KR101603951B1 - A Composition For Controlling the Growth of Nerve Cells containing lumbricusin peptide - Google Patents

Abstract

TECHNICAL FIELD The present invention relates to a composition for regulating neuronal cell growth, which comprises a robiquin peptide as an active ingredient.
The present invention is characterized by providing a composition for treating degenerative neurological diseases comprising an amino acid sequence of SEQ ID NO: 1 and containing as an active ingredient a lumbricusin peptide as a regulator for promoting the growth of nerve cells.
The present invention can provide a composition for regulating neuronal cell growth which can promote neuronal cell growth and proliferation or inhibit the cell death process without any adverse side effects, And the possibility of developing a new therapeutic agent.

Description

[0001] The present invention relates to a composition for controlling neuronal cell growth, which comprises a room-containing bactucin peptide as an active ingredient,

More particularly, the present invention relates to a composition for regulating neuronal cell growth, which comprises a robiquin peptide as an active ingredient. More particularly, the present invention relates to a composition for regulating neuronal cell growth, The present invention relates to a composition for the treatment of neurodegenerative diseases.

Generally, Alzheimer's syndrome and Parkinson's syndrome are degenerative neurological diseases, which are not only the diseases but also the incurable diseases which have not developed the therapeutic agents. Degenerative neurological diseases such as aging of living tissues are becoming a social problem in the process of development of modern society.

So far, Alzheimer's syndrome is considered to be the main cause of senile plaque deposition, neurofibrillary tangle formation and neuronal death. The formation and deposition process of β-amyloid peptide (A) and neuronal cytotoxicity induced by deposited A have been studied extensively.

In addition, oxidative stress is also considered as an important factor of degenerative brain diseases of the central nervous system such as Alzheimer's syndrome, Parkinson's syndrome, and Huntington's syndrome, and attempts are being made to develop a therapeutic agent that blocks the development process. Clinically, various treatments such as antioxidant treatment, cell transplantation, and surgical operation have been proposed to treat degenerative neurological diseases, but most of them show the risk factors and side effects at the same time.

In the case of brain tissue, it is difficult to recover function once the damage is done. Therefore, it is urgently required to develop new technology to protect nerve cells in degenerative neurology or induce numerical compensation of reduced nerve cells by promoting the growth of remaining neurons .

Korean Prior Art 10-2012-0051929 (a composition containing black soybean anthocyanin for prevention or treatment of cerebral nervous system diseases that inhibits neuronal cell death due to oxidative stress) and Korean Patent No. 10-0425798 (A novel damaran derivative, a method for producing the same, and a neuronal cell protective agent containing the same as an active ingredient).

In addition, a number of leading research institutes have proposed new techniques using stem cells. For example, the technology to induce regeneration and proliferation of neural cells using mesenchymal stem cells extracted from umbilical cord blood by Domestic MediPost has been announced. As of 2011, 15 institutions in 6 countries including USA have induced neuronal cell differentiation 72 stem cells have been established, and in domestic Mizmedi, seven stem cells have been established which can be used as a treatment after induced differentiation into neurons. However, such a technique using stem cells has a problem of high development cost and serious side effects.

Therefore, there is still a need for a new technique for treating neurodegenerative diseases of the central nervous system such as brain cells, which can reduce the development cost and promote the growth of nerve cells and inhibit apoptosis without side effects.

The object of the present invention is to solve the above-mentioned problems of the prior art and to add various other advantages. In particular, the inventors of the present invention have found that the antioxidant treatment, Surgical surgery has already produced a drug that is low in therapeutic effect and induces various side effects, and thus, as a new therapeutic approach, it is non-toxic to nerve cells and selectively stimulates the growth process of neural stem cells In addition, if the cell suicide process acts on already progressing neurons to inhibit the suicide process and isolate the substances that protect the remaining neurons, it can be applied as a therapeutic agent for the disease. And so on.

