophilus sp., Neisseria sp., Serratia sp. The genus Serratia sp., Proteus sp., Brucella sp., Citrobacter sp., Stenotrophomonas sp., Moraxella sp. sp.), Bdellovibrio sp., or Klebsiella sp. bacterium.
12. A pharmaceutical composition for treating tumors, comprising the transformed host cell of claim 12 as an active ingredient.
delete 13. A composition for tumor tissue imaging comprising the transformed host cell of claim 12 as an active ingredient.
A method for producing a protein through cell fermentation comprising the steps of:
(a) (i) a LuxR protein encoding nucleotide sequence which is an acyl-homoserine lactone (AHL) binding protein operatively linked to the LuxR promoter; (Ii) a LuxI protein encoding nucleotide sequence which is an AHL synthase operatively linked to a LuxI promoter; (Iii) an AraC ^c protein encoding nucleotide sequence consisting of the amino acid sequence of SEQ ID NO: 35 operatively linked to the Lux I promoter; And (iv) constructing a construct comprising a protein encoding nucleotide sequence of expression interest operatively linked to a P _BAD promoter;
(b) preparing a recombinant vector comprising the constructed construct;
(c) transforming the prepared recombinant vector into a host cell; And
(d) culturing the transformed host cell to express the expressed protein of interest.
19. The method of claim 18, wherein the AHL-binding protein of LuxR protein in combination with AHL in the step (a) is the (ⅱ) combines the LuxI promoter in and (ⅲ) AHL synthase is LuxI protein and transfer of the AraC ^c protein , And the AraC ^c protein binds to the P _BAD promoter of (iv) to promote transcription of a protein of interest for expression.
delete 19. The method according to claim 18, wherein the expressed protein of interest in step (iv) of step (a) comprises a Holin & lysin protein.
19. The method of claim 18, wherein the expressed protein of (iv) in step (a) further comprises a hailed or non-hailed protein.

Images