KR101599523B1 - Quality evaluation method of de-differentiating cells including early embryos and stem cells - Google Patents

Abstract

The present invention relates to a method for determining the quality of degenerated cells including early embryonic stem cells, and the present invention relates to a method for determining the quality of regenerated cells including early embryonic stem cells, We found a method to judge the quality of a standard animal embryo derived from various environmental conditions with a certain quality as compared with the standard, and found that the function and importance of epigenetic reprogramming in early embryogenesis was confirmed by multiplex PCR . The expression levels of these genes were analyzed by molecular biology of individual blastocysts. The relative expression levels of the genes in the individual blastocysts were measured and individual mutations were measured between gene expression-related blastocysts. Various treatments were performed to increase replication efficiency or iPS efficiency The difference between the individual methods can be quantified for efficacy So it can be effectively utilized.

Description

[0001] The present invention relates to a method for determining quality of degenerated cells including early embryos and stem cells,

The present invention relates to a method for determining the quality of regenerated cells including early embryonic stem cells and a stem cell using a method of analyzing the expression of a gene related to a proximal genetic rearrangement from a trace amount sample by a multiplex PCR technique, And a biochip.

In vitro maturation, in vitro fertilization and cultivation of human and mammalian oocytes is a method of producing fertilized eggs which is very useful for clinical and industrial purposes and easy to experimentally access. However, in some mammals, such as pigs, the in vitro production method is still established and is known to be significantly inferior to in vitro fertilized embryos. Therefore, although many studies have been conducted to overcome this problem, the method for quickly confirming the effect thereof is very limited to date. In large animals, the pregnancy is long, the number of offspring is limited, and the replication efficiency is too low. At best, the development rate to the blastocyst is compared, or the structure of the blastocyst is immunostained to determine the inner cell mass We have judged the appropriateness of these trials to be somewhat customary, in an indirect and more verifiable measure, to the extent of examining the ratio of the trophectoderm cells.

On the other hand, animal cloning technology has been anticipated for infinite medical and industrial applications since its inception and has been combined with various technologies such as transgenic technology and stem cell technology to create new high value-added industries . However, high replication failure rate is a major constraint on the creation of these new industries. Furthermore, when using transgenic somatic cells such as adenocarcinoma cells, which are not normal somatic cells, as a donor nucleus, the replication efficiency is further reduced. Even if a child is born with a low probability, it may die within a few months after birth and cause various abnormalities such as immune system abnormality, I have shown. This phenomenon is not a phenomenon that is confined to a specific species, but rather a phenomenon that occurs throughout mammal species such as mice, cows, sheep, and pigs. In order to solve these problems, although various attempts have been made such as changes in the activation method of reconstituted oocytes, improvement of in vitro culture conditions, improvement of culture medium, change of micro-manipulation method and manipulation of donor somatic cells, It did not improve greatly.

The low production efficiency of cloned animals can be attributed to the epigenetic gap between recipient oocytes and donor somatic cells. The cytoplasm of egg yolk oocytes has a protein complex for remodeling the spermatozoa in consideration of the genome of the spermatozoa. When the oocyte nuclei with completely different characteristics are introduced, the protein complexes of these oocyte eggs are suitable They are unable to perform the remodeling function, thereby causing various epigenetic mutations (epimutations).

Because the presence of a residual genetic mutation in the embryonic genome of the somatic cell cloned embryo causes an abnormal occurrence of the cloned embryo, it is necessary to identify the actual state of the epigenetic reorganization occurring in the cloned embryo and to promote the reproductive reorganization Various attempts should be made. At the same time, an objective analysis system should be established to judge the appropriateness and effectiveness of these attempts.

The success of complex and diverse trials aimed at promoting the development of embryonic and stem cell genetics, such as new replication techniques, in vitro culture techniques, de-differentiation facilitation techniques, and epigenome alteration studies And to establish an objective molecular biologic analysis system that can be used as a measure to identify and predict disease.

Sperm and eggs of mammals are completely differentiated cells, and their genomes are left with signs of differentiation during the development of germ cells. In order to facilitate early embryogenesis after fertilization, the traces of differentiation in the genome of sperm and egg must be erased and rewritten. This process is called posterior inheritance, I am involved. This process is a very important process in the developmental process since it is directly related to the acquisition of totipotency or pluripotency of the early embryo (Kang, YK, KK Lee, and YM Han, Reprogramming DNA methylation in the preimplantation stage: peeping with Dolly's eyes, Curr Opin Cell Biol, 2003. 15 (3): p.

The posterior genetic rearrangements are largely classified into DNA methylation, histone modifications, polycomb-group (PcG) protein action, and nuclear structure that determines the structure and functional compartmentalization of specific chromosomal regions It happens to the target. A variety of epigenetic systems have been re-established and re-established through such a reorganization process, including genomic methylation reprogramming, X-chromosome inactivation, Genomic imprinting, etc. (Surani, MA, Reprogramming of genome function through epigenetic inheritance. Nature, 2001 414 (6859): p. 122-8.).

The posterior genetic system consists of several layers. DNA methylation, histone methylation and demethylation, and PcG proteins involved in regulating the expression of Hox genes critical to development constitute a progeny genetic system, either separately or interacting. The genetic significance of the genes that make up the posterior genetic system can be seen in that most of the loss-of-function mutations show lethal phenotype. Abnormal proliferative genetic control has been known to prevent embryos such as abortion from occurring normally, to maintain unstable chromosomes, and to induce various diseases and cancers.

DNA methylation enzymes (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) are widely known as representative proteins that play an important role in somatic cell degeneration through epigenetic rearrangement (Reik, W., W. Dean, and J. Walter , Epigenetic reprogramming in mammalian development. Science, 2001. 293 (5532): p. 1089-93, Rideout, WM, 3rd, K. Eggan, and R. Jaenisch, Nuclear cloning and epigenetic reprogramming of the genome. Science, 2001. 293 (5532): p. (Setdb1 / Eset, Suv39h1, G9a, Glp, etc.) and the demethylating enzyme (Jhdm2a, Jhdm3a, Lsd1, Jmjd3, etc.), an epigenetic marker of histone H3K9, which is known to have a causal correlation with DNA methylation ) (Tamaru, H. and EU Selker, A histone H3 methyltransferase controls DNA methylation in Neurospora crassa. Nature, 2001 414 (6861): p. 277-83, Jackson, JP, et al., Control of CpNpG DNA 메틸레이션 by the KRYPTONITE histone H3 methyltransferase . Nature, 2002. 416 (6880): p. (Eed, Suz12, Bmi1, YY1, etc.) responsible for the methylation of H3K27 (Bernstein, BE, et al. A bivalent chromatin structure marks key developmental genes in embryonic stem cells . Cell, 2006. 125 (2): p. 315-26, Shafa, M., R. Krawetz, and DE Rancourt, Returning to the stem state : epigenetics of recapitulating pre - differentiation chromatin structure . Bioessays, 2010. 32 (9): p. 791-9.) Are well known. Therefore, by examining the expression pattern and expression level of these proteins, it is possible to judge the degree of proliferative genetic rearrangement in cloned embryos or somatic cells, and as a result, it can be used as a measure for judging the success of degeneration.

