KR101633703B1 - Composition for preventing or treating of irradiation induced cell damage comprising necro X-5 - Google Patents

Abstract

The present invention relates to a composition for preventing or treating cell damage by radiation irradiation, comprising necro X-5 as an active ingredient. According to the present invention, active oxygen generated by radiation irradiation and an inflammatory reaction can increase side effects such as the necrosis of normal cells or the like, or resistance of cancer cells to the radiation, thereby reducing a gene of MCP-1 for significantly changing an amount of expression after radiation irradiation in a HUVEC cell which is a blood vessel cell strain, or expressed protein thereof through the treatment of necro X-5. In addition, the composition inhibits side effects of radiation treatment therethrough, and can significantly enhance radiation treatment effects.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing or treating cell damage by irradiation including necro X-5 as an active ingredient.

The present invention relates to a composition for preventing or treating cell damage by irradiation containing necro X-5 as an active ingredient.

Radiation therapy is one of the three major cancer treatment methods combined with surgery and anticancer therapy. It is a method of inducing apoptosis through gene damage reaction by irradiating tumor region with high energy radiation. Radiation therapy has been used for many decades as an indispensable treatment method for various types of cancer. However, the side effects such as acquisition of radiation resistance of cancer cells, increase of active oxygen due to ionization of biomaterials, Has come.

Therefore, in order to increase the efficiency of the radiation therapy and to reduce the side effects, studies for inhibiting active oxygen, inflammation, and the like caused by irradiation are very important factors for the treatment of cancer and the recovery of patients. In order to effectively treat various cancer diseases by maximizing the effect of radiation therapy, it is required to develop a therapeutic method that can solve the above problems and prevent or minimize side effects.

It has been reported that necro X-5 is a necrosis inhibitor that can penetrate into cells. Through these studies, antioxidative effects and inhibition of cell and tissue damage through inhibition of calcium accumulation in mitochondria have been reported. However, And inflammatory response.

Korean Patent Laid-Open No. 10-2012-0116520 (published on October 23, 2012)

It is an object of the present invention to provide a composition for preventing or treating cell damage by irradiation containing necro X-5 as an active ingredient.

In order to achieve the above object, there is provided a composition for preventing or treating damage to normal cells by irradiation with radiation when treating necro X-5 as an active ingredient.

According to the present invention, the active oxygen and inflammatory reaction generated by irradiation can increase side effects such as normal cell necrosis or radiation resistance of cancer cells. Therefore, MCP-1, which is greatly changed in expression level after irradiation in HUVEC cells, Can be reduced through the treatment of necro X-5. Further, it is possible to suppress the side effects of radiation therapy and further enhance the radiation treatment effect.

FIG. 1 shows changes in the expression pattern of inflammatory factors according to the RT-PCR (1) and real-time PCR (2) analysis performed according to an embodiment (Example 2) of the present invention.
Figure 2 shows changes in cytokines and chemokines secreted from blood vessel cells according to one embodiment of the present invention.
FIG. 3 shows the amount of reactive oxygen species generated in the blood vessel cells by irradiation with radiation according to an embodiment of the present invention.
FIG. 4 shows Western blot analysis of the transcription factor of the inflammation-inducing gene by separating the nucleus and cytoplasmic proteins.

The inventors of the present invention found that when necro X-5 inhibits the production of active oxygen and the inflammatory reaction by irradiation of human vascular cells in the course of research for minimizing side effects that may occur during radiation exposure or irradiation, .

The present invention provides a composition for preventing or treating cell damage by irradiation containing necro X-5 as an active ingredient.

In detail, the cell damage may be damage of normal cells upon radiation treatment, and the cell damage may increase reactive oxygen species and increase inflammatory response.

Specifically, the cell may be, but is not limited to, a human umbilical vein endothelial cell (HUVEC).

In the present specification, "necro X-5" is an indole-structured compound having an antioxidative activity such as melatonin as shown in Formula 1 below. In particular, it is known that necro X-5 removes mitochondrial reactive oxygen species (ROS) and reactive nitrogen species It is known to have a mechanism of action.

[Chemical Formula 1]

As used herein, the term " human umbilical vein endothelial cell (HUVEC) "mainly refers to a function of maintaining vascular homeostasis by controlling vascular motility and permeability, blood coagulation and degradation, and proliferation of inflammatory cells and vascular smooth muscle cells do. It is known that when vascular endothelial cells are damaged, fibrosis proliferation is accompanied by an inflammatory reaction, resulting in a series of atherosclerosis.

The composition according to the present invention may be provided in the form of a pharmaceutical or functional food.

That is, the present invention provides a pharmaceutical composition for preventing or treating cell damage by irradiation with necro X-5 as an active ingredient.

