KR101590035B1 - Biomaker gene and diagnostic composition specific for environmental stress of poultry, and Prediction method of stress possibility, egg production using the same - Google Patents

Abstract

The present invention relates to a gene biomarker specific to environmental stress of poultry, a method of predicting stress and a rate of egg production using the same, and more particularly, to a method of predicting a stress hormone (CORT) The aim of this study was to develop a biomarker for genes that are differentially expressed in stressed laying hens and unstressed laying hens.
The present invention according to the present invention relates to a gene biomarker specific to environmental stress of poultry and to a method for predicting stress probability and egg production using the same as a method for producing a biomarker that is differentially expressed in a fallopian tube due to stress, And can predict and evaluate egg production and egg quality in laying hens.
In addition, by developing a gene biomarker specific to the environmental stress of the present invention as a kit, it is possible to provide a kit for delaying acetic acid late onset, shortening the peak period of the egg production, and producing an egg, A method of slaughtering and selecting and improving excellent poultry can be provided.
It is another object of the present invention to develop a marker composition for stress diagnosis using a protein newly expressed or differentially expressed in an egg white ratio due to stress. It is an object of the present invention to develop a composition for stress diagnosis and a kit using an antibody that specifically binds to a newly expressed or differentially expressed protein in an egg white ratio due to stress.

Description

Technical Field [0001] The present invention relates to a gene biomarker specific for environmental stress of poultry, a composition for diagnosing environmental stress, a diagnostic kit, and a method for predicting stress probability and egg production rate using the same, the same}

The present invention relates to a gene biomarker specific to environmental stress of poultry, a composition for diagnosing environmental stress, and a method of predicting stress and a method of predicting an egg production rate using the same. More particularly, the present invention relates to a method for predicting the occurrence of corticosterone (CORT) , Which can be used as a biomarker to differentially express genes expressed in stressed laying hens and unstressed laying hens, and to predict the possibility of stress in the poultry, laying rate of laying hens, Method. In addition, it was shown that chicken was induced by artificially feeding corticosterone (CORT), a type of stress hormone, to the stressed laying hens and to the egg white protein, which is differentially expressed in the egg whites of the unstressed laying hens Antibodies and the like, and a kit for environmental stress diagnosis.

At present, livestock chickens are exposed to many environmental stressors. These factors include breeding density, ambient temperature, transport, fasting, and feed contamination. These factors produce stress responses in chickens.

Stress in animals reduces immunity and lowers both quantitative and qualitative productivity. In the case of chickens, the stressed laying hens decreased egg production and egg quality, and the concentration of corticosterone (CORT), glucose, and cholesterol changed, and the weight of the spleen, liver and F- It has been revealed through various studies that it changes. Stress in laying hens also slows down the age of acetic acid, shortens the spawning peak period, and reduces the weight of the organs that produce eggs, the fallopian tubes and the ovaries. Consistent with these results, stress reduces the number of large follicles in the ovary, increases the number of obturator follicles, and decreases plasma levels of testosterone, progesterone and estrogen, the reproductive-related steroid hormones. It also reduces ovarian gene expression and affects protein expression in the fallopian tubes and ovaries.

Recently, proteome analysis has been introduced as a means of analyzing gene expression and identifying biomarkers at different protein levels. However, proteomics studies have been developed to date, and proteomics studies on environmental stresses are extremely rare.

Therefore, in the present invention, a gene which is different in the degree of expression is directly fed to a chicken, and corticosterone, which is a type of stress hormone, is directly fed to the chicken to develop a gene biomarker related to the stress in the chicken. The possibility of stress in poultry, the egg production rate and egg quality in laying hens.

Egg can be said to be a place where information about the environmental information at the time of birth of eggs is produced. A complete egg yolk requires several days to be produced, whereas an egg egg is produced in a few hours. The fallopian tubes are divided into five areas as infundibulum, magnum, isthmus, shell gland (uterus) and vagina. The egg secretion part is an egg It is a place to produce egg white for 2-3 hours.

When the laying hens are exposed to environmental stress, the secretion of stress hormones such as corticosterone is increased, which is stored and transferred to eggs, similar to the transfer of nutrients. The high corticosterone concentration in the mother's blood also affects offspring development and sex ratio survival. Treatment of Corticosterone or adrenocorticotrophic hormone (ACTH) not only delays the onset of spawning and reduces the duration of the spawning peak, but also reduces the egg production rate and eventually leads to discontinuation of spawning. The cause of this phenomenon is associated with a sharp decrease in the weight of the fallopian tubes and ovaries. In addition to increasing the concentration of corticosteone in the blood, it also affects the ovary and tubal weight, ovarian hormone related to ovarian cell death and cell proliferation, and stress. In addition, stress is also associated with the expression of mRNAs and proteins involved in the regulation of steroid hormones in laying hens and receptors present in the fallopian tubes. The mRNA of steroid enzymes in the ovary is reduced by high temperature stress and increased by ovarian cancer. Stress, such as bad breath, inflammatory response, ovarian cancer or dexamethasone treatment, affects ovarian and oviductal gene expression and protein expression in laying hens.

Therefore, in the present invention, corticosterone, a type of stress hormone, is directly fed to a chicken to identify egg white protein having a different degree of expression, and antibodies specifically binding thereto are identified in a poultry environment It is intended to be used as a composition and a kit for stress diagnosis.

Application No. 10-2003-0078451 Cellulase gene chip for environmental stress analysis and environmental hazard using it

Accordingly, in order to achieve the above object, the present invention provides a method for selecting a gene that is differentially expressed by a stress hormone and developing the gene as a biomarker specific for environmental stress of poultry, And a method for evaluating the quality of the hull.

In order to accomplish the above object, the present invention provides a method of screening for an anti-parasitic bovine protein that is differentially expressed in an egg white scale of poultry by a corticosterone (CORT), a type of stress hormone, and an antibody specifically binding thereto And to utilize it as a composition and kit for environmental stress diagnosis of poultry.

The present invention relates to a gene biomarker specific to environmental stress of poultry, and a method for predicting stress probability and egg production using the same, which is selected from the group consisting of m-calpain, Caspase 3 and cathepsin B, Lt; RTI ID = 0.0 > biomarkers. ≪ / RTI >

The method for identifying the environmental stress of poultry using the gene biomarker specific to the environmental stress of the poultry of the present invention is characterized in that the reduction of the expression of the m-calpain gene is used as a marker indicating a high stress of the poultry. In addition, the present invention is characterized in that the increase in the expression of the Cathepsin B gene is used as a marker indicating a high stress in the poultry. In addition, the present invention is characterized in that the increase of expression of Caspase 3 gene is used as a sign indicating that stress of poultry is high.

The method of predicting the egg production rate of a laying hens using a gene biomarker specific to the environmental stress of the poultry of the present invention is characterized in that the egg production rate of the laying hen decreases as the expression amount of the m-calpain gene decreases. Also, the present invention is characterized in that the egg production rate of the laying hens decreases as the expression amount of Cathepsin B increases. Also, the present invention is characterized in that the egg production rate of the laying hens decreases as the expression level of Caspase 3 increases.

The marker composition for environmental stress diagnosis of poultry according to the present invention comprises Tropomyosin (TPM2) of SEQ ID NO: 7, Keratin19 (KRT19) of SEQ ID NO: 8, Desmin (DES) of SEQ ID NO: 9, Vimentin Of Lysozyme C (LYZ) is newly expressed when environmental stress is likely to be high.

The marker composition for diagnosing environmental stress of poultry according to the present invention comprises Actin of SEQ ID NO: 12, aortic smooth muscle (ACT), F-actin-capping protein subunit alpha-2 (CAPZA2) of SEQ ID NO: 13, Capping protein Tublin alpha (TUBA) of SEQ ID NO: 16, Tublin beta-3 chain (TUBB2C) of SEQ ID NO: 17, SEQ ID NO: An antiththrombin (ANT) of SEQ ID NO: 20, an Apolipoprotein A-1 preproprotein (APOA 1) of SEQ ID NO: 21, The nucleotide sequence of SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 22, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 23, the nucleotide sequence of SEQ ID NO: 26, Tissue transglutaminase (TGases), Creatine kinase B-type (CKB) of SEQ ID NO: 27, Adenylosuccinate synt IG light chain (Ig-Lc) of SEQ ID NO: 30 and PIT 54 protein of SEQ ID NO: 31 (SEQ ID NO: 31) PIT) is elevated when the possibility of environmental stress is high.

The marker composition for environmental stress diagnosis of poultry according to the present invention comprises PREDICTED: similar to sorbin and SH3 domain containing 1 (SORBS 1) of SEQ ID NO: 32, Ovomucoid (OVM) of SEQ ID NO: 33, ATP synthase subunit beta of mitochondrial precursor (ATP5B), Sorting nexin-13 (SNX 13) of SEQ ID NO: 35, Coatomer subunit epsilon (COPE) of SEQ ID NO: 36, Rap GDP dissociation inhibitor beta (GDI 2) of SEQ ID NO: 37, Protein disulfide- Wherein at least one egg white protein is selected from the group consisting of A3 (PDIA3), Protein disulfide-isomerase A4 (SEQ ID NO: 39) and PREDICTED: similar to mKIAA1258 protein (mKIAA 1258) Expression is reduced.

The composition and kit for environmental stress diagnosis of poultry according to the present invention are characterized in that the antibody specifically binding to the environmental stress specific proteins of the poultry described above is used.

The present invention according to the present invention relates to a gene biomarker specific to environmental stress of poultry and to a method for predicting stress probability and egg production using the same as a method for producing a biomarker that is differentially expressed in a fallopian tube due to stress, And can predict and evaluate egg production and egg quality in laying hens.

In addition, by developing a gene biomarker specific to the environmental stress of the present invention as a kit, it is possible to provide a kit for delaying acetic acid late onset, shortening the peak period of the egg production, and producing an egg, A method of slaughtering and selecting and improving excellent poultry can be provided.

The marker composition for environmental stress diagnosis using the egg white protein of the poultry of the present invention and the composition for diagnosing environmental stress using the antibody that specifically binds to the egg white protein can be used to determine the stress of the poultry.

As described above, according to the present invention, it is possible to analyze the expression of a specific egg yolk protein component and the increase / decrease of the specific egg yolk protein component by the differential expression analysis of the egg white protein of the poultry, thereby determining the stress of the poultry. Can be used as a new indicator for quality analysis of meat or eggs.

In addition, the antibodies prepared on the basis of the egg white protein of the present invention can be used as an immunoassay kit (ELISA, antibody coated tube test, lateral-flow test, potable) for diagnosing environmental stress of poultry and analyzing meat quality and egg quality of poultry biosensors, etc.), and also can be used in the development of protein chips having a variety of environmental stress diagnoses and a spectrum of quality analysis of poultry meat quality and eggs through the development of antibodies exhibiting higher specificity and sensitivity.

The present invention provides a diagnostic marker composition, a diagnostic composition, and a diagnostic kit specific to environmental stress of poultry to determine the presence or absence of stress in poultry, and can determine environmental stressor factors by determining environmental stress. In other words, it is possible to grasp the correlation between the environment of poultry breeding and stress, and it is possible to grasp the factor that causes environmental stress in the breeding environment of poultry. By eliminating the environmental stressor of poultry, it is possible to improve the breeding environment of poultry, to prevent various diseases by improving immunity of poultry, to prolong life, to improve meat quality of poultry, and to improve quality of poultry. Animal welfare can be improved by judging the environmental stress of poultry. In addition, it is possible to provide a method of selecting and improving poultry with better quality through prediction of environmental stress of poultry.

Figure 1. Differential expression patterns of each gene due to corticosterone feeding
Figure 2. Analysis of weight change due to corticosterone treatment
Figure 3. Analysis of changes in feed intake due to corticosterone
Figure 4. Analysis of the change in egg production due to corticosterone treatment
Figure 5. Analysis of egg weight change due to corticosterone feeding
Figure 6. Analysis of the change in the quality of the egg due to corticosterone treatment
Figure 7. SDS-PAGE of the proteins of the egg white of 2 weeks after the start of the test
Figures 8 and 9. Protein of the egg white portion at 2 weeks after the start of the test was treated with 2DE and Images Master,
10 to 16. The egg white proteins are divided into A (Cytoskeleton Organization, Proteases, C Protease Inhibitors, D Protein Transport Proteins, E DNA Associated Proteins, F Enzymes and G Immunity groups) Protein spots of two treatments with significantly increased expression were classified by protein function
Figure 17. Data showing protein spots (TPM2, KRT19, DES, VIM, LYZ) that were expressed only in the stress group.
18. Analysis of the genes of the proteins significantly increased or decreased in protein expression analysis revealed that the genes showing increased genes in the treatment group compared to the control group
19. Analysis of the genes of the proteins significantly increased or decreased in protein expression analysis revealed that the genes showing reduced genes in the treatment group compared to the control group
20. to 21. Display the necessary information to perform the expression analysis of all proteins and genes tested
Figures 22 to 31. Results of 2DE gel and Image Master analysis of all the proteins tested and 2DE gel spots of the treatments with significantly increased expression compared to the control were analyzed using MALDI-TOF / TOF / MS / MS Data identified as
32 to 39. All of the tested opsonophagocyte bovine proteins were amplified using A (Cytoskeleton Organization, B Proteases, C Protease Inhibitors, D Protein Transport Proteins, E DNA Associated Proteins, F Enzymes, G Immunity) group, and all the information of protein spots of two treatments with significant increase in expression was classified by protein function

The present invention relates to a gene biomarker specific to environmental stress of poultry, and a method for predicting stress probability and egg production using the same, which is selected from the group consisting of m-calpain, Caspase 3 and cathepsin B, Lt; RTI ID = 0.0 > biomarkers.

The method for confirming the environmental stress potential of poultry using a gene biomarker specific to the environmental stress of poultry according to the present invention is characterized in that the reduction of the m-calpain gene expression is used as a marker indicating a high stress of the poultry Provides a way to predict environmental stress potential. Also, the present invention provides a method for predicting the environmental stress of poultry, characterized in that the increase of the expression of Cathepsin B gene is used as a marker indicating high stress in poultry. Also, the present invention provides a method for predicting the environmental stress of poultry, wherein the expression of Caspase 3 gene expression is used as a marker indicating high stress in poultry.

The method of predicting the egg production rate of a laying hens using a gene biomarker specific to the environmental stress of the poultry of the present invention is characterized in that the egg production rate of the laying hens decreases as the expression amount of the m-calpain gene decreases, A method for predicting the egg production rate of a laying hens using a biomarker is provided. Also, the present invention provides a method for predicting the egg production rate of a laying hens using a gene biomarker specific to environmental stress of poultry, wherein the egg production rate of the laying hens is lowered as the expression amount of Cathepsin B is increased. Also, the present invention provides a method for predicting the egg production rate of a laying hens using a gene biomarker specific to environmental stress of poultry, characterized in that the egg production rate of the laying hens decreases as the expression amount of Caspase 3 increases.

The gene biomarkers specific to the environmental stress of the poultry according to the present invention were obtained by first dividing the control and experimental groups and feeding the experimental group with the feedstuff containing the stress hormone corticosterone for 2 weeks, , Extracting the tubules from the control and the experimental group, extracting the RNA from each tubal tube, and identifying the genes that are differentially expressed in the control and experimental groups using real-time PCR technique. Also, the present invention provides a method for evaluating the stress potential of the poultry, the egg laying rate of the laying hens, and the egg quality by developing a gene that is differentially expressed in the present invention as a biomarker.

Genes with differential expression confirmed by the above process and their roles are as follows.

m-calpain exists as two isoforms with μ-calpain, and catalytic subunit (80-kDa) and regulatory subunit (28-kDa) are heterodimers, . m-calpain (Capn2) is a cysteine protease that is known to be involved in the cytoskeletonization induced by integrins during cell migration, and is known to regulate osteoclast migration and bone resorption.

Caspase plays an important role in hepatocyte death, and Caspase 3 among several caspases is an important executable protein of cell death. Caspase 3, a member of the cysteine proteolytic cleavage group, is an intracellular inactive enzyme source. When DNA is damaged by various stimuli, caspase 3 is activated and thus important for apoptosis signaling Recently, it has been known that the inhibition of apoptosis by Caspase 3 abnormal differentiation in pre - cancerous lesions or carcinoma plays an important role in the carcinogenesis.

Cathepsin B is a protein consisting of 340 amino acids, also known as Cathepsin B1, which is divided into two chains: Cathepsin B light chain and Cathepsin B heavy chain. The gene associated with this protein is CTSB (Accession no. NCBI: gi | 46195455, Uniprot: P43233). Peptidase belongs to the C1 family and is involved in the regulation of proteolysis and catalytic activity. Cathepsin plays an important role in the degradation process of proteins in lysosomes and degrades muscle proteins.

Hereinafter, the present invention will be described in detail with reference to examples.

Example 1: Animal experiment

Forty-four weeks old, single comb brown Hy-Line Leghorn hens were individually housed in a 3-row upright cage with 4 chambers in each of two chambers of equal size. The temperature of the breeding room was maintained at 18 to 22 ° C, and lighted at 6:00 am and turned off at 9:00 pm (turned on for 15 hours). During the test period feed and water were supplied without restriction. After 2 weeks of adaptation period, control diet (containing 1 mg of corticosterone in 1 kg of feed) and experimental feed (1 kg in experimental group) were applied to one treatment (control) Containing 30 mg of corticosterone) for two weeks.

The experimental diets were prepared by dissolving 500 mg of ethanol (ETOH) in the control diet and 815 mg of corticosterone (92%, C2505, Sigma, USA) in 500 mL of 99.5% EtOH. .

Example 2: Fallopian tube extraction

Control feeds or experimental feeds After the start of feeding, the laying hens were chopped for 2 weeks, and the fallopian tubes were removed and stored at -80 ° C until analysis.

Example 3: qPCR ( Quantitative 중합체 chain reaction ) analysis

Extraction of the egg white of the egg white from the fallopian tube tissue isolated from Example 2 was performed according to the instructions using an RNA extraction kit (Easy-SpinTM Total RNA Extraction Kit, Intron, Korea) from about 100 mg of the tissue. The concentration of extracted RNA was quantified by absorbance measurement at 260 nm using a spectrophotometer (Nanodrop 2000C, Thermo Scientific, USA). In order to confirm the state of the extracted RNA, electrophoresis was performed on 1% agarose gel to confirm the bands of 18S and 28S, respectively. After that, the cDNA synthesis was carried out using a cDNA synthesis kit (PrimeScriptTM 1st Strand cDNA Synthesis Kit, Takara, Japan) according to the guidelines, and the RNA was reverse-transcribed with the cDNA.

The primers corresponding to each gene for qPCR were synthesized as shown in Table 1. In order to confirm the reaction conditions, cDNA was amplified using general PCR (Accupower hotstart PCR premix, Biomeer, Korea) ) Was performed to amplify each gene, and the band of the gene was confirmed by electrophoresis on 1.5% agarose gel.

Gene name Gene
Symbol Accession
No Forward (5 ', 3')
Reverse (5 ', 3') Size Gallus gallus mCL mRNA for m-calpain large subunit M-calpain D38026 F: ACATCATCGTGCCCTCTACC
R: GAGATCTCTGCATCGCTTCC 202 Gallus gallus mCL mRNA for m-calpain large subunit Caspase 3 AF083029 F: TGGCGATGAAGGACTCTTCT
R: TGGTCCACTGTCTGCTTCA 173 Gallus gallus cathepsin B CTSB NM_205371 F: GGGTAGATTTTGCTGAGGATATGG
R: GGAGCCCTGGTCTCTGATCTC 101

The quantitative polymerase chain reaction (qPCR) analysis was performed using the Power SYBR Green PCR Mater Mix (Applied Biosystems, USA) and Step One Plus Real-Time PCR System (Applied Biosystems, USA) glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Example 4: Statistical analysis

Statistical analysis was performed by independent t-test (t-test) to estimate the effect of the corticosterone feeding according to the invention. The P-value was found to be significantly different from the mean of the two groups when the P-value was less than 0.05. It means that there is.

Example 5: m- calpain due to corticosterone feeding , Caspase 3, Cathepsin Analysis of expression pattern of B gene

Expression patterns of m-calpain, Caspase 3, and Cathepsin B genes confirmed by qPCR in Example 3 were analyzed and shown in Table 2 and Fig.

Gene / GAPDH mRNA Treatment M-calpain CTSB Caspase 3 Control 1.5 ± 0.2 0.7 ± 0.1 0.7 ± 0.1 Stress 0.5 ± 0.2 1.5 ± 0.2 1.8 ± 0.3 P -value 0.002 0.0003 0.004

The expression of m-calpain was rapidly decreased in the experimental group fed with the corticosterone, a type of stress hormone, compared with the control group fed the control diet. In addition, the expression of Cathepsin B and Caspase 3 Respectively, and their differentially expressed values were significant.

These results suggest that stress in poultry reduces expression of m-calpain gene and improves expression of Cathepsin B and Caspase 3. These results suggest that the expression of m-calpain, Caspase 3, and Cathepsin B genes may be useful for stress detection in poultry.

Example 6. Corticosterone  Specification experiment results due to pay

Table 3 (Fig. 2), Table 4 (Fig. 3) and Table 5 (Fig. 3) show the experimental results of the experimental group consuming the control feed consuming the control diet and the experimental feed containing the corticosterone, (Fig. 4) and Table 6 (Fig. 5).

Body weight (g) Day 0 Day 7 Day 13 Control 1830 ± 36 1857 ± 58 1830 ± 69 Stress 1929 ± 63 1994 ± 60 1993 ± 107 P -value 0.29 0.11 0.32

Body weight and egg weight of laying hens were not different between control and experimental groups. On the other hand, there was a significant difference in feed intake and egg production.

Feed intake (g) Day 0 Day 7 Day 13 Control 117.5 ± 4.8 109.7 ± 4.3 111.1 ± 5.2 Stress 126.5 ± 4.9 137.0 ± 6.2 142.3 ± 4.1 P -value 0.10 0.0005 0.00002

In the case of feed intake, the control diet fed the control diet showed a trend of keeping the feed intake constant at a constant level without increasing the feed intake during the test period, whereas in the experimental diet fed corticosterone during the feeding period, the feed intake Which is a significant increase.

Egg production (%) Day-7 Day 0 Day 7  Day 13 Control 95 75 80 85 Stress 90 95 50 5

"The egg production rate is calculated as the daily egg production rate = chickens / whole chickens scattered, no standard error"

In the case of the egg production rate, the egg production rate of the control group and the experimental group showed a constant egg production rate of 75 to 100%, and the egg production rate of the experimental group rapidly decreased during the feeding period of the corticosterone. , And stress was found to have a great influence on laying rate of laying hens.

Egg weight (g) Day 0 Day 7  Day 13 Control 58.2 ± 1.0 61.6 ± 1.4 59.5 ± 1.3 Stress 62.0 ± 0.9 57.9 ± 2.0 63.0 ± 0.0 P -value 0.0005 0.05 -

In addition, in the case of egg weight, when the control and the experimental group were compared, significant difference was found on the 7th and 8th days of the test, but the difference in the weight was so slight that the stress hormone of the corticosterone It is difficult to conclude that it is affected.

Thus, we concluded that stress in laying hens affects the feed intake and egg production rate.

Example 7: Corticosterone  Analysis of ovary due to salary

As in Example 1, the egg quality of eggs produced by the control group fed with the control diet and the experimental diet containing the corticosterone, a type of stress hormone, were compared and analyzed, 6.

Egg weight, Albumen height, Haugh unit, Yolk color, yolk lightness, and yolk lightness, which are generally used for evaluation of egg quality, Yolk redness, Yolk yellowness, Shell color, Shell weight, Shell thickness, and Shell strength of egg shells. Respectively.

Parements Treatment Days 0 One 5 10 Egg weight
(g) Control 59.3 ± 1.00 60.1 ± 1.3 58.3 ± 1.1 58.2 ± 1.5 Stress 61.3 ± 1.9 61.7 ± 1.4 58.8 ± 1.8 59.1 ± 2.2 P -value 0.18 0.20 0.42 0.35 Albumen height
(mm) Control 6.8 ± 0.6 9.0 ± 0.5 6.9 ± 0.6 7.8 ± 0.6 Stress 7.3 ± 0.7 9.0 ± 0.6 6.8 ± 0.4 5.5 ± 0.8 P -value 0.28 0.49 0.43 0.01 Haugh unit
(HU) Control 80.7 ± 4.1 94.2 ± 1.9 81.8 ± 3.7 87.5 ± 3.2 Stress 87.0 ± 3.3 93.1 ± 3.2 81.2 ± 3.5 69.5 ± 7.8 P -value 0.13 0.39 0.45 0.01 Egg yolk color
(unit) Control 7.0 ± 0.3 7.1 ± 0.3 7.4 ± 0.3 7.0 ± 0.4 Stress 7.0 ± 0.3 7.7 ± 0.1 7.8 ± 0.3 8.1 ± 0.4 P -value 0.33 0.05 0.16 0.03 Yolk lightness Control 63.0 ± 1.1 60.0 ± 0.7 64.8 ± 0.9 61.7 ± 0.8 Stress 63.0 ± 0.8 62.8 ± 0.9 61.7 ± 0.6 59.1 ± 2.5 P -value 0.37 0.01 0.01 0.13 Yolk redness Control -3.5 ± 0.2 -2.7 ± 0.2 -3.1 ± 0.1 -3.4 ± 0.4 Stress -3.3 ± 0.2 -2.8 ± 0.2 -1.6 + 0.4 -0.7 ± 0.6 P -value 0.29 0.35 0.00 0.00 Yolk yellowness Control 48.2 ± 1.5 47.00 ± 0.9 50.6 ± 0.5 47.2 ± 1.5 Stress 49.8 ± 1.5 49.3 ± 1.4 51.1 ± 1.2 44.8 ± 1.6 P -value 0.23 0.08 0.37 0.16 Shell Color
(unit) Control 24.6 ± 1.0 24.0 + 1.43 25.6 ± 2.0 28.0 ± 2.5 Stress 27.0 ± 1.8 23.6 ± 1.6 25.4 ± 1.8 26.6 ± 2.5 P -value 0.14 0.42 0.47 0.35 Shell weight
(g) Control 8.2 ± 0.3 8.5 ± 0.2 8.2 ± 0.3 8.2 ± 0.2 Stress 8.7 ± 0.3 8.8 ± 0.3 8.5 ± 0.2 8.4 ± 0.4 P -value 0.10 0.12 0.20 0.32 Shell thickness
(탆) Control 4.1 ± 0.1 4.2 ± 0.2 4.3 ± 0.1 4.1 ± 0.2 Stress 4.3 ± 0.1 4.5 ± 0.1 4.5 ± 0.1 4.7 ± 0.01 P -value 0.16 0.03 0.20 0.01 Shell density
(kg / cm ² ) Control 5.0 ± 0.4 5.1 ± 0.3 4.6 ± 0.3 5.0 ± 0.4 Stress 4.9 ± 0.4 4.7 ± 0.3 5.0 ± 0.3 5.7 ± 0.2 P -value 0.43 0.17 0.16 0.10

As a result of checking the egg white height, a low egg white height was observed in the experimental group fed with corticosterone in the control and experimental groups at the 10th day of the test. The freshness of eggs is determined by rainfall units. The higher the rainfall unit, the more fresh eggs are evaluated. In the present invention, as in the case of egg white height, a significantly lower level of rainfall was observed in the experimental group on the 10th day of the test, and the eggs produced by the stressed laying hens were found to be inferior in freshness. In addition, the yolk redness was significantly stronger in the experimental group than in the control group. In addition, there was no significant difference between the control and the experimental group in the other evaluation items.

Thus, it was confirmed that stress in the laying hens affects a part of the egg quality including freshness.

The present invention as described above is an invention that confirms the effect of stress on the laying hens by mixing corticosterone, which is a type of stress hormone, into feed, and examines effects of stress on m-calpain, Caspase 3, and Cathepsin B genes, which can provide a method to confirm the possibility of stress in poultry. In addition, it was confirmed that stress addition significantly affects feed intake and egg production in laying hens, and it was found to have some effects on egg quality.

Therefore, the expression of m-calpain, Caspase 3, and Cathepsin B genes in chicken can be used to estimate the possibility of stress in the chicken, to estimate the egg production rate, and to provide a method for evaluating the egg quality.