By effectively inducing early embryogenesis, it is possible to greatly improve replication efficiency if a large quantity of high quality nuclear transfer-replicating embryos can be obtained. Various attempts have been made to improve the initial embryo efficiency, but the method of confirming the effect is very limited to date. In large animals, it is almost impossible to directly compare the efficiency of attempts to increase replication efficiency with the number of live births because of long pregnancy, limited number of offspring, and too low replication efficiency. Therefore, the developmental rates of the blastocysts have been compared, or the structure of the blastocysts has been immunostained and analyzed depending on the indirect methods such as the ratio of the inner cell mass and the trophectoderm cell ratio. It has been practiced somewhat conventionally without verification because there is no alternative approach.

Accordingly, the inventors of the present invention have found that a standard animal embryo derived from various environmental conditions such as in-vivo fertilization, in vitro fertilization, in-vivo development, in vitro development, virgin reproduction, nuclear substitution replication and culture conditions has a certain quality In the present study, we investigated the expression of the target genes by multiple reverse transcriptase polymerase chain reaction in epigenetic reprogramming subjects whose function and significance were confirmed in early embryogenesis and analyzed their molecular biology by individual blastocysts By measuring relative gene expression levels in individual blastocysts and measuring individual variation among gene expression-associated blastocysts, we could quantify differences between individual methods for the efficacy of various treatments to increase replication efficiency or iPS efficiency Thus completing the present invention.

SUMMARY OF THE INVENTION

1) preparing a colony of an early embryo or de-differentiated cell to be detected as an experimental group, and a standard early embryo or de-differentiated cell as a control group, respectively;

2) Multiple RT-PCT was performed using primers capable of amplifying each of the following 15 genes from single embryonic or single cell colonies derived from the experimental group and the control group in the above step 1) Analysis step:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3); And

3) comparing the gene expression level of the test group analyzed in step 2) with the level of gene expression of the control group, and determining the quality of early embryonic or degenerated cells.

It is still another object of the present invention to provide a kit for determining the quality of early embryonic or degenerated cells comprising primers capable of amplifying the following 15 genes, respectively:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

It is still another object of the present invention to provide a biochip for judging the quality of early embryonic or degenerated cells comprising primers capable of amplifying each of the following 15 genes,

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

In order to achieve the above object,

The present invention provides: 1) preparing a colony of an early embryo or de-differentiated cell to be detected as an experimental group, a standard early embryo or a regenerated cell as a control,

2) Multiple RT-PCT was performed using primers capable of amplifying each of the following 15 genes from single embryonic or single cell colonies derived from the experimental group and the control group in the above step 1) Analysis step:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3); And

3) comparing the gene expression level of the test group analyzed in the step 2) with the gene expression level of the control group, to determine the quality of early embryonic or degenerated cells.

In order to achieve the above object, the present invention provides a kit for determining quality of early embryonic or degenerated cells comprising primers capable of amplifying the following 15 genes, respectively:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

In order to achieve the above object, the present invention provides a biochip for determining quality of an early embryonic stem cell or a degenerated cell comprising primers capable of amplifying the following 15 genes, respectively:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

The present invention relates to a method for judging a standard animal embryo derived from various environmental conditions such as in-body fertilization, in vitro fertilization, in-vivo development, in vitro development, virgin reproduction, nuclear replacement replication, The expression of the gene was investigated by multiple PCR using epigenetic reprogramming related to its function and significance in early embryogenesis. Molecular biologic analysis was performed for each blastocyst. Relative expression levels can be measured and individual variation among gene expression-related blastocysts measured, and the efficacy of various treatments enhancing replication efficiency or iPS efficiency can be quantified and quantified.

FIG. 1 shows the results of RT-PCR analysis of the expression of each of the genes related to the proliferative gene rearrangement from the mRNA extracted from embryonic stem cells (upper), mouse blastocyst (discontinued) and bovine blastocyst (lower).
FIG. 2 shows the results of multiplex PCR analysis of the expression of each of the genes related to the reprogramming genes from the mRNA extracted from the blastocyst of a mouse blastocyst.
FIG. 3 is a comparative analysis of the expression levels of the genes related to the reproductive rearrangement between the two groups in the multi-PCR of the in-vitro cultured blastocyst and the in vitro cultured blastocyst.
FIG. 4 is a graph comparing the expression amounts of the genes related to the progeny of the herniated genome of the two groups with respect to the multiplex PCR performed on the cultured blastocysts and IVF blastocysts of the mice.
FIG. 5 is a graph comparing the expression levels of the genes related to the progeny of the herpes simplex in the two groups by the results of multiplex PCR on the in vitro fertilized blastocysts and cloned blastocysts of bovine animals.
FIG. 6 is a graph comparing the expression levels of the genes related to the proliferative gene rearrangement between the two groups through the results of multiplex PCR on colonies derived from mouse embryonic stem cells and colonies derived from the stem cells derived from the differentiated pluripotent stem cells.

Hereinafter, the present invention will be described in detail.

The present invention

1) preparing a colony of an early embryo or de-differentiated cell to be detected as an experimental group, and a standard early embryo or de-differentiated cell as a control group, respectively;

2) Multiple RT-PCT was performed using primers capable of amplifying each of the following 15 genes from single embryonic or single cell colonies derived from the experimental group and the control group in the above step 1) Analysis step:

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3); And

3) comparing the gene expression level of the test group analyzed in the step 2) with the gene expression level of the control group, to determine the quality of early embryonic or degenerated cells.

In this method, the type of embryo cells of step 1) is preferably selected from the group consisting of an in-body fertilized egg, an in vitro embryo culture blastocyst, an in vitro culture blastocyst, an in vitro fertilized blastocyst and a reproductive embryo.

In this method, the degenerated cells of step 1) are preferably embryonic stem cells or induced pluripotent stem (iPS) cells, but are not limited thereto.

In this method, the gene of step 3) is preferably a gene related to epigenetic reprogramming, but is not limited thereto.

Wherein G9q, GLP, ESET and Suv39h1 are histone methylating enzymes, Eed, Suz12, Bmil and YY1 are polycomb proteins and LSD1, Dnmt3a and Dnmt3b are DNA methylation enzymes, JHDM2A, JHDM3A, and JHDM3 are preferably histone demethylating enzymes, but are not limited thereto.

In the above method, the primer of step 2) is preferably composed of any one of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 60, but is not limited thereto and is shown in Table 2 below.

In this method, the test group and the control group are each constituted by the following methods: Determination of quality of early embryonic or degenerated cells:

I) In vitro culture blastocysts and control group were cultured in vitro:

Ii) In vitro culture of in vitro fertilized blastocysts and control group were performed in vitro.

Iii) Cloned embryos in the experimental group and in vitro embryos in the control group; And

Iv) In the experimental group, it is preferable that the colony derived from the pluripotent pluripotent stem cells and the control group are embryonic stem cell-derived colonies, but not always limited thereto.