The pharmaceutical compositions may further comprise suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions. Examples of carriers, excipients or diluents usable in the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil.

The pharmaceutical composition according to the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method .

In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations are prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, And so on.

In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The amount of necro X-5 which is an active ingredient of the pharmaceutical composition according to the present invention may vary depending on the age, sex and body weight of the patient, but is preferably 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / It can be administered several times.

In addition, the dose of necro X-5 may be increased or decreased depending on route of administration, degree of disease, sex, weight, age and the like. Thus, the dosage amounts are not intended to limit the scope of the invention in any manner.

The pharmaceutical composition may be administered to mammals such as rats, mice, livestock, humans, and the like in a variety of routes. All modes of administration may be expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intratracheal, intrauterine or intracerebroventricular injections.

The present invention also provides a functional food for preventing or ameliorating cell damage by irradiation with necro X-5 as an active ingredient. At this time, the functional food may be provided in the form of a health functional food or a health drink, and is preferably used in the form of a soft drink or a hard capsule filled with a functional beverage, a pill, a tablet, or the above-mentioned ingredients in the form of a dry powder.

The functional food is used together with other food or food additives other than necro X-5, and can be suitably used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to its use purpose, for example, prevention, health or therapeutic treatment.

 The effective dose of necro X-5 contained in the functional food may be used in accordance with the effective dose of the pharmaceutical composition. However, in the case of long-term consumption intended for health and hygiene purposes or health control purposes, And it is clear that the active ingredient can be used in an amount exceeding the above range since there is no problem in terms of safety.

There is no particular limitation on the kind of the functional food. Examples of the functional food include meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, Drinks, alcoholic beverages and vitamin complexes.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  1> cell line, necro  X-5 treatment and irradiation

Human vascular cell line HUVEC cells were cultured in EGM2 medium (CC-3162, Lonza) in a 5% CO ₂ , 37 ° C incubator. As a comparative group, DMSO was treated and treated with 10-20 μM necro X-5 (ALX-430-167-M005, Enzo) for 1 hour. Radiation was irradiated with gamma rays, and this was done using a ¹³⁷ Cs gamma-ray source (Atomic Energy of Canada, Ltd., Canada).

< Example  2> RT - PCR  And real time PCR Gene through Expression level  analysis

One. RT - PCR  analysis

The extracted RNA was quantified, 2 ㎍ of RNA was added, and dT, dNTP was added, and the mixture was heated at 65 캜 for 5 minutes, and then put in ice to cool. After incubation at 42 ° C for 2 minutes, 1 μl of superscript II was added and incubated at 42 ° C for 1 hour. After incubation at 70 ° C for 15 minutes Was heated to terminate the reaction to synthesize cDNA. PCR was carried out using the synthesized cDNA and annealing temperature for each primer.

2. Real time PCR  analysis

cDNA was synthesized with qPCR SYBR Green 2X Master Mix Kit (18303, M.biotech) and real-time quantitative RT-PCR was performed using CFX96 Touch real time PCR detection system (Biorad). The primer sequences used at this time are shown in Table 1 below.

order Gene name Real-time PCR primer sequence One GAPDH Forward: GCCATCAATGACCCCTTCATT (SEQ ID NO: 1)
Reverse: TTGACGGTGCCATGGAATTT (SEQ ID NO: 2) 2 IL-1? Forward: GAATGACGCCCTCAATCAAAGT (SEQ ID NO: 3)
Reverse: TCATCTTGGGCAGTCACATACA (SEQ ID NO: 4) 3 IL-1? Forward: AAATACCTGTGGCCTTGGGC (SEQ ID NO: 5)
Reverse: TTTGGGATCTACACTCTCCAGCT (SEQ ID NO: 6) 4 MCP-1 Forward: ACTCTCGCCTCCAGCATGAA (SEQ ID NO: 7)
Reverse: TTGATTGCATCTGGCTGAGC (SEQ ID NO: 8) 5 COX1 Forward: TGCCCAGCTCCTGGCCCGCCGCTT (SEQ ID NO: 9)
Reverse: GTGCATCAACACAGGCGCCTCTTC (SEQ ID NO: 10) 6 COX2 Forward: GTTTGCATTCTTTGCCCAGC (SEQ ID NO: 11)
Reverse: CAGGCACCAGACCAAAGACC (SEQ ID NO: 12)

As a result, as shown in FIG. 1, the expression of IL-1α and IL-1β was increased and the expression of MCP-1 was rapidly increased by radiation in HUVEC cells and the expression of MCP-1 was effectively inhibited by necro X-5 RT-PCR was confirmed.