The present invention relates to a marker composition for environmental stress diagnosis of poultry, which comprises Tropomyosin (TPM2) of SEQ ID NO: 7, Keratin19 (KRT19) of SEQ ID NO: 8, Desmin (DES) of SEQ ID NO: 9, Vimentin And Lysozyme C (LYZ) of SEQ ID NO: 11 is newly expressed when environmental stress is likely to be high. The present invention also provides a marker composition for diagnosing environmental stress of poultry. Thus, Tropomyosin (TPM2) of SEQ ID NO: 7, Keratin19 (KRT19) of SEQ ID NO: 8, Desmin (DES) of SEQ ID NO: 9, Vimentin (VIM) of SEQ ID NO: 10, Lysozyme C The presence of stress inducers in the poultry breeding environment can be inferred.

The present invention also provides a marker composition for environmental stress diagnosis of poultry comprising Actin of a nucleotide number 12, aortic smooth muscle (ACT), F-actin-capping protein subunit alpha-2 (CAPZA2) of SEQ ID NO: 13, Tropomyosin 1, alpha (TPM1), SEQ ID NO: 16 Tublin alpha (TUBA), SEQ ID NO: 17 Tublin beta-3 chain (SEQ ID NO: (ANT) of SEQ ID NO: 20, Apolipoprotein A-1 preproprotein of SEQ ID NO: 21 (SEQ ID NO: 18), the Cathepsin B precursor (CTSB) of SEQ ID NO: 18, PREDICTED: proteasome subunit beta type- APOA 1), Serum albumin precursor (ALB) of SEQ ID NO: 22, Chloride intracellular channel protein 2 (CLIC 2) of SEQ ID NO: 23, PREDICTED of similarity to SEQ ID NO: 24, Partial (ART), Prohhibitin PHB), Tissue transglutaminase (TGases) of SEQ ID NO: 26, Creatine kinase B-type (CKB) of SEQ ID NO: 27, Ad a light chain (Ig-Lc) of SEQ ID NO: 30 and a light chain of PIT 54 protein of SEQ ID NO: 31 (SEQ ID NO: (PIT) is elevated when environmental stress is highly likely to be present in the marker protein for environmental stress diagnosis of poultry. Actin, aortic smooth muscle (ACT) of SEQ ID NO: 12, F-actin-capping protein subunit alpha-2 (CAPZA2) of SEQ ID NO: 13, Capping protein (actin filament) muscle Z- TUBLIN alpha (TUBA) of SEQ ID NO: 16, Tublin beta-3 chain (TUBB2C) of SEQ ID NO: 17 and Cathepsin B precursor of SEQ ID NO: 18 (SEQ ID NO: (ANT) of SEQ ID NO: 21, Apolipoprotein A-1 preproprotein (APOA 1) of SEQ ID NO: 21, Serum albumin precursor of SEQ ID NO: 22 (CTSB), PREDICTED: proteasome subunit beta type- (ALB), Chloride intracellular channel protein 2 (CLIC 2) of SEQ ID NO: 23, PREDICTED: similar to artemis, partial (ART) of SEQ ID NO: 24, Prohhibitin (PHB) of SEQ ID NO: 25, Tissue transglutaminase ), The Creatine kinase B-type (CKB) of SEQ ID NO: 27, the Adenylosuccinate synthetase isozyme 2 (ADSS) of SEQ ID NO: 28, the PR When the increase in the expression of PIT 54 protein (PIT) proteins of SEQ ID NO: 31 was confirmed, the pituitary gland of poultry It can be deduced that there is a stressor in the breeding environment.

 The present invention also relates to a marker composition for environmental stress diagnosis of poultry comprising PREDICTED: similar to sorbin and SH3 domain containing 1 (SORBS 1) of SEQ ID NO: 32, Ovomucoid (OVM) of SEQ ID NO: 33, ATP synthase subunit beta , the mitochondrial precursor (ATP5B), Sorting nexin-13 (SNX 13) of SEQ ID NO: 35, Coatomer subunit epsilon (COPE) of SEQ ID NO: 36, Rap GDP dissociation inhibitor beta (GDI 2) of SEQ ID NO: 37, Protein wherein at least one egg white protein is selected from the group consisting of disulfide-isomerase A3 (PDIA3), protein disulfide-isomerase A4 (SEQ ID NO: 39) and PREDICTED: similar to mKIAA1258 protein (mKIAA 1258) The present invention provides a marker composition for environmental stress diagnosis of poultry which is characterized in that the expression is reduced when the concentration of the compound is high. (OVM) of SEQ ID NO: 33, ATP synthase subunit beta, mitochondrial precursor (ATP5B) of SEQ ID NO: 34, SEQ ID NO: 37, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 38, SEQ ID NO: 38, SEQ ID NO: 39 protein ID (PDIA4), and PREDICTED: similar to mKIAA1258 protein (mKIAA 1258) proteins of SEQ ID NO: 40 are confirmed, it can be deduced that the stress inducers are present in the breeding environment of poultry.

In addition, the present invention provides a composition and a kit for diagnosing environmental stress of poultry using an antibody that specifically binds to 34 proteins newly expressed or increased or decreased in a stress environment.

Hereinafter, the present invention will be described in more detail by way of specific examples. However, it should be understood that the present invention is not limited by the following examples, and that various changes and modifications can be made therein without departing from the spirit and scope of the present invention.

 The egg white protein of the present invention refers to a protein expressed in the egg white part of the fallopian tube. In the present invention, part of the egg secretory protein is used. However, it is not limited thereto.

The antibody of the present invention may be a polyclonal antibody, a monoclonal antibody or a recombinant antibody, but the antibody of the present invention is preferably a monoclonal antibody.

Polyclonal antibodies can be prepared by injecting an immunogen-causing biomarker protein into an external host according to conventional methods known to those skilled in the art. External hosts include, but are not limited to, mammals such as mice, goats, rabbits, sheep, monkeys, horses, pigs, cows, dogs and the like. Immunogens are injected by intramuscular injection, intraperitoneal injection, subcutaneous injection, etc., and are generally administered together with an adjuvant to increase antigenicity. Blood is routinely collected from an external host to collect the sera showing improved titer and specificity for the antigen or isolating and purifying the antibody therefrom.

Monoclonal antibodies can be produced by immortalized cell line generation techniques (Koeher and Milstein (1975) Nature, 256: 495 and Kohler and Milstein (1976) European Jounal of Immunology 6: 511) by fusion well known to those skilled in the art . More specifically, about 20 μg of a pure biomarker protein is first obtained and immunized with a suitable host animal such as a Balb / C mouse, or the peptide is synthesized and bound to bovine serum albumin and immunized with the host animal. The antibody-producing lymphocytes isolated from host animals such as mice are then fused by methods well known in the art, such as the use of human or mouse microRNAs and polyethylene glycols to produce immortalized hybridomas. Thereafter, only the hybridoma cells producing the desired monoclonal antibody are selected and proliferated using the ELISA method, and then the monoclonal antibody is separated and purified from the culture. The monoclonal antibody produced by the hybridoma may be used without purification. However, in order to obtain the best results, it is preferable to purify the antibody by high purity according to a method well known in the art.

Monoclonal antibodies may also be prepared by techniques known in the art, such as the phage antibody library (Clackson et al, Nature, 352: 624-628, 1991; Marks et al, J. Mol. Biol., 222: 58, . ≪ / RTI > More specifically, a phage antibody library method comprises obtaining an antibody gene (single chain fragment variable, scFv form) for a biomarker protein and expressing it in the form of a fusion protein on the surface of a phage, thereby preparing an antibody library in vitro And separating and preparing the monoclonal antibody binding to the biomarker protein.

The antibody prepared from the above method can be separated by methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography and the like.

Antibodies included in compositions or kits of the invention include functional fragments of antibody molecules as well as complete forms having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2, Fv and the like.

The diagnostic kit of the present invention is produced by a conventional manufacturing method known to a person skilled in the art, and includes a reagent capable of detecting an antigen-antibody complex in addition to the freeze-dried type antibody, buffer, stabilizer, For example, a labeled secondary antibody, chromophores, an enzyme (e.g., conjugated to an antibody) and its substrate, or other material capable of binding to the antibody, and the like. Also, the antibody according to the present invention can be labeled with radionuclides, fluorescent sources, enzymes, and the like.

According to another aspect of the present invention, there is provided a method for analyzing the environmental stress of poultry, which comprises detecting the expression of an egg white protein specific to environmental stress of poultry and the change in the expression level .

The present invention also provides a method for analyzing meat quality and egg quality of poultry which is characterized by detecting the expression and expression level of egg white protein specifically expressed in environmental stress of poultry .

In the analysis methods of the present invention, the step of detecting whether or not the expression of the egg white protein is altered may be performed by directly detecting the presence of the biomarker protein from the egg white part of the poultry by two-dimensional electrophoresis (2-DE) The semen secretion of the poultry is contacted with an antibody that specifically binds to the semen secretory protein to indirectly confirm the presence of the semen secretory protein through an antigen-antibody reaction.

In order to measure protein levels using antibodies, Western blot, enzyme linked immunosorbent assay (ELISA) and antibody-conjugated magnetic particles were bound to the tube, and then antigen-tracer and degradation-resistant contaminants were competitively reacted with each other, (RIA), radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, and rocket immunoassay, which can be used to quantitate and quantitate the response of an antibody- But are not limited to, immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement fixation assays, FACS, protein chips, and the like.

Through the above analysis methods, the changes of the newly expressed or differentially expressed unspecific egg protein in stressed and unstressed poultry parasites were evaluated to estimate the environmental stress of poultry, the meat quality and egg quality of poultry Quality can be analyzed.

In the present invention, the expression of the immunoglobulin B protein is not present in the unspiked part of the unspared poultry, but it is expressed only in the egg white part of the poultry under the stress environment and the existence of the proteins is confirmed. In the present invention, the change in the expression level of the egg white protein means that the expression level of the egg white protein is increased or decreased.

Example 8: Animal experiment

Twenty-four-week-old, single-comb brown Hy-Line Leghorn hens were individually housed in a three-stage upright cage with four chambers in each of two chambers of equal size. The temperature of the breeding room was maintained at around 20 ± 2 ℃ and turned on at 6:00 am and turned off at 9:00 pm (15h lit). During the test period feed and water were supplied without restriction. After the adaptation period of this week, two treatments were divided into two treatments: control diet in one treatment and corticosterone (30 mg / kg diet) in another treatment for 2 weeks. The control diet was prepared by dissolving 500 ml of ethanol (EtOH), corticosterone supplemented diet, and 815 mg corticosterone (92%, C2505, Sigma, USA) in 500 ml of 99.5% EtOH. .

Example 9: Egg white  extracting

The eggs were sacrificed at 2 weeks after the feeding of Corticosterone, and the eggs were harvested and stored at -80 ° C until analysis.

Example 10: Protein extraction

100 to 200 mg of egg white secretion was added to a 5-fold volume of a lysis buffer A (1% sodium dodecyl sulfate (SDS), 1 mM phenylmethanesulfonyl fluoride (PMSF), protease inhibitor cocktail, 100 mM Tris-HCl Homogenized. Lysis buffer A was added to each well of a lysis buffer B (7 M urea, 2 M thiourea, 4% CHAPS, 0.1 M dithiothreitol (DTT), 1 mM PMSF, protease inhibitor cocktail, 40 mM Tris- For 1 hour. After sonication for a while, incubation was carried out at room temperature for 1 hour. After centrifugation at 15,000 × g at 4 ° C. for 20 minutes, the mixture was incubated at 4 ° C. for 1 hour and further centrifuged at 15,000 × g at 4 ° C. for 20 minutes. The supernatant, water soluble protein, was quantified using 2DE Quant kit (GE Healthcare Life Sciences, Uppsala, Sweden).

Example 11: SPS - PAGE  analysis

5 μg of soluble protein was mixed with sample buffer (2% SDS, 10% glycerol, 500 mM Tris-HCl, pH 6.8) and electrophoresed in 12% SDS polyacrylamide gel at 20 mA for 3 hours. (silver staining).

Example 12: Two dimensional 전공기  (2 DE ) analysis

150 μg of soluble protein was mixed with rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 2.5% DTT, 10% isopropanol, 5% glycerol and 2% IPG buffer). Proteins were rehydrated for 18 h using a pH 4-7 linear (NL) 18 cm IPG strip. For primary separation of the proteins by pH, the voltage was gradually increased from 30 V at 50 V for 30 minutes, 100 V for 30 minutes, 250 V for 1 hour and 8,000 V for 9 hours using an IPGphor 3 system (GE amersharm) For 6 h. The focused IPG strips were equilibrated with equilibration buffer (6M urea, 50 mM Tris-HCl pH 8.8, 30% glycerol, 2% SDS and bromophenol blue) and 1% DTT for 15 min. 2.5% iodoacetamide was added. 12% SDS polyacrylamide gels were prepared for secondary separation of proteins by size. SDS-PAGE gel electrophoresis at 20 mA for 15 hours and then silver stained. Protein expression of two treatment zones was compared and analyzed using Image Master (Image Master 2D Plantinum v7.0, GE).

Example 13: M atrix - Assisted Laser Desorption - Ionization Time - of - Flight Mass Spectrometry ( MALDI - TOF / MS ) and MALDI - TOF / TOF / MS / MS analysis

The desired spot was cut out using a pipette tip and collected in a tube. 30mM potassium ferricyanide, 100mM sodium thiosulfate pentahydrate was added, and the silver dye was removed from the gel and completely dried. 50-100 μl of 10 mM DTT / 0.1 M ABC was added and reacted at 56 ° C. for about 45 minutes. The supernatant was removed and 50 ~ 100 ul of 55 mM lodoacetamide / 0.1 M ABC was added, followed by reaction for about 30 minutes and then completely dried. 3 μl of Trypsin digestion buffer (0.0012 μg / μL in 25 mM NH 4 HCO 3, pH 7.8) was added, followed by overnight incubation at 37 ° C. The peptide was extracted from the gel by treating the sample with extraction solution (acetonitrile: water: TFA = 66: 33: 0.1). After mixing the extracted peptide solution with a matrix solution (α-Cyano-4-hydroxy-cinnamic acid), the mixture was dispensed on MALDI TOF / TOF sample plate and ABI 4800 Plus TOF-TOF Mass. Spectrometer (Applied Biosystems, Framingham, Mass., USA). MS / MS spectra were searched using NCBInr database.

Example 14: Reverse Transcription  ( RT ) and Real - Time Quantitative PCR  ( qPCR )

Nanbaekbun the tissue and RNA extracted from about ^{100mg kit (Easy-spin TM totalRNAextractionkit} , Intron, Korea) was used to extract RNA from bibu. The concentration of RNA was measured by absorbance at 260 nm using a spectrophotometer (Nanodrop 2000C, Thermo scientific, USA). RNA was loaded on 1% agarose gel to determine the 18S and 28S bands. RNA was reverse transcribed with cDNA using cDNA synthesis kit (PrimeScriptTM 1st strand cDNA synthesis kit, Takara, Japan). To confirm the reaction conditions of each primer, the gene was amplified using PCR kit (Accupower hotstart PCR premix, Biomeer, Korea) and then loaded on 1.5% agarose gel to confirm the band of the gene. Quantitative PCR (qPCR) analysis was performed using the Power SYBR Green PCR Mater Mix (Applied Biosystems, UK) and Step One Plus Real-Time PCR System (Applied Biosystems, UK). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) Were used.

Example 15: Statistical analysis

Data for all items examined were expressed as mean standard errors and statistical analyzes were performed using an independent t-test to estimate the effect of stress treatment. P-value was verified by verifying the identity of the mean between independent control and stress groups. A P-value of less than 0.05 means that the mean of the two groups is significantly different.

Proteomics (result)

When the first electrophoresis was carried out using the egg white secretion part at 2 weeks after the start of the test, the protein expression of the two treatments was very different (Fig. 7). These results were confirmed by secondary electrophoresis (FIGS. 8 and 9). After the second electrophoresis, 332 spots were matched by Image Master, and 318 spots of the egg white protein in the egg yolk protein of the laying hens were increased 1.2 times or more (Figure 8). The intensity of spot intensity of three gel images per treatment area was measured using an image master and statistically analyzed by t-test. In the stress group, 195 protein spots were significantly increased (P = 0.05) and 44 protein spots were significantly decreased (P = 0.05).

Of the 195 protein spots that were significantly increased in the stress group, MALDI TOF / MS / MS analysis was performed and the results were searched using the NCBI database. As a result, 50 spots were identified as 17 kinds of proteins (Figures 22 to 31 and 32 to 39 ). 2) adenylosuccinate synthase (ADSS, spot no. 124), 3) albumin (ALB, spots no. 6, 48, 57, 73, 101 , 140, 147, 156, 166, 175), 4) α-tropomyosin (TPM1, spot No. 248, 262), 5) antithrombin, AT-III (ANT, spot No. 150), 6) apolipoprotein AI , spot no 100, 244, 282), 7) artemis (ART, spot No. 136), 8) brain creatine kinase (CKB, spot no. alpha 2 (CAPZA2, spot no. 63), 10) capping protein (actin filament) muscle Z-line, beta (CAPZB, spot No. 59), 11) cathepsin B precursor (CTSB, spot no. 13) chloride intracellular channel 2 (CLIC2, spot no. 106), 14) heat shock (IGY, spot No. 135, 159, 177, protein 70 (HSP70, spot No. 49, 172), 15) heat shock protein beta-1 (HSPB1, spot No. 98), 16) hemopexin (HPX, spot No. 153, 154, 187) chain (Ig-Lc, spot No. 227), 18) ovalbumin (OVA, spot no. 168, 229), 19) ovoinhibitor (OVI, spot no. 22), 20) ovotransferrin (OVTF, spot No. 161,229), 21) PIT 54 protein (PIT54, spot no. 158,191), 22) prohibitin isoform 2 (PHB, spot no. protein (PSMB3, spot No. 16), 24) tissue transglutaminase (TGases, spot No. 160), 25) tubulin alpha (TUBA, spot No. 121), and 26) tubulin, beta 2C (TUBB2C, spot no. )to be.

In the stress group, 44 protein spots were significantly decreased (P = 0.05) and 23 spots were identified as 17 proteins by MALDI TOF-TOF / MS / MS and NCBI database And Figs. 32 to 39). 2) ATP synthase subunit beta mitochondrial (ATP5B, spot no 68), 3) calreticulin (CAL, spot no. 38), 4) IGY (spot no 268), 5) coatomer protein (GD2, spot no. 33), 7) guanine nucleotide exchange factor for ADP ribosylation factor 6 (PSD3, spot no. 86), 8) heat shock 10) OVA (spots no 83, 276, 277, 306, 315, 321), 11) ovalbumin-related protein Y (SEQ ID NO: (OVAY, spot no. 328), 12) OVI (spot No. 71, 83), 13) ovomucoid (OVM, spot No. 88), 14) protein disulfide isomerase A3 (PSDIA3, spot no 41) disulfide isomerase A4 (PDIA4, spot no 80), 16) sorbin and SH3 domain containing 1 (SORBS1, spot no 80), and 17) sorting nexin 13 (SNX13, spot no.

Five spots were expressed only in the control but 26 spots were expressed only in the stress (Fig. 17). In Control, 5 spots were found as one spot in each case and several spots were found in stress. In control, spot 88 was identified as an OVM, but when stressed, protein expression was reduced and four spots were found. One of the four spots was identified as tropomyosin (TPM2, spot no. 239) and the remaining three (not determined protein, spots no. 240, 251, 252) were not identified. In control, spot 306 was identified as OVA, but when stressed, protein expression was reduced and 8 spots were found. Five of the eight spots were vimentin (VIM, spots no. 215, 216), ALB (spot no. 307), HSPA5 (spot no. 308), OVA (spot no. 311) and lysozyme (LYZ, spot no. 311) and the other three (spots no. 309, 310, and 312) were not identified. In control, spot 315 was identified as OVA, but when stressed, protein expression was reduced and 5 spots were found. Four of the five spots were identified as OVA (spots no. 316, 317), keratin 19 (KRT 19, spot no. 319) and desmin (DES, spot no. Were not identified.

In control, spot 321 was identified as OVA, but when stressed, protein expression was reduced and three spots were found. It was all identified as OVA (spots no. 296, 322, 333). In control, spot 328 was identified as an OVAY, but when stressed, protein expression was reduced and three spots were found. One of the three spots was identified as ALB (spot no. 242) and the other two (spots no. 303 and 327) were not identified.

Identified as the same protein, but there were other proteins that increased or decreased expression. Of the four spots identified as Actin, only one spot (spot no. 02) was reduced and the other three spots (spot no. 109, 125, and 176) were increased in expression. Only one spot (spot no. 268) of the five spots identified with IgY-Fc 3-4 was reduced and the other four spots (spot no. 135, 159, 177, 243) were increased. Of the eight spots identified as OVA, only two spots (spot no. 168, 229) were increased and the remaining six spots (spot no. 83, 276, 277, 306, 315, 321) were decreased. Of the three spots identified as OVI, only one spot (spot no. 22) was increased and the other two spots (spot no. 71, 83) were reduced.

Gene Expression Analysis

Expression of 43 genes was analyzed by qPCR based on proteins significantly increased or decreased in protein expression analysis (FIGS. 20 and 21). 1) ACTA 2, 2) ADSS 3) ALB 4) ANT 5) APOA 1 6) ATP 5B 7) CAL 8) CAPZA 2 9) CAPZB 10) CKB 11) CLIC 2 12) COPE 13) HSPA1, 20) HSPB1, 21) Ig-Lc, 22) KRT19, 23) MKIAA1258, 24) ART, 25) 32) OVA, 34) OVAY, 35) SNX13, 36) SORBS1, 37) SPINK5, 31) PSD3, 32) PSB3, 33) OVA, 38) OVTF, 39) TPM1, 40) TGases, 41) TPM2, 42) TUBB2C, 43) VIM.

Significantly increased genes were (P = 0.05, Figure 18).

1) ADSS, 2) ALB, 3) APOA1, 4) ATP5B, 5) CAPZA2, 6) CAPZB, 7) CKB, 8) CLIC2, 9) CTSB, 10) HSP70, 11) HSP90AA1, 14) ART, 15) PIT54, 16) SNX13, 17) SORBS1, 18) TPM1, 19) TGases, 20) TPM2, 21) TUBB2C, 22) VIM

Significantly reduced genes were (P = 0.05, Figure 19).

1) CAL, 2) HPX, 3) HSPA5, 4) MKIAA1258, 5) LYZ, 6) OVM, 7) PDIA3, 8) PDIA4, 9) PSD3, 10) OVA, OVTF

Protein analysis showed a significant increase (P = 0.05), but the genes that were not significant in gene analysis were as follows.

1) ACTA2, 2) ANT, 3) COPE, 4) DES, 5) GDI2, 6) HSPB1

A total of 34 proteins and genes listed below can be used as a composition for stress diagnosis using genes and proteins related to stress (corticosterone) in poultry by expressing stress-specifically or increasing or decreasing expression.

1) Actin, aortic smooth muscle (ACT),

2) F-actin-capping protein subunit alpha-2 (CAPZA2),

3) Capping protein (actin filament) muscle Z-line, beta isoform 1 (CAPZB),

4) Tropomyosin 1, alpha (TPM1),

5) Tropomyosin (TPM2),

6) Keratin 19 (KRT 19),

7) Desmin (DES),

8) Vimentin (VIM),

9) Tubulin alpha (TUBA),

10) Tubulin beta-3 chain (TUBB2C),

11) PREDICTED: similar to sorbin and SH3 domain containing 1 (SORBS1),

12) Cathepsin B precursor (CTSB),

13) PREDICTED: proteasome subunit beta type-3 (PSMB3),

14) Ovomucoid (OVM),

15) Antithrombin (ANT),

16) Apolipoprotein A-I preproprotein (APOA1),

17) Serum albumin precursor (ALB),

18) Chloride intracellular channel protein 2 (CLIC2),

19) ATP synthase subunit beta, mitochondrial precursor (ATP5B),

20) Sorting nexin-13 (SNX13),

21) Coatomer subunit epsilon (COPE),

22) Rab GDP dissociation inhibitor beta (GDI2),

23) PREDICTED: similar to artemis, partial (ART),

24) Prohibition (PHB),

25) Protein disulfide-isomerase A3 (PDIA3),

26) Protein disulfide isomerase A4 (PDIA4),

27) Tissue transglutaminase (TGases),

28) Creatine kinase B-type (CKB),

29) Adenylosuccinate synthetase isozyme 2 (ADSS),

30) Lysozyme C (LYZ),

31) PREDICTED: similar to guanine nucleotide exchange factor for ADP ribosylation factor 6 (PSD3),

32) PREDICTED: similar to mKIAA1258 protein (mKIAA1258),

33) Ig light chain (Ig-Lc),

34) PIT 54 protein (PIT 54).

2) F-actin-capping protein subunit alpha-2 (CAPZA2), 3) Capping protein (actin filament) muscle Z-line, beta isoform 4) Tropomyosin 1, alpha (TPM1) 5) Tubulin alpha (TUBA) 6) Tubulin beta-3 chain (TUBB2C) 7) Cathepsin B precursor 8) PREDICTED: Proteasome subunit beta type-3 (PSMB3), 9) antithrombin (ANT), 10) Apolipoprotein AI preproprotein (APOA1), 11) Serum albumin precursor (ALB), 12) Chloride intracellular channel protein 2 (CLIC2) (15) Tissue transglutaminase (TGases), 16) Creatine kinase B-type (17), Adenylosuccinate synthetase isozyme 2 (ADSS), 18) PREDICTED: similar to guanine nucleotide exchange factor for ADP ribosylation factor 6 (PSD3), 19) Ig light chain (Ig-Lc), 20) PIT 54 protein (PIT 54).

(3) ATP synthase subunit beta, mitochondrial precursor (ATP5B), and (4) Sorting nexin-13. Protein disulfide-isomerase A3 (PDIA3), Protein disulfide isomerase A4 (PDIA4), 9) PREDICTED: similar (SNX13), 5) Coatomer subunit epsilon (COPE), 6) Rab GDP dissociation inhibitor beta to mKIAA1258 protein (mKIAA1258).

5) Proteins found only in stressed rats: 1) Tropomyosin (TPM2), 2) Keratin 19 (KRT 19), 3) Desmin (DES), 4) Vimentin (VIM), and 5) Lysozyme C (LYZ).

The 34 proteins and genes that are specifically expressed or increased or decreased in expression can be broadly classified into Cytoskeleton Organization, Proteases & Protease Inhibitors, Transport Proteins, DNA associated proteins, Enzymes, Immunity, and Transport Proteins Can be classified as extracellular transport protein and intracellular transport protein.

Cytoskeleton Organization

Treatment of Corticosterone affected the expression of proteins involved in the skeletal structure of the cells. Eukaryotic cytoskeleton proteins are composed of actin filaments, microfilaments, intermediate filaments, microtubules, and septins. Proteins contribute to maintaining the structure of the cell and keeping it functioning precisely. The ACT, CAPZA2, CAPZB, TPM1, and TPM2 identified in the experiments are proteins that correspond to microfibers that are actin-binding proteins that bind to ACT and ACT. KRT 19, DES and VIM are intermediate fiber proteins, and TUBA and TUBB2C are microtubule proteins.

One) ACT

ACT is a protein consisting of 377 amino acids. Its full name is actin, aortic smooth muscle, alpha-actin, and its associated gene is ACTA1 (Accession No. NCBI: gi | 71895043, Uniprot: P08023). ACT belongs to Actin family and exists in cytoplasm especially cytoskeleton and affects cytoskeleton. ACT plays a major role in cell function to maintain and regulate cell shape, cell division, adhesion, motility, signal transduction and protein sorting. .

In this study, corticosterone treatment increased ACT protein expression, but gene expression did not change.

2) CAPZA2 , 3) CAPZB

Capping protein is an actin binding protein composed of α and β subunits. CAPZA2 is a 286 amino acid protein whose full name is F-actin-capping protein subunit alpha-2, and in other names, beta-actinin subunit l and CapZ 36/32, and its associated gene is CAPZA2 (Accession no. NCBI: gi | 52138663, Uniprot: P28497). These proteins have an amino acid sequence belonging to the F-action-capping protein alpha subunit family, constituting the actin cytoskeleton and actin filament capping function. CAPZB is a protein consisting of 277 amino acids. Its full name is F-action-capping protein subunit beta isoforms 1 and 2. Beta-actinin subunit II, CapZ 36/32 and CapZ B1 and B2, The name is CAPZB (Accession no. NCBI: gi | 45382141, Uniprot: P14315). It has an amino acid sequence belonging to the F-action-capping protein beta subunit family. Like CAPZA2, it has the function of actin cytoskeleton, actin filament capping, and regulates morphogenesis of tissues. Capping protein constitutes actin and plays an important role in cell mobility. Apoptosis did not increase the protein expression of actin but the protein expression of F-actin capping protein was increased.