In the method, the multiple RT-PCT of step 2)

1) subjecting the primers of SEQ ID NO: 1 to SEQ ID NO: 60 to a first polymerase reaction simultaneously; And

2) It is preferable to dilute the first polymerase reaction product of step 1) and use as a template for the second polymerase reaction to perform a second NestPit polymerase reaction with a pair of nested polymerase reaction primers. However, Not limited.

In the above method, the degree of expression of the gene preferably includes a step of digitizing the remaining genes based on the degree of expression of one gene, but is not limited thereto.

The present inventors have constructed a gene related to the reproductive rearrangement and a primer thereof, and expressed the expression of each of the genes related to the rearranged gene rearrangement from the mRNA extracted from embryonic stem cells (top), mouse blastocyst (discontinued) and bovine blastocyst (bottom) It was confirmed that the expression of each of the genes related to the eukaryotic gene rearrangement from the mRNA extracted from the mouse blastocyst was amplified by multiplex PCR (see FIGS. 1 and 2).

In order to analyze the expression of the gene related to the reproductive rearrangement of the blastocyst in the mouse body culture medium and the in vitro culture blastocyst, the genes related to the reproductive rearrangement in the <Example> were classified into four groups of 15 genes. In the individual mouse blastocysts, 15 In order to simultaneously analyze the expression of the genes, multiplex PCR was performed to confirm that there is a large difference between the body and the extracellular blastocysts by comparing the reproductive rearrangement indexes. In the case of in vitro blastocysts, Dnmt1 (p = 0.005), Suv39h1 (p = 0.016), Glp (p = 0.013) and Eed (p = 6.29E-6) genes were significantly higher than in the blastocysts of the body (see FIG. 3).

In order to analyze the expression of the genes related to the progeny in the mouse embryo culture and in vitro fertilization / culturing blastocysts, the genes related to the progeny genetic rearrangement were classified into four groups, 15 genes in the Examples, and the individual mouse blastocysts In order to analyze the expression of 15 genes simultaneously, multiplex PCR was used to compare the results obtained with in vitro fertilization and in vitro culture of hormone - (P = 1.68E-4), v Dnmt3a (p = 0.024), Dnmt3b (p = 0.008), and Suv39h1 (p = 1.15E-4) in the in vitro fertilized and blastocyst blastocysts, (P = 1.39E-8), Jmjd3 (p = 0.016), Jhdm2a (p = = 7.61E-7) gene was significantly higher than that of blastocysts in the body (see FIG. 4).

In order to analyze the expression of the genes related to the reproductive rearrangement of bovine IVF embryos and cloned embryos, the genes related to reproductive rearrangement in the <Example> were classified into 15 genes in four groups, and 15 genes In order to analyze expression simultaneously, multiplex PCR was performed to confirm that the expression of Dnmt3b (p = 0.035) and Suv39h1 (p = 0.001) genes was significantly different between in vitro and infertile embryos ).

In order to analyze the expression of the gene related to the progeny of the reprogramming-induced pluripotent stem cell (IPS) In the <Example>, the genes related to the progeny genetic rearrangement were classified into 15 genes in four groups. In order to simultaneously analyze the expression of 15 genes in individual mouse blastocysts, multiplex PCR was performed to obtain Dnmt3a (p = 1.33E-5), Dnmt3b (p = 6.97E-4) and G9a (p = 0.008).

Accordingly, the present inventors have conducted extensive studies on gene rearrangement related genes in vitro and in vitro, in vitro, in vitro fertilized / cultured blastocysts, bovine embryo and cloned embryos, and reprogramming-stem cells (IPS) Molecular biology of individual blastocysts was measured by multiplex PCR. The relative expression level of each gene in the individual blastocysts was measured, individual mutations in gene expression-related blastocysts were measured, and cloning efficiency or iPS efficiency It is useful because it can quantify the difference between the individual methods for the efficacy of the various treatments.

The present invention also provides a kit for determining the quality of early embryonic or degenerated cells comprising primers capable of amplifying the following 15 genes, respectively;

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

The primer preferably comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 60, but is not limited thereto and is shown in Table 2 below.

In addition, the present invention provides a biochip for determining the quality of early embryonic or degenerated cells comprising primers capable of amplifying the following 15 genes, respectively;

Dnmt1 (DNA methyltransferase 1); Dnmt3a (DNA methyltransferase 3a); Dnmt3b (DNA methyltransferase 3b); G9a; GLP (G9a-like protein); ESET (ERG-associated protein with a SET domain); Suv39h1 (suppressor of variant 3-9 homolog 1); Eed (embryonic ectoderm development); Suz12 (suppressor of zest12 homolog); Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine (K) -specific demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A 3A) and JMJD3 (Jumonji domain 3).

The primer preferably comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 60, but is not limited thereto and is shown in Table 2 below.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples.

However, the following examples and experimental examples are illustrative of the present invention, and the contents of the present invention are not limited by the examples and the experimental examples.

< Example > Fusheng oilfield  Relocation-related genes and their objections primer

Derived embryo and in vitro derived embryos, in vitro derived embryos and nuclear embryos, and embryonic stem colonies and IPS colonies Table 1 shows 15 genes of 4 groups selected for analysis of expression. The DNA methyltransferases (DNMTs) group consists of enzymes involved in DNA methylation, including Dnmt1 [ref], Dnmt3a, and Dnmt3b. The histone lysine methyltransferases (HMTs) group consists of enzymes that methylate the ninth lysine residue of histone H3 and include G9a, Suv39h1, Eset, and GLP. Polycomb proteins (PcGs) group is a protein complex that functions to methylate histone H3 27 lysine or to activate / inhibit the expression of genes important for development with other proteins, including Eed, Suz12, Bmi, YY1 Respectively. The histone demethylases (HDMs) group has the function of demethylating histone H3 lysine, including LSD1, JHDM2A, JHDM3A, and JMJD3.

In vitro derived embryo and in vitro derived embryos, in vitro derived embryos and nuclear substituted embryos, and embryonic stem colonies and IPS colonies The primers for each of the 15 genes in each of the four groups were selected to analyze the expression, and the mRNA extracted from embryonic stem cells (top), mouse blastocysts (discontinued) and bovine blastocysts (bottom) The expression of each of the genes related to the reproductive rearrangement was amplified by RT-PCR and by multiplex PCR analysis of expression of each of the genes related to the eukaryotic reorganization from the mRNA extracted from the mouse blastocyst stage (FIGS. 1 and 2).