Accordingly, the present invention provides a novel Lumbricusin peptide (Lumbricusin peptide) isolated from earthworm ( Lumbricusin terrestris ) as an active ingredient and capable of promoting neuronal cell growth and proliferation or inhibiting the cell death process without any development cost or adverse side effects It is an object of the present invention to provide a composition for treating a neurodegenerative disease.

In order to achieve the above object, the present invention provides a composition for treating degenerative neurological diseases comprising the amino acid sequence of SEQ ID NO: 1 and containing as an active ingredient a lumbricusin peptide as an regulator for promoting growth of nerve cells .

In another embodiment of the present invention, there is provided a neurodegenerative disease comprising an amino acid sequence of SEQ. ID. NO. 1 and containing a lumbricusin peptide as an active ingredient as a regulator for inhibiting the programmed cell death The present invention is characterized by providing a therapeutic composition.

The neuron is a brain cell and is characterized by separating the lumbosaccharide peptide from earthworm ( Lumbricusin terrestris ).

The lumbosaccharide peptide is characterized by being non-toxic to nerve cells.

The composition for treating neurodegenerative diseases according to the present invention is used for treating neurodegenerative diseases of the central nervous system, wherein the neurodegenerative neurodegenerative disease is any one selected from Alzheimer's syndrome, Parkinson's syndrome, Huntington's syndrome to be.

According to the present invention having the above-described constitution, it is possible to use a lumbricusin peptide isolated from earthworm ( Lumbricusin terrestris ) as an active ingredient to promote neuronal cell growth and proliferation or to inhibit the cell death process without development cost or side effects A novel neuronal cell growth regulating composition which can be used for the treatment of neurodegenerative diseases can be provided and it is possible to provide a remarkable effect such as providing a possibility to develop a new therapeutic agent which is low in cost for treating degenerative neurological diseases and free from side effects.

Brief Description of the Drawings Fig. 1 is a diagram showing a gene sequence comprising 11 amino acid sequences homologous to beta -dipensin and a portion encoding the amino acid sequence thereof (sequence in a square; peptide sequence having antimicrobial activity)
FIG. 2 is a graph showing the growth rate of SH-SY5Y neurons in response to changes in stimulation concentration of a lumbaricus peptide, which is a main component of a composition for treating degenerative neurological disease, according to an embodiment of the present invention.
FIG. 3 is a diagram showing the cell non-toxicity of a lumbronic peptide (lumbricusin peptide), which is a main component of a composition for treating degenerative neurological disease, to an SH-SY5Y neuron according to an embodiment of the present invention.
FIG. 4 is a graph showing the ability of a lumbricusin peptide, which is a main component of a composition for treating degenerative neurological disease, to decrease the expression level of p27 protein according to an embodiment of the present invention.
FIG. 5 is a graph showing the results of immunohistochemical analysis of 6-OHDA (6-hydroxydopamine) and Okadaic acid (OA), which are the main components of the composition for the treatment of neurodegenerative diseases according to an embodiment of the present invention, Lt; RTI ID = 0.0 > cell death < / RTI >

Below. A composition for treating degenerative neurological diseases according to a specific embodiment of the present invention will be described with reference to the drawings.

In one aspect of the present invention, SH-SY5Y neurons are treated with a lumbricusin peptide to confirm the growth promoting effect.

For example, SH-SY5Y cells, SW13 cells, adrenocortical epithelial cells, and HT29 cells, human colon epithelial cells, are treated with an earthworm lumbricusin peptide to confirm the growth promoting effect.

Each of the cells was seeded at a density of 1 × 10 ⁴ cells in a 96-well plate and incubated for 48 hours in an incubator at 37 ° C. and 5% CO2, and the earthworm peptide Lumbricusin is treated at a concentration of 10 μg / ml. After culturing for 24 hours, the growth rate change is measured at 450 nm absorbance.

In addition, proliferation confirmation using the BrdU Kit is performed to closely examine whether the growth rate is affected.