In this study, corticosterone treatment increased CAPZA2 and CAPZB protein and gene expression.

4) TPM1 , 5) TPM2

TPM1 is a protein consisting of 284 amino acids, also called alpha-tropomyosin or tropomyosin-1, and the associated gene is named TPM1 (Accession no. NCBI: gi | 45382322, Uniprot: P04268). TPM2 is a protein consisting of 284 amino acids, also called beta-tropomyosin or tropyosin-2, and the associated gene is named TPM2 (Accession no. NCBI: gi | 515694, Uniprot: P19352). Both TPM1 and TPM2 have amino acid sequences belonging to the tropomyosin family and are proteins that bind to actin filaments of muscle and non-muscle cells. Muscle tropomyosin isoforms are involved in the interaction of actin and myosin in muscle sarcomere (a repeating unit of myofibrils in the rhabdomyolium) and regulate muscle contraction. Tropomyosin is a major receptor for angiogenesis inhibitor proteins and treatment of tumor treatments reduces tropomyosin protein expression.

In this study, corticosterone treatment increased TPM1 protein, whereas TPM2 protein was found only in stress treatment. Expression of TPM1 and TPM2 genes was increased.

6) KRT  19

KRT 19 is an intermediate filament protein composed of 423 amino acids and is also called Keratin, type I cytoskeletal 19 or cytokeratin-19 (CK-19), GK-19 and keratin-19 (L19) (Accession no. NCBI: gi | 45384356, Uniprot: O93256). Keratin plays an important role in the morphogenesis and cell differentiation of organs, especially in the epithelial tissues of digestive organs. KRT 19 is a biomarker for determining the presence or absence of disseminated tumor cells in the blood and bone marrow, and also for breast cancer, hepatocellular carcinoma, lung cancer, pancreatic endocrine tumors tumors, and metastatic cancers. Expression of KRT 19 gene was increased in the intestines of broiler chickens infected with coccidiosis.

In this study, the protein of KRT 19 was found only in the stress-treated area, so the increase or decrease could not be judged. There was also no change in gene expression.

7) DES

DES is a protein consisting of 448 amino acids. Its full name is desmin. The name of the associated gene is DES (Accession no. NCBI: gi | 2959450, Uniprot: P02542). DES is an intermediate filament protein that plays an important role in the maturation, maintenance, and recovery of muscle fibers. Especially in the form of interlinking scaffolds around the myofibrils that connect the sarcolemma to the nuclear membrane in the skeletal and cardiac muscle fibers.

In this study, DES protein was found only in the stress-treated area, so it could not judge the increase or decrease. However, expression of the gene was reduced.

8) VIM

VIM is a protein consisting of 460 amino acids, the full name is vimentin, and the associated gene name is VIM (Accession No. NCBI: gi | 114326309, Uniprot: P09654). Intermediate filament family of class-III intermediate filament proteins found in many non-epithelial cells, especially in mesenchymal cells [37]. Degradation and recombination of VIM in cells is very rare, but cell death derivatives have reduced the protein expression of VIM.

In the present study, VIM protein was found only in stress-treated areas and thus can not be evaluated. However, the expression of the gene was increased.

9) TUBA  10) TUBB2C

TUBA is a protein composed of 411 amino acids and its full name is tubulin alpha-1 chain and its associated gene is TUBA (Accession no. NCBI: gi | 223280, Uniprot: P02552). TUBB2C is a protein consisting of 445 amino acids. Its full name is tubulin, beta, 2C or tubulin beta-3 chain and the name of the associated gene is TUBB2C (Accession No. NCBI: gi | 153792017, Uniprot: P09206). Tubulin is involved in protein polymerization, catabolism of GTP and microtubule movement. If the content of corticosterone is continuously increased, it may affect the fetal brain development. This is because tubulin affects the activity of mitotic spindle fibers.

In this study, corticosterone treatment increased the protein of TUBA and TUBB2C. Expression of TUBB2C gene was increased and expression of TUBA gene was not analyzed.

11) SORBS1

PREDICTED Proteins: similar to sorbin and SH3 domain containing 1 (SORBS1) is a protein consisting of 1290 amino acids similar to sorbin and SH3 domain containing protein 1 isoform X11 (accession no. NCBI: gi 513192517) No. NCBI: gi | 118092681, Uniprot: E1C009). SORBS1 has a sequence belonging to 1 RGS domain and is involved in protein transfer (intracellular protein transport, intracellular protein transport). SORBS1 is involved in the metabolism of the cytoskeleton and glucose.

In this study, corticosterone treatment reduced the SORBS1 protein and increased the gene.

Proteases  & Protease Inhibitors

Corticosterone treatment affects the expression of proteases that hydrolyze proteins in living organisms and protease inhibitors that inhibit the activity of hydrolytic factors. Protease can be classified into six types (aspartate proteases, cysteine proteases, metalloproteases, serine proteases, threonine protease, and glutamic proteases), but there are many others (KEGG Orthology; The CTSB identified in the experiment is cysteine protease, and PSMB3 is threonine protease. On the other hand, OVM and ANT identified in the experiment are serine protease inhibitors.

12) CTSB

CTSB (Cathepsin B) is a protein consisting of 340 amino acids. Another name is cathepsin B1, which is divided into two chains: cathepsin B light chain and cathepsin B heavy chain. The gene associated with this protein is CTSB (Accession no. NCBI: gi | 46195455, Uniprot: P43233). Peptidase belongs to the C1 family and is involved in the regulation of proteolysis and catalytic activity. Cathespins play an important role in the degradation process of lysosomes and degrade muscle proteins. Sepsis increased the activity of cathespin B and oxidative stress also increased the activity of cathepsin, resulting in the degradation of proteins present in chick myotubes.

In this study, corticosterone treatment increased the expression of CTSB protein and gene.

13) PSMB3

PSMB3 (proteasome subunit beta type-3) is a protein composed of 205 amino acids, and its associated gene is named PSMB3 (Accession no. NCBI: gi | 118102948, Uniprot: E1BYW9). PSMB3 belongs to the peptidase T1B family and is involved in proteolysis in the cellular protein catabolic process. PSMB3 degrades and destroys a protein that cleaves the peptide band of an unwanted or damaged protein. In this study, corticosterone treatment increased the expression of protein and gene of magnum PSMB3.

14) OVM

OVM (Ovomucoid) is a protein consisting of 210 amino acids, in other names there is allergen Gal d l and the name of the associated gene is ovomucoid (Accession No. NCBI: gi | 209979542, Uniprot: P01005). It has three Kazal-like domains and is a protease inhibitor that inhibits the action of peptidase. OVM is a major component of chicken egg whites and is a glycoprotein that occupies 11% of egg white. It has a pI of 4.1 and a molecular weight of 28 kDa.

In this study, corticosterone treatment decreased OVM protein and gene expression.

15) ANT

ANT (antithrombin) is a protein consisting of 423 amino acids and the associated gene is named antithrombin / AT-III (Accession no. NCBI: gi | 1195581, Uniprot: Q91422). ANT is a serine protease inhibitor that inhibits the action of peptidase. Antithrombin III (ANT III) is a heparin-binding protein that inhibits blood clotting factors such as thrombin and factor Xa. In addition, ANT-III is a protease inhibitor that interferes with proteolytic activities in order to maintain the endometrial cells without dislodging.

In this study, corticosterone treatment increased expression of ANT protein, but did not change gene expression.

Transport Proteins

The cell membrane of the cell maintains the internal environment of the cell, enabling the metabolism necessary for survival, thus maintaining the homeostasis of the cell. These cell membranes are composed of phospholipid membranes that can easily pass hydrophobic molecules and very small neutral molecules, but not water soluble molecules, polar organic molecules, sugars, ions, and proteins. Therefore, transport proteins are present for molecules that can not move their own membranes. The transport protein is a kind of membrane protein responsible for transporting substances inside and outside the cell. It is an extracellular transport protein involved in extracellular protein transport and an intracellular transport protein involved in protein transport in the cell. . APOA1, ALB, HPX and OVTF identified in this study are extracellular transport proteins and CIC2, ATP5B, SNX 13, COPE and GDI2 are intracellular transport proteins.

Transport Proteins in Extracellular Region

16) APOA1

APOA1 (apolipoprotein A-1) is a 264-amino acid protein with the other name apolipoprotein A1 and the associated gene is named APOA1 (Accession No. NCBI: gi | 45382961, Uniprot: P08250). It has an amino acid sequence belonging to Apoprotein Al / A4 / E family. It has cholesterol metabolism, lipid metabolism, lipid transport, steroid metabolism, , sterol metabolism (sterol metabolism) and protein transport (protein transport) has the function. APOA1 is the major protein in high density lipoprotein (HDL) in plasma. The virus increased the expression of APOA1.

In this study, the expression of magnum APOA1 protein and gene was increased together with stress.

17) ALB

ALB (albumin) is a globular protein composed of 615 amino acids, also known as alpha-livetin, allergen = Gal d 5, and the associated gene is called ALB (Accession no. NCBI: gi | 45383974, Uniprot: P19121). Albumin has an amino acid sequence belonging to the serum albumin / AFP / VDB (vitamin D-binding protein) family. As the main protein of plasma, water, metal ion (Ca2 +, Na +, K + It is a transport protein that binds to fatty acids, lipids, hormones and transports substances.

In this study, corticosterone treatment increased ALB protein and gene expression.

Transport Protein in Cytoplasm Membrane , Membrane Transport Proteins

18) CLIC2

CLIC2 (chloride intracellular channel 2) is a protein consisting of 244 amino acids and the associated gene is named CLIC2 (Accession no. NCBI: gi | 71895359, Uniprot: F1NHE3). Chloride channels (CLIC) are widely expressed in most eukaryotic cells. The important role of CLIC is to regulate intracellular pH, cell volume homeostasis, organic solute transport, and cell migration, proliferation, and differentiation, . Because the CLIC has the function of chondrogenesis, when the gene is mutated, it can have abnormal skeletal formation and body shape. Treatment of the chloride channel inhibitor material with chickens decreased CLIC mRNA expression as well as cell growth and differentiation.

In this study, corticosterone treatment increased expression of CLIC2 protein and gene.

19) ATP5B

ATP5B (ATP synthase subunit beta, mitochondrial) is a protein consisting of 533 amino acids and named ATP5B (Accession no. NCBI: gi | 71897237, Uniprot: Q5ZLC5). ATP5B is located on the inner membrane of the mitochondria and is a member of the ATPase alpha / beta chains family. Cells gain energy from food. The resulting energy is converted into an ATP form that can be distributed throughout the cell. ATP can prevent the generation of reactive oxygen species (ROS) due to hypoxia ormoxia cycles and the high b-oxidation rate of fatty acids.

In this study, corticosterone treatment reduced ATP5B protein but increased the gene.

20) SNX13

SNX13 (sorting nexin 13) is a protein consisting of 957 amino acids and the name of the associated gene is SNX13 (Accession no. NCBI: gi | 157909845, Uniprot: E1BZM0). SNX13 is located in the cytoplasm and belongs to the RGS (regulator of G protein signaling) protein family and promotes GTPase. Sorting nexin also binds to a lipid-binding PX domain (a phospholipid-binding motif) and helps to move from the previous stage to the next stage of the endocytic pathway in the form of RGS-PX1 / SNX13. And protein-protein interactions.

In this study, corticosterone treatment decreased expression of SNX13 protein but increased gene expression.

21) COPE

COPE (coatomer protein complex, subunit epsilon) is a protein composed of 308 amino acids and its name is COPE (Accession no. NCBI: gi | 57530593, Uniprot: Q5ZIK9). COPE has been shown to inhibit the production of α-COP (160 kDa), β-COP (110 kDa), β'-COP (102 kDa), γ-COP (98 kDa), δ- , And ε-COP, which is composed of 7 coat proteins (COP) with ζ-COP (20 kDa). COPE is an anterograde protein that moves from the endoplasmic reticulum (ER) to the Golgi body or vice versa. Coatomer protein complex subunit beta 1 (COPB1) mRNA was expressed in chick embryos at 3, 5, 7 and 9 days of age. Expression of COPB1 mRNA in 72 - week - old chickens was higher in the ovary than in the testes, and was similarly expressed in the brain. When breast cancer inducers were injected into embryos, COPB1 mRNA was decreased in 7 - day - old males but increased in females.

In this study, corticosterone treatment reduced expression of COPE protein but did not alter gene expression.

22) GDI2

GDI2 (Rab GDP (Guanosine diphosphate) dissociation inhibitor 2) is a protein consisting of 448 amino acids and the name of the gene is GDI2 (Accession No. NCBI: gi | 45384364, Uniprot: F1P112). The Rab protein family is a member of the Ras superfamily of monomeric G proteins. Rab proteins are peripheral membrane proteins that directly or indirectly affect specific proteins. Rab proteins are present in two forms: inactive GDP (guanosine diphosphate) and activated GTP (guanosine triphosphate). Rab GTPases modulate many steps, including vesicle formation, membrane traffic, vesicle movement, and membrane fusion along the actin and tubulin networks. GDP dissociation inhbitor (GDI) is attached to the inactivated form of Rab protein to prevent GDP from becoming GTP and to restore Rab protein to its original membrane.

In this study, the expression of magnum GDI2 protein was reduced by stress. However, the expression of the gene was unchanged.

DNA associated proteins

ART and PHB are proteins that perform various functions and have been studied to affect DNA repair, synthesis, cell differentiation, immunity and tumor genes.

23) ART

ART (Similar to artemis, partial) is a protein consisting of 310 amino acids similar to protein artemis (Accession no. NCBI: gi | 71896183, Uniprot: Q5QJC2) consisting of 714 amino acids (Accesion no. Gi | 118120898). Another name for Artemis is DNA cross-link repair 1C protein, SNM1 homolog C, and the associated gene is DCLRE1C. Artemis belongs to the family of DNA repair metallo-beta-lactamase (DRMBL), and has functions of adaptive immunity, DNA damage, DNA recombination, DNA repair and immunity. [66, 67]. ART functions both as a tumor suppressor as well as an oncogene.

In this study, corticosterone treatment increased ART protein and gene.

24) PHB

PHB (prohibitin) is a protein consisting of 272 amino acids. Its gene name is PHB (Accession no. NCBI: gi | 50760715, Uniprot: P84173). Prohibitin belongs to the prohibitin family and is involved in DNA synthesis. PHB consists of two isoforms, PHB 1 and PHB 2, which are present in several species of eukaryotes and prokaryotes. Thus, it is expressed in various regions, from intracellular mitochondria to cytoplasm. PHB was found in the muscle, heart, kidney, liver, tubal cannulation, and egg white, especially in egg white. PHB inhibits various functions such as cellular differentiation, anti-proliferation and morphogenesis in mitochondria and nuclei. In addition, PHB is involved in follicle-stimulating hormone (FSH) -responsive responses to granulocyte cells, as well as folliculogenesis, which forms and fosters ovarian follicles . Prohibitins help overcome fertility disorders and inhibit the development of ovarian cancer.

In this study, corticosterone treatment increased the protein and gene expression of PHB.

Enzymes

The treatment of Corticosterone influenced the expression of enzyme proteins that catalyze chemical reactions in organisms. Enzymes are largely classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases (KEGG Orthology, KO) . TGases and CKB identified in the experiment are the proteins corresponding to the transgene, LYZ is the degrading enzyme and ADSS is the linking enzyme. PSD3 is expected to be a transferase and MKIAA1258 is expected to be a degradative enzyme.

25) PDIA3 , 26) PDIA4

PDIA3 (protein disulfide-isomerase A3) consists of 505 amino acids, and another name is endoplasmic reticulum resident protein 57 and glucose-regulated thiol oxidoreductase 58 kDa protein. The associated gene is named PDIA3 (Accession no. 45383890, Uniprot: Q8JG64). Protein disulfide-isomerase A4 (PDIA4) consists of 627 amino acids and the associated gene is named PDIA4 (Accession no. NCBI: gi | 57530768, Uniprot: F1NDY9). PDIA3 and PDIA4 proteins have amino acid sequences belonging to the protein disulfide isomerase family. PDIA3 has two thioredoxin domains and PDIA4 has three thioredosin domains. The main function of both proteins is protein folding, glycerol ether metabolic process and cell redox homeostasis, but PDIA3 has a positive regulation of apoptotic process. Protein expression of the PDIA3 precursor was increased when the cell death inducer was treated.

In this study, corticosterone treatment reduced the expression of proteins and genes in PDIA3 and PDIA4.

27) TGases

TGases (Tissue transglutaminase) is a protein consisting of 689 amino acids and the name of the associated gene is also tissue transglutaminase (Accession no. NCBI: gi | 2148922, Uniprot: O13265). TGases is a calcium-dependent enzyme (Ca ^{2 +} -dependent enzymes) to catalyze the calcium-binding protein of the shared the glutamine and lysine residues. TGases are also found in microorganisms, plants, invertebrates and vertebrates, and are found in many tissues such as the brain, endothelial cells of the blood vessels, and epithelial cells of the skin. When the expression and activity of TGases in the brain increases, a number of neurodegenerative diseases such as Alzheimer's disease, Huntington's disease, Parkinson's disease and amyotrophic lateral sclerosis It was developed.

In this study, corticosterone treatment increased the protein and gene of TGases.

28) CKB

Brain creatine kinase (CKB) is a protein composed of 381 amino acids, called creatine kinase B-type or B-CK, and its associated gene is also called CKB (Accession no. NCBI: gi | 45384340, Uniprot: P05122). ATP: belongs to the guanido phosphotransferase family and contributes to phosphorylation. Creatine kinase (CK) is an enzyme involved in the reversible transphosphorylation of adenosine diphosphate (ADP) and creatine. And CK plays a central role in maintaining intracellular energy supply by adenosine triphosphate (ATP) concentration. In many species of birds, the degree of change in plasma total CK activity is used as an indicator of response to various pathogens, heat and migratory stress.

In this study, corticosterone treatment increased the protein and gene of CKB.

29) ADSS

Adenylosuccinate synthetase (ADSS) is a protein consisting of 451 amino acids. Adenylosuccinate synthetase (acid isozyme) and adenylosuccinate synthetase (liver isozyme) are also named. The related gene is named ADSS (Accession no. NCBI: gi | 71895783, Uniprot: Q5ZJL5). (IMP) and aspartic acid with guanosine diphosphate (GDP), phosphate and N (6) - (1,2-dicarboxyethyl) depending on the energy of guanosine triphosphate (GTP) -AMP. ≪ / RTI > ADSS has two isoforms: ADSS1 and ADSS2. ADSS1 is required for de novo synthesis of adenosine 50-monophosphate (AMP).

In this study, corticosterone treatment increased the protein and gene expression of ADSS.

30) LYZ

LYZ (Lysozyme) is a protein consisting of 147 amino acids. It is also called 1,4-beta-N-acetylmuramidase C, allergen Gal d IV and allergen = Gal d 4 and its associated gene is called LYZ (Accession no. gi | 126608, Uniprot: P00698). Lysozyme is part of the innate immune system found in animals, plants, and bacteria, and its primary function is to break down the cell wall of bacteria by bacteriolytic action. The proinflammatory effects of antioxidants in chickens resulted in a dramatic decrease in the levels of LYZ in the liver, duodenum, thymus, F sac and spleen.

In this study, LYZ protein was detected only in the stress-treated area, so the increase or decrease of the expression can not be judged. However, the expression of LYZ gene was decreased.

31) PSD3

PSD3 (similar to guanine nucleotide exchange factor for ADP ribosylation factor 6) is composed of 1044 amino acids and its gene name is PSD3 (Accession no. NCBI: gi | 118104315, Uniprot: E1C623). Guanine nucleotide-exchange factors (GEFs) are proteins that promote the signal transduction of GDP to GDP in ADP-ribosylation factor (ARF) proteins.

In this study, corticosterone treatment increased the protein and gene of PSD3.

32) mKIAA1258

mKIAA 1258 (Similar to mKIAA1258 protein) is a protein consisting of 489 amino acids similar to MKIAA 1258 (Accession No. NCBI: gi | 50510861, Uniprot: Q69ZN0) consisting of 487 amino acids (Accession No. NCBI: gi | 118104085). The gene associated with MKIAA 1258 is Gda. MKIAA 1258 has the function of the guanine catabolic process. There are no published papers related to this protein.

In this study, corticosterone treatment reduced the protein and gene of mKIAA1258.

Immunity

The treatment of Corticosterone influenced the expression of proteins involved in the immune system. IG (immunoglobulin) is the main antibody of B lymphocyte. Three IGs (IgM, IgA and IgY) are known in chicken. The proteins identified in the experiment are Ig-Lc and PIT 54.

33) Ig - Lc

Ig-Lc (immunoglobulin light chain) is a protein consisting of 231 amino acids and the associated gene is Ig rearranged light-chain (Accession no. NCBI: gi | 212060, Uniprot: P01875). IG plays a role in activating the proliferation of B cells. Generally, IG consists of two heavy chains and two light chains. However, in certain species such as sharks and camels, only heavy chains exist. When the vaccine was administered to broiler chickens infected with Salmonella, the IG light chain and heavy chain of the spleen were increased. The gene expression of IG light chain and heavy chain was significantly increased after infecting chickens with bacteria.

In this study, corticosterone treatment increased Ig-Lc protein and gene expression.

34) PIT  54

PIT 54 is a protein consisting of 470 amino acids and the name of the associated gene is also PIT 54 (Accession no. NCBI: gi | 46395491, Uniprot: Q98TD1). PIT 54 is also called 18-B and the molecular weight of a single peptide is 54 or 66 kDa. In chicken and goose, PIT 54 is a protein homologous to the cysteine-rich family of protein scavenger receptor, similar to haptoglobin, and regulates the leukocyte function as a hemoglobin binding protein. PIT 54 is an antioxidant with acute-phase serum proteins [86]. PIT54 protein in the serum increased when the inflammation substance was administered to the hen.

In this study, corticosterone treatment increased the protein and gene expression of PIT 54.

FIG. 7 shows data of SDS-PAGE of the proteins of the egg white portion at 2 weeks after the start of the test. In the gel images of the two treatments, protein expression in the size range of 37 ~ 50 kDa, 20 ~ 25 kDa and 15 kDa is very different.

FIGS. 8 and 9 are data showing the spots of the treatments in which the expression of the protein of the egg white part at 2 weeks after the start of the test was significantly increased compared with the control, as a result of 2DE and Images Master. Figure 8 is a photograph of the control and Figure 9 is a photograph of the treatment.

10 to 16 show that the egg white proteins are divided into A (Cytoskeleton Organization, B Proteases, C Protease Inhibitors, D Protein Transport Proteins, E DNA Associated Proteins, F Enzymes and G Immunity groups , Protein spots of the treated groups with significantly increased expression and protein spots of the control were compared and the information of each protein was classified according to the function of the protein.

FIG. 17 shows that five spots were detected as one spot in the control group, and TPM2, KRT19, DES, VIM, and LYZ were found only in the stress group. In other words, TPM2, KRT19, DES, VIM and LYZ proteins were newly expressed in the stressed environment and confirmed in the treatment area.

FIG. 18 is a graph showing the genes of proteins significantly increased or decreased in protein expression analysis, as a result of qPCR analysis.

FIG. 19 is a graph showing the genes of proteins significantly increased or decreased in expression of the protein by qPCR, which shows reduced genes in the treated group as compared with the control.

Referring to the above analysis results, a total of 34 genes and proteins shown in Tables 8, 9 to 15 and Table 16 below are expressed specifically in stress or increased or decreased in expression, Genes and proteins can be developed as marker compositions for environmental stress diagnosis.

Table 8 shows the information necessary to perform the expression analysis of a total of 34 proteins and genes which are expressed specifically in stress or whose expression is increased or decreased.

Tables 9 to 15 show the results of 2DE gel and Image Master analyzes, which showed that the 2DE gel spots of the treatments that were newly expressed or significantly increased in expression compared to the control were identified by MALDI-TOF / TOF / MS / MS to be.

Table 16 shows the amino acid sequences of the treatment proteins newly expressed or significantly increased in expression compared to the control.

The 34 genes and proteins in Table 8, Tables 9 to 15 and Table 16 were newly expressed specifically in stress or significantly increased or decreased in expression, so that stress-related genes and proteins in chicken were detected as markers for environmental stress diagnosis Can be developed.

The results of this study provide the first evidence that treatment with corticosterone (stress) may affect the expression of egg white protein. In addition, it is suggested that other specification conditions, environmental stress, may directly affect the expression of the egg white protein. This means that the individual proteins that make up the egg white protein by the environment can be newly expressed or their contents can change, thus indicating that environmental conditions can directly affect the meat quality and egg quality of the poultry.

Such an egg white protein can be used not only for evaluating the meat quality and egg quality of poultry but also as an index for estimating the stress state of poultry at the time of breeding. Therefore, it can be used as a marker to estimate the animal welfare for the environment at the post-breeding stage by assaying the egg white protein of the poultry.

Therefore, the egg white protein of the present invention can be utilized as a composition for diagnosing environmental stress of poultry.

INDUSTRIAL APPLICABILITY As described above, the present invention is an invention which confirms the effect of stress on the poultry by mixing corticosterone, a type of stress hormone, into feed, and thereby, detects genes newly expressed or differentially expressed due to stress The present invention provides a marker composition for stress diagnosis, a diagnostic composition and a kit for confirming the possibility of stress of a chicken.