Selected for expression analysis Fusheng oilfield  Regrouped genes group gene mouse Bovine Porcine size Ref # size Ref # size Ref # DNMTs Dnmt1 133 NM_010066.4 131 NM_182651.2 O NM_001032355 Dnmt3a 192 NM_007872.4 192 AY271298.1 O NM_001097437 Dnmt3b 168 NM_001003960.3 168 NM_181813.2 O NM_001162404 HMTs G9a 184 NM_145830.1 186 XM_869170.4 O EU219914.1 GLP 127 NM_001012518.2 127 NM_001099041 X ESET 167 NM_001163641.1 164 XM_002686045 O XM_001929668 Suv39h1 242 NM_011514.2 242 NM_001046264 O DQ913894 PcGs Eed 195 NM_021876.3 195 NM_001040494 O AK238681 Suz12 172 NM_199196.2 172 XM_582605.5 O XM_003131745 Bmi1 258 NM_007552.4 258 NM_001038072 O XM_003130780 YY1 112 NM_009537.3 112 NM_001098081 O AK230712 HDMs LSD1 157 NM_133872.2 157 XM_002685717 O EU219916 JHDM2A 228 NM_001038695.2 222 NM_001192872 O XM_003124935 JHDM3A 219 NM_001161823.1 219 XM_002686436 O EU661937 JMJD3 273 NM_001017426.1 272 XR_083052.1 O

Selected for expression analysis Fusheng oilfield  Amplification of rearranged genes DNA  Size and Objectives Primer  Base sequence gene PCR # Forward primer (5 ' to 3 ') Reverse primer (5 ' to 3 ') size
( bp ) Dnmt1 One CAGTGGCATGAACCGCTTCA (SEQ ID NO: 1) GTCTGGGCCACGCCATACT (SEQ ID NO: 2) 240b 2 GCTACTGTGACTACTACCG (SEQ ID NO: 3) AAAGGTGCACTGGTAGCC (SEQ ID NO: 4) 133 Dnmt3a One TCAAGGAGATCATTGATG (SEQ ID NO: 5) TGTTCCCACACATGAGCA (SEQ ID NO: 6) 255 2 AGCGGCTGGTGTATGAGG (SEQ ID NO: 7) AGCAGATGGTGCAATAGGAC (SEQ ID NO: 8) 192 Dnmt3b One CCTACCCGGAATGAACAG (SEQ ID NO: 9) ACAGGCAAAGTAGTCCTTC (SEQ ID NO: 10) 343 2 AGCTCGAGCTGCAGGACT (SEQ ID NO: 11) AGATCCTTTCGAGCTCAGTG (SEQ ID NO: 12) 168 Suv39h1 One CCATCTACGAGTGCAACTC (SEQ ID NO: 13) CTCATCAAGGTTGTCTATG (SEQ ID NO: 14) 374 2 CGCTACGATCTCTGCATCTT (SEQ ID NO: 15) ACAAAATGAGAGATGTTCC (SEQ ID NO: 16) 242 G9a One GACAGAACGCGGGTTTGAG (SEQ ID NO: 17) CAGGCCTTATGGAAGCGG (SEQ ID NO: 18) 324 2 AGGGCACAAGTGCATGGC (SEQ ID NO: 19) CCCGCTGTGCAGAAGTAG (SEQ ID NO: 20) 184 Eset One CACACGCCAGTTCTATGA (SEQ ID NO: 21) TCAGGAAGACCCAGTTCCT (SEQ ID NO: 22) 354 2 ACCTCAATCACAGTTGCAGC (SEQ ID NO: 23) CTCCTTGCCTTCCACACTG (SEQ ID NO: 24) 167 Glp One TGGTCAAGTATGAGCTGATGC (SEQ ID NO: 25) TGCTATGGTCACCTCTTTG (SEQ ID NO: 26) 260 2 ATGGTGAAGCACCAGTGCTG (SEQ ID NO: 27) CATTGTTGACTCGAGAGGCA (SEQ ID NO: 28) 127 Bmi1 One GAGGGTACTTCATTGATG (SEQ ID NO: 29) ACTTTCCGATCCAATCTG (SEQ ID NO: 30) 376 2 GAGACCAGCAAGTATTGTCC (SEQ ID NO: 31) CAAGCTTATTATCTCATCATCAG (SEQ ID NO: 32) 258 Eed One CTGAGTGCTGATTATGATC (SEQ ID NO: 33) TATGAGGATCTTCTACTTC (SEQ ID NO: 34) 475 2 TCTACCAGAGACATACATAG (SEQ ID NO: 35) CCAAATGTCACACTGGCTGT (SEQ ID NO: 36) 195 Suz12 One CTCTATTTCCACAGTGATAC (SEQ ID NO: 37) TATCTATTGACATTATGC (SEQ ID NO: 38) 337 2 AAGGAGAGAAAGAAGTGATG (SEQ ID NO: 39) TCATGCATGCTGACTAGATG (SEQ ID NO: 40) 172 Yy1 One AAGAAGTGGGAGCAGAAGC (SEQ ID NO: 41) TGTTCTTGGAGCATCATC (SEQ ID NO: 42) 279 2 TGCAGATCAAGACCCTGGA (SEQ ID NO: 43) GAGTTCTCTCCAATGATCTG (SEQ ID NO: 44) 112 Jmjd3 One CTCACCATCAGCCACTGTG (SEQ ID NO: 45) AGCTCTCACAGGGCCAGAT (SEQ ID NO: 46) 415 2 TGCCAGCAAGAATGCCAAG (SEQ ID NO: 47) CCAGAGTCTTGGTGGAGAAA (SEQ ID NO: 48) 273 Jhdm2a One AGCATTCTTGGCTTTGACA (SEQ ID NO: 49) CATCAGATCATCAAACCTG (SEQ ID NO: 50) 402 2 GGCAGCCAGTGATGGTGT (SEQ ID NO: 51) CCTTAAGTTTCAACACCATTG (SEQ ID NO: 52) 228 Jhdm3a One TTCTACCAGTGTGAGGTG (SEQ ID NO: 53) TCTCATTGAAGCGCATGTC (SEQ ID NO: 54) 346 2 CATAGTGAGTCAGGACTGTC (SEQ ID NO: 55) AGTCTAGACTTGACTCTCTT (SEQ ID NO: 56) 219 Lsd1 One TCTGGCTTGGCAGCAGCTC (SEQ ID NO: 57) GTGGCTTCTAGCAACCGGT (SEQ ID NO: 58) 302 2 ACTTCTGGAAGCCAGGGATC (SEQ ID NO: 59) CTTGATCTTGGCCAGTTCCA (SEQ ID NO: 60) 157

< Experimental Example  1> In-body culture Blastocyst  And in vitro culture In a blastocyst Fusheng oilfield  Gene rearrangement gene expression analysis

In order to analyze the expression of the gene related to the reproductive rearrangement of the blastocyst in the mouse body culture medium and the in vitro culture blastocyst, the genes related to the reproductive rearrangement in the <Example> were classified into four groups of 15 genes. In the individual mouse blastocysts, 15 Multiplex PCR was performed to simultaneously analyze the expression of the genes.