The same amount of cells was seeded in a 96-well plate to examine whether the above-mentioned lumbosaccharide peptide (lumbricusin peptide) was toxic to SH-SY5Y cells. The peptide was treated at a concentration of 10 ug / ml and maintained for up to 72 hours MTT assays are performed.

In another aspect of the present invention, SH-SY5Y neurons are treated with a lumbricusin peptide to inhibit neuronal cell death (programmed cell death).

In order to identify the intracellular regulatory proteins that promote the growth of SH-SY5Y cells, neurons were treated with lumbricusin peptide at a concentration of 10 μg / ml and maintained for up to 24 hours Proteins are extracted and subjected to stern blotting.

We also investigated the inhibitory effect of 6-hydroxydopamine (6-OHDA) and Okadaic acid (OA) on the cell death of lumbosaccharide peptides (lumbricusin peptide), which are known to induce strong cell apoptosis in SH-SY5Y cells .

At this time, neurons were pretreated with lumbricusin peptide for 1 hour, treated with 100 uM and 20 nM of 6-OHDA and OA, respectively, for 12 hours, and then subjected to Western blotting To confirm the cell death process.

Hereinafter, the present invention will be described in more detail with reference to Examples and Experimental Examples.

It should be apparent to those skilled in the art that the scope of the present invention is not limited by these examples and experimental examples, and these examples and experimental examples only illustrate the present invention specifically. Also, although not shown in the concrete examples and experimental examples, compositions of brain diseases-related therapeutic agents containing the peptide according to the present invention having a growth promoting action and a cell death-suppressing action on nerve cells of humans or mammals It will be obvious to those skilled in the art.

< Example 1> Selection of peptides derived from earthworms

In order to isolate the antimicrobial peptide gene from earthworm ( Lumbricus terrestris ), immune was induced by injecting Lipopolysacchride into earthworm body cavity. After immune induction, earthworms were ground in liquid nitrogen and total RNA was isolated using Trizol (Invitrogen, USA).

In addition, unimmunized earthworms were used as a control to search for differentially expressed genes. We used GeneFishing Technology to select differentially expressed genes using an arbitrary primer to find cDNA markers specifically present in immunoprecipitated earthworms. As a result, we found 54 candidate cDNA markers.

The nucleotide sequences of the markers were determined using an ABI 370 Genetic Analyzer (PE Applied Biosystems, USA), and genes having high homology with Defensin among the markers were selected through Protein Blast

The antimicrobial proteins reported so far have a helix structure according to structure, a disulfide linkage in the structure, a proline amino acid or a glycine amino acid .

As a result of the structural analysis of the selected markers, a gene sequence comprising 11 amino acid sequences homologous to beta -dipenesis and a portion encoding the amino acid sequence is shown in FIG. 1, wherein the sequence in the square in FIG. Lt; / RTI &gt;

Example 2: Peptide synthesis from selected gene markers

To synthesize the peptides, we used Merrifield's liquid phase method (Merrifield, RB., J. Am. Chem. Soc .; 85: 2149, 1963) using a Fmoc amino protecting vessel. The synthesis method is _a solid phase method using Fmoc (9-fluorenylmethoxycarbonyl) as _a protecting group of the N _a -amino group of an amino acid. In detail, peptides having a carboxyl terminal in the form of -NH ₂ were used as starting materials for Rink Amide MBHA-Resin, and peptides having carboxyl terminal in the form of -OH were used as starting materials for Fmoc-amino acid-Wang Resin . Elongation of the peptide chain by coupling of Fmoc-amino acid was performed by N -hydroxybenzotriazole (HOBt) -dicyclo-hexylcar-bodiimide (DCC) method. After the Fmoc-amino acid of the amino terminal of each peptide was coupled, the Fmoc group was removed with 20% piperidine / N-methylpyrrolidone (NMP) solution, washed several times with NMP and dichloromethane (DCM) It was dried with gas. A solution of TFA (trifluoroacetic acid) -phenol-thioanisole-H ₂ O-triisopropylsilane (85: 5: 5: 2.5: 2.5, vol./vol.) Was added and the reaction was carried out for 3 hours. The peptides were separated and the peptide was precipitated with diethyl ether. The crude peptide thus obtained was purified by HPLC on a reverse phase HPLC column (Delta Pak, C ₁₈ 300 Å, 15 μ 19.0 mm × 30) using an acetonitrile gradient containing 0.1% TFA , Waters). The synthetic peptide was hydrolyzed with 6 N HCl at 110 for 24 hours. The resulting residue was concentrated under reduced pressure, dissolved in 0.02 N HCl, and the amino acid composition was measured with an amino acid analyzer (Hitachi 8500 A). The molecular weight was calculated based on the sequence of the synthesized peptides, and the exact molecular weight was measured using a MALDI mass spectrometer (MALDI). As a result, it was confirmed that the antimicrobial peptide having the correct amino acid sequence was synthesized because the calculated molecular weight and the calculated molecular weight were identical.