<110> Gyeongsang National University Foundation of University-Industry cooperation <120> Diagnostic composition and kit of specific biomarker genes and          protein for environmental stress in poultry, and prediction          method of egg production for environmental stress by using the          diagnostic composition and kit <130> P13-0045 <150> KR 10/20130136566 <151> 2013-11-11 <160> 40 <170> Kopatentin 2.0 <210> 1 <211> 2723 <212> DNA <213> m-calpain <400> 1 atggcgggga tggcggcggc gctggcgaag gagcgggcgg cggcggcggg cgcggggcgg 60 cacgggcagg ccgtgcccta cctggggcag gacttcgggg cgctgcggcg ggagtgcctg 120 cagggaggcc gcctcttcca cgacccgtcc ttccccgccg gccccgccgc tctcgggtac 180 cgggagctgg ggcccaactc ctacaaaacg aagggcgtcg tctggtgtag acctacggag 240 ctgtgttcct gtccgcggtt catcgccggc ggagccacgc gcaccgacat ctgccaagga 300 gccctggggg actgctggct cttggcagct attgcctccc tcactctgaa tgaagaaatt 360 ctggcccgtg ttgttcccag agaccagagc ttccaggatg aatatgcagg aatcttccac 420 ttccagttct ggcagtacgg agagtgggtg gacgtcgtgg tggatgaccg gctgcccacc 480 aagaacgggg agctgctctt cgtgcactcg gcagagggca gcgagttctg gagcgcactg 540 ctggagaagg cctacgccaa gctgaatgga tcatacgagg ctctctctgg tggcaccacc 600 actgaaggct ttgaggactt cactggtggg attgcagaat ggtatgagtt gcagaaggca 660 ccacccaacc tcttcaaaat cattcagaaa gcactgcaga aaggctctct ccttggctgc 720 tccatcgata tcaccagtgc agctgagaca gaggcagtca cgtcgcagaa gctggtgaag 780 ggacacgcgt actccgtcac cggggagag gaggtgaact tccgtggaag tatccagaag 840 ctcatcagaa tccgaaatcc ctggggggaa gtggagtgga cagggaaatg gaatgacaac 900 tgcccaaact ggagtggtgt tgacccagag gtgcgggagc ggctgacgag gagacatgag 960 gatggggagt tttggatggc cttcaatgac ttcctgaggc actactcccg cctggaaatc 1020 tgcaatctga ctccagacac tctggcaagt gacaggtaca agaagtggag cctgctgaag 1080 ctggatggga actggcggcg aggagctact gcggggggct gcaggaatta cccaaacact 1140 ttctggacga atccacagta tttaatcaag ctggaggaag aagatgagga tcctgatgat 1200 cctgaggggg gctgcacatt tctcattggc ctgattcaga agcatcggag gaagcagagg 1260 aagatgggag aggacatgca taccattggc tttgcaattt atgaggtgcc cccagagttc 1320 tctggccaga cgaatattca tctgagcaaa aattttttcc tgactaacaa agcaagagaa 1380 aaatccaaca ccttcatcaa cctccgggag gtgctgaacc ggttcaagct ccctgcagga 1440 gaatacatca tcgtgccctc tacctttgag cccaacttga atggagactt ctgcctccga 1500 gtcttctcgg aaaaaaatgc aaactcaacg gttatagatg atgaaataga ggccaatttt 1560 gaagagactg agatcgatga agatgacatt gaacctagct tcaaaaagct ttttgggcag 1620 ttggcaggaa gcgatgcaga gatctctgcc ttcgagctgc gcagcatcct gaataaaatc 1680 ctggctaagc gccaagatat taaatctgac ggctttagca ttgagacgtg caaaataatg 1740 gttgacctgc tagataacga tgggagtgga aaactggggc tgaaggagtt ccacacgctc 1800 tggacaaaga ttcagaaata tcagaaaatt tacagggaaa ttgacgtgga tcgatctgga 1860 accatgaact cgtatgagat gagaagagcg ctggaagctg cagggttcaa gttgagctgc 1920 cagttacatc agatcattgt ggctcggttt gctgatgaag acctcatcat tgactttgat 1980 aattgtgtcc ggtgcttgat tcggctggaa accttgtaca aaatgtttag aaaactggac 2040 accgagaaaa ctggaacaat agagttgaac ctcattaatt ggctcttctt cactgtcatt 2100 tgaactactg ccatcagccc aagatgcttc aaaaagatga agatcaggtg aagataatca 2160 aacagcatac aaagcaaaaa atacatatat gctaaattac acgtgcctta acttgcaaat 2220 gggaactttg cacaagctta caaggaggaa agagctaatt ccatggcaga agatctgcaa 2280 ccttggttta taggttaata gtcttaaata accatgtacc tttgacactt atactgataa 2340 cctagcgcac tttgaaatat tcttactaaa tctcctacgt catgtggaga agatcatatg 2400 cttgagtgag gctttgtaat agcagcacca cagtccgtgt atctgaaagg gatgtatgca 2460 cacctcagac actgtgttca gtaagacctg aggctctgtg tactttctgt aagcttcagc 2520 atatcacatt caggttaaat atttttgaag gacttgagta gcaagtaacg catttaaaca 2580 aactggagac aagtctctgc atcctggcca ttgatatccc tgaacaggaa aaggctgtcg 2640 gcaactcagc tcaccagata aagcacaggt ctttagttcc tgcatctttt ttttttatct 2700 tcctttgaaa tacaaggagt att 2723 <210> 2 <211> 1461 <212> DNA <213> Caspase 3 <400> 2 tggtggaggt ggaggagctc tcctatgtat tatgatacagt ttctcaagtc tggaatcatc 60 ttatgaatca tatttcttaa ttacgttggt gcttcaagat acagagaaac aacattcaga 120 agaaccttga agatcttttg gagctactaa aaatctgata atcaagagcc atgatgacag 180 acataaaaga tggaccacgc tcaggggaag atgtatcaga tgcaagatct ttccctggtt 240 ccaaaggaat gaacttacct gctagcaagt ctgtggactc tggaattctg cctgatgaca 300 gttacagaat ggattatcca gagataggag tatgtgttat aataaacaat aagaacttcc 360 accgagatac cggactgtca tctcgttcag gcacggatgc agatgctgca agtgtcagag 420 aagtttttat gaagctggga tataaagtca agcttaacaa tgatctgtca agcagagata 480 tttttaagct attgaaaaat gtttctgaag aagatcacag caagcgaagc agttttgttt 540 gtgtgttgct aagccatggc gatgaaggac tcttctatgg tacagatggc cctcttgaac 600 tgaaagtact aaccagcctt ttcagaggtg acaagtgcag aagtctagca gggaaaccca 660 aactcttttt cattcaggcc tgtagaggaa cagaattaga ttctggtatt gaaggagaca 720 gtggaccaga tgaaacagtg tgtcaaaaaa tacctgtaga agcagacttc ctgtatgcat 780 attctactgc tccaggctac tactcctgga ggaacgcagc tgaaggctcc tggtttattc 840 agtctctgtg taggatgctg aaggaacacg ccaggaaact tgaactcatg cagattttaa 900 ctcgtgtaaa tcgcagagtg gcagaatatg aatcctgctc cactcgacag gatttcaatg 960 caaagaaaca gattccatgc attgtgtcta tgcttaccaa agaattctac tttccttgct 1020 aaatagaaaa aaaaagtact ttgcaatttt tcacttcagg tttttatctg taatttatac 1080 actgttagta cggaatacca cttttaagtc tgacttgctg ttcactgcca tagaaggcac 1140 aatgaactat ctgagagttg gagatgtccg ttattagaag taatccacgg tatggctaag 1200 ttagaaacgc aaacctgagt aggtgaagca cagggaaatt taaacatagt aagaatttgg 1260 aaaaatgatg aggaggggrt tgaagagaaa tcccatcact tacaagacct acttggtgct 1320 acatttcact ttgcagaagg agcagagaaa agaaacaggt cttgtaaatg gtttggtttc 1380 gtatcttcat crgtaggaag aagattcaga atgtgatctg tttgctaatt gcagtaatgt 1440 agtagtgtca ttgcacattt c 1461 <210> 3 <211> 1029 <212> DNA <213> Cathepsin B <400> 3 tgcagcaaga tgtcgtggtc ccgctccatc ctgtgtctgc ttggtgcctt cgccaatgcc 60 cgcagcattc cttactaccc acccctctca agcgacctgg tcaaccacat aaacaagctc 120 aacaccactg gaagggcagg gcacaacttc cacaacactg acatgagcta tgtgaagaag 180 ctctgtggca ctttcctggg tggacccaag gctcctgaaa gggtagattt tgctgaggat 240 atggatttgc cggatacctt tgacacgcgg aagcaatggc caaattgccc caccatcagc 300 gagatcagag accagggctc ctgtggctct tgctgggctt ttggtgctgt ggaagcgatt 360 tcggacagaa tctgtgttca caccaacgcc aaggtgagcg tggaggtgtc ggcggaggat 420 ttgctgtcat gctgtggctt cgagtgcggc atggggtgca atggtggtta tccttctggt 480 gcatggaggt actggacaga gaggggcctc gtgtctgggg gtctctatga ctcccatgtg 540 ggctgccggg cctacaccat cccaccctgt gagcaccacg tcaatggctc ccggccacct 600 tgcactgggg agggaggaga aacccccagg tgcagccggc actgtgaacc tggctactcg 660 ccttcctaca aggaggacaa gcactacggc atcacatcct acggtgtccc tcgcagcgag 720 aaggaaatca tggctgagat ctacaagaac ggcccagttg aaggagcctt tattgtctat 780 gaggacttcc tgatgtacaa atctggggtg taccagcatg tgtcagggga gcaggttgga 840 ggccacgcca tccggatcct gggctggggc gtcgagaacg ggaccccgta ctggttggct 900 gccaactcct ggaacactga ctgggggata acgggcttct tcaaaatcct ccgaggagag 960 gccactgtg ggatcgagtc cgagatcgtg gctggcgtcc ccaggatgga gcaatactgg 1020 agggtgtaa 1029 <210> 4 <211> 700 <212> PRT <213> m-calpain <400> 4 Met Ala Gly Met Ala Ala Ala Ala   1 5 10 15 Gly Ala Gly Arg His Gly Gln Ala Val Pro Tyr Leu Gly Gln Asp Phe              20 25 30 Gly Ala Leu Arg Arg Glu Cys Leu Gln Gly Gly Arg Leu Phe His Asp          35 40 45 Pro Ser Phe Pro Ala Gly Pro Ala Ala Leu Gly Tyr Arg Glu Leu Gly      50 55 60 Pro Asn Ser Tyr Lys Thr Lys Gly Val Val Trp Cys Arg Pro Thr Glu  65 70 75 80 Leu Cys Ser Cys Pro Arg Phe Ile Ala Gly Gly Ala Thr Arg Thr Asp                  85 90 95 Ile Cys Gln Gly Ala Leu Gly Asp Cys Trp Leu Leu Ala Ala Ile Ala             100 105 110 Ser Leu Thr Leu Asn Glu Glu Ile Leu Ala Arg Val Val Pro Arg Asp         115 120 125 Gln Ser Phe Gln Asp Glu Tyr Ala Gly Ile Phe His Phe Gln Phe Trp     130 135 140 Gln Tyr Gly Glu Trp Val Asp Val Val Val Asp Asp Arg Leu Pro Thr 145 150 155 160 Lys Asn Gly Glu Leu Leu Phe Val His Ser Ala Glu Gly Ser Glu Phe                 165 170 175 Trp Ser Ala Leu Leu Glu Lys Ala Tyr Ala Lys Leu Asn Gly Ser Tyr             180 185 190 Glu Ala Leu Ser Gly Gly Thr Thr Thr Glu Gly Phe Glu Asp Phe Thr         195 200 205 Gly Gly Ile Ala Glu Trp Tyr Glu Leu Gln Lys Ala Pro Pro Asn Leu     210 215 220 Phe Lys Ile Ile Gln Lys Ala Leu Gln Lys Gly Ser Leu Leu Gly Cys 225 230 235 240 Ser Ile Asp Ile Thr Ser Ala Ala Glu Thr Glu Ala Val Thr Ser Gln                 245 250 255 Lys Leu Val Lys Gly His Ala Tyr Ser Val Thr Gly Ala Glu Glu Val             260 265 270 Asn Phe Arg Gly Ser Ile Gln Lys Leu Ile Arg Ile Arg Asn Pro Trp         275 280 285 Gly Glu Val Glu Trp Thr Gly Lys Trp Asn Asp Asn Cys Pro Asn Trp     290 295 300 Ser Gly Val Asp Pro Glu Val Arg Glu Arg Leu Thr Arg Arg His Glu 305 310 315 320 Asp Gly Glu Phe Trp Met Ala Phe Asn Asp Phe Leu Arg His Tyr Ser                 325 330 335 Arg Leu Glu Ile Cys Asn Leu Thr Pro Asp Thr Leu Ala Ser Asp Arg             340 345 350 Tyr Lys Lys Trp Ser Leu Leu Lys Leu Asp Gly Asn Trp Arg Arg Gly         355 360 365 Ala Thr Ala Gly Gly Cys Arg Asn Tyr Pro Asn Thr Phe Trp Thr Asn     370 375 380 Pro Gln Tyr Leu Ile Lys Leu Glu Glu Glu Asp Glu Asp Pro Asp Asp 385 390 395 400 Pro Glu Gly Gly Cys Thr Phe Leu Ile Gly Leu Ile Gln Lys His Arg                 405 410 415 Arg Lys Gln Arg Lys Met Gly Glu Asp Met His Thr Ile Gly Phe Ala             420 425 430 Ile Tyr Glu Val Pro Glu Phe Ser Gly Gln Thr Asn Ile His Leu         435 440 445 Ser Lys Asn Phe Phe Leu Thr Asn Lys Ala Arg Glu Lys Ser Asn Thr     450 455 460 Phe Ile Asn Leu Arg Glu Val Leu Asn Arg Phe Lys Leu Pro Ala Gly 465 470 475 480 Glu Tyr Ile Val Ser Ser Thr Phe Glu Pro Asn Leu Asn Gly Asp                 485 490 495 Phe Cys Leu Arg Val Phe Ser Glu Lys Asn Ala Asn Ser Thr Val Ile             500 505 510 Asp Asp Glu Ile Asp Glu Asp Phe Glu Glu Thr Glu Ile Asp Glu Asp         515 520 525 Asp Ile Glu Pro Ser Phe Lys Lys Leu Phe Gly Gln Leu Ala Gly Ser     530 535 540 Asp Ala Glu Ile Ser Ala Phe Glu Leu Arg Ser Ile Leu Asn Lys Ile 545 550 555 560 Leu Ala Lys Arg Gln Asp Ile Lys Ser Asp Gly Phe Ser Ile Glu Thr                 565 570 575 Cys Lys Ile Met Val Asp Leu Leu Asp Asn Asp Gly Ser Gly Lys Leu             580 585 590 Gly Leu Lys Glu Phe His Thr Leu Trp Thr Lys Ile Gln Lys Tyr Gln         595 600 605 Lys Ile Tyr Arg Glu Ile Asp Val Asp Arg Ser Gly Thr Met Asn Ser     610 615 620 Tyr Glu Met Arg Arg Ala Leu Glu Ala Ala Gly Phe Lys Leu Ser Cys 625 630 635 640 Gln Leu His Gln Ile Ile Val Ala Arg Phe Ala Asp Glu Asp Leu Ile                 645 650 655 Ile Asp Phe Asp Asn Cys Val Arg Cys Leu Ile Arg Leu Glu Thr Leu             660 665 670 Tyr Lys Met Phe Arg Lys Leu Asp Thr Glu Lys Thr Gly Thr Ile Glu         675 680 685 Leu Asn Leu Ile Asn Trp Leu Phe Phe Thr Val Ile     690 695 700 <210> 5 <211> 283 <212> PRT <213> Caspase 3 <400> 5 Met Met Thr Asp Ile Lys Asp Gly Pro Arg Ser Gly Glu Asp Val Ser   1 5 10 15 Asp Ala Arg Ser Phe Pro Gly Ser Lys Gly Met Asn Leu Pro Ala Ser              20 25 30 Lys Ser Val Asp Ser Gly Ile Leu Pro Asp Asp Ser Tyr Arg Met Asp          35 40 45 Tyr Pro Glu Ile Gly Val Cys Val Ile Ile Asn Asn Lys Asn Phe His      50 55 60 Arg Asp Thr Gly Leu Ser Ser Arg Ser Gly Thr Asp Ala Asp Ala Ala  65 70 75 80 Ser Val Arg Glu Val Phe Met Lys Leu Gly Tyr Lys Val Lys Leu Asn                  85 90 95 Asn Asp Leu Ser Ser Arg Asp Ile Phe Lys Leu Leu Lys Asn Val Ser             100 105 110 Glu Glu Asp His Ser Lys Arg Ser Ser Phe Val Cys Val Leu Leu Ser         115 120 125 His Gly Asp Glu Gly Leu Phe Tyr Gly Thr Asp Gly Pro Leu Glu Leu     130 135 140 Lys Val Leu Thr Ser Leu Phe Arg Gly Asp Lys Cys Arg Ser Leu Ala 145 150 155 160 Gly Lys Pro Lys Leu Phe Phe Ile Gln Ala Cys Arg Gly Thr Glu Leu                 165 170 175 Asp Ser Gly Ile Glu Ala Asp Ser Gly Pro Asp Glu Thr Val Cys Gln             180 185 190 Lys Ile Pro Val Glu Ala Asp Phe Leu Tyr Ala Tyr Ser Thr Ala Pro         195 200 205 Gly Tyr Tyr Ser Trp Arg Asn Ala Ala Glu Gly Ser Trp Phe Ile Gln     210 215 220 Ser Leu Cys Arg Met Leu Lys Glu His Ala Arg Lys Leu Glu Leu Met 225 230 235 240 Gln Ile Leu Thr Arg Val Asn Arg Arg Val Ala Glu Tyr Glu Ser Cys                 245 250 255 Ser Thr Arg Gln Asp Phe Asn Ala Lys Lys Gln Ile Pro Cys Ile Val             260 265 270 Ser Met Leu Thr Lys Glu Phe Tyr Phe Pro Cys         275 280 <210> 6 <211> 340 <212> PRT <213> Cathepsin B <400> 6 Met Ser Trp Ser Arg Ser Leu Cys Leu Leu Gly Ala Phe Ala Asn   1 5 10 15 Ala Arg Ser Ile Pro Tyr Tyr Pro Pro Leu Ser Ser Asp Leu Val Asn              20 25 30 His Ile Asn Lys Leu Asn Thr Thr Gly Arg Ala Gly His Asn Phe His          35 40 45 Asn Thr Asp Met Ser Tyr Val Lys Lys Leu Cys Gly Thr Phe Leu Gly      50 55 60 Gly Pro Lys Ala Pro Glu Arg Val Asp Phe Ala Glu Asp Met Asp Leu  65 70 75 80 Pro Asp Thr Phe Asp Thr Arg Lys Gln Trp Pro Asn Cys Pro Thr Ile                  85 90 95 Ser Glu Ile Arg Asp Gln Gly Ser Cys Gly Ser Cys Trp Ala Phe Gly             100 105 110 Ala Val Glu Ala Ile Ser Asp Arg Ile Cys Val His Thr Asn Ala Lys         115 120 125 Val Ser Val Glu Val Ser Ala Glu Asp Leu Leu Ser Cys Cys Gly Phe     130 135 140 Glu Cys Gly Met Gly Cys Asn Gly Gly Tyr Pro Ser Gly Ala Trp Arg 145 150 155 160 Tyr Trp Thr Glu Arg Gly Leu Val Ser Gly Gly Leu Tyr Asp Ser His                 165 170 175 Val Gly Cys Arg Ala Tyr Thr Ile Pro Pro Cys Glu His His Val Asn             180 185 190 Gly Ser Arg Pro Pro Cys Thr Gly Glu Gly Gly Glu Thr Pro Arg Cys         195 200 205 Ser Arg His Cys Glu Pro Gly Tyr Ser Pro Ser Tyr Lys Glu Asp Lys     210 215 220 His Tyr Gly Ile Thr Ser Tyr Gly Val Pro Arg Ser Glu Lys Glu Ile 225 230 235 240 Met Ala Glu Ile Tyr Lys Asn Gly Pro Val Glu Gly Ala Phe Ile Val                 245 250 255 Tyr Glu Asp Phe Leu Met Tyr Lys Ser Gly Val Tyr Gln His Val Ser             260 265 270 Gly Glu Gln Val Gly Gly His Ala Ile Arg Ile Leu Gly Trp Gly Val         275 280 285 Glu Asn Gly Thr Pro Tyr Trp Leu Ala Ala Asn Ser Trp Asn Thr Asp     290 295 300 Trp Gly Ile Thr Gly Phe Phe Lys Ile Leu Arg Gly Glu Asp His Cys 305 310 315 320 Gly Ile Glu Ser Glu Ile Val Ala Gly Val Pro Arg Met Glu Gln Tyr                 325 330 335 Trp Thr Arg Val             340 <210> 7 <211> 248 <212> PRT <213> TPM2 <400> 7 Met Ala Gly Ile Ser Ser Ile Asp Ala Val Lys Lys Lys Ile Gln Ser   1 5 10 15 Leu Gln Gln Val Ala Asp Glu Ala Glu Glu Arg Ala Glu His Leu Gln              20 25 30 Arg Glu Ala Asp Ala Glu Arg Gln Ala Arg Glu Arg Ala Glu Ala Glu          35 40 45 Val Ala Ser Leu Asn Arg Arg Ile Gln Leu Val Glu Glu Glu Leu Asp      50 55 60 Arg Ala Gln Glu Arg Leu Ala Thr Ala Leu Gln Lys Leu Glu Glu Ala  65 70 75 80 Glu Lys Ala Ala Asp Glu Ser Glu Arg Gly Met Lys Val Ile Glu Asn                  85 90 95 Arg Ala Met Lys Asp Glu Glu Lys Met Glu Leu Gln Glu Met Gln Leu             100 105 110 Lys Glu Ala Lys His Ile Ala Glu Glu Ala Asp Arg Lys Tyr Glu Glu         115 120 125 Val Ala Arg Lys Leu Val Val Leu Glu Gly Glu Leu Glu Arg Ser Glu     130 135 140 Glu Arg Ala Glu Val Ala Glu Ser Arg Val Glu Leu Glu Glu Glu 145 150 155 160 Leu Arg Thr Met Asp Gln Ser Leu Lys Ser Leu Ile Ala Ser Glu Glu                 165 170 175 Glu Tyr Ser Thr Lys Glu Asp Lys Tyr Glu Glu Glu Ile Lys Leu Leu             180 185 190 Gly Glu Lys Leu Lys Glu Ala Glu Thr Arg Ala Glu Phe Ala Glu Arg         195 200 205 Ser Val Ala Lys Leu Glu Lys Thr Ile Asp Asp Leu Glu Glu Ser Leu     210 215 220 Ala Ser Ala Lys Glu Glu Asn Val Gly Ile His Gln Val Leu Asp Gln 225 230 235 240 Thr Leu Leu Glu Leu Asn Asn Leu                 245 <210> 8 <211> 423 <212> PRT <213> KRT19 <400> 8 Met Ala Thr Tyr Ser Phe Arg Gln Thr Thr Ser Ser Val Ala Gly Gly   1 5 10 15 Pro Cys Gly Arg Ser Leu Arg Leu Gly Gly Gly Ser Phe Arg Ala Pro              20 25 30 Ser Ile His Gly Gly Ser Gly Gly Arg Gly Val Ser Ser Val Ser Ser Ala          35 40 45 Arg Phe Val Ser Ser Gly Leu Gly Ser Gly Leu Gly Gly Gly Tyr Gly      50 55 60 Gly Ala Phe Ser Ser Ser Phe Ser Ala Gly Phe Gly Gly Gly Tyr Gly  65 70 75 80 Gly Gly Leu Gly Ser Gly Asp Gly Leu Leu Ser Gly Asn Glu Lys Thr                  85 90 95 Thr Met Gln Asn Leu Asn Asp Arg Leu Ala Ser Tyr Leu Asp Lys Val             100 105 110 Arg Ala Leu Glu Glu Ala Asn Ser Asp Leu Glu Thr Lys Ile Arg Glu         115 120 125 Trp Tyr Leu Lys Gln Gly Pro Gly Pro Ala Arg Asp Tyr Ser Pro Tyr     130 135 140 Tyr Lys Ala Ile Glu Asp Leu Arg Asp Gln Ile Leu Ala Ala Thr Ile 145 150 155 160 Asp Asn Ser Lys Val Val Leu Gln Ile Asp Asn Ala Arg Leu Ala Ala                 165 170 175 Asp Asp Phe Lys Thr Lys Phe Glu Thr Glu Gln Ala Leu Arg Met Ser             180 185 190 Val Glu Ala Asp Ile Asn Gly Leu Arg Arg Val Leu Asp Glu Leu Thr         195 200 205 Leu Ala Arg Thr Asp Leu Glu Leu Gln Ile Glu Asn Leu Lys Glu Glu     210 215 220 Leu Ala Tyr Leu Lys Lys Asn His Glu Glu Glu Met Ser Ala Leu Gly 225 230 235 240 Gly Gln Val Ala Ser Gln Val Ser Val Glu Val Asp Ser Ala Pro Gly                 245 250 255 Ile Asp Leu Ser Lys Ile Leu Ala Asp Met Arg Asp Gln Tyr Glu His             260 265 270 Met Ala Glu Lys Asn Arg Lys Asp Ala Glu Ala Trp Phe His Ser Lys         275 280 285 Thr Glu Glu Leu Asn Arg Glu Leu Ala Val Asn Thr Glu Gln Leu Gln     290 295 300 Ser Ser Lys Ser Glu Val Thr Asp Leu Arg Arg Thr Leu Gln Gly Leu 305 310 315 320 Glu Ile Glu Leu Gln Ser Gln Leu Ser Met Lys Gly Ala Leu Glu Ser                 325 330 335 Thr Leu Ala Asp Thr Glu Gly Arg Tyr Gly Ala Gln Leu Ala Gln Ile             340 345 350 Gln Asp Met Ile Gly Ser Ile Glu Ala Gln Leu Ala Glu Leu Arg Ala         355 360 365 Asp Met Glu Arg Gln Asn Ser Glu Tyr Lys Met Leu Met Asp Ile Lys     370 375 380 Thr Arg Leu Glu Gln Glu Ile Ala Thr Tyr Arg Gln Leu Leu Glu Gly 385 390 395 400 Gln Glu Ser Gln Leu Phe Gly Ser Leu Ser Gly Ser Pro Asp Lys Arg                 405 410 415 Asp Lys Pro Ala Asp Gly Lys             420 <210> 9 <211> 448 <212> PRT <213> DES <400> 9 Arg Val Ser Ser Tyr Arg Arg Thr Phe Gly Gly Gly Thr Ser Pro Val   1 5 10 15 Phe Pro Arg Ala Ser Phe Gly Ser Arg Gly Ser Gly Ser Ser Val Thr              20 25 30 Ser Arg Val Tyr Gln Val Ser Ser Thr Ser Ala Val Pro Thr Leu Ser          35 40 45 Thr Phe Arg Thr Thr Arg Val Thr Pro Leu Arg Thr Tyr Gln Ser Ala      50 55 60 Tyr Gln Gly Ala Gly Glu Leu Leu Asp Phe Ser Leu Ala Asp Ala Met  65 70 75 80 Asn Gln Glu Phe Leu Gln Thr Arg Thr Asn Glu Lys Val Glu Leu Gln                  85 90 95 Glu Leu Asn Asp Arg Phe Ala Asn Tyr Ile Glu Lys Val Arg Phe Leu             100 105 110 Glu Gln Gln Asn Ala Leu Met Val Ala Glu Val Asn Arg Leu Arg Gly         115 120 125 Lys Glu Pro Thr Arg Val Ala Glu Met Tyr Glu Glu Glu Leu Arg Glu     130 135 140 Leu Arg Arg Gln Val Asp Ala Leu Thr Gly Gln Arg Ala Arg Val Glu 145 150 155 160 Val Glu Arg Asp Asn Leu Leu Asp Asp Leu Gln Lys Leu Lys Gln Arg                 165 170 175 Leu Gln Glu Glu Ile Gln Leu Lys Glu Glu Glu Ala Glu Asn Asn Leu Ala             180 185 190 Ala Phe Arg Ala Asp Val Asp Ala Ala Thr Leu Ala Arg Ile Asp Leu         195 200 205 Glu Arg Arg Ile Glu Ser Leu Gln Glu Glu Ile Ala Phe Leu Lys Lys     210 215 220 Val His Glu Glu Glu Ile Arg Glu Leu Gln Ala Gln Leu Gln Glu Gln 225 230 235 240 His Ile Gln Val Glu Met Asp Ile Ser Lys Pro Asp Leu Thr Ala Ala                 245 250 255 Leu Arg