Specifically, embryos were collected from female mice by intraperitoneal injection of PMSG (Sigma, USA) and hCG (Sigma, USA) and mating with male mice after induction of superovulation and cultured in M16 (Sigma, USA) (37 ^° C and 5% CO ₂ ) to obtain blastocysts. In this study, 1 - cell embryos were collected and divided into two groups: in vitro group obtained by in vitro culture and in vivo group obtained by further incubation in body for 3.5 days. The reverse transcription (RT) reaction and the first PCR were performed in a single tube using the primers used in the primary and secondary PCRs of the above Table 2, respectively. PCR reactions were performed by using one-step RT-PCR kit (Qiagen, USA) with 1 mouse blastocyst as a template and 15 primers of 10 picomoles of [Table 2] 1 μl each were mixed to form a total of 100 μl so as to have a pico mole. PCR was performed using DNA Engine (BIORAD, USA) at 94 ° C for 30 seconds, denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds extension was performed 40 times, and finally, reaction was carried out at 72 ° C for 30 seconds. The first PCR product was diluted 100-fold and then divided into 4 subgroups and used as a template for the second PCR. Secondary PCR was performed using nested primer sets contained in four subgroups. The PCR reaction mixture was diluted to 1/100 of 1 ^st PCR product in a PCR Pre-Mix (Bioneer, Korea), 5 μl was added as a template, and then 10 picomoles of each of the [Table 2] 15 primers were mixed with 10 쨉 l of each of the four subgroups to form a total of 100 쨉 l to give a pico mole. PCR was performed using DNA Engine Followed by denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and subsequent denaturation at 94 ° C for 30 seconds. 40 times, and finally at 72 ° C for 30 seconds. In addition, the relative expression level of the Lsd1 band, which is the most constant and stable expression among the 15 genes, is shown in the graph. TINA2.0 software is used to quantify band intensities of the multiplex PCR results. And the relative expression level was examined based on the value of Dnmt1. The results are shown in Table 3 below.

As a result, it was confirmed that there was a large difference between the in vivo and in vitro blastocysts through comparison of the posterior inheritance regression indexes. The expression of Dnmt1 (p = 0.005), Suv39h1 (p = 0.016), Glp (p = 0.013) and Eed (p = 6.29E-6) in the blastocysts was significantly higher than in the blastocysts 3).

Inoculation of mouse body Blastocyst  And in vitro culture In a blastocyst Fusheng oilfield  Regeneration related gene expression level in vivo STD in vitro STD P value Dnmt1 0.247185 0.369598 0.719481 0.371753 0.00521 Dnmt3a 0.990137 0.211899 1.013507 0.461552 0.85385 Dnmt3b 1.031448 0.238758 1.154823 0.162604 0.19333 Suv39h1 0.242102 0.370474 0.694805 0.536734 0.0164 G9a 0.833508 0.39202 0.803954 0.388061 0.858 Eset 0.365614 0.363696 0.435361 0.476577 0.67815 Glp 0.076459 0.121302 0.209396 0.113937 0.01313 Bmi1 0.808171 0.410781 0.75365 0.489451 0.76601 Eed 0.152916 0.321769 0.915879 0.328103 6.29439E-6 Suz12 0.015434 0.04007 0.028193 0.033436 0.4342 Yy1 0.612691 0.416925 0.545554 0.371946 0.69536 Jmjd3 0.484403 0.455433 0.566709 0.431969 0.66503 Jhdm2a 0.252544 0.316883 0.303546 0.418193 0.72822 Jhdm3a 0.347034 0.408817 0.091315 0.258278 0.11448

< Experimental Example  2> In-body culture Blastocyst  And in vitro fertilization / culture In a blastocyst Fusheng oilfield  Expression Analysis of Regeneration Related Gene

In order to analyze the expression of the genes related to the progeny in the mouse embryo culture and in vitro fertilization / culturing blastocysts, the genes related to the progeny genetic rearrangement were classified into four groups, 15 genes in the Examples, and the individual mouse blastocysts Multiplex PCR was performed to analyze the expression of 15 genes simultaneously.

Specifically, mature oocytes were recovered 16 hours after induction of superovulation by using PMSG (Sigma, USA) and hCG (Sigma, USA) at 4 weeks old female mice (Coatec) for in vitro fertilization. (Sigma, USA) for 1 hour and then inoculated with matured oocytes for 5 to 6 hours. After 3 days of incubation, Mice were mated with male rats after induction of superovulation using PMSG and hCG in mice. Two groups of embryo - derived blastocysts recovered from the uterus of female mice three days later were used for multiplex PCR. The reverse transcription (RT) reaction and the first PCR were performed in a single tube using the primers used in the primary and secondary PCRs of the above Table 2, respectively. The PCR reaction mixture was prepared by mixing 1 μl of each of 15 primers of the above [Table 2] of 10 picomoles of a mouse blastocyst with one-step RT-PCR Kit (Qiagen, USA) as a template To give a total pico mole of 0.1 picol. PCR was performed using DNA Engine (BIORAD, USA) at 94 ° C for 30 seconds, denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds extension was performed 40 times, and finally, reaction was carried out at 72 ° C for 30 seconds. The first PCR product was diluted 100-fold and then divided into 4 subgroups and used as a template for the second PCR. The PCR reaction mixture was diluted to 1/100 of 1 ^st PCR product in PCR Pre-Mix (Bioneer, Korea), 5 μl was added as a template, and 15 μl of each 10 picomoles of [Table 2] 10 primers were mixed with 4 subgroups of 10 μl each to give a total of 100 μl to give 1 pico mole. PCR was performed using DNA Engine Followed by denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and subsequent denaturation at 94 ° C for 30 seconds. 40 times, and finally at 72 ° C for 30 seconds. In addition, the relative expression level of the Lsd1 band, which is the most constant and stable expression among the 15 genes, is shown in the graph. TINA2.0 software is used to quantify band intensities of the multiplex PCR results. And the relative expression level was examined based on the value of Dnmt1. The results are shown in Table 4 below.

As a result, the mature oocytes induced by the hormone - induced ovarian hyperstimulation were significantly different from those obtained from in vivo - derived blastocysts compared with in vivo - derived blastocysts obtained from in vitro fertilization and in vitro culture. In vitro fertilization / culture blastocysts were cultured in the presence of Dnmt1 (p = 1.68E-4), v Dnmt3a (p = 0.024), Dnmt3b (p = 0.008), Suv39h1 (p = 1.15E-6), G9a (p = 5.69E-4), Glp (p = 1.74E-5), Eed (p = 1.39E-8), Jmjd3 (p = 0.016) and Jhdm2a (Fig. 4).

Inoculation of mouse body Blastocyst  And in vitro fertilization / culture In a blastocyst Fusheng oilfield  Expression of gene related to rearrangement in vivo STD IVF STD P value Dnmt1 0.247185 0.369598 1.165208 0.650476 1.67567E-4 Dnmt3a 0.990137 0.211899 1.47517 0.851674 0.02388 Dnmt3b 1.031448 0.238758 1.426925 0.440478 0.00777 Suv39h1 0.242102 0.370474 1.431319 0.481766 1.1455E-6 G9a 0.833508 0.39202 1.304087 0.577955 0.02969 Eset 0.365614 0.363696 1.200449 0.690793 5.68942E-4 Glp 0.076459 0.121302 0.71448 0.509577 1.73636E-5 Bmi1 0.808171 0.410781 1.241544 0.470897 0.03801 Eed 0.152916 0.321769 1.411703 0.327492 1.39479E-8 Suz12 0.015434 0.04007 0.018624 0.023542 0.85554 Yy1 0.612691 0.416925 0.956814 0.385864 0.08439 Jmjd3 0.484403 0.455433 1.066438 0.58219 0.01642 Jhdm2a 0.252544 0.316883 1.361211 0.490084 7.61321E-7 Jhdm3a 0.347034 0.408817 0.558236 0.684494 0.35345

< Experimental Example  3> Bovine IVF Embryo and Cloned Embryo Fusheng oilfield  Expression Analysis of Regeneration Related Gene

In order to analyze the expression of the genes related to the reproductive rearrangement of bovine IVF embryos and cloned embryos, the genes related to reproductive rearrangement in the <Example> were classified into 15 genes in four groups, and 15 genes Multiplex PCR was performed to analyze the expression simultaneously.