The amino acid sequence of the biosynthetic peptide was HOOC-RNRRWCIDQQA-NH ₂ , which was composed of 11 amino acids and was named 'Lumbricusin peptide'.

Selection gene sequence
tgctcagcaggacatttgttggcgacgtaataga Selection gene
Amino acid sequence
(SEQ ID NO: 1)
NH ₂ -AQQDICWRRN R-HOOC

EXPERIMENTAL EXAMPLE 1 Growth Promotion Effect of Earthworm-derived Lumbricusin Peptide on Neuron SH-SY5Y

1. Experimental Method

SH-SY5Y cells, SW13 cells and HT29 cells were seeded in a 96-well plate, and Lumbulicus peptide (10 μg / ml) was cultured for 24 hours.

The cell growth rate was then measured using the BrdU Cell Proliferation Assay Kit from Exalpha Biological, and the amount of BrdU introduced into the cells after the final reaction was measured at 450 nm.

2. Experimental results

As a result of the above experiment, it was confirmed that the cell growth rate of SH-SY5Y cells (neurons, FIG. 2A) treated with Lumbricusin peptide was significantly increased as shown in FIG.

On the other hand, it was confirmed that the growth promoting effect of Lumbricusin peptide on SW13 cells (Fig. 2B) and HT29 cells (Fig. 2C) was not observed.

This shows that the Lumbricusin peptide increases cell proliferation rate specifically to neurons.

< Experimental Example 2: Non-toxic evaluation of Lumbricusin against neuronal SH-SY5Y cells

1. Experimental Method

The concentration of the Lumbricusin peptide which promotes the growth of neurons is 10 ㎍ / ml. Since the concentration of the peptide shows a slightly higher tendency, it is necessary to confirm that the neuronal cell does not cause cytotoxicity as a side effect.

For this purpose, Lumbricusin peptide was treated for 12, 24, 48, 72 hours and MTT assay was performed to assess cytotoxicity.

In the cells treated with room-brickucin peptide for the above time, the MTT solution was treated with the culture solution, followed by further incubation for 2 hours. Then, the culture solution was removed and 100 μl of DMSO solution was added to dissolve the MTT. Then, the absorbance was measured at a wavelength of 570 nm to confirm cytotoxicity.

2. Experimental results

As a result, as shown in FIG. 3, it was confirmed that the cell health was lowered after 48 hours of treatment. However, considering that it is still higher than that of the control group, there is no cytotoxicity of the Lumbricusin peptide to neurons Respectively.

<Experimental Example 3> In-cell neuronal pathway activated by Lumbricusin peptide in neurons

1. Experimental Method

The p27 protein is an intracellular protein that inhibits cell division. A well-known mechanism of action is to inhibit activity by complexing with cyclin dependent CDKs. Thus, a decrease in the expression level of the p27 protein means promoting cell division.