Asp Ile Arg Ala Gln Tyr Glu Ser Ile Ala Ala Lys Asn Ile             260 265 270 Ala Glu Ala Glu Glu Trp Tyr Lys Ser Lys Val Ser Asp Leu Thr Gln         275 280 285 Ala Ala Asn Lys Asn Asn Asp Ala Leu Arg Gln Ala Lys Gln Glu Met     290 295 300 Leu Glu Tyr Arg His Gln Ile Gln Ser Tyr Thr Cys Glu Ile Asp Ala 305 310 315 320 Leu Lys Gly Thr Asn Asp Ser Leu Met Arg Gln Met Arg Glu Met Glu                 325 330 335 Glu Arg Phe Ala Gly Glu Ala Gly Gly Tyr Gln Asp Thr Ile Ala Arg             340 345 350 Leu Glu Glu Glu Ile Arg His Leu Lys Asp Glu Met Ala Arg His Leu         355 360 365 Arg Glu Tyr Gln Asp Leu Leu Asn Val Lys Met Ala Leu Asp Val Glu     370 375 380 Ile Ala Thr Tyr Arg Lys Leu Leu Glu Gly Glu Glu Asn Arg Ile Ser 385 390 395 400 Ile Pro Met His Gln Thr Phe Ala Ser Ala Leu Asn Phe Arg Glu Thr                 405 410 415 Ser Pro Asp Gln Arg Gly Ser Glu Val His Thr Lys Lys Thr Val Met             420 425 430 Ile Lys Thr Ile Glu Thr Arg Asp Gly Glu Val Val Ser Glu Ala Thr         435 440 445 <210> 10 <211> 460 <212> PRT <213> VIM <400> 10 Met Ser Phe Thr Ser Ser Lys Asn Ser Ser Tyr Arg Arg Met Phe Gly   1 5 10 15 Gly Gly Ser Arg Pro Ser Ser Gly Thr Arg Tyr Ile Thr Ser Ser Thr              20 25 30 Arg Tyr Ser Leu Gly Ser Ala Leu Arg Pro Ser Ser Ala Arg Tyr Val          35 40 45 Ser Ala Ser Pro Gly Gly Val Tyr Arg Thr Lys Ala Thr Ser Val Arg      50 55 60 Leu Arg Ser Ser Met Pro Met Met Arg His Asp Ala Val Asp Phe  65 70 75 80 Thr Leu Ala Asp Ala Ile Asn Thr Glu Phe Lys Ala Asn Arg Thr Asn                  85 90 95 Glu Lys Val Glu Leu Gln Glu Leu Asn Asp Arg Phe Ala Asn Tyr Ile             100 105 110 Asp Lys Val Arg Phe Leu Glu Gln Gln Asn Lys Ile Leu Leu Ala Glu         115 120 125 Leu Glu Gln Leu Lys Gly Lys Gly Thr Ser Arg Leu Gly Asp Leu Tyr     130 135 140 Glu Glu Glu Met Arg Asp Val Arg Arg Gln Val Asp Gln Leu Thr Asn 145 150 155 160 Asp Lys Ala Arg Val Glu Val Glu Arg Asp Asn Leu Ala Asp Asp Ile                 165 170 175 Met Arg Leu Arg Glu Lys Leu Gln Glu Glu Met Leu Gln Arg Glu Glu             180 185 190 Ala Glu Ser Thr Leu Gln Ser Phe Arg Gln Asp Val Asp Asn Ala Ser         195 200 205 Leu Ala Gly Leu Asp Leu Glu Arg Pro Val Glu Ser Leu Gln Glu Glu     210 215 220 Ile Val Phe Leu Lys Lys Leu His Asp Glu Glu Ile Arg Glu Leu Gln 225 230 235 240 Ala Gln Leu Gln Glu Gln His Ile Gln Ile Asp Met Asp Val Ser Lys                 245 250 255 Pro Asp Leu Thr Ala Ala Leu Arg Asp Val Arg Gln Gln Tyr Glu Ser             260 265 270 Val Ala Ala Lys Asn Leu Glu Glu Ala Glu Glu Trp Tyr Lys Ser Lys         275 280 285 Phe Ala Asp Leu Ser Glu Ala Ala Asn Arg Asn Asn Asp Ala Leu Arg     290 295 300 Gln Ala Lys Gln Glu Ala Asn Glu Tyr Arg Arg Gln Ile Gln Ser Leu 305 310 315 320 Thr Cys Glu Val Asp Ala Leu Lys Gly Ser Asn Glu Ser Leu Glu Arg                 325 330 335 Gln Met Arg Glu Met Glu Glu Asn Phe Ala Val Glu Ala Ala Asn Tyr             340 345 350 Gln Asp Thr Ile Gly Arg Leu Gln Asp Glu Ile Gln Asn Met Lys Glu         355 360 365 Glu Met Ala Arg His Leu Arg Glu Tyr Gln Asp Leu Leu Asn Val Lys     370 375 380 Met Ala Leu Asp Ile Glu Ile Ala Thr Tyr Arg Lys Leu Leu Glu Gly 385 390 395 400 Glu Glu Ser Arg Ile Asn Met Pro Ile Pro Thr Phe Ala Ser Leu Asn                 405 410 415 Leu Arg Glu Thr Asn Ile Glu Ser Gln Pro Ile Val Asp Thr His Ser             420 425 430 Lys Arg Thr Leu Leu Ile Lys Thr Val Glu Thr Arg Asp Gly Gln Val         435 440 445 Ile Asn Glu Thr Ser Gln His His Asp Asp Leu Glu     450 455 460 <210> 11 <211> 147 <212> PRT <213> LYZ <400> 11 Met Arg Ser Leu Leu Ile Leu Val Leu Cys Phe Leu Pro Leu Ala Ala   1 5 10 15 Leu Gly Lys Val Phe Gly Arg Cys Glu Leu Ala Ala Ala Met Lys Arg              20 25 30 His Gly Leu Asp Asn Tyr Arg Gly Tyr Ser Leu Gly Asn Trp Val Cys          35 40 45 Ala Ala Lys Phe Glu Ser Asn Phe Asn Thr Gln Ala Thr Asn Arg Asn      50 55 60 Thr Asp Gly Ser Thr Asp Tyr Gly Ile Leu Gln Ile Asn Ser Arg Trp  65 70 75 80 Trp Cys Asn Asp Gly Arg Thr Pro Gly Ser Arg Asn Leu Cys Asn Ile                  85 90 95 Pro Cys Ser Ala Leu Leu Ser Ser Asp Ile Thr Ala Ser Val Asn Cys             100 105 110 Ala Lys Lys Ile Val Ser Asp Gly Asn Gly Met Asn Ala Trp Val Ala         115 120 125 Trp Arg Asn Arg Cys Lys Gly Thr Asp Val Gln Ala Trp Ile Arg Gly     130 135 140 Cys Arg Leu 145 <210> 12 <211> 377 <212> PRT <213> ACT <400> 12 Met Cys Glu Glu Glu Asp Ser Thr Ala Leu Val Cys Asp Asn Gly Ser   1 5 10 15 Gly Leu Cys Lys Ala Gly Phe Ala Gly Asp Asp Ala Pro Arg Ala Val              20 25 30 Phe Pro Ser Ile Val Gly Arg Pro Arg His Gln Gly Val Met Met Gly          35 40 45 Met Gly Gln Lys Asp Ser Tyr Val Gly Asp Glu Ala Gln Ser Lys Arg      50 55 60 Gly Ile Leu Thr Leu Lys Tyr Pro Ile Glu His Gly Ile Ile Thr Asn  65 70 75 80 Trp Asp Asp Met Glu Lys Ile Trp His His Ser Phe Tyr Asn Glu Leu                  85 90 95 Arg Val Ala Pro Glu Glu His Pro Thr Leu Leu Thr Glu Ala Pro Leu             100 105 110 Asn Pro Lys Ala Asn Arg Glu Lys Met Thr Gln Ile Met Phe Glu Thr         115 120 125 Phe Asn Val Pro Ala Met Tyr Val Ala Ile Gl Ala Val Leu Ser Leu     130 135 140 Tyr Ala Ser Gly Arg Thr Thr Gly Ile Val Leu Asp Ser Gly Asp Gly 145 150 155 160 Val Thr His Asn Val Pro Ile Tyr Glu Gly Tyr Ala Leu Pro His Ala                 165 170 175 Ile Met Arg Leu Asp Leu Ala Gly Arg Asp Leu Thr Asp Tyr Leu Met             180 185 190 Lys Ile Leu Ser Glu Arg Gly Tyr Ser Phe Val Thr Thr Ala Glu Arg         195 200 205 Glu Ile Val Arg Asp Ile Lys Glu Lys Leu Cys Tyr Val Ala Leu Asp     210 215 220 Phe Glu Asn Glu Met Ala Thr Ala Ala Ser Ser Ser Seru Glu Lys 225 230 235 240 Ser Tyr Glu Leu Pro Asp Gly Gln Val Ile Thr Ile Gly Asn Glu Arg                 245 250 255 Phe Arg Cys Pro Glu Thr Leu Phe Gln Pro Ser Phe Ile Gly Met Glu             260 265 270 Ser Ala Gly Ile His Glu Thr Thr Tyr Asn Ser Ile Met Lys Cys Asp         275 280 285 Ile Asp Ile Arg Lys Asp Leu Tyr Ala Asn Asn Val Leu Ser Gly Gly     290 295 300 Thr Thr Met Tyr Pro Gly Ile Ala Asp Arg Met Gln Lys Glu Ile Thr 305 310 315 320 Ala Leu Ala Pro Ser Thr Met Lys Ile Lys Ile Ile Ala Pro Pro Glu                 325 330 335 Arg Lys Tyr Ser Val Trp Ile Gly Gly Ser Ile Leu Ala Ser Leu Ser             340 345 350 Thr Phe Gln Gln Met Trp Ile Ser Lys Gln Glu Tyr Asp Glu Ala Gly         355 360 365 Pro Ser Ile Val His Arg Lys Cys Phe     370 375 <210> 13 <211> 286 <212> PRT <213> CAPZA2 <400> 13 Met Ala Asp Leu Glu Glu Gln Leu Ser Asp Glu Glu Lys Val Arg Ile   1 5 10 15 Ala Ala Lys Phe Ile Ile His Ala Pro Pro Gly Glu Phe Asn Glu Val              20 25 30 Phe Asn Val Val Arg Leu Leu Leu Asn Asn Asp Asn Leu Leu Arg Glu          35 40 45 Gly Ala Ala His Ala Phe Ala Gln Tyr Asn Leu Asp Gln Phe Thr Pro      50 55 60 Val Lys Ile Asp Gly Tyr Asp Glu Gln Val Leu Ile Thr Glu His Gly  65 70 75 80 Asp Leu Gly Asn Gly Lys Phe Leu Asp Pro Lys Asn Lys Ile Ser Phe                  85 90 95 Lys Phe Asp His Leu Arg Lys Glu Ala Thr Asp Pro Arg Pro His Glu             100 105 110 Val Glu Asn Ala Ile Glu Ser Trp Arg Asn Ser Val Glu Thr Ala Met         115 120 125 Lys Ala Tyr Val Lys Glu His Tyr Pro Asn Gly Val Cys Thr Val Tyr     130 135 140 Gly Lys Thr Ile Asp Gly Gln Gln Thr Ile Ile Ala Cys Ile Glu Ser 145 150 155 160 His Gln Phe Gln Ala Lys Asn Phe Trp Asn Gly Arg Trp Arg Ser Glu                 165 170 175 Trp Lys Phe Thr Ile Ser Ser Thr Thr Gln Val Ala Gly Ile Leu             180 185 190 Lys Ile Gln Val His Tyr Tyr Glu Asp Gly Asn Val Gln Leu Val Ser         195 200 205 His Lys Asp Ile Gln Asp Ser Leu Thr Val Ser Asn Glu Ala Gln Thr     210 215 220 Ala Lys Glu Phe Ile Lys Ile Val Glu Ala Ala Glu Asn Glu Tyr Gln 225 230 235 240 Thr Ala Ile Ser Glu Asn Tyr Gln Thr Met Ser Asp Thr Thr Phe Lys                 245 250 255 Ala Leu Arg Arg Gln Leu Pro Val Thr Arg Thr Lys Ile Asp Trp Asn             260 265 270 Lys Ile Leu Ser Tyr Lys Ile Gly Lys Glu Met Gln Asn Ala         275 280 285 <210> 14 <211> 277 <212> PRT <213> CAPZB <400> 14 Met Ser Asp Gln Gln Leu Asp Cys Ala Leu Asp Leu Met Arg Arg Leu   1 5 10 15 Pro Pro Gln Gln Ile Glu Lys Asn Leu Ser Asp Leu Ile Asp Leu Val              20 25 30 Pro Ser Leu Cys Glu Asp Leu Leu Ser Ser Val Asp Gln Pro Leu Lys          35 40 45 Ile Ala Arg Asp Lys Val Val Gly Lys Asp Tyr Leu Leu Cys Asp Tyr      50 55 60 Asn Arg Asp Gly Asp Ser Tyr Arg Ser Pro Trp Ser Asn Lys Tyr Asp  65 70 75 80 Pro Pro Leu Glu Asp Gly Ala Met Pro Ser Ala Arg Leu Arg Lys Leu                  85 90 95 Glu Val Glu Ala Asn Asn Ala Phe Asp Gln Tyr Arg Asp Leu Tyr Phe             100 105 110 Glu Gly Val Ser Ser Val Tyr Leu Trp Asp Leu Asp His Gly Phe         115 120 125 Ala Gly Val Ile Leu Ile Lys Lys Ala Gly Asp Gly Ser Lys Lys Ile     130 135 140 Lys Gly Cys Trp Asp Ser Ile His Val Val Glu Val Gln Glu Lys Ser 145 150 155 160 Ser Gly Arg Thr Ala His Tyr Lys Leu Thr Ser Thr Val Met Leu Trp                 165 170 175 Leu Gln Thr Asn Lys Thr Gly Ser Gly Thr Met Asn Leu Gly Gly Ser             180 185 190 Leu Thr Arg Gln Met Glu Lys Asp Glu Thr Val Ser Asp Ser Ser Pro         195 200 205 His Ile Ala Asn Ile Gly Arg Leu Val Glu Asp Met Glu Asn Lys Ile     210 215 220 Arg Ser Thr Leu Asn Glu Ile Tyr Phe Gly Lys Thr Lys Asp Ile Val 225 230 235 240 Asn Gly Leu Arg Ser Ile Asp Ala Ile Pro Asp Asn Gln Lys Tyr Lys                 245 250 255 Gln Leu Gln Arg Glu Leu Ser Gln Val Leu Thr Gln Arg Gln Ile Tyr             260 265 270 Ile Gln Pro Asp Asn         275 <210> 15 <211> 284 <212> PRT <213> TPM1 <400> 15 Met Asp Ala Ile Lys Lys Lys Met Gln Met Leu Lys Leu Asp Lys Glu   1 5 10 15 Asn Ala Leu Asp Arg Ala Glu Gln Ala Glu Ala Asp Lys Lys Ala Ala              20 25 30 Glu Glu Arg Ser Lys Gln Leu Glu Asp Glu Leu Val Ala Leu Gln Lys          35 40 45 Lys Leu Lys Gly Thr Glu Asp Glu Leu Asp Lys Tyr Ser Glu Ser Leu      50 55 60 Lys Asp Ala Gln Glu Lys Leu Glu Leu Ala Asp Lys Lys Ala Thr Asp  65 70 75 80 Ala Glu Ser Glu Val Ala Ser Leu Asn Arg Arg Ile Gln Leu Val Glu                  85 90 95 Glu Glu Leu Asp Arg Ala Gln Glu Arg Leu Ala Thr Ala Leu Gln Lys             100 105 110 Leu Glu Glu Ala Glu Lys Ala Ala Asp Glu Ser Glu Arg Gly Met Lys         115 120 125 Val Ile Glu Asn Arg Ala Gln Lys Asp Glu Glu Lys Met Glu Ile Gln     130 135 140 Glu Ile Gln Leu Lys Glu Ala Lys His Ile Ala Glu Glu Ala Asp Arg 145 150 155 160 Lys Tyr Glu Glu Val Ala Arg Lys Leu Val Ile Ile Glu Gly Asp Leu                 165 170 175 Glu Arg Ala Glu Glu Arg Ala Glu Leu Ser Glu Ser Gln Val Arg Gln             180 185 190 Leu Glu Glu Gln Leu Arg Ile Met Asp Gln Thr Leu Lys Ala Leu Met         195 200 205 Ala Ala Glu Asp Lys Tyr Ser Gln Lys Glu Asp Lys Tyr Glu Glu Glu     210 215 220 Ile Lys Val Leu Thr Asp Lys Leu Lys Glu Ala Glu Thr Arg Ala Glu 225 230 235 240 Phe Ala Glu Arg Ser Val Thr Lys Leu Glu Lys Ser Ile Asp Asp Leu                 245 250 255 Glu Glu Lys Val Ala His Ala Lys Glu Glu Asn Leu Asn Met His Gln             260 265 270 Met Leu Asp Gln Thr Leu Leu Glu Leu Asn Asn Met         275 280 <210> 16 <211> 411 <212> PRT <213> TUBA <400> 16 Thr Ile Gly Gly Gly Asp Asp Ser Phe Asn Thr Phe Phe Ser Glu Thr   1 5 10 15 Gly Ala Gly Lys His Val Pro Arg Ala Val Phe Val Asp Leu Glu Pro              20 25 30 Thr Val Ile Asp Glu Val Arg Thr Gly Thr Tyr Arg Gln Leu Phe His          35 40 45 Pro Glu Gln Leu Ile Thr Gly Lys Glu Asp Ala Ala Asn Asn Tyr Ala      50 55 60 Arg Gly His Tyr Thr Ile Gly Lys Glu Ile Ile Asp Leu Val Leu Asp  65 70 75 80 Arg Ile Arg Lys Leu Ala Asp Gln Cys Thr Gly Leu Gln Gly Phe Ser                  85 90 95 Val Phe His Ser Phe Gly Gly Gly Thr Gly Ser Gly Phe Thr Ser Leu             100 105 110 Leu Met Glu Arg Leu Ser Val Asp Tyr Gly Lys Lys Ser Lys Leu Glu         115 120 125 Phe Ser Ile Tyr Pro Ala Arg Gln Val Ser Thr Ala Val Val Glu Pro     130 135 140 Tyr Asn Ser Ile Leu Thr Thr His Thr Thr Leu Glu His Ser Asp Cys 145 150 155 160 Ala Phe Met Val Asp Asn Glu Ala Ile Tyr Asp Ile Cys Arg Arg Asn                 165 170 175 Leu Asp Ile Glu Arg Pro Thr Tyr Thr Asn Leu Asn Arg Leu Ile Gly             180 185 190 Gln Ile Val Ser Ser Ile Thr Ala Ser Leu Arg Phe Asp Gly Ala Leu         195 200 205 Asn Val Asp Leu Thr Glu Phe Gln Thr Asn Leu Val Pro Tyr Pro Arg     210 215 220 Ile His Phe Pro Leu Ala Thr Tyr Ala Pro Val Ile Ser Ala Glu Lys 225 230 235 240 Ala Tyr His Glu Gln Leu Ser Val Ala Glu Ile Thr Asn Ala Tyr Phe                 245 250 255 Glu Pro Ala Asn Gln Met Val Lys Cys Asp Pro Arg His Gly Lys Tyr             260 265 270 Met Ala Cys Cys Leu Leu Tyr Arg Gly Asp Val Val Pro Lys Asp Val         275 280 285 Asn Ala Ile Ala Thr Ile Lys Thr Lys Arg Thr Ile Gln Phe Val     290 295 300 Asp Trp Cys Pro Thr Gly Phe Lys Val Gly Ile Asn Tyr Gln Pro Pro 305 310 315 320 Thr Val Val Pro Gly Gly Asp Leu Ala Lys Val Gln Arg Ala Val Cys                 325 330 335 Met Leu Ser Asn Thr Thr Ala Ile Ala Glu Ala Trp Ala Arg Leu Asp             340 345 350 His Lys Phe Asp Leu Met Tyr Ala Lys Arg Ala Phe Val His Trp Tyr         355 360 365 Val Gly Glu Gly Met Glu Glu Gly Glu Phe Ser Glu Ala Arg Glu Asp     370 375 380 Met Ala Ala Leu Glu Lys Asp Tyr Glu Glu Val Gly Val Asp Ser Val 385 390 395 400 Glu Gly Glu Gly Glu Glu Glu Gly Gly Glu Glu Tyr                 405 410 <210> 17 <211> 445 <212> PRT <213> TUBB2C <400> 17 Met Arg Glu Ile Val His Leu Gln Ala Gly Gln Cys Gly Asn Gln Ile   1 5 10 15 Gly Ala Lys Phe Trp Glu Val Ile Ser Asp Glu His Gly Ile Asp Pro              20 25 30 Thr Gly Thr Tyr His Gly Asp Ser Asp Leu Gln Leu Glu Arg Ile Asn          35 40 45 Val Tyr Tyr Asn Glu Ala Thr Gly Gly Lys Tyr Val Pro Arg Ala Val      50 55 60 Leu Val Asp Leu Glu Pro Gly Thr Met Asp Ser Val Arg Ser Gly Pro  65 70 75 80 Phe Gly Gln Ile Phe Arg Pro Asp Asn Phe Val Phe Gly Gln Ser Gly                  85 90 95 Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly Ala Glu Leu             100 105 110 Val Asp Ser Val Leu Asp Val Val Arg Lys Glu Ala Glu Ser Cys Asp         115 120 125 Cys Leu Gln Gly Phe Gln Leu Thr His Ser Leu Gly Gly Gly Thr Gly     130 135 140 Ser Gly Met Gly Thr Leu Leu Ile Ser Lys Ile Arg Glu Glu Tyr Pro 145 150 155 160 Asp Arg Ile Met Asn Thr Phe Ser Val Val Ser Ser Pro Lys Val Ser                 165 170 175 Asp Thr Val Glu Pro Tyr Asn Ala Thr Leu Ser Val His Gln Leu             180 185 190 Val Glu Asn Thr Asp Glu Thr Tyr Cys Ile Asp Asn Glu Ala Leu Tyr         195 200 205 Asp Ile Cys Phe Arg Thr Leu Lys Leu Thr Thr Pro Thr Tyr Gly Asp     210 215 220 Leu Asn His Leu Val Ser Ala Thr Met Ser Gly Val Thr Thr Cys Leu 225 230 235 240 Arg Phe Pro Gly Gln Leu Asn Ala Asp Leu Arg Lys Leu Ala Val Asn                 245 250 255 Met Val Pro Phe Pro Arg Leu His Phe Phe Met Pro Gly Phe Ala Pro             260 265 270 Leu Thr Ser Arg Gly Ser Gln Gln Tyr Arg Ala Leu Thr Val Pro Glu         275 280 285 Leu Thr Gln Gln Met Phe Asp Ala Lys Asn Met Met Ala Ala Cys Asp     290 295 300 Pro Arg His Gly Arg Tyr Leu Thr Val Ala Val Val Phe Arg Gly Arg 305 310 315 320 Met Ser Met Lys Glu Val Asp Glu Gln Met Leu Asn Val Gln Asn Lys                 325 330 335 Asn Ser Ser Tyr Phe Val Glu Trp Ile Pro Asn Asn Val Lys Thr Ala             340 345 350 Val Cys Asp Ile Pro Pro Arg Gly Leu Lys Met Ser Ala Thr Phe Ile         355 360 365 Gly Asn Ser Thr Ala Ile Gln Glu Leu Phe Lys Arg Ile Ser Glu Gln     370 375 380 Phe Thr Ala Met Phe Arg Arg Lys Ala Phe Leu His Trp Tyr Thr Gly 385 390 395 400 Glu Gly Met Asp Glu Met Glu Phe Thr Glu Ala Glu Ser Asn Met Asn                 405 410 415 Asp Leu Val Ser Glu Tyr Gln Gln Tyr Gln Asp Ala Thr Ala Glu Glu             420 425 430 Glu Gly Glu Phe Glu Glu Glu Ala Glu Glu Glu Ala Glu         435 440 445 <210> 18 <211> 340 <212> PRT <213> CTSB <400> 18 Met Ser Trp Ser Arg Ser Leu Cys Leu Leu Gly Ala Phe Ala Asn   1 5 10 15 Ala Arg Ser Ile Pro Tyr Tyr Pro Pro Leu Ser Ser Asp Leu Val Asn              20 25 30 His Ile Asn Lys Leu Asn Thr Thr Gly Arg Ala Gly His Asn Phe His          35 40 45 Asn Thr Asp Met Ser Tyr Val Lys Lys Leu Cys Gly Thr Phe Leu Gly      50 55 60 Gly Pro Lys Ala Pro Glu Arg Val Asp Phe Ala Glu Asp Met Asp Leu  65 70 75 80 Pro Asp Thr Phe Asp Thr Arg Lys Gln Trp Pro Asn Cys Pro Thr Ile                  85 90 95 Ser Glu Ile Arg Asp Gln Gly Ser Cys Gly Ser Cys Trp Ala Phe Gly             100 105 110 Ala Val Glu Ala Ile Ser Asp Arg Ile Cys Val His Thr Asn Ala Lys         115 120 125 Val Ser Val Glu Val Ser Ala Glu Asp Leu Leu Ser Cys Cys Gly Phe     130 135 140 Glu Cys Gly Met Gly Cys Asn Gly Gly Tyr Pro Ser Gly Ala Trp Arg 145 150 155 160 Tyr Trp Thr Glu Arg Gly Leu Val Ser Gly Gly Leu Tyr Asp Ser His                 165 170 175 Val Gly Cys Arg Ala Tyr Thr Ile Pro Pro Cys Glu His His Val Asn             180 185 190 Gly Ser Arg Pro Pro Cys Thr Gly Glu Gly Gly Glu Thr Pro Arg Cys         195 200 205 Ser Arg His Cys Glu Pro Gly Tyr Ser Pro Ser Tyr Lys Glu Asp Lys     210 215 220 His Tyr Gly Ile Thr Ser Tyr Gly Val Pro Arg Ser Glu Lys Glu Ile 225 230 235 240 Met Ala Glu Ile Tyr Lys Asn Gly Pro Val Glu Gly Ala Phe Ile Val                 245 250 255 Tyr Glu Asp Phe Leu Met Tyr Lys Ser Gly Val Tyr Gln His Val Ser             260 265 270 Gly Glu Gln Val Gly Gly His Ala Ile Arg Ile Leu Gly Trp Gly Val         275 280 285 Glu Asn Gly Thr Pro Tyr Trp Leu Ala Ala Asn Ser Trp Asn Thr Asp     290 295 300 Trp Gly Ile Thr Gly Phe Phe Lys Ile Leu Arg Gly Glu Asp His Cys 305 310 315 320 Gly Ile Glu Ser Glu Ile Val Ala Gly Val Pro Arg Met Glu Gln Tyr                 325 330 335 Trp Thr Arg Val             340 <210> 19 <211> 205 <212> PRT <213> PSMB3 <400> 19 Met Ser Ile Met Ser Tyr Asn Gly Gly Ala Val Met Ala Met Arg Gly   1 5 10 15 Lys Asn Cys Val Ala Ile Ala Ser Asp Arg Arg Phe Gly Ile Gln Ala              20 25 30 Gln Met Val Thr Thr Asp Phe Gln Lys Ile Phe Pro Met Gly Glu Arg          35 40 45 Leu Tyr Ile Gly Leu Ala Gly Leu Ala Thr Asp Val Gln Thr Val Ala      50 55 60 Gln Arg Leu Lys Phe Arg Leu Asn Leu Tyr Glu Leu Lys Glu Gly Arg  65 70 75 80 Gln Ile Lys Pro Gln Thr Phe Met Ser Met Val Ser Asn Leu Leu Tyr                  85 90 95 Glu Arg Arg Phe Gly Pro Tyr Tyr Thr Glu Pro Val Ile Ala Gly Leu             100 105 110 Asp Pro Ile Thr His Glu Pro Phe Ile Cys Ser Leu Asp Leu Ile Gly         115 120 125 Cys Pro Met Ile Thr Glu Asp Phe Val Val Ser Gly Thr Cys Ser Glu     130 135 140 Gln Met Tyr Gly Met Cys Glu Ser Leu Trp Glu Pro Asp Met Glu Pro 145 150 155 160 Asp His Leu Phe Glu Thr Ile Ser Gln Ala Met Leu Asn Ala Val Asp                 165 170 175 Arg Asp Ile Ser Gly Met Gly Val Val Val His Ile Ile Glu Lys             180 185 190 Asp Lys Ile Thr Thr Arg Thr Leu Lys Ala Arg Met Asp         195 200 205 <210> 20 <211> 423 <212> PRT <213> ANT <400> 20 Arg Asp Ile Pro Val Asn Pro Ile Cys Ile Tyr Arg Asn Pro Glu Lys   1 5 10 15 Lys Pro Gln Glu Arg Arg Gly Ala Gly Ala Gly Glu Gly Gln Asp Pro              20 25 30 Gly Val His Lys Pro Pro Val Trp Glu Leu Ser Arg Ala Asn Ser Arg          35 40 45 Phe Ala Val Val Phe Tyr Lys His Leu Ala Asp Ser Lys Asp