< Example  3 > cytokine &lt; / RTI &gt; Inflammatory factor  Confirm

HUVEC cells were plated on a 60 mm plate at 1 × 10 ⁵ cells, cultured for 24 hours, irradiated (10 Gy), and cultured for 24 hours. The media containing cytokines and chemokines secreted from HUVEC cells were isolated and the amount of inflammatory factors secreted by the manufacturer's method was confirmed using a human cytokine array kit, Panel A (ARY005, R & D systems).

As a result, as shown in FIG. 2, it was confirmed that the secretion amount of MCP-1 was increased and the secretion of MCP-1 was suppressed by necro X-5 similarly to the RT-PCR result in HUVEC cells by irradiation.

< Example  4> DHR123 Active oxygen analysis by

DHR 123 (Dihydrorhodamine 123) was originally not fluorescent but was reduced by active oxygen to develop fluorescence, and an assay method was used to detect the amount of active oxygen by detecting it. HUVEC cells were seeded in 6-well plates at 5 × 10 ⁴ cells and cultured for 24 hours. DMSO or 10 μM necro X-5 was treated with the cells for 1 hour, followed by irradiation (10 Gy) for 3 hours. Cells were washed 1 x PBS 30 min before recovery and 0.75 μM DHR123 was reacted. The cells were washed twice with cold 1 × PBS and scraped off the plate to collect the cells. Cells were lysed with RIPA buffer (50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.1% deoxycholate, protease inhibitor, phosphatase inhibitor) Intracellular components were extracted. The extracted cell components were analyzed using a fluorescence analyzer (PerkinElmer 2030 VICTOR × 2) at exitation / emission = 485 nm / 520 nm wavelength. The amount of reactive oxygen generated was defined as the relative amount of DHR123 fluorescence generation relative to the amount of protein in the cell by quantifying the protein by the Bradford method.

As a result, as shown in FIG. 3, it was confirmed that necro X-5 can reduce the active oxygen of the cell and also reduce the active oxygen increased by irradiation.

< Example  5> necro  Analysis of the effects of irradiation on the nucleus and cytoplasm after X-5 treatment

1. Protein separation of nucleus and cytoplasm

HUVEC cells were plated on a 100 mm plate at 5 × 10 ⁵ cells for 24 hours. The cultured cells were washed twice with cold 1 × PBS and scraped off the plate to collect the cells. Cells were lysed with buffer A (10 mM HEPES-KOH (pH 7.9), 150 mM MgCl 2, 10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, protease inhibitor and phosphatase inhibitor) Respectively. The nucleus was sonicated in Extraction buffer (10 mM HEPES (pH 7.2), 422 mM NaCl, 0.1 mM EGTA, 0.5 mM PMSF, 5.3% Glycerol) to obtain a nuclear protein fraction.

2. Western Blot  Analysis of Protein Changes

The extracted cell nucleus and cytoplasmic protein fractions were quantified by Bradford method, and the degree of protein expression was confirmed by Western blot analysis.

As a result, as shown in FIG. 4, it was confirmed that phosphorylation of NF-κB, which is a transcription factor controlling the expression of MCP-1, and p65 and c-jun, which are active forms of AP-1, It was confirmed that the treatment of necro X-5 contributes to the stability of IκB protein in the cytoplasm and can reduce both the activity of NF-κB and AP-1 in the nucleus. MCP-1 is a chemokine that is secreted in inflammatory tissues and induces macrophages, NK cells, T cells, and other immune cells to the site of inflammation. It has been reported that a wide range of inflammatory responses are induced and that cancer cells are metastasized. It is known that expression is regulated by NF-κB and AP-1.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> KOREA INSTITUTE OF RADIOLOGICAL & MEDICAL SCIENCES <120> Composition for preventing or treating of irradiation induced          cell damage comprising necro X-5 <130> ADP-2014-0584 <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 gccatcaatg accccttcat t 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ttgacggtgc catggaattt 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gaatgacgcc ctcaatcaaa gt 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tcatcttggg cagtcacata ca 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aaatacctgt ggccttgggc 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tttgggatct acactctcca gct 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 actctcgcct ccagcatgaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 ttgattgcat ctggctgagc 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tgcccagctc ctggcccgcc gctt 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtgcatcaac acaggcgcct cttc 24 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gtttgcattc tttgcccagc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 caggcaccag accaaagacc 20

Claims (4)

(1) A composition for preventing or treating cell damage by irradiation comprising necro X-5 as an active ingredient.
[Chemical Formula 1]

The composition for preventing or treating cell damage according to claim 1, wherein the cell damage is normal cell damage upon radiation treatment. The composition for preventing or treating cell damage according to claim 1, wherein the cell damage increases active oxygen and increases inflammatory response. The composition for preventing or treating cell damage according to any one of claims 1 to 3, wherein the cell is a human umbilical vein endothelial cell (HUVEC).

Images