Lumbricusin peptide was treated with 10 ㎍ / ml of nerve cells and western blotting experiment was performed. At this time, the treated cells were disrupted, electrophoresed with SDS-PAGE gel, and then transferred to a membrane. Then, the primary antibody, p27 protein, was reacted overnight, and the secondary antibody, rabbit-HRP, was visualized by reacting for 2 hours.

2. Experimental results

As a result, as shown in FIG. 4, it was confirmed that the amount of p27 protein was remarkably decreased from 12 hours after treatment with Lumbricusin peptide. Thus, the decrease of p27 protein, which inhibits cell division, It was also proved that this promotion.

<Experimental Example 4> Evaluation of the inhibitory effect of the Lumbricusin peptide on the neuronal cell death induced by the neurotoxic substances 6-hydroxydopamine (6-OHDA) and okadaic acid (OA)

1. Experimental Method

To investigate the inhibitory effect of Lamb- ricusin peptide on acute apoptosis by treatment with 6-hydroxydopamine and Okadaic acid, which were found to induce strong apoptosis in SH-SY5Y neurons.

For this purpose, the neurons were pretreated with Lumbricusin peptide for 1 hour and then treated with 100 uM and 20 nM of 6-OHDA and OA, respectively, to induce apoptosis.

After 12 hours of incubation, cells were disrupted, proteins were separated, and Western blotting was performed. At this time, the degree of apoptosis was evaluated as activation of caspase-3 protein, which is known to promote apoptosis.

2. Experimental results

As shown in FIG. 5, the treatment with 6-OHDA and OA alone strongly induced the activation of caspase-3 protein, which strongly induces neuronal death.

On the other hand, neurons treated with Lumbricusin peptide significantly reduced activation of caspase-3 protein by 6-OHDA and OA treatment.

It has been confirmed that the Lumbricusin peptide inhibits the neuronal death by neurotoxic substances.

As described above, it was confirmed that the Lumbricusin peptide isolated from earthworms according to the present invention is a neurotropic factor that strongly stimulates cell growth on neurons. In addition, the Lumbricusin peptide inhibited the neuronal death by various neurotoxic substances.

Taken together, these results show that the most prominent problem identified in neurodegenerative diseases such as Alzheimer's and Parkinson's disease can be significantly reduced. In addition, considering that the process of promoting cell growth of neurons or neural stem cells remaining uninjured remains an important goal of therapy, the efficacy of the Lumbricusin peptide, which promotes the growth of neuronal cells, And it is expected to improve the symptoms of the disease.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> A Composition For Controlling the Growth of Nerve Cells          containing lumbricusin peptide <130> p203-0126 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 11 <212> PRT <213> Lumbricusin peptide <400> 1 Ala Gln Gln Asp Ile Cys Trp Arg Arg Asn Arg   1 5 10

Claims (7)

Comprising an amino acid sequence represented by SEQ. ID. NO: 1 below and comprising as an active ingredient a lumbricusin peptide, which is an regulator for promoting the growth of neurons,
A composition for the treatment of neurodegenerative diseases.
&Lt; SEQ ID NO.
Ala Gln Gln Asp Ile Cys Trp Arg Arg Asn Arg
Comprising an amino acid sequence represented by SEQ. ID. NO. 1 below and comprising as an active ingredient a lumbricusin peptide, which is an regulator for inhibiting the programmed cell death of neuronal cells,
A composition for the treatment of neurodegenerative diseases.
&Lt; SEQ ID NO.
Ala Gln Gln Asp Ile Cys Trp Arg Arg Asn Arg
The method according to claim 1 or 2,
Wherein the nerve cell is a brain cell.
A composition for the treatment of neurodegenerative diseases.
The method according to claim 1 or 2,
Characterized in that the lumbricusin peptide is isolated from earthworm ( Lumbricusin terrestris ).
A composition for the treatment of neurodegenerative diseases.
The method according to claim 1 or 2,
Wherein the lumbronic peptide is non-toxic to nerve cells. &Lt; RTI ID = 0.0 &gt;
A composition for the treatment of neurodegenerative diseases. delete delete

Images