Asn Glu      50 55 60 Glu Asn Ile Phe Leu Ser Pro Leu Ser Ile Ser Thr Ala Phe Ala Met  65 70 75 80 Thr Lys Leu Gly Ala Cys Gly Asp Thr Leu Gln Gln Leu Met Glu Val                  85 90 95 Phe Gln Phe Asp Thr Ile Ser Glu Lys Thr Ser Asp Gln Val His Phe             100 105 110 Phe Phe Ala Lys Leu Asn Cys Arg Leu Tyr Lys Lys Ala Asn Lys Ser         115 120 125 Ser Glu Leu Ile Ser Ala Asn Arg Leu Phe Gly Glu Lys Ser Leu Val     130 135 140 Phe Asn Glu Thr Tyr Gln Asn Ile Ser Glu Ile Val Tyr Gly Ala Lys 145 150 155 160 Leu Trp Pro Leu Asn Phe Lys Glu Lys Pro Glu Leu Ser Arg Lys Ile                 165 170 175 Ile Asn Glu Trp Val Ala Asn Lys Thr Glu Arg Arg Ile Thr Glu Val             180 185 190 Ile Pro Glu Lys Gly Ile Asp Asp Leu Thr Val Leu Val Leu Val Asn         195 200 205 Thr Ile Tyr Phe Lys Gly His Trp Lys Ser Gln Phe Pro Ala Pro Asn     210 215 220 Thr Arg Leu Asp Leu Phe His Lys Ala Asn Gly Glu Thr Cys Asn Val 225 230 235 240 Pro Ile Met Tyr Gln Glu Ser Arg Phe Pro Tyr Ala Phe Ile Gln Glu                 245 250 255 Asp Lys Val Gln Val Leu Glu Leu Pro Tyr Lys Gly Asp Asp Ile Thr             260 265 270 Met Val Leu Val Leu Pro Lys Ala Gly Thr Pro Leu Val Glu Val Glu         275 280 285 Arg Asp Leu Thr Ser Asp Lys Leu Gln Asp Trp Ile Asp Ser Met Met     290 295 300 Glu Val Ser Leu Thr Val Ser Phe Pro Arg Phe Arg Val Glu Asp Ser 305 310 315 320 Phe Ser Val Lys Glu Lys Leu Arg Lys Met Gly Leu Glu Asp Leu Phe                 325 330 335 Ser Pro Glu Asn Ala Lys Leu Pro Gly Ile Val Ala Gly Asp Arg Thr             340 345 350 Asp Leu Tyr Val Ser Glu Ala Phe His Lys Ala Phe Leu Glu Val Asn         355 360 365 Glu Glu Gly Ser Glu Ala Ser Ala Ala Thr Ala Val Val Ile Ser Gly     370 375 380 Arg Ser Phe Pro Met Asn Arg Ile Ile Phe Glu Ala Asn Arg Pro Phe 385 390 395 400 Leu Leu Phe Ile Arg Glu Ala Thr Leu Asn Thr Ile Ile Phe Met Gly                 405 410 415 Arg Ile Ser Asp Pro Cys Ser             420 <210> 21 <211> 264 <212> PRT <213> APOA1 <400> 21 Met Arg Gly Val Leu Val Thr Leu Ala Val Leu Phe Leu Thr Gly Thr   1 5 10 15 Gln Ala Arg Ser Phe Trp Gln His Asp Glu Pro Gln Thr Pro Leu Asp              20 25 30 Arg Ile Arg Asp Met Val Asp Val Tyr Leu Glu Thr Val Lys Ala Ser          35 40 45 Gly Lys Asp Ala Ile Ala Gln Phe Glu Ser Ser Ala Val Gly Lys Gln      50 55 60 Leu Asp Leu Lys Leu Ala Asp Asn Leu Asp Thr Leu Ser Ala Ala Ala  65 70 75 80 Ala Lys Leu Arg Glu Asp Met Ala Pro Tyr Tyr Lys Glu Val Arg Glu                  85 90 95 Met Trp Leu Lys Asp Thr Glu Ala Leu Arg Ala Glu Leu Thr Lys Asp             100 105 110 Leu Glu Glu Val Lys Glu Lys Ile Arg Pro Phe Leu Asp Gln Phe Ser         115 120 125 Ala Lys Trp Thr Glu Glu Leu Glu Gln Tyr Arg Gln Arg Leu Thr Pro     130 135 140 Val Ala Gln Glu Leu Lys Glu Leu Thr Lys Gln Lys Val Glu Leu Met 145 150 155 160 Gln Ala Lys Leu Thr Pro Val Ala Glu Glu Ala Arg Asp Arg Leu Arg                 165 170 175 Gly His Val Glu Glu Leu Arg Lys Asn Leu Ala Pro Tyr Ser Asp Glu             180 185 190 Leu Arg Gln Lys Leu Ser Gln Lys Leu Glu Glu Ile Arg Glu Lys Gly         195 200 205 Ile Pro Gln Ala Ser Glu Tyr Gln Ala Lys Val Met Glu Gln Leu Ser     210 215 220 Asn Leu Arg Glu Lys Met Thr Pro Leu Val Gln Glu Phe Arg Glu Arg 225 230 235 240 Leu Thr Pro Tyr Ala Glu Asn Leu Lys Asn Arg Leu Ile Ser Phe Leu                 245 250 255 Asp Glu Leu Gln Lys Ser Val Ala             260 <210> 22 <211> 615 <212> PRT <213> ALB <400> 22 Met Lys Trp Val Thr Leu Ile Ser Phe Ile Phe Leu Phe Ser Ser Ala   1 5 10 15 Thr Ser Arg Asn Leu Gln Arg Phe Ala Arg Asp Ala Glu His Lys Ser              20 25 30 Glu Ile Ala His Arg Tyr Asn Asp Leu Lys Glu Glu Thr Phe Lys Ala          35 40 45 Val Ala Met Ile Thr Phe Ala Gln Tyr Leu Gln Arg Cys Ser Tyr Glu      50 55 60 Gly Leu Ser Lys Leu Val Lys Asp Val Val Asp Leu Ala Gln Lys Cys  65 70 75 80 Val Ala Asn Glu Asp Ala Pro Glu Cys Ser Lys Pro Leu Pro Ser Ile                  85 90 95 Ile Leu Asp Glu Ile Cys Gln Val Glu Lys Leu Arg Asp Ser Tyr Gly             100 105 110 Ala Met Ala Asp Cys Cys Ser Lys Ala Asp Pro Glu Arg Asn Glu Cys         115 120 125 Phe Leu Ser Phe Lys Val Ser Gln Pro Asp Phe Val Gln Pro Tyr Gln     130 135 140 Arg Pro Ala Ser Asp Val Ile Cys Gln Glu Tyr Gln Asp Asn Arg Val 145 150 155 160 Ser Phe Leu Gly His Phe Ile Tyr Ser Val Ala Arg Arg His Pro Phe                 165 170 175 Leu Tyr Ala Pro Ala Ile Leu Ser Phe Ala Val Asp Phe Glu His Ala             180 185 190 Leu Gln Ser Cys Cys Lys Glu Ser Asp Val Gly Ala Cys Leu Asp Thr         195 200 205 Lys Glu Ile Val Met Arg Glu Lys Ala Lys Gly Val Val Ser Lys Gln     210 215 220 Gln Tyr Phe Cys Gly Ile Leu Lys Gln Phe Gly Asp Arg Val Phe Gln 225 230 235 240 Ala Arg Gln Leu Ile Tyr Leu Ser Gln Lys Tyr Pro Lys Ala Pro Phe                 245 250 255 Ser Glu Val Ser Lys Phe Val His Asp Ser Ile Gly Val His Lys Glu             260 265 270 Cys Cys Glu Gly Asp Met Val Glu Cys Met Asp Asp Met Ala Arg Met         275 280 285 Met Ser Asn Leu Cys Ser Gln Gln Asp Val Phe Ser Gly Lys Ile Lys     290 295 300 Asp Cys Cys Glu Lys Pro Ile Val Glu Arg Ser Gln Cys Ile Met Glu 305 310 315 320 Ala Glu Phe Asp Glu Lys Pro Ala Asp Leu Pro Ser Leu Val Glu Lys                 325 330 335 Tyr Ile Glu Asp Lys Glu Val Cys Lys Ser Phe Glu Ala Gly His Asp             340 345 350 Ala Phe Met Ala Glu Phe Val Tyr Glu Tyr Ser Arg Arg His Pro Glu         355 360 365 Phe Ser Ile Gln Leu Ile Met Arg Ile Ala Lys Gly Tyr Glu Ser Leu     370 375 380 Leu Glu Lys Cys Cys Lys Thr Asp Asn Pro Ala Glu Cys Tyr Ala Asn 385 390 395 400 Ala Gln Glu Gln Leu Asn Gln His Ile Lys Glu Thr Gln Asp Val Val                 405 410 415 Lys Thr Asn Cys Asp Leu Leu His Asp His Gly Glu Ala Asp Phe Leu             420 425 430 Lys Ser Ile Leu Ile Arg Tyr Thr Lys Lys Met Pro Gln Val Pro Thr         435 440 445 Asp Leu Leu Leu Glu Thr Gly Lys Lys Met Thr Thr Ile Gly Thr Lys     450 455 460 Cys Cys Gln Leu Gly Glu Asp Arg Arg Met Ala Cys Ser Glu Gly Tyr 465 470 475 480 Leu Ser Ile Val Ile His Asp Thr Cys Arg Lys Gln Glu Thr Thr Pro                 485 490 495 Ile Asn Asp Asn Val Ser Gln Cys Cys Ser Gln Leu Tyr Ala Asn Arg             500 505 510 Arg Pro Cys Phe Thr Ala Met Gly Val Asp Thr Lys Tyr Val Pro Pro         515 520 525 Pro Phe Asn Pro Asp Met Phe Ser Phe Asp Glu Lys Leu Cys Ser Ala     530 535 540 Pro Ala Glu Glu Arg Glu Val Gly Gln Met Lys Leu Leu Ile Asn Leu 545 550 555 560 Ile Lys Arg Lys Pro Gln Met Thr Glu Glu Gln Ile Lys Thr Ile Ala                 565 570 575 Asp Gly Phe Thr Ala Met Val Asp Lys Cys Cys Lys Gln Ser Asp Ile             580 585 590 Asn Thr Cys Phe Gly Glu Glu Gly Ala Asn Leu Ile Val Gln Ser Arg         595 600 605 Ala Thr Leu Gly Ile Gly Ala     610 615 <210> 23 <211> 244 <212> PRT <213> CLIC2 <400> 23 Met Glu Ser Arg Pro Val Lys Glu Pro Glu Ile Glu Leu Phe Val Lys   1 5 10 15 Ala Gly Leu Asp Gly Glu Asn Ile Gly Asn Cys Pro Phe Cys Gln Arg              20 25 30 Leu Phe Met Val Leu Trp Leu Lys Gly Val Lys Phe Asn Val Thr Thr          35 40 45 Val Asp Met Thr Arg Lys Pro Glu Glu Leu Lys Asp Leu Ala Pro Gly      50 55 60 Thr Asn Pro Pro Phe Leu Leu Phe Asn Arg Glu Leu Lys Thr Asp Phe  65 70 75 80 Ile Lys Ile Glu Glu Phe Leu Glu Gln Thr Leu Cys Pro Pro Thr Tyr                  85 90 95 Pro His Leu Ser Pro Lys Tyr Lys Glu Ser Phe Asp Val Gly Ser Asp             100 105 110 Ile Phe Ala Lys Phe Ser Ala Tyr Ile Lys Asn Ser Arg Lys Glu Ala         115 120 125 Asn Ser Asn Leu Glu Lys Ala Leu Leu Arg Glu Phe Gln Arg Leu Asp     130 135 140 Gln Tyr Leu Thr Thr Pro Leu Pro Glu Glu Ile Asp Gln Asp Ser Val 145 150 155 160 Glu Asp Ile Thr Ile Ser Lys Arg Lys Phe Leu Asp Gly Asp His Leu                 165 170 175 Thr Leu Ala Asp Cys Asn Leu Leu Pro Lys Leu His Ile Ile Lys Ile             180 185 190 Ala Ala Lys Lys Tyr Arg Asp Phe Glu Ile Pro Ala Asp Met Thr Gly         195 200 205 Val Trp Arg Tyr Leu Asn Asn Ala Tyr Ala Cys Asp Glu Phe Ser His     210 215 220 Thr Cys Pro Ala Asp Glu Glu Ile Val His Thr Tyr Ala Ser Val Ala 225 230 235 240 Arg Lys Met Thr                 <210> 24 <211> 310 <212> PRT <213> ART <400> 24 Met Ser Arg Phe Gly Gly Arg Leu Arg Glu Tyr Pro Gln Leu Ser Ile   1 5 10 15 Asp Arg Phe Asp Tyr Asp Asn Leu Arg Ala Arg Ala Tyr Phe Leu Ser              20 25 30 His Cys His Lys Asp Ile Leu Arg Gly Leu Arg Ala Pro Pro Leu          35 40 45 Arg Gly Gly Ala Ala Glu Pro Ser Leu Lys Val Lys Leu Tyr Cys Ser      50 55 60 Pro Val Thr Lys Glu Leu Leu Leu Thr Asn Ser Lys Tyr Ala Phe Trp  65 70 75 80 Glu Asn His Ile Val Ala Leu Glu Val Glu Thr Pro Thr Gln Ile Ser                  85 90 95 Leu Val Asp Glu Thr Thr Gly Glu Lys Glu Asp Ile Glu Val Thr Leu             100 105 110 Leu Pro Ala Gly His Cys Pro Gly Ser Val Met Phe Leu Phe Gln Gly         115 120 125 Glu Asn Gly Thr Val Leu Tyr Thr Gly Asp Phe Arg Leu Ala Lys Gly     130 135 140 Glu Ala Ala Arg Met Glu Leu Leu His Ser Gly Thr Ser Val Lys Asp 145 150 155 160 Ile Gln Ser Val Tyr Leu Asp Thr Thr Phe Cys Asp Pro Arg Phe Tyr                 165 170 175 His Ile Pro Ser Arg Glu Glu Cys Leu Ser Gly Ile Leu Glu Leu Val             180 185 190 Arg Ser Trp Thr Thr Leu Ser Arg Tyr His Val Val Trp Leu Asn Cys         195 200 205 Lys Ala Ala Tyr Gly Tyr Glu Tyr Leu Phe Ile Asn Leu Ser Glu Glu     210 215 220 Leu Gly Ile Lys Val His Val Asn Lys Leu Asp Met Phe Lys Asn Met 225 230 235 240 Pro Glu Ile Leu Tyr His Ile Thr Thr Asp Arg Tyr Thr Gln Ile His                 245 250 255 Ala Cys Arg His Pro Lys Asp Asp Asp Tyr Val Arg Gly Asn Arg Leu             260 265 270 Pro Cys Gly Ile Thr Leu Gln Pro Leu Cys Arg Ser Tyr Arg Arg Asn         275 280 285 Thr Glu Pro Arg Tyr Lys Pro Leu Gly Thr Leu Lys Arg Ala Cys Lys     290 295 300 Arg Asn Leu Ser Asp Thr 305 310 <210> 25 <211> 272 <212> PRT <213> PHB <400> 25 Met Ala Lys Val Phe Glu Ser Ile Gly Lys Phe Gly Leu Gly Leu   1 5 10 15 Ala Val Ala Gly Gly Val Val Asn Ser Ala Leu Tyr Asn Val Asp Ala              20 25 30 Gly His Arg Ala Val Ile Phe Asp Arg Phe Arg Gly Val Gln Asp Thr          35 40 45 Val Val Gly Glu Gly Thr His Phe Leu Ile Pro Trp Val Gln Lys Pro      50 55 60 Ile Ile Phe Asp Cys Arg Ser Arg Pro Arg Asn Ile Pro Val Ile Thr  65 70 75 80 Gly Ser Lys Asp Leu Gln Asn Val Asn Ile Thr Leu Arg Ile Leu Phe                  85 90 95 Arg Pro Val Thr Ala Gln Leu Pro Arg Ile Phe Thr Ser Ile Gly Glu             100 105 110 Asp Tyr Asp Glu Arg Val Leu Pro Ser Ile Thr Thr Glu Ile Leu Lys         115 120 125 Ser Val Val Ala Arg Phe Asp Ala Gly Glu Leu Ile Thr Gln Arg Glu     130 135 140 Leu Val Ser Arg Gln Val Ser Glu Asp Leu Thr Glu Arg Ala Ala Thr 145 150 155 160 Phe Gly Leu Ile Leu Asp Asp Val Ser Leu Thr His Leu Thr Phe Gly                 165 170 175 Lys Glu Phe Thr Glu Ala Val Glu Met Lys Gln Val Ala Gln Gln Glu             180 185 190 Ala Glu Arg Ala Arg Phe Ile Val Glu Lys Ala Glu Gln Gln Lys Lys         195 200 205 Ala Ala Val Ile Ser Ala Glu Gly Asp Ser Lys Ala Ala Glu Leu Ile     210 215 220 Ala Asn Ser Leu Ala Pro Ala Gly Asp Gly Leu Ile Glu Leu Arg Lys 225 230 235 240 Leu Glu Ala Ala Glu Asp Ile Ala Tyr Gln Leu Ser Arg Ser Ser Asn                 245 250 255 Ile Thr Tyr Leu Pro Ser Gly Gln Ser Val Leu Leu Gln Leu Pro Gln             260 265 270 <210> 26 <211> 689 <212> PRT <213> TGases <400> 26 Met Ala Glu Glu Leu Val Leu Glu Thr Cys Asp Leu Gln Cys Glu Arg   1 5 10 15 Asn Gly Arg Glu His Arg Thr Ala Glu Met Gly Ser Gln Gln Leu Val              20 25 30 Val Arg Arg Gly Gln Pro Phe Thr Ile Thr Leu Asn Phe Ala Gly Arg          35 40 45 Gly Tyr Glu Glu Gly Val Asp Lys Leu Ala Phe Asp Val Glu Thr Gly      50 55 60 Pro Cys Pro Val Glu Thr Ser Gly Thr Arg Ser His Phe Thr Leu Thr  65 70 75 80 Asp Cys Pro Glu Glu Gly Thr Trp Ser Ala Val Leu Gln Gln Gln Asp                  85 90 95 Gly Ala Thr Leu Cys Val Ser Leu Cys Ser Pro Ser Ser Ala Arg Val             100 105 110 Gly Arg Tyr Arg Leu Thr Leu Glu Ala Ser Thr Gly Tyr Gln Gly Ser         115 120 125 Ser Phe His Leu Gly Asp Phe Val Leu Leu Phe Asn Ala Trp His Pro     130 135 140 Glu Asp Ala Val Tyr Leu Lys Glu Glu Asp Glu Arg Arg Glu Tyr Val 145 150 155 160 Leu Ser Gln Gln Gly Leu Ile Tyr Met Gly Ser Arg Asp Tyr Ile Thr                 165 170 175 Ser Thr Pro Trp Asn Phe Gly Gln Phe Glu Asp Glu Ile Leu Ala Ile             180 185 190 Cys Leu Glu Met Leu Asp Ile Asn Pro Lys Phe Leu Arg Asp Gln Asn         195 200 205 Leu Asp Cys Ser Arg Arg Asn Asp Pro Val Tyr Ile Gly Arg Val Val     210 215 220 Ser Ala Met Val Asn Cys Asn Asp Glu Asp His Gly Val Leu Leu Gly 225 230 235 240 Arg Trp Asp Asn His Tyr Glu Asp Gly Met Ser Pro Met Ala Trp Ile                 245 250 255 Gly Ser Val Asp Ile Leu Lys Arg Trp Arg Arg Leu Gly Cys Gln Pro             260 265 270 Val Lys Tyr Gly Gln Cys Trp Val Phe Ala Ala Val Ala Cys Thr Val         275 280 285 Met Arg Cys Leu Gly Val Pro Ser Arg Val Val Thr Asn Tyr Asn Ser     290 295 300 Ala His Asp Thr Asn Gly Asn Leu Val Ile Asp Arg Tyr Leu Ser Glu 305 310 315 320 Thr Gly Met Glu Glu Arg Arg Ser Thr Asp Met Ile Trp Asn Phe His                 325 330 335 Cys Trp Val Glu Cys Trp Met Thr Arg Pro Asp Leu Ala Pro Gly Tyr             340 345 350 Asp Gly Trp Gln Ala Leu Asp Pro Thr Pro Gln Glu Lys Ser Glu Gly         355 360 365 Val Tyr Cys Cys Gly Pro Ala Pro Val Lys Ala Ile Lys Glu Gly Asp     370 375 380 Leu Gln Val Gln Tyr Asp Ile Pro Phe Val Phe Ala Glu Val Asn Ala 385 390 395 400 Asp Val Val Tyr Trp Ile Val Gln Ser Asp Gly Glu Lys Lys Lys Ser                 405 410 415 Thr His Ser Ser Val Gly Lys Asn Ile Ser Thr Lys Ser Val Gly             420 425 430 Arg Asp Ser Arg Glu Asp Ile Thr His Thr Tyr Lys Tyr Pro Glu Gly         435 440 445 Ser Glu Lys Glu Arg Glu Val Phe Ser Lys Ala Glu His Glu Lys Ser     450 455 460 Ser Leu Gly Glu Glu Glu Glu Gly Leu His Met Arg Ile Lys Leu Ser 465 470 475 480 Glu Gly Ala Asn Asn Gly Ser Asp Phe Asp Val Phe Ala Phe Ile Ser                 485 490 495 Asn Asp Thr Asp Lys Glu Arg Glu Cys Arg Leu Arg Leu Cys Ala Arg             500 505 510 Thr Ala Ser Tyr Asn Gly Glu Val Gly Pro Gln Cys Gly Phe Lys Asp         515 520 525 Leu Leu Asn Leu Ser Leu Gln Pro His Met Glu Gln Ser Val Pro Leu     530 535 540 Arg Ile Leu Tyr Glu Gln Tyr Gly Pro Asn Leu Thr Gln Asp Asn Met 545 550 555 560 Ile Lys Val Val Ala Leu Leu Thr Glu Tyr Glu Thr Gly Asp Ser Val                 565 570 575 Val Ala Ile Arg Asp Val Tyr Ile Gln Asn Pro Glu Ile Lys Ile Arg             580 585 590 Ile Leu Gly Glu Pro Met Gln Glu Arg Lys Leu Val Ala Glu Ile Arg         595 600 605 Leu Val Asn Pro Leu Ala Glu Pro Leu Asn Asn Cys Ile Phe Val Val     610 615 620 Glu Gly Ala Gly Leu Thr Glu Gly Gln Arg Ile Glu Glu Leu Glu Asp 625 630 635 640 Pro Val Glu Pro Gln Ala Glu Ala Lys Phe Arg Met Glu Phe Val Pro                 645 650 655 Arg Gln Ala Gly Leu His Lys Leu Met Val Asp Phe Glu Ser Asp Lys             660 665 670 Leu Thr Gly Val Lys Gly Tyr Arg Asn Val Ile Ile Ala Pro Leu Pro         675 680 685 Lys     <210> 27 <211> 381 <212> PRT <213> CKB <400> 27 Met Pro Phe Ser Asn Ser His Asn Leu Leu Lys Met Lys Tyr Ser Val   1 5 10 15 Asp Asp Glu Tyr Pro Asp Leu Ser Val His Asn Asn His Met Ala Lys              20 25 30 Val Leu Thr Leu Asp Leu Tyr Lys Lys Leu Arg Asp Arg Gln Thr Ser          35 40 45 Ser Gly Phe Thr Leu Asp Asp Val Ile Gln Thr Gly Val Asp Asn Pro      50 55 60 Gly His Pro Phe Ile Met Thr Val Gly Cys Val Ala Gly Asp Glu Glu  65 70 75 80 Ser Tyr Glu Val Phe Lys Glu Leu Phe Asp Pro Val Ile Glu Asp Arg                  85 90 95 His Gly Gly Tyr Lys Pro Thr Asp Glu His Lys Thr Asp Leu Asn Ala             100 105 110 Asp Asn Leu Gln Gly Gly Asp Asp Leu Asp Pro Asn Tyr Val Leu Ser         115 120 125 Ser Arg Val Thr Gly Arg Ser Ser Arg Gly Phe Cys Leu Pro Pro     130 135 140 His Cys Ser Arg Gly Glu Arg Arg Ala Ile Glu Lys Leu Ser Val Glu 145 150 155 160 Ala Leu Gly Ser Leu Gly Gly Asp Leu Lys Gly Lys Tyr Tyr Ala Leu                 165 170 175 Arg Asn Met Thr Asp Ala Glu Gln Gln Gln Leu Ile Asp Asp His Phe             180 185 190 Leu Phe Asp Lys Pro Val Ser Pro Leu Leu Leu Ala Ser Gly Met Ala         195 200 205 Arg Asp Trp Pro Asp Ala Arg Gly Ile Trp His Asn Asp Asn Lys Thr     210 215 220 Phe Leu Val Trp Ile Asn Glu Glu Asp His Leu Arg Val Ile Ser Met 225 230 235 240 Gln Lys Gly Gly Asn Met Lys Glu Val Phe Thr Arg Phe Cys Thr Gly                 245 250 255 Leu Thr Gln Ile Glu Thr Leu Phe Lys Ser Lys Asn Tyr Glu Phe Met             260 265 270 Trp Asn Pro His Leu Gly Tyr Ile Leu Thr Cys Pro Ser Asn Leu Gly         275 280 285 Thr Gly Leu Arg Ala Gly Val His Ile Lys Leu Pro Asn Leu Gly Lys     290 295 300 His Glu Lys Phe Gly Glu Val Leu Lys Arg Leu Arg Leu Gln Lys Arg 305 310 315 320 Gly Thr Gly Gly Val Asp Thr Ala Ala Val Gly Gly Val Phe Asp Val                 325 330 335 Ser Asn Ala Asp Arg Leu Gly Phe Ser Glu Val Glu Leu Val Gln Met             340 345 350 Val Val Asp Gly Val Lys Leu Leu Ile Glu Met Glu Lys Arg Leu Glu         355 360 365 Lys Gly Gln Ser Ile Asp Asp Leu Met Pro Ala Gln Lys     370 375 380 <210> 28 <211> 451 <212> PRT <213> ADSS <400> 28 Met Ala Glu His Gly Ala Pro Ala Pro Ala Ile Pro Asn Gly Gly Cys   1 5 10 15 Ala Ala Arg Leu Pro Gly Asn Lys Val Thr Val Val Leu Gly Ala Gln              20 25 30 Trp Gly Asp Glu Gly Lys Gly Lys Val Val Asp Leu Leu Ala Gln Asp          35 40 45 Ala Asp Ile Val Cys Arg Cys Gln Gly Gly Asn Asn Ala Gly His Thr      50 55 60 Val Val Val Asp Ser Val Glu Tyr Asp Phe His Leu Leu Pro Ser Gly  65 70 75 80 Ile Ile Asn Pro Lys Val Thr Ala Phe Ile Gly Asn Gly Val Val Ile                  85 90 95 His Leu Pro Gly Leu Phe Glu Glu Thr Glu Lys Asn Leu Lys Lys Gly             100 105 110 Lys Gly Leu Glu Gly Trp Glu Lys Arg Leu Val Ile Ser Asp Arg Ala         115 120 125 His Ile Val Phe Asp Phe His Gln Ala Ala Asp Gly Ile Gln Glu Gln     130 135 140 Gln Arg Gln Glu Gln Ala Gly Lys Asn Leu Gly Thr Thr Lys Lys Gly 145 150 155 160 Ile Gly Pro Val Tyr Ser Ser Lys Ala Ala Arg Ser Gly Leu Arg Met                 165 170 175 Cys Asp Leu Val Ser Asp Phe Asp Glu Phe Ser Glu Arg Phe Lys Val             180 185 190 Leu Ala Asn Gln Tyr Lys Ala Ile Tyr Pro Thr Leu Glu Ile Asp Ile         195 200 205 Glu Gly Glu Leu Lys Lys Leu Lys Ala Tyr Met Glu Lys Val Lys Pro     210 215 220 Met Val Lys Asp Gly Val Tyr Phe Met Tyr Glu Ala Leu His Gly Pro 225 230 235 240 Pro Lys Lys Ile Leu Val Glu Gly Ala Asn Ala Ala Leu Leu Asp Ile                 245 250 255 Asp Phe Gly Thr Tyr Pro Phe Val Thr Ser Ser Asn Cys Thr Val Gly             260 265 270 Gly Val Cys Thr Gly Leu Gly Met Pro Pro Gln Asn Val Gly Glu Val         275 280 285 Tyr Gly Val Val Lys Ala Tyr Thr Thr Arg Val Gly Ile Gly Ala Phe     290 295 300 Pro Thr Glu Gln Asp Asn Glu Ile Gly Glu Leu Leu Gln Met Arg Gly 305 310 315 320 Lys Glu Phe Gly Val Thr Thr Gly Arg Lys Arg Arg Cys Gly Trp Leu                 325 330 335 Asp Leu Val Gln Leu Arg Tyr Ala Tyr Met Ile Asn Gly Phe Thr Ala             340 345 350 Leu Ala Leu Thr Lys Leu Asp Ile Leu Asp Val Phe Pro Glu Ile Lys         