Specifically, the ovaries from slaughtered cattle (Daejeon Oh Jung-dong) were slaughtered, and immature oocytes were obtained from the laboratory and cultured in TCM199 (Gibco BRL) supplemented with 10% FBS for 20-22 hours to obtain mature oocytes. Swim-up sperm were recovered by centrifugation using a percoll (Sigma, USA) gradient, which allows only spermatozoa to be screened, and mature oocytes were co-cultured for 24 hours. . The in vitro fertilized embryos were cultured for 7 days in culture medium of CR1-aa (Rosenkrans LG et al., 1991. Culture of bovine zygotes to the blastocyst stape: Effect of amino acids and vitamins. Theriogenology 35: 266) ). For the production of cloned fertilized eggs, the mature oocytes obtained from the in vitro maturation process were harvested and the reconstituted oocytes were transplanted into the cumulus cells obtained from the oocyte retrieval process to obtain reconstituted embryonated eggs (NT ). The reverse transcription (RT) reaction and the first PCR were carried out in the same manner as in Example 1 using the primers used for the primary and secondary PCRs of Table 2, . The PCR reaction mixture was prepared by mixing 1 ㎕ of each of 15 primers of [Table 2] of 10 picomoles (template 2) into a one-shot blastocyst with a one-step RT-PCR kit (Qiagen, USA) 0.1 pico mole (pico mole). PCR was performed using DNA Engine Followed by denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and subsequent denaturation at 94 ° C for 30 seconds. 40 times, and finally at 72 ° C for 30 seconds. The first PCR product was diluted 100-fold and then divided into 4 subgroups and used as a template for the second PCR. Secondary PCR was performed using nested primer sets contained in four subgroups. The PCR reaction solution was prepared by diluting a 1- ^st PCR product to 1/100 in a PCR Pre-Mix (Bioneer, Korea), adding 5 μl of the PCR product as a template, and adding 10 picomoles of each of the above [Table 2] 15 primers were mixed with 10 쨉 l of each of the four subgroups to form a total of 100 쨉 l to give a pico mole. PCR was performed using DNA Engine (BIORAD, USA) at 94 ° C for 30 seconds, denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds extension was performed 40 times, and finally, reaction was carried out at 72 ° C for 30 seconds. In addition, the relative expression level of the Lsd1 band, which is the most constant and stable expression among the 15 genes, is shown in the graph. TINA2.0 software is used to quantify band intensities of the multiplex PCR results. And the relative expression level was examined based on the value of Dnmt1, and the results are shown in Table 5 below.

As a result, it was confirmed that the expression of Dnmt3b (p = 0.035) and Suv39h1 (p = 0.001) genes were significantly different between in vitro and in vitro fertilized embryos (FIG. 5).

Bovine embryos and cloned embryos Fusheng oilfield  Amount of expression of rearranged genes b-NT STD b-IVF STD P value Dnmt1 0 0 0.040382 0.141848 0.40602 Dnmt3a 1.093526 0.125223 1.057954 0.183549 0.60879 Dnmt3b 0.69571 0.324142 0.938483 0.226663 0.0348 Suv39h1 0.3446 0.382053 0.008841 0.036453 0.00124 G9a 0.220483 0.392466 0.174733 0.361139 0.76794 Eset 0.018505 0.031897 0.09344 0.128676 0.10126 Glp 0.041701 0.051295 0.127116 0.250094 0.3253 Bmi1 0.930875 0.226136 0.847744 0.317539 0.49392 Eed 0.002207 0.00662 0 0 0.17415 Suz12 0 0 0 0 - Yy1 0.61051 0.293862 0.444169 0.205524 0.10379 Jmjd3 0 0 0.017383 0.049394 0.30618 Jhdm2a 0.095157 0.161693 0.107285 0.191235 0.87288 Jhdm3a 0.885587 0.13514 0.975608 0.201385 0.24191

< Experimental Example  4> De-differentiation -Stem Cells( induced Pluripotent Stem cell , IPS ) Fusheng oilfield  Expression Analysis of Regeneration Related Gene

In order to analyze the expression of the gene related to the reprogramming-induced pluripotent stem cell (IPS) In the <Example>, genes related to the progeny gene rearrangement were classified into four groups of 15 genes, and multiplex PCR was performed to simultaneously analyze the expression of 15 genes in individual mouse blastocysts.

Specifically, mRNA was extracted from early stage single-differentiation-stem cell (IPS) colonies induced by expression of a single colony and Yamanaka factor derived from JI mouse embryonic stem cell (ATCC), and 15 genes Respectively. The IPS obtained from the HEAD cells obtained from the transgenic mouse 4F2A was cultured in a culture medium supplemented with 10% FBS, and 4,000 cells were seeded per well into a 4-well culture dish coated with Matrigel one day before the experiment . Doxycyclin at a concentration of 2 ug / ml was added to the culture supernatant after 24 hours. Doxycyclin was added to the culture solution containing knockout SR 10% and 5% FBS for ES cells in a knockout DMEM for 48 days. After observation, iPS colonies were generated. One colony was separated by using a glass pipette, washed with PBS, and then placed in a PCR tube. The reverse transcription (RT) reaction and the first PCR were performed in a single tube using the primers used in the primary and secondary PCRs of the above Table 2, respectively. The PCR reaction mixture was prepared by adding 1 mouse oocyte stem cell colony or iPS colony as a template to 15 primers (pico moles) of [Table 2] in a one-step RT-PCR kit (Qiagen, USA) Were mixed to prepare a total of 100 mu l so as to be 0.1 picomoles. PCR was performed using DNA Engine Followed by denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and subsequent denaturation at 94 ° C for 30 seconds. 40 times, and finally at 72 ° C for 30 seconds. The first PCR product was diluted 100-fold and then divided into 4 subgroups and used as a template for the second PCR. The PCR reaction mixture was diluted to 1/100 of 1 ^st PCR product in a PCR Pre-Mix (Bioneer, Korea), 5 μl was added as a template, and 10 pico moles of each of 15 10 primers were mixed with 4 subgroups of 10 μl each to give a total of 100 μl to give 1 pico mole. PCR was performed using DNA Engine Followed by denaturation at 94 ° C for 15 minutes, annealing at 72 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and subsequent denaturation at 94 ° C for 30 seconds. 40 times, and finally at 72 ° C for 30 seconds. In addition, expression patterns of somatic cells used for iPS induction as a comparative group were also examined. Relative expression levels were plotted on the basis of the Lsd1 band, which is the most constant and stable expression among the 15 genes. To quantify the band intensities of the multiplex PCR, TINA2.0 software After the quantification, the relative expression level was examined based on the value of Dnmt1, and the results are shown in Table 6 below.