355 360 365 Val Gly Val Ala Tyr Lys Leu Asp Gly Glu Val Ile Pro His Phe Pro     370 375 380 Ala Asn His Glu Val Leu Ser Lys Val Glu Val Lys Tyr Glu Thr Leu 385 390 395 400 Pro Gly Trp Asp Thr Asp Ile Ser Asn Ala Arg Thr Phe Asp Glu Leu                 405 410 415 Pro Val Asn Ala Gln Asn Tyr Val Arg Phe Ile Glu Met Glu Leu Gly             420 425 430 Val Pro Val Lys Trp Ile Gly Val Gly Lys Ser Arg Glu Ser Met Ile         435 440 445 Gln Leu Phe     450 <210> 29 <211> 1044 <212> PRT <213> PSD3 <400> 29 Met Ser Thr Asp Ala Tyr Pro Lys Ala Glu Ala Pro Val Trp His Asn   1 5 10 15 Asp Ile Ser Ala His Ala Gln Ser Val Ala Lys Ala Lys Tyr Glu Phe              20 25 30 Leu Phe Gly Leu Glu Glu Glu Lys Cys Pro Asp Cys Ser Gly His Gly          35 40 45 Ser Asn Thr Leu Leu Pro His Thr Ile Ile Asn Glu Phe Pro Glu Tyr      50 55 60 Gly Thr Met Glu Ala Ser Arg Asp Ala Leu Arg Thr Ser Ser Ser Ser  65 70 75 80 Gln Ala Glu Pro Val Thr Cys Ser Pro Glu Gly Arg Asp Arg His His                  85 90 95 Ile Pro Gly Arg Pro Pro Pro Gln Ser Val Ala Ser Ala Asp Glu Pro             100 105 110 Arg Ala Gln Val Lys Ala Ala Gln Leu His Thr Ala Glu Glu Gly Leu         115 120 125 Gln Pro Val Gly Asn Leu Pro Glu Ile Met Lys Ile Ser Arg Gln Leu     130 135 140 Glu Ala Thr Lys Val Gln Glu Arg Ala Asn Thr Tyr Leu Asp Ser Glu 145 150 155 160 Thr His Met Glu Lys Lys Ser Val Leu Gly Cys Gln Asn Ala Gln Thr                 165 170 175 Ala Arg Glu Pro Val Ala Ala Gly Gln Glu Lys Pro Ser Asp Met Pro             180 185 190 Leu Pro Ser Glu Arg Thr Ala Glu Glu Lys Met His Leu Ile Ile Glu         195 200 205 Lys Asp Leu Ala Ile Trp Thr Gly Glu Lys Gln Ser Glu Ser Leu     210 215 220 Gln Ala Thr Ser Asn Lys Glu Ala Glu Glu Val His Thr Ala Lys Glu Ala 225 230 235 240 Ser Ser His Arg Pro Ser Val Thr Asn Leu Glu Ala Ala Ser Arg Val                 245 250 255 Glu Gly Trp Ala Gln Ser Glu Glu Phe Ser Ala Tyr Ser Gln Gly Lys             260 265 270 Met Gln Met Gly Pro Glu Arg Arg Leu Ser Lys Glu Ala Ala Val Ser         275 280 285 Lys His Val Glu Phe Gln Gly Val Glu Ile Leu Trp Leu Gln Lys Ala     290 295 300 Glu Asp Gln Ser Arg Lys Lys His Ser Leu Leu Glu Thr Thr Ser Val 305 310 315 320 Glu Arg Lys Thr Phe Pro Lys Thr Ser Ser His Ser Val Pro Leu Met                 325 330 335 Val Ala Pro Ser Leu Val Thr Leu Pro Asp Ile Ala Lys Ser Glu Val             340 345 350 Trp Glu Glu Pro Arg Val Gly Ala Ala His Gly Ala Ala Pro Leu Ala         355 360 365 Leu Leu Asp Glu Ser Gly Glu Asp Glu Val Phe Val Lys Asp Lys Lys     370 375 380 Asn Cys Ser Lys Glu Glu Thr Thr Val Leu Ala Arg Gly His Ala Arg 385 390 395 400 Ile Met Glu Glu Gly Glu Asp Val Leu                 405 410 415 Gly Gln Arg Gln Ser Asp Val Ser Thr Asp Leu Tyr Ser Ser Gln Phe             420 425 430 Glu Asn Ile Leu Asp Asn Ala Ser Leu Tyr Tyr Ser Ala Glu Ser Leu         435 440 445 Glu Thr Leu Tyr Ser Glu Pro Asp Ser Tyr Phe Ser Phe Glu Met Pro     450 455 460 Leu Thr Pro Met Ile Gln Gln Arg Met Lys Glu Gly Ser Gln Phe Leu 465 470 475 480 Glu Arg Thr Ser Gly Gln Met Asp Val Phe Gln Leu Pro Pro Asp Gly                 485 490 495 Glu Val Lys Ser Cys Cys Glu Gly Ile Thr Asn Gly Leu Arg Asn Val             500 505 510 Ser Glu Thr Leu Phe Arg Gly Asp Val Thr Glu Val Pro His Leu Gly         515 520 525 Ser Asn Ala Gly Leu Gln Asn Met Val Leu Asp Ser Ser Ala Ala Met     530 535 540 Gly Ser Asn Lys Leu Gln Glu Lys Asp Ala Ala Gly Ala Leu Gly His 545 550 555 560 Asp Leu Ser Asn Gly Asn Ser Ser Asn Leu Glu Ala Ala Arg His Leu                 565 570 575 Ala Glu Arg Leu Tyr His Leu Asp Arg Phe Lys Arg Ser Asp Val Ala             580 585 590 Lys His Leu Gly Lys Asn Asn Glu Phe Ser Lys Leu Val Ala Glu Glu         595 600 605 Tyr Leu Lys Phe Phe Asp Phe Thr Gly Met Thr Leu Asp Phe Ser Leu     610 615 620 Arg Ser Phe Phe Lys Ala Phe Ser Leu Ile Gly Glu Thr Gln Glu Arg 625 630 635 640 Glu Arg Val Leu Ile His Phe Ser Ser Arg Tyr Tyr Gln Cys Asn Pro                 645 650 655 Asn Thr Ile Ser Ser Lys Asp Gly Val His Cys Leu Thr Cys Ala Leu             660 665 670 Met Leu Leu Asn Thr Asp Leu His Gly His Asn Ile Gly Lys Lys Met         675 680 685 Thr Cys Gln Glu Phe Ile Ala Asn Leu Gln Gly Met Asn Asp Gly Lys     690 695 700 Asp Phe Gln Lys Gly Leu Leu Lys Ala Leu Tyr Asn Ser Ile Lys Asn 705 710 715 720 Glu Lys Leu Glu Trp Ala Val Asp Glu Glu Glu Lys Lys Lys Pro His                 725 730 735 Ser Asp Gly Thr Asp Glu Lys Asp Asn Gly Asn Gln Thr Lys Ala Val             740 745 750 Ser Arg Ile Gly Asn Ser Asn Asn Pro Phe Leu Asp Ile Pro His Asp         755 760 765 Pro Asn Ala Ala Val Tyr Lys Thr Gly Phe Leu Ala Arg Lys Ile His     770 775 780 Ala Asp Met Asp Gly Lys Lys Thr Pro Trp Gly Lys Arg Gly Trp Lys 785 790 795 800 Thr Phe Tyr Ala Val Leu Lys Gly Thr Val Leu Tyr Leu Gln Lys Asp                 805 810 815 Glu Tyr Lys Pro Glu Lys Ala Leu Ser Glu Glu Asp Leu Lys Asn Ala             820 825 830 Val Ser His Ala Leu Ala Ser Lys Ala Thr Asp Tyr Glu Lys         835 840 845 Lys Pro Asn Val Leu Lys Leu Lys Thr Ala Asp Trp Arg Val Leu Leu     850 855 860 Phe Gln Ala Gln Ser Gln Glu Glu Met Gln Thr Trp Ile Asn Lys Ile 865 870 875 880 Asn Cys Val Ala Ala Val Phe Ser Ala Pro Pro Phe Pro Ala Ala Ile                 885 890 895 Gly Ser Gln Lys Lys Phe Ser Arg Pro Leu Leu Pro Ala Thr Thr Thr             900 905 910 Lys Leu Ser Gln Asp Glu Gln Leu Lys Ser His Glu Ala Lys Leu Lys         915 920 925 Gln Ile Ser Thr Glu Leu Ala Glu His Arg Ser Tyr Pro Pro Asp Lys     930 935 940 Lys Leu Lys Gly Lys Glu Val Asp Asp Tyr Arg Leu Arg Asp His Tyr 945 950 955 960 Leu Glu Phe Glu Lys Asn Arg Tyr Glu Ile Tyr Ile Gly Leu Leu Lys                 965 970 975 Glu Gly Val Lys Glu Leu Leu Ser Gly Gly Glu Asn Asp Ala Ser Gly             980 985 990 Leu Lys Lys Ser His Ser Ser Thr Ser Leu Asn Gln Glu Ser Pro Val         995 1000 1005 Ser Ala Lys Val Asn Ser Ser His Gly Leu Leu Ala Arg Met His Val    1010 1015 1020 Ser Arg Asn Leu Trp Trp Ile Gln Pro Pro Glu Gln Val Cys Ala Leu 1025 1030 1035 1040 Ser Leu Gly Lys                 <210> 30 <211> 231 <212> PRT <213> Ig-Lc <400> 30 Met Ala Trp Ala Pro Leu Leu Ala Val Leu Ala His Thr Ser Gly   1 5 10 15 Ser Leu Val Gln Ala Ala Leu Thr Gln Pro Ala Ser Val Ser Ala Asn              20 25 30 Pro Gly Glu Thr Val Lys Ile Thr Cys Ser Gly Ser Ser Gly Ser Trp          35 40 45 Tyr Gly Trp Phe Gln Gln Lys Ser Pro Gly Ser Ala Pro Val Thr Val      50 55 60 Ile Tyr Ser Asn Asp Lys Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser  65 70 75 80 Gly Ser Lys Ser Gly Ser Thr Gly Thr Leu Thr Ile Ile Gly Val Gln                  85 90 95 Ala Glu Asp Glu Ala Val Tyr Phe Cys Gly Gly Tyr Asp Ser Asp Thr             100 105 110 Gly Asn Arg Asp Ile Phe Gly Ala Gly Thr Ile Leu Thr Val Leu Gly         115 120 125 Gln Pro Lys Val Ala Pro Thr Ile Thr Leu Phe Pro Pro Ser Lys Glu     130 135 140 Glu Leu Asn Glu Ala Thr Lys Ala Thr Leu Val Cys Leu Ile Asn Asp 145 150 155 160 Phe Tyr Pro Ser Pro Val Thr Val Asp Trp Val Ile Asp Gly Ser Thr                 165 170 175 Arg Ser Gly Glu Thr Thr Ala Pro Gln Arg Gln Ser Asn Ser Gln Tyr             180 185 190 Met Ala Ser Ser Tyr Leu Ser Leu Ser Ala Ser Asp Trp Ser Ser His         195 200 205 Glu Thr Tyr Thr Cys Arg Val Thr His Asp Gly Thr Ser Ile Thr Lys     210 215 220 Thr Leu Lys Arg Ser Glu Cys 225 230 <210> 31 <211> 470 <212> PRT <213> PIT54 <400> 31 Met Arg Phe Ile Leu Leu Pro Cys Leu Trp Ala Ser Leu Ala Gly Val   1 5 10 15 Leu Leu Ala Glu Asp Val Asp Thr Ser Thr Ala Glu Val Arg Leu Val              20 25 30 Asp Gly Pro Asn Arg Cys Ser Gly Arg Val Glu Val Leu His Asn Asp          35 40 45 Val Trp Gly Thr Val Cys Asp Glu Gly Trp Asp Leu Arg Glu Ala Arg      50 55 60 Val Val Cys Arg Gln Leu Gly Cys Gly Thr Ala Leu Ser Ser Pro Lys  65 70 75 80 Lys Ser Lys Tyr Gly Glu Gly Lys Gly Gln Ile Trp Leu Ser Asp Leu                  85 90 95 Asp Cys Lys Gly Thr Glu Gly Ser Leu Ser Asn Cys Lys Ser Lys Pro             100 105 110 Trp Gly Glu Asn Ile Cys Asn His Val Glu Asp Ala Ser Val Glu Cys         115 120 125 Ser Gly Thr Glu Ile Pro Glu Pro Gly Pro Leu Arg Leu Val Gly Gly     130 135 140 Pro Asn Arg Cys Ala Gly Arg Val Glu Val Leu His Glu Glu Gln Trp 145 150 155 160 Gly Ser Val Cys His Asp Glu Trp Asp Ile Asn Asp Ala Gln Val Val                 165 170 175 Cys Lys Gln Leu Gly Cys Gly Asp Ala Val Leu Ala Pro Ile Ala Ala             180 185 190 Lys Phe Gly Arg Gly Thr Asp Thr Ile Trp Leu Asp Asp Val Asn Cys         195 200 205 Thr Gly Ser Glu Ala Ser Leu Ser Glu Cys Gln Ala Arg Pro Trp Gly     210 215 220 Asp His Asn Cys Tyr His Gly Glu Asp Ala Ser Ala Ile Cys Ser Asp 225 230 235 240 Ser Gly Ile Ser Ile Ser Thr Ser Val Arg Leu Val Gly Gly Pro Asn                 245 250 255 Arg Cys Ser Gly Arg Val Glu Val Leu His Asn Asn Val Trp Gly Thr             260 265 270 Val Cys Asp Asp Asn Trp Asp Leu Arg Glu Ala Lys Val Val Cys Lys         275 280 285 Gln Leu Gly Cys Gly Thr Ala Leu Ser Ala Leu Pro Glu Ser Lys Tyr     290 295 300 Gly Glu Gly Lys Gly Gln Ile Trp Leu Ser Asp Leu Asn Cys Thr Gly 305 310 315 320 Thr Glu Gly Ser Leu Thr Glu Cys Glu Ala Lys Pro Trp Gly Glu Asn                 325 330 335 Val Cys Asn His Val Glu Asp Ala Ser Val Glu Cys Ser Glu Thr Asp             340 345 350 Ile Ser Glu Ile Gly Pro Val Arg Leu Val Asp Gly Pro Asn Gln Cys         355 360 365 Ala Gly Arg Val Glu Val Phe His Glu Asn Arg Trp Gly Ser Val Cys     370 375 380 Asp Asp Asn Trp Asp Met Lys Asp Ala Lys Val Val Cys Lys Gln Val 385 390 395 400 Gly Cys Gly Ser Pro Leu Ser Ala Leu Gly Ser Ala Arg Tyr Gly Arg                 405 410 415 Gly Pro Asp Val Ile Trp Leu Asp Asp Val Asn Cys Glu Gly Thr Glu             420 425 430 Glu Ser Ile Phe Asp Cys Lys Ala Arg Pro Trp Gly Glu His Asn Cys         435 440 445 Tyr His Gly Glu Asp Ala Ser Val Phe Cys Thr Val Asn Lys Asn Leu     450 455 460 Glu Glu Thr Glu Thr Ser 465 470 <210> 32 <211> 1290 <212> PRT <213> SORBS1 <400> 32 Met Ala Pro Leu Thr Glu Lys Ser Glu Leu Arg Asp Lys Gln Asn Pro   1 5 10 15 Glu Val Lys Arg Ala Ile Pro Ser Thr Thr Met Ser Ser Glu Arg Glu              20 25 30 Glu Val Asp Val Ala Lys Thr Val Val Asn Gly Leu Ser Ser Asn Gly          35 40 45 Gln Glu Lys Ala Val Asp Val Pro Leu Tyr Thr Arg Ser Ser Ser Ala      50 55 60 Val Thr Ile Pro Val Lys Lys Val Lys Thr Ser Pro His Leu Val  65 70 75 80 Leu Pro Thr Glu Thr Asp Pro Thr Lys Val Cys Ser Gly Lys Gly Ala                  85 90 95 Val Thr Leu Trp Ala Ser Pro Ala Ser Glu Glu Asn Gln Lys Ile Ser             100 105 110 Ser Pro Cys Pro Gln Asp Ala Glu Lys Pro Glu Asn Asp Trp Arg Ser         115 120 125 Ser Pro Asn Thr Asp Ala Asn Gly Asp Ala Gln Pro Ser Ser Leu Ala     130 135 140 Ala Lys Gly Tyr Arg Ser Val Arg Pro Asn Leu Ser Ser Asp Ser Lys 145 150 155 160 Pro Gln Asp Ala Thr Ala Thr Thr Gln Pro Gly Val Ile Val Val                 165 170 175 Pro Leu Val Gln Ile Asn Pro Asp Arg Gln Gln Glu Gly Ser Ser Ser             180 185 190 Thr Pro Pro Pro Leu Val Pro Phe Gly Gln Gly Ser Val Phe Pro         195 200 205 Glu Thr Val Pro Pro Gly Thr Pro Leu Thr Phe Pro Thr Leu Asp Asp     210 215 220 Phe Ile Pro Pro His Leu Gln Arg Gly Ser His His His Gln Ala Pro 225 230 235 240 Ser Ala Ser Gly Thr Ser Pro Ser Val Tyr Pro Lys Leu Pro Phe Phe                 245 250 255 Ser Thr Pro Pro Ser Leu Val Pro Pro Thr Gly Ala Leu His Arg             260 265 270 Gly Leu Lys Pro Glu Ile Thr Gly Val Ile Ser Arg Thr Asp Pro Gly         275 280 285 Pro Ala Leu Asn Glu Val Thr Gln Pro Ser Ser Gly Thr Asp Tyr Pro     290 295 300 Ser Ser Phe Thr Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser 305 310 315 320 Thr Ile Val Asn Pro Thr Ile Val Leu Leu Gln His Asn Arg Glu Gln                 325 330 335 Gln Lys Arg Leu Ser Ser Leu Ala Asp Ser Val Pro Asp Arg Leu Val             340 345 350 Ser Asp Lys Val Asp Leu Ala Leu Thr Gln Val Lys Pro Leu Gln Glu         355 360 365 Pro Val Leu Ser Glu Arg Arg Val Leu Glu Glu Lys Arg Arg Ile Val     370 375 380 Lys Ser Pro Gln His Met Ala Asp Thr Ser Val Asp Asp Ile Gly Ile 385 390 395 400 Pro Leu Arg Asn Thr Asp Arg Ser Lys Asp Trp Tyr Lys Thr Met Phe                 405 410 415 Lys Gln Ile His Lys Leu Asn Arg Asp Thr Pro Glu Glu Asn Pro Tyr             420 425 430 Cys Pro Thr Tyr Ile Phe Pro Glu Leu Pro Glu Ile Gln Gln Lys Pro         435 440 445 Glu Asp Asn Pro Tyr Ser Pro Thr Tyr Gln Phe Pro Ala Ser Thr     450 455 460 Pro Ser Pro Ile Ser Glu Asp Glu Asp Ser Asp Ser Tyr Ser Pro Arg 465 470 475 480 Tyr Ser Tyr Cys Glu Asp Thr Arg Ser Gln Pro Ser Val Pro Arg Ser                 485 490 495 Lys Ser Glu Met Asp His Ile Asp Ser Glu Lys Val Phe Lys Arg Ser             500 505 510 Ala Thr Leu Pro Leu Pro Asn Arg Thr Ser Ser Leu Lys Ser Ser Pro         515 520 525 Glu Arg Thr Asp Trp Glu Pro Pro Asp Lys Lys Val Asp Thr Arg Lys     530 535 540 Tyr Arg Ala Glu Pro Arg Ser Ile Tyr Asp Tyr Gln Pro Gly Lys Ser 545 550 555 560 Ser Val Leu Asn Ser Glu Lys Met Thr Arg Asp Ile Ser Pro Glu Glu                 565 570 575 Ile Asp Leu Lys Asn Glu Pro Trp Tyr Lys Phe Phe Ser Glu Leu Glu             580 585 590 Phe Gly Lys Pro Pro Pro Lys Lys Ile Trp Asp Tyr Thr Pro Gly Asp         595 600 605 Cys Ser Ile Leu Thr Arg Glu Asp Arg Lys Thr Asp Leu Glu Lys Asp     610 615 620 Leu Tyr Leu Tyr Gln Thr Glu Leu Glu Ala Asp Leu Glu Lys Met Glu 625 630 635 640 Lys Leu Tyr Lys Ala Pro His Lys Lys Pro Gln Lys Leu Pro Leu Thr                 645 650 655 Pro Thr Pro Arg Val Ser Met Thr Pro Phe Ser Thr Tyr Ser Pro Asn             660 665 670 Tyr His Ala Ala Lys Arg Asp Ser Glu Pro Ala Leu Gly Asp Leu Ala         675 680 685 Gly Leu Glu Asn Glu Arg Gln Ile Tyr Lys Ser Val Leu Glu Gly Gly     690 695 700 Asp Ile Pro Phe Gln Gly Leu Ser Gly Leu Lys Arg Pro Ser Ser Ser 705 710 715 720 Ala Ser Thr Lys Asp Ser Glu Ser Pro Arg His Phe Ala Pro Val Asp                 725 730 735 Tyr Met Glu Thr Pro Glu Glu Ile Ile Arg Arg Arg Tyr Asp Asp Lys             740 745 750 Glu Lys Leu Leu Glu Asp Gln Arg Arg Leu Lys Arg Glu Gln Glu Glu         755 760 765 Ala Asp Ile Ala Ala Arg Arg His Thr Gly Val Ile Pro Thr His His     770 775 780 Gln Phe Ile Thr Asn Glu Arg Phe Gly Asp Leu Leu Asn Val Asp Asp 785 790 795 800 Thr Ala Lys Arg Lys Ser Gly Ser Glu Met Arg Pro Ala Arg Ala Lys                 805 810 815 Phe Asp Phe Lys Ala Gln Thr Leu Lys Glu Leu Pro Leu Gln Lys Gly             820 825 830 Asp Ile Val Tyr Ile Tyr Lys Gln Ile Asp Gln Asn Trp Tyr Glu Gly         835 840 845 Glu His His Gly Arg Val Gly Ile Phe Pro Arg Ser Tyr Ile Glu Leu     850 855 860 Leu Pro Pro Ala Glu Lys Ala Gln Pro Lys Lys Pro Leu Pro Leu Gln 865 870 875 880 Val Leu Glu Tyr Gly Asp Ala Ile Ala Lys Phe Asn Phe Asn Gly Asp                 885 890 895 Thr Gln Val Glu Met Ser Phe Arg Lys Gly Glu Arg Ile Thr Leu Ile             900 905 910 Arg Arg Val Asp Glu Asn Trp Tyr Glu Gly Arg Ile Ser Gly Thr Ser         915 920 925 Arg Gln Gly Ile Phe Pro Val Thr Tyr Val Glu Val Leu Lys Arg Pro     930 935 940 Val Val Lys Asn Ala Ile Asp Tyr Pro Asp Pro Val Val Ser Leu Ser 945 950 955 960 Pro Asn Arg Ser Met Thr Ala Ser Pro Gln Ser Pro Ser Ser Glu Leu                 965 970 975 Leu His Thr Pro Thr Pro Pro Pro Leu Pro Phe Ser Arg Arg Ala Leu             980 985 990 Ser Pro Glu Val Gln Ala Val Thr Ser Glu Trp Ile Ala Leu Thr Val         995 1000 1005 Gly Val Ser Ser Thr Thr Pro Ala Leu Thr Ala Pro Leu Pro Ser    1010 1015 1020 Leu Pro Glu Ala Ser Leu Ser His Thr Asp Ser Leu Ser Pro Pro Thr 1025 1030 1035 1040 Val Ala Ser Pro Ser Pro Ser Phe Ser Leu Pro His Ser His Leu Ser                1045 1050 1055 Gly Ser Ser Thr Pro Arg Ser Ile Lys Ser Pro Leu Pro Ser Tyr Ser            1060 1065 1070 Ser Gly Pro Gln Pro Ser Thr His Ser Phe Tyr Gln Ala Ala Pro Gln        1075 1080 1085 Ser Lys Glu Lys Val Gly Gly Ser Ser Ser Pro Cys Pro Arg Trp Ala    1090 1095 1100 Gly Arg Ser Pro Glu Ser Thr Leu Thr Glu Gln His Gly Thr Pro Gly 1105 1110 1115 1120 Ser Gln Ala Trp Leu Gln Lys Thr Arg Glu Gly Ser Ser Asn Ser Glu                1125 1130 1135 Gln Gly Ser His Ala Ala Pro Asn Val Ser Val Glu Arg Cys Leu Lys            1140 1145 1150 Pro Ser Gln Leu Asp Met Arg Ala Ser Pro Glu Arg Arg Pro Val Ser        1155 1160 1165 Ser Ser Glu Asp Asn Gln Leu Cys Gln Glu Leu Met Ala Ile Val Gln    1170 1175 1180 Gly Gly Lys Ala Glu Lys Arg Gly Thr Arg Arg Gly Thr Glu Trp Cys 1185 1190 1195 1200 Leu Cys Ser Met Ala Gly Ser Gly Gly Ser Thr Gln Pro Gln Ala Gln                1205 1210 1215 Gln Gln Gly Ala Ser Pro Asp Arg Ser Gln Thr Pro Arg Asp Ile Val            1220 1225 1230 Ser Tyr Gln Ala Leu Tyr Ser Tyr Thr Pro Gln Asn Asp Asp Glu Leu        1235 1240 1245 Glu Leu Arg Asp Gly Asp Ile Val Asp Val Met Glu Lys Cys Asp Asp    1250 1255 1260 Gly Trp Phe Val Gly Thr Ser Arg Arg Thr Arg Gln Phe Gly Thr Phe 1265 1270 1275 1280 Pro Gly Asn Tyr Val Lys Leu Leu Tyr Leu                1285 1290 <210> 33 <211> 210 <212> PRT <213> OVM <400> 33 Met Ala Met Ala Gly Val Phe Val Leu Phe Ser Phe Val Leu Cys Gly   1 5 10 15 Phe Leu Pro Asp Ala Val Phe Gly Ala Glu Val Asp Cys Ser Arg Phe              20 25 30 Pro Asn Ala Thr Asp Met Glu Gly Lys Asp Val Leu Val Cys Asn Lys          35 40 45 Asp Leu Arg Pro Ile Cys Gly Thr Asp Gly Val Thr Tyr Thr Asn Asp      50 55 60 Cys Leu Leu Cys Ala Tyr Ser Val Glu Phe Gly Thr Asn Ile Ser Lys  65 70 75 80 Glu His Asp Gly Glu Cys Lys Glu Thr Val Pro Met Asn Cys Ser Ser                  85 90 95 Tyr Ala Asn Thr Thr Ser Glu Asp Gly Lys Val Met Val Leu Cys Asn             100 105 110 Arg Ala Phe Asn Pro Val Cys Gly Thr Asp Gly Val Thr Tyr Asp Asn         115 120 125 Glu Cys Leu Leu Cys Ala His Lys Val Glu Gln Gly Ala Ser Val Asp     130 135 140 Lys Arg His Asp Gly Gly Cys Arg Lys Glu Leu Ala Ala Val Ser Val 145 150 155 160 Asp Cys Ser Glu Tyr Pro Lys Pro Asp Cys Thr Ala Glu Asp Arg Pro                 165 170 175 Leu Cys Gly Ser Asp Asn Lys Thr Tyr Gly Asn Lys Cys Asn Phe Cys             180 185 190 Asn Ala Val Val Glu Ser Asn Gly Thr Leu Thr Leu Ser His Phe Gly         195 200 205 Lys Cys     210 <210> 34 <211> 533 <212> PRT <213> ATP5B <400> 34 Met Leu Gly Leu Ala Gly Arg Cys Ser Ala Ala Ala Ala Ser Ala Ala   1 5 10 15 Arg Pro Ala Leu Arg Arg Ala Ala Gly Pro Ser Ser Gly Phe Leu Pro              20 25 30 Leu Leu Leu Ser Arg Gly Ala Gly Ala Ala Ala Val Gly Ala Arg          35 40 45 Arg Asp His Ala Ala Gln Ala Ala Pro Ala Ala Lys Ala Gly Ser Ala      50 55 60 Thr Gly Arg Ile Val Ala Val Ile Gly Ala Val Val Asp Val Gln Phe  65 70 75 80 Asp Glu Leu Pro Ile Leu Asn Ala Leu Glu Val Gln Gly Arg                  85 90 95 Glu Thr Arg Leu Val Leu Glu Val Ala Gln His Leu Gly Glu Asn Thr             100 105 110 Val Arg Thr Ile Ala Met Asp Gly Thr Glu Gly Leu Val Arg Gly Gln         115 120 125 Lys Val Leu Asp Ser Gly Ala Pro Ile Arg Ile Pro Val Gly Pro Glu     130 135 140 Thr Leu Gly Arg Ile Met Asn Val Ile Gly Glu Pro Ile Asp Glu Arg 145 150 155 160 Gly Pro Ile Thr Thr Lys Gln Phe Ala Ala Ile His Ala Glu Ala Pro                 165 170 175 Glu Phe Val Glu Met Ser