As a result, it was confirmed that the difference in the expression level between the two groups was significant in genes such as Dnmt3a (p = 1.33E-5), Dnmt3b (p = 6.97E-4) and G9a (p = 0.008) 6).

Mouse embryonic stem cells (ES) and De-differentiation -Stem Cells( iPS )in Fusheng oilfield  Expression Analysis of Regeneration Related Gene ES ES-STDV iPS iPS-STDV P value Dnmt1 0.272792 0.165184 0.249083 0.097753 0.62402 Dnmt3a 1.011669 0.304794 0.62.874 0.096119 1.33433E-5 Dnmt3b 0.872441 0.337886 0.480444 0.223413 6.97286E-4 Suv39h1 0.186458 0.184617 0.308403 0.237408 0.1668 G9a 0.625047 0.321653 0.378588 0.154541 0.00789 Eset 0.749326 0.320667 0.668443 0.245514 0.44895 Glp 0.91147 0.158392 0.190706 0.180232 0.14964 Bmi1 0.245182 0.316607 0.344318 0.226921 0.33175 Eed 0.342565 0.28175 0.242023 0.169688 0.23152 Suz12 0.37147 0.220055 0.407414 0.263669 0.71378 Yy1 0.197529 0.154232 0.226889 0.140225 0.60496 Jmjd3 0.143755 0.218491 0.206746 0.142409 0.34895 Jhdm2a 0.356057 0.196611 0.352512 0.213249 0.96522 Jhdm3a 0.370687 0.533502 0.255836 0.123834 0.36083

<110> Korea Research Institute of Bioscience and Biotechnology <120> Quality evaluation method of de-differentiating cells including          early embryos and stem cells <130> 12p-05-56 <160> 60 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Dnmt1 forward 5'-3 ' <400> 1 cagtggcatg aaccgcttca 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt1 reverse 5'-3 ' <400> 2 gtctgggcca cgccatact 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Dnmt1 forward 5'-3 ' <400> 3 gctactgtga ctactaccg 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt1 reverse 5'-3 ' <400> 4 aaaggtgcac tggtagcc 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3a forward 5'-3 ' <400> 5 tcaaggagat cattgatg 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3a reverse 5'-3 ' <400> 6 tgttcccaca catgagca 18 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3a forward 5'-3 ' <400> 7 agcggctggt gtatgagg 18 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3a reverse 5'-3 ' <400> 8 agcagatggt gcaataggac 20 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3b forward 5'-3 ' <400> 9 cctacccgga atgaacag 18 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> Dnmt3b reverse 5'-3 ' <400> 10 acaggcaaag tagtccttc 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Dnmt3b forward 5'-3 ' <400> 11 agctcgagct gcaggact 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> Dnmt3b reverse 5'-3 ' <400> 12 agatcctttc gagctcagtg 20 <210> 13 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Suv39h1 forward 5'-3 ' <400> 13 ccatctacga gtgcaactc 19 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Suv39h1 reverse 5'-3 ' <400> 14 ctcatcaagg ttgtctatg 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Suv39h1 forward 5'-3 ' <400> 15 cgctacgatc tctgcatctt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Suv39h1 reverse 5'-3 ' <400> 16 acaaaatgag agatgttgcc 20 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> G9a forward 5'-3 ' <400> 17 gacagaacgc gggtttgag 19 <210> 18 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> G9a reverse 5'-3 ' <400> 18 caggccttat ggaagcgg 18 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> G9a forward 5'-3 ' <400> 19 agggcacaag tgcatggc 18 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> G9a reverse 5'-3 ' <400> 20 cccgctgtgc agaagtag 18 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Eset forward 5'-3 ' <400> 21 cacacgccag ttctatga 18 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Eset reverse 5'-3 ' <400> 22 tcaggaagac ccagttcct 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Eset forward 5'-3 ' <400> 23 acctcaatca cagttgcagc 20 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Eset reverse 5'-3 ' <400> 24 ctccttgcct tccacactg 19 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Glp forward 5'-3 ' <400> 25 tggtcaagta tgagctgatg c 21 <210> 26 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Glp reverse 5'-3 ' <400> 26 tgctatggtc acctctttg 19 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glp forward 5'-3 ' <400> 27 atggtgaagc accagtgctg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Glp reverse 5'-3 ' <400> 28 cattgttgac tcgagaggca 20 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bmi1 forward 5'-3 ' <400> 29 gagggtactt cattgatg 18 <210> 30 <211> 18 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bmi1 reverse 5'-3 ' <400> 30 actttccgat ccaatctg 18 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bmi1 forward 5'-3 ' <400> 31 gagaccagca agtattgtcc 20 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Bmi1 reverse 5'-3 ' <400> 32 caagcttatt atctcatcat cag 23 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Eed forward 5'-3 ' <400> 33 ctgagtgctg attatgatc 19 <210> 34 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Eed reverse 5'-3 ' <400> 34 tatgaggatc ttctacttc 19 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Eed forward 5'-3 ' <400> 35 tctaccagag acatacatag 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Eed reverse 5'-3 ' <400> 36 ccaaatgtca cactggctgt 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Suz12 forward 5'-3 ' <400> 37 ctctatttcc acagtgatac 20 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Suz12 reverse 5'-3 ' <400> 38 tatctattga cattatgc 18 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Suz12 forward 5'-3 ' <400> 39 aaggagagaa agaagtgatg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Suz12 reverse 5'-3 ' <400> 40 tcatgcatgc tgactagatg 20 <210> 41 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Yy1 forward 5'-3 ' <400> 41 aagaagtggg agcagaagc 19 <210> 42 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Yy1 reverse 5'-3 ' <400> 42 tgttcttgga gcatcatc 18 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Yy1 forward 5'-3 ' <400> 43 tgcagatcaa gaccctgga 19 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Yy1 reverse 5'-3 ' <400> 44 gagttctctc caatgatctg 20 <210> 45 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jmjd3 forward 5'-3 ' <400> 45 ctcaccatca gccactgtg 19 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jmjd3 reverse 5'-3 ' <400> 46 agctctcaca gggccagat 19 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jmjd3 forward 5'-3 ' <400> 47 tgccagcaag aatgccaag 19 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Jmjd3 reverse 5'-3 ' <400> 48 ccagagtctt ggtggagaaa 20 <210> 49 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jhdm2 forward 5'-3 ' <400> 49 agcattcttg gctttgaca 19 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jhdm2 reverse 5'-3 ' <400> 50 catcagatca tcaaacctg 19 <210> 51 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Jhdm2 forward 5'-3 ' <400> 51 ggcagccagt gatggtgt 18 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Jhdm2 reverse 5'-3 ' <400> 52 ccttaagttt caacaccatt g 21 <210> 53 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Jhdm3a forward 5'-3 ' <400> 53 ttctaccagt gtgaggtg 18 <210> 54 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Jhdm3a reverse 5'-3 ' <400> 54 tctcattgaa gcgcatgtc 19 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Jhdm3a forward 5'-3 ' <400> 55 catagtgagt caggactgtc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Jhdm3a reverse 5'-3 ' <400> 56 agtctagact tgactctctt 20 <210> 57 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Lsd1 forward 5'-3 ' <400> 57 tctggcttgg cagcagctc 19 <210> 58 <211> 19 <212> DNA <213> Artificial Sequence <220> Lsd1 reverse 5'-3 ' <400> 58 gtggcttcta gcaaccggt 19 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Lsd1 forward 5'-3 ' <400> 59 acttctggaa gccagggatc 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> Lsd1 reverse 5'-3 ' <400> 60 cttgatcttg gccagttcca 20