Val Glu Gln Lys Ile Leu Val Thr Gly Ile             180 185 190 Lys Val Val Asp Leu Leu Ala Pro Tyr Ala Lys Gly Gly Lys Ile Gly         195 200 205 Leu Phe Gly Aly Gly Aly Gly Val Gly Lys Thr Val Leu Ile Met Glu Leu     210 215 220 Ile Asn As Val Ala Lys Ala His Gly Gly Tyr Ser Val Phe Ala Gly 225 230 235 240 Val Gly Glu Arg Thr Arg Glu Gly Asn Asp Leu Tyr His Glu Met Ile                 245 250 255 Glu Ser Gly Val Ile Asn Leu Lys Asp Ala Thr Ser Lys Val Ala Leu             260 265 270 Val Tyr Gly Gln Met Asn Glu Pro Pro Gly Ala Arg Ala Arg Val Ala         275 280 285 Leu Thr Gly Leu Thr Val Ala Glu Tyr Phe Arg Asp Gln Glu Gly Gln     290 295 300 Asp Val Leu Leu Phe Ile Asp Asn Ile Phe Arg Phe Thr Gln Ala Gly 305 310 315 320 Ser Glu Val Ser Ala Leu Leu Gly Arg Ile Pro Ser Ala Val Gly Tyr                 325 330 335 Gln Pro Thr Leu Ala Thr Asp Met Gly Thr Met Gln Glu Arg Ile Thr             340 345 350 Thr Thr Arg Lys Gly Ser Ile Thr Ser Val Gln Ala Ile Tyr Val Pro         355 360 365 Ala Asp Asp Leu Thr Asp Pro Ala Pro Ala Thr Thr Phe Ala His Leu     370 375 380 Asp Ala Thr Thr Val Leu Ser Arg Ala Ile Ala Glu Leu Gly Ile Tyr 385 390 395 400 Pro Ala Val Asp Pro Leu Asp Ser Thr Ser Arg Ile Met Asp Pro Asn                 405 410 415 Ile Val Gly Pro Glu His Tyr Asp Val Ala Arg Gly Val Gln Lys Ile             420 425 430 Leu Gln Asp Tyr Lys Ser Leu Gln Asp Ile Ala Ile Leu Gly Met         435 440 445 Asp Glu Leu Ser Glu Glu Asp Lys Leu Thr Val Ala Arg Ala Arg Lys     450 455 460 Ile Gln Arg Phe Leu Ser Gln Pro Phe Gln Val Ala Glu Val Phe Thr 465 470 475 480 Gly His Met Gly Lys Leu Val Pro Leu Lys Glu Thr Ile Lys Gly Phe                 485 490 495 Lys Gln Ile Leu Ala Gly Glu Tyr Asp His Leu Pro Glu Gln Ala Phe             500 505 510 Tyr Met Val Gly Pro Ile Glu Glu Ala Val Ala Lys Ala Glu Lys Leu         515 520 525 Ala Glu Glu His Ala     530 <210> 35 <211> 957 <212> PRT <213> SNX13 <400> 35 Met Leu Ala Glu Thr Ser Leu Ser Ile Trp Gly Trp Gly Ser Leu Gly   1 5 10 15 Val Val Leu Phe Leu Ile Thr Phe Gly Pro Phe Ala Ile Phe Tyr Phe              20 25 30 Ala Phe Tyr Ile Leu Cys Phe Val Gly Gly Gly Phe Val Val Thr Leu          35 40 45 Leu Phe Gly Lys Asn Asn Ser Glu Lys Tyr Leu Glu Gln Cys Glu His      50 55 60 Ser Phe Leu Pro Cys Thr Ser Val Gly Ile Pro Lys Cys Ile Glu Glu  65 70 75 80 Met Lys Arg Glu Ala Arg Pro Ile Lys Ile Asp Arg Arg Leu Thr Gly                  85 90 95 Ala Asn Ile Asp Asp Glu Pro Leu Gln Gln Val Ile Gln Phe Ser Leu             100 105 110 Arg Asp Tyr Val Gln Tyr Trp Tyr Tyr Thr Leu Ser Asp Asp Glu Ser         115 120 125 Phe Leu Leu Glu Ile Arg Gln Ala Leu Gln Tyr Ala Leu Val Gln Phe     130 135 140 Ser Ala Arg Ser Lys Glu Thr Asp Trp Gln Pro Tyr Phe Thr Thr Arg 145 150 155 160 Leu Val Asp Asp Phe Gly Thr His Leu Arg Val Phe Arg Lys Ala Gln                 165 170 175 Gln Arg Ile Ala Glu Lys Gly Asp Gln Met Lys Asp Gln Ala Glu Glu             180 185 190 Leu Val Asp Thr Phe Phe Glu Val Glu Val Glu Met Glu Lys Glu Val         195 200 205 Cys Arg Asp Leu Val Cys Thr Ser Pro Lys Asp Glu Glu Gly Phe Leu     210 215 220 Arg Asp Leu Cys Glu Val Leu Leu Tyr Ile Leu Leu Pro Pro Gly Asp 225 230 235 240 Phe Gln Asn Lys Ile Met Arg Tyr Phe Val Arg Glu Ile Leu Ser Arg                 245 250 255 Gly Ile Leu Leu Pro Leu Ile Asn Gln Leu Ser Asp Pro Asp Tyr Ile             260 265 270 Asn Gln Tyr Val Ile Trp Met Ile Arg Asp Ser Asn Cys Asn Tyr Glu         275 280 285 Ala Phe Met Asn Ile Ile Lys Leu Ser Asp Asn Ile Gly Glu Leu Glu     290 295 300 Ala Val Lys Asp Lys Ala Ser Glu Glu Leu Gln Tyr Leu Arg Ser Leu 305 310 315 320 Asp Thr Ala Gly Asp Asp Ile Asn Thr Ile Lys Asn Gln Ile Asn Ser                 325 330 335 Leu Leu Tyr Val Ile Lys Val Cys Asp Ser Arg Ile Gln Arg Leu Gln             340 345 350 Ser Gly Lys Glu Ile Asp Thr Val Lys Leu Ala Ala Asn Phe Gly Lys         355 360 365 Leu Cys Thr Val Pro Leu Asp His Ile Leu Val Asp Asn Val Ala Leu     370 375 380 Gln Phe Phe Met Asp Tyr Met Gln Gln Thr Gly Gly Gln Ala His Leu 385 390 395 400 Phe Phe Trp Met Thr Val Glu Gly Tyr Arg Val Thr Ala Gln Gln Gln                 405 410 415 Leu Glu Val Leu Gln Ser Arg Gln Arg Asp Gly Lys His Gln Thr Asn             420 425 430 Gln Thr Lys Gly Leu Leu Arg Ala Ala Ala Val Gly Val Tyr Glu Gln         435 440 445 Tyr Leu Ser Glu Lys Ala Ser Pro Arg Val Asn Ile Asp Asp Asn Leu     450 455 460 Val Ala Lys Leu Ala Glu Thr Leu Asn His Glu Asp Pro Thr Pro Glu 465 470 475 480 Ile Phe Asp Asp Ile Gln Arg Lys Val Tyr Glu Leu Met Leu Arg Asp                 485 490 495 Glu Arg Phe Tyr Pro Ser Phe Lys Gln Asn Val Leu Tyr Val Arg Met             500 505 510 Leu Ala Glu Leu Asp Met Leu Lys Asp Pro Ser Phe Arg Gly Ser Asp         515 520 525 Asp Gly Glu Gly Glu Ser Phe Asn Gly Ser Pro Thr Ser Ser Ile Asn     530 535 540 Leu Ser Leu Asp Asp Leu Ser Asn Val Ser Ser Asp Glu Thr Val Gln 545 550 555 560 Leu His Ala Tyr Ile Ser Asp Thr Gly Val Cys Asn Asp His Gly Lys                 565 570 575 Thr Tyr Ala Leu Tyr Ala Ile Thr Val His Arg Arg Asn Ala Asn Ser             580 585 590 Glu Glu Thr Trp Lys Thr Tyr Arg Arg Tyr Ser Asp Phe His Asp Phe         595 600 605 His Met Arg Ile Thr Glu Gln Phe Glu Asn Leu Ala Asn Ile Leu Lys     610 615 620 Leu Pro Gly Lys Lys Thr Phe Asn Met Asp Arg Glu Phe Leu Glu 625 630 635 640 Lys Arg Lys Lys Asp Leu Asn Ala Tyr Leu Gln Leu Leu Leu Asn Pro                 645 650 655 Glu Met Met Lys Ala Ser Pro Ala Leu Ala His Tyr Val Tyr Asp Phe             660 665 670 Leu Glu Asn Lys Ala Tyr Ser Lys Gly Lys Gly Asp Phe Ala Arg Lys         675 680 685 Met Asp Thr Phe Val Asn Pro Leu Arg Asn Ser Met Arg Asn Val Ser     690 695 700 Asn Ala Val Lys Ser Leu Pro Asp Ser Leu Ala Glu Gly Met Thr Lys 705 710 715 720 Met Ser Asp Asn Met Gly Lys Met Ser Glu Arg Leu Gly Gln Asp Ile                 725 730 735 Lys Gln Ser Phe Phe Lys Val Pro Pro Leu Ile Gln Lys Thr Tyr Ser             740 745 750 Asp Pro Asp His Cys Arg Val Ala Ala Thr Ile Asp Asp Ser Val Asp         755 760 765 Asp Asn Ile Pro Leu Arg Val Met Leu Leu Leu Met Asp Glu Val Phe     770 775 780 Asp Leu Lys Glu Arg Asn Gln Trp Leu Arg Arg Asn Ile Lys Asn Leu 785 790 795 800 Leu Gln Gln Leu Ile Arg Ala Thr Tyr Gly Asp Thr Ile Asn Arg Lys                 805 810 815 Ile Val Asp His Val Asp Trp Met Thr Ser Pro Glu Gln Val Ala Asp             820 825 830 Ala Val Lys Arg Phe Arg Asp Ala Phe Trp Pro Asn Gly Ile Leu Ala         835 840 845 Glu Thr Val Arg Arg Asp Lys Ala Ile Arg Met Arg Thr Arg Val     850 855 860 Ala Gly Lys Thr Lys Leu Leu Glu Ile Met Pro Asp Glu Leu Lys His 865 870 875 880 Ile Ile Gly Ala Glu Thr Thr Arg Lys Gly Ile Leu Arg Val Phe Glu                 885 890 895 Met Phe Gln His Thr Gln Leu Asn Lys Arg Met Val Tyr Val Phe Leu             900 905 910 Glu Arg Phe Leu Glu Thr Leu Phe Pro Gln Asn Lys Phe His Glu Leu         915 920 925 Phe Asn Lys Leu His Ser Arg Ser Lys Gln Met Gln Arg Tyr Lys Gln     930 935 940 Arg Leu His Ser Thr Gln Ala Pro Ser Leu Gln Lys Arg 945 950 955 <210> 36 <211> 308 <212> PRT <213> COPE <400> 36 Met Ala Ser Gly Ala Gly Ala Gly Ala Gly Gly Gly Gly Gly Aly   1 5 10 15 Asp Glu Leu Phe Asp Val Lys Asn Ser Phe Tyr Ile Gly Ala Tyr Gln              20 25 30 Ala Ala Ile Asn Glu Ala Gln Arg Ile Lys Pro Ser Asn Pro Glu Lys          35 40 45 Glu Thr Glu Arg Asp Val Phe Leu Phe Arg Ser Tyr Ile Ala Gln Arg      50 55 60 Lys Tyr Gly Val Val Leu Asp Glu Ile Lys Ala Asn Ala Ser Pro Glu  65 70 75 80 Leu Gln Ala Val Arg Phe Ala Glu Tyr Leu Ser Asn Glu Ser Gln                  85 90 95 Arg Asp Ala Ile Val Ala Asp Leu Asp Lys Lys Met Ala Lys Ser Val             100 105 110 Asp Val Ala Asn Thr Thr Phe Leu Leu Met Ala Ala Ser Ile Tyr Phe         115 120 125 His Asp Lys Asn Pro Asp Ala Ala Leu Arg Thr Leu His Gln Gly Glu     130 135 140 Ser Leu Glu Cys Met Ala Met Met Ile Gln Ile Leu Leu Lys Leu Asp 145 150 155 160 Arg Leu Asp Leu Ala Arg Lys Glu Leu Lys Lys Met Gln Glu Gln Asp                 165 170 175 Glu Asp Ala Thr Leu Thr Gln Leu Ala Thr Ala Trp Val Asn Leu Ala             180 185 190 Ile Gly Gly Glu Lys Leu Gln Asp Ala Tyr Tyr Ile Phe Gln Glu Met         195 200 205 Ala Asp Lys Cys Ser Ser Thr Leu Leu Leu Leu Asn Gly Gln Ala Ala     210 215 220 Cys Tyr Met Ala Gln Gly Lys Trp Asp Asp Ala Glu Gly Val Leu Gln 225 230 235 240 Glu Ala Leu Asp Lys Asp Ser Gly His Pro Glu Thr Leu Ile Asn Phe                 245 250 255 Val Val Leu Ser Gln His Leu Gly Lys Pro Pro Glu Val Thr Asn Arg             260 265 270 Tyr Leu Ser Gln Leu Lys Asp Ala His Lys Asn His Pro Phe Ile Lys         275 280 285 Glu Tyr Gln Ala Lys Glu Asn Asp Phe Asp Arg Leu Ala Met Gln Tyr     290 295 300 Ala Pro Ser Ala 305 <210> 37 <211> 448 <212> PRT <213> GDI2 <400> 37 Met Asn Glu Glu Tyr Asp Val Ile Val Leu Gly Thr Gly Leu Thr Glu   1 5 10 15 Cys Ile Leu Ser Gly Ile Met Ser Val Asn Gly Lys Lys Val Leu His              20 25 30 Met Asp Arg Asn Ser Tyr Tyr Gly Gly Glu Ser Ala Ser Ile Thr Pro          35 40 45 Leu Glu Asp Leu Tyr Lys Arg Phe Asn Leu Pro Gly Thr Pro Pro Glu      50 55 60 Ser Met Gly Arg Gly Arg Asp Trp Asn Val Asp Leu Ile Pro Pro Phe  65 70 75 80 Leu Met Ala Asn Gly Gln Leu Val Lys Met Leu Leu Tyr Thr Glu Val                  85 90 95 Thr Arg Tyr Leu Asp Phe Lys Val Ile Glu Gly Ser Phe Val Tyr Lys             100 105 110 Gly Gly Lys Ile Tyr Lys Val Pro Ser Thr Glu Ala Glu Ala Leu Ala         115 120 125 Ser Ser Leu Met Gly Leu Phe Glu Lys Arg Arg Phe Arg Lys Phe Leu     130 135 140 Val Tyr Val Ala Asn Phe Asp Glu Asn Asp Pro Arg Thr Phe Glu Gly 145 150 155 160 Val Asp Pro Lys Lys Thr Thr Met Arg Asp Val Tyr Lys Lys Phe Asp                 165 170 175 Leu Gly Gln Asp Val Ile Asp Phe Thr Gly His Ala Leu Ala Leu Tyr             180 185 190 Arg Thr Asp Asp Tyr Leu Asp Gln Pro Cys Gln Glu Thr Ile Asn Arg         195 200 205 Ile Lys Leu Tyr Ser Glu Ser Leu Ala Arg Tyr Gly Lys Ser Pro Tyr     210 215 220 Leu Tyr Pro Leu Tyr Gly Leu Gly Glu Leu Pro Gln Gly Phe Ala Arg 225 230 235 240 Leu Ser Ala Ile Tyr Gly Gly Thr Tyr Met Leu Asn Lys Pro Ile Glu                 245 250 255 Glu Ile Val Ile Glu Asn Gly Lys Val Val Gly Val Lys Ser Glu Gly             260 265 270 Glu Val Ala Arg Cys Lys Gln Leu Ile Cys Asp Pro Ser Tyr Val Ser         275 280 285 Asp Arg Val Thr Lys Val Gly Gln Val Ile Arg Val Ile Cys Ile Leu     290 295 300 Ser His Pro Ile Lys Asn Thr Asn Asp Ala Asn Ser Cys Gln Ile Ile 305 310 315 320 Ile Pro Gln Asn Gln Val Asn Arg Lys Ser Asp Ile Tyr Val Cys Met                 325 330 335 Ile Ser Ser Ala His Asn Ala Ile Ale Gln Gly Lys Tyr Ile Ala Ile             340 345 350 Ala Ser Thr Thr Val Glu Thr Ala Asp Pro Glu Lys Glu Ile Lys Pro         355 360 365 Ala Leu Asp Leu Leu Glu Pro Ile Glu Gln Lys Phe Val Ser Ile Ser     370 375 380 Asp Leu Phe Ala Pro Thr Asp Leu Gly Thr Glu Ser Gln Ile Phe Ile 385 390 395 400 Ser Arg Thr Tyr Asp Ala Thr Thr His Phe Glu Thr Thr Cys Asp Asp                 405 410 415 Ile Lys Asp Ile Tyr Lys Arg Met Met Gly Ser Glu Phe Asp Phe Glu             420 425 430 Glu Met Lys Arg Lys Lys Asn Asp Ile Tyr Gly Glu Glu Glu Gln Gln         435 440 445 <210> 38 <211> 505 <212> PRT <213> PDIA3 <400> 38 Met Ser Val Pro Arg Pro Ser Arg Ala Leu Leu Leu Leu Val Pro   1 5 10 15 Leu Leu Ala Leu Ser Ala Gly Ala Ser Asp Val Val Glu Leu Ser Asp              20 25 30 Ala Asp Phe Glu Ser Gly Leu Ala Glu Arg Pro Gly Leu Val Leu Val          35 40 45 Glu Phe Phe Ala Pro Trp Cys Gly His Cys Lys Arg Leu Ala Pro Glu      50 55 60 Tyr Glu Ala Ala Ala Thr Arg Leu Lys Gly Ile Val Val Leu Val Lys  65 70 75 80 Val Asp Cys Thr Ala Asn Ser Asn Thr Cys Asn Lys Tyr Gly Val Ser                  85 90 95 Gly Tyr Pro Thr Leu Lys Ile Phe Arg Asp Gly Glu Glu Ser Gly Thr             100 105 110 Tyr Asp Gly Pro Arg Thr Ala Asp Gly Ile Val Ser His Leu Lys Lys         115 120 125 Gln Ala Gly Pro Ala Ser Val Ala Leu Ser Ser Val Ala Asp Phe Glu     130 135 140 Lys Phe Ile Gly Asp Lys Asp Ala Ser Val Val Gly Phe Phe Arg Asp 145 150 155 160 Ala Ser Gly Asp Ala Asn Asn Leu                 165 170 175 Arg Asp Asn Tyr Arg Phe Ala His Thr Ser Glu Glu Gln Leu Val Gln             180 185 190 Lys Tyr Glu Glu Asp Gly Glu Gly Val Val Leu Tyr Arg Pro Ser Arg         195 200 205 Leu Ala Asn Lys Phe Glu Asp Ser Thr Val Lys Tyr Thr Glu Asp Lys     210 215 220 Ile Thr Ser Ala Lys Ile Lys Lys Phe Ile Gln Glu Asn Ile Phe Gly 225 230 235 240 Ile Cys Pro His Met Thr Glu Asp Asn Lys Asp Leu Ile Gln Gly Lys                 245 250 255 Asp Leu Leu Val Ala Tyr Tyr Asp Val Asp Tyr Glu Lys Asn Ala Lys             260 265 270 Gly Ser Asn Tyr Trp Arg Asn Arg Val Met Met Ile Ala Lys Lys Phe         275 280 285 Leu Asp Ala Gly His Lys Leu Ser Phe Ala Val Ala Ser Arg Lys Thr     290 295 300 Phe Gly His Glu Leu Ser Glu Phe Gly Leu Asp Asn Ser Val Gly Glu 305 310 315 320 Ala Pro Val Val Ala Ile Arg Thr Ala Lys Gly Asp Lys Phe Val Met                 325 330 335 Glu Glu Glu Phe Ser Arg Asp Gly Lys Ala Leu Glu Arg Phe Leu Gln             340 345 350 Asp Tyr Phe Asp Gly Asn Leu Lys Lys Tyr Leu Lys Ser Glu Pro Val         355 360 365 Pro Glu Asn Asn Asp Gly Pro Val Lys Val Val Val Ala Glu Asn Phe     370 375 380 Asp Glu Ile Val Asn Ala Glu Asp Lys Asp Val Leu Ile Glu Phe Tyr 385 390 395 400 Ala Pro Trp Cys Gly His Cys Lys Asn Leu Glu Pro Lys Tyr Lys Glu                 405 410 415 Leu Gly Glu Lys Leu Ser Lys Asp Pro Asn Ile Val Ile Ala Lys Met             420 425 430 Asp Ala Thr Ala Asn Asp Val Ser Pro Tyr Glu Val Arg Gly Phe         435 440 445 Pro Thr Ile Tyr Phe Ala Pro Ala Gly Lys Lys Gln Ser Pro Lys Lys     450 455 460 Tyr Glu Gly Gly Arg Glu Val Ser Asp Phe Ile Ser Tyr Leu Lys Arg 465 470 475 480 Glu Ala Thr Ser Thr Pro Val Leu Gln Glu Glu Asp Lys Ala Lys Lys                 485 490 495 Ser Lys Lys Lys Ala Lys Glu Asp Leu             500 505 <210> 39 <211> 627 <212> PRT <213> PDIA4 <400> 39 Met Ala Gln Leu Ala Val Leu Val Ala Gln Glu Asp Gly Arg Glu Ser   1 5 10 15 Val Thr Gln Glu Val Asp Gly Asp Asp Asp Glu Glu Glu Glu Asp Asp              20 25 30 Asp Asp Asp Asn Ser Glu Val Lys Glu Glu Asn Asp Val Leu Val          35 40 45 Leu Asn Asp Ala Asn Phe Asp Thr Phe Thr Ala Asp Lys Asp Thr Val      50 55 60 Leu Leu Glu Phe Tyr Ala Pro Trp Cys Gly His Cys Lys Gln Phe Ala  65 70 75 80 Pro Glu Tyr Glu Lys Ile Ala Lys Thr Leu Lys Glu Asn Asp Pro Pro                  85 90 95 Ile Pro Val Ala Lys Ile Asp Ala Thr Ala Ala Thr Ala Leu Ala Ser             100 105 110 Arg Phe Asp Val Ser Gly Tyr Pro Thr Ile Lys Ile Leu Lys Lys Gly         115 120 125 Gln Pro Val Asp Tyr Asp Gly Ser Arg Thr Glu Asp Ala Ile Val Ala     130 135 140 Lys Val Lys Glu Ile Ser Asp Pro Asn Trp Thr Pro Pro Pro Glu Ala 145 150 155 160 Thr Leu Val Leu Thr Gln Asp Asn Phe Asp Asp Val Val Lys Asp Ala                 165 170 175 Asp Ile Leu Val Glu Phe Tyr Ala Pro Trp Cys Gly His Cys Lys             180 185 190 Arg Leu Ala Pro Glu Tyr Glu Lys Ala Ala Gln Glu Leu Ser Lys Arg         195 200 205 Thr Pro Pro Ile Pro Leu Ala Lys Val Asp Ala Thr Ala Glu Thr Glu     210 215 220 Leu Ala Lys Lys Phe Asp Val Thr Gly Tyr Pro Thr Leu Lys Ile Phe 225 230 235 240 Arg Lys Gly Lys Pro Tyr Asp Tyr Ser Gly Pro Arg Glu Lys Tyr Gly                 245 250 255 Ile Val Asp Tyr Met Ile Glu Gln Ala Gly Pro Pro Ser Lys Gln Ile             260 265 270 Gln Ala Thr Lys Gln Val Gln Glu Phe Leu Lys Asp Gly Asp Asp Val         275 280 285 Ile Ile Ile Gly Val Phe Ser Gly Glu Thr Asp Glu Val Tyr Gln Leu     290 295 300 Tyr Gln Glu Ala Ala Asn Ser Leu Arg Glu Asp Tyr Lys Phe His His 305 310 315 320 Thr Phe Ser Ser Glu Ile Ala Lys Leu Leu Lys Val Ser Ser Gly Lys                 325 330 335 Leu Val Val Met Gln Pro Glu Lys Phe Gln Ser Lys His Glu Pro Lys             340 345 350 Met Tyr Val Leu Asp Leu Lys Tyr Ser Thr Ser Glu Ser Glu Ile Lys         355 360 365 Glu His Val Val Lys His Ala Leu Pro Leu Val Gly His Arg Lys Pro     370 375 380 Ser Asn Asp Ala Lys Arg Tyr Ala Lys Arg Pro Leu Val Val Val Tyr 385 390 395 400 Tyr Thr Val Asp Phe Ser Phe Asp Tyr Arg Val Ala Thr Gln Tyr Trp                 405 410 415 Arg Gly Lys Val Leu Glu Val Ala Lys Asp Phe Pro Glu Tyr Val Phe             420 425 430 Ala Val Ser Asp Glu Glu Asp Tyr Ser Ser Glu Ile Lys Asp Leu Gly         435 440 445 Leu Leu Glu Ser Gly Glu Asp Val Asn Val Ala Leu Asp Glu Gly     450 455 460 Gly Lys Lys Tyr Ala Met Glu Pro Glu Glu Phe Asp Ser Asp Ala Leu 465 470 475 480 Arg Gln Phe Val Leu Ala Phe Lys Lys Gys Lys Leu Lys Pro Ile Val                 485 490 495 Lys Ser Gln Pro Val Pro Lys Asn Asn Lys Gly Pro Val Lys Val Val             500 505 510 Val Gly Lys Thr Phe Asp Thr Ile Val Met Asp Pro Lys Asn Asp Val         515 520 525 Leu Ile Glu Phe Tyr Ala Pro Trp Cys Gly His Cys Lys Lys Leu Glu     530 535 540 Pro Val Tyr Thr Glu Leu Gly Lys Lys Tyr Lys Asn Glu Lys Asn Leu 545 550 555 560 Val Ile Ala Lys Met Asp Ala Thr Ala Asn Asp Val Thr Asn Asp His                 565 570 575 Tyr Lys Val Glu Gly Phe Pro Thr Ile Tyr Phe Ala Pro Arg Asp Lys             580 585 590 Lys Asn Asn Pro Ile Lys Phe Glu Gly Gly Asp Arg Asp Leu Glu His         595 600 605 Leu Ser Lys Phe Ile Glu Glu His Ala Thr Lys Leu Ser Arg Thr Lys     610 615 620 Glu Glu Leu 625 <210> 40 <211> 489 <212> PRT <213> mKIAA <400> 40 Met Arg Asn Gly Lys Ser Gly Val Ala Gly Gln Leu Leu Leu Thr Lys   1 5 10 15 Tyr Val Leu Ile Val Leu Asn Lys Ile Asp Lys Gly Gln Gly Gly Thr              20 25 30 Glu Asn Lys Thr Thr Glu Asn Gly Gln Glu Ser Gly Leu Glu Asp Glu          35 40 45 Leu Asp Phe Asp Thr Asn Phe Ser Ser Thr Asp Asn Glu Glu Asp Ser      50 55 60 Asp Arg Leu Glu Glu Arg Phe Lys Ser Met Thr Phe Glu Arg Thr Glu  65 70 75 80 Ile Val Phe Leu Glu Glu Ala Asp Gln Gln Gln Gln Gln Leu Ala Lys Lys                  85 90 95 Trp Gly Phe Lys Thr Ser Asp Ile Arg Glu Leu Thr His His Glu Phe             100 105 110 Phe Met Pro Gly Leu Val Asp Thr His Ile His Ala Pro Gln Tyr Leu         115 120 125 Phe Ala Gly Thr Arg Val Asp Leu Pro Leu Leu Gln Trp Leu Thr Thr     130 135 140 Tyr Thr Phe Pro Thr Glu Ala Arg Tyr Lys Asp Ser Asp Phe Ala Glu 145 150 155 160 Glu Val Tyr Thr Arg Val Val Arg Arg Thr Leu Lys Asn Gly Thr Thr                 165 170 175 Thr Ala Cys Tyr Phe Ala Thr Ile Tyr Thr Asp Thr Ser Leu Leu Leu             180 185 190 Ala Asp Ile Ile Asp Lys Phe Gly Gln Arg Ala Phe Val Gly Lys Val         195 200 205 Cys Met Asp Met Asn Asp Ala Val Pro His Tyr Lys Glu Thr Thr Ala     210 215 220 Asp Ser Val Gln Glu Met Glu Arg Phe Val Lys Glu Leu Leu Glu Arg 225 230 235 240 Gln Tyr Pro Arg Val Leu Pro Ile Val Thr Pro Arg Phe Gly Pro Ser                 245 250 255 Cys Thr Glu Asp Leu Leu Arg Ala Leu Gly Asp Leu Ala Gln Thr His             260 265 270 Asp Leu His Val Gln Ser His Ile Ser Glu Thr Glu Glu Glu Leu Lys         275 280 285 Val Val Glu Asn Met Phe Pro Ala Tyr Gln Asn Tyr Thr Asp Leu Tyr     290 295 300 Asp Lys Asn Lys Leu Leu Thr Ser Lys Thr Val Met Ala His Ala Cys 305 310 315 320 His Leu Ser Glu Glu Glu Leu Glu Leu Phe Asn Leu Arg Gly Ala