Claims (13)

1) preparing an experimental group and a control group of any one of the following i) to iii)
i) In vitro culture blastocysts and control group were cultured in mammals other than humans; blastocysts;
Ii) In vitro cultured blastocysts after in vitro fertilization and the control group were cultured in vitro in mammals other than humans; blastocysts; And
Iii) Cloned embryos in the experimental group and in vitro embryos in the control group;
2) Multiple RT-PCR was performed using primers capable of amplifying each of the following 15 genes from a single embryo or a single cell colony derived from each of the experimental group and the control group in the above step 1) to determine the expression level of the 15 genes Analysis step:
DNA methyltransferase 3a, Dnmt3b DNA methyltransferase 3b, G9a, GLP (G9a-like protein), ESET (ERG-associated protein with a SET domain), Suv39h1 (suppressor of variant 3- 9 homolog 1), Eed (embryonic ectoderm development), Suz12 (suppressor of zeste 12 homolog), Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A (JmjC-Containing H3K9 Demethylase 3A) and JMJD3 (Jumonji domain 3); And
3) comparing the gene expression level of the test group analyzed in the step 2) with the gene expression level of the control group to determine the following a) to c):
Wherein the method comprises the steps of: determining the quality of the embryonic cell;
a) If the Dnmt1, Suv39h1, Glp and Eed genes are increased as compared to the control group in step i) above, the replication efficiency of the test group is higher than that of the control group;
b) In step ii) of the step 1), when the Dnmt1, Dnmt3a, Dnmt3b, Suv39h1, G9a, ESET, Glp, Eed, Jmjd3 and Jhdm2a genes are increased as compared with the control group, the replication efficiency of the test group is higher than that of the control group;
c) In the case of iii) in the above step 1), the Dnmt3b and Suv39h1 genes are compared with the control group and the value of each p is 0.05 or less. If there is a significant difference, the replication efficiency is higher than that of the control.
delete 1) preparing the following experimental group and control group, respectively:
The experimental group was a population of pluripotent pluripotent stem cells and the control group was embryonic stem cell-derived colonies;
2) performing multiple RT-PCR using primers capable of amplifying each of the following 15 genes from the single cell colonies derived from the experimental group and the control group of the step 1) to analyze the expression level of the 15 genes :
DNA methyltransferase 3a, Dnmt3b DNA methyltransferase 3b, G9a, GLP (G9a-like protein), ESET (ERG-associated protein with a SET domain), Suv39h1 (suppressor of variant 3- 9 homolog 1), Eed (embryonic ectoderm development), Suz12 (suppressor of zeste 12 homolog), Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A (JmjC-Containing H3K9 Demethylase 3A) and JMJD3 (Jumonji domain 3); And
3) comparing the gene expression level of the test group analyzed in the step 2) with the gene expression level of the control group,
(IPS) efficiency of regenerated cells comprising the same.
a) In step 1), when the Dnmt3a, Dnmt3b and G9a genes are compared with the control group and the value of each p is 0.05 or less, iPS efficiency is higher than that of the control group.
[3] The method according to claim 1, wherein the gene of step 3) is a gene related to epigenetic reprogramming.
The method according to claim 1, wherein Dnmt1, Dnmt3a and Dnmt3b among the genes of step 3) are DNA methylase, G9a, GLP, ESET and Suv39h1 are histone methylation enzymes, Eed, Suz12, Bmil and YY1 are polycomb proteins, LSD1 , JHDM2A, JHDM3A and JMJD3 are histone demethylating enzymes, which increase the replication efficiency of embryonic cells.
The method according to claim 1, wherein the primer of step 2) comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 60.
delete 2. The method of claim 1, wherein the multiple RT-PCR of step 2)
1) subjecting the primers of SEQ ID NO: 1 to SEQ ID NO: 60 to a first polymerase reaction simultaneously; And
2) The first polymerase reaction product of step 1) is diluted and used as a template for a second polymerase reaction to perform a secondary nested polymerase reaction with a pair of nested polymerase enzyme reaction primers A method of quality determination which increases the replication efficiency of embryonic cells.
A kit for quality assessment to increase the induced-pluripotent stem cell (iPS) efficiency of a degenerated cell comprising primers capable of amplifying the following 15 genes, respectively:
DNA methyltransferase 3a, Dnmt3b DNA methyltransferase 3b, G9a, GLP (G9a-like protein), ESET (ERG-associated protein with a SET domain), Suv39h1 (suppressor of variant 3- 9 homolog 1), Eed (embryonic ectoderm development), Suz12 (suppressor of zeste 12 homolog), Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine demethylase 1), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A (JmjC-Containing H3K9 Demethylase 3A) and JMJD3 (Jumonji domain 3).
A kit for determining the quality of a blastocyst or a fertilized egg cell which includes a primer capable of amplifying the following 15 genes, respectively,
(DNA methyltransferase 1), Dnmt3a (DNA methyltransferase 3a), Dnmt3b (DNA methyltransferase 3b), G9aGLP (G9a-like protein), ESET (ERG-associated protein with a SET domain), Suv39h1 (suppressor of variant 3-9 homolog 1), Eed (embryonic ectoderm development), Suz12 (suppressor of zeste 12 homolog), Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine ), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A (JmjC-Containing H3K9 Demethylase 3A) and JMJD3 (Jumonji domain 3).
[Claim 11] The kit for determining the quality of a blastocyst or embryo cell according to claim 10, wherein the primer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO:
A biochip for quality determination to increase the replication efficiency of a blastocyst or embryo cell containing primers capable of amplifying the following 15 genes, respectively:
(DNA methyltransferase 1), Dnmt3a (DNA methyltransferase 3a), Dnmt3b (DNA methyltransferase 3b), G9aGLP (G9a-like protein), ESET (ERG-associated protein with a SET domain), Suv39h1 (suppressor of variant 3-9 homolog 1), Eed (embryonic ectoderm development), Suz12 (suppressor of zeste 12 homolog), Bmi1 (B lymphoma Mo-MLV insertion region 1 homolog), YY1 (yin-yang protein), LSD1 (lysine ), JHDM2A (JmjC-Containing H3K9 Demethylase 2A), JHDM3A (JmjC-Containing H3K9 Demethylase 3A) and JMJD3 (Jumonji domain 3).
13. The biochip for quality control as claimed in claim 12, wherein the primer comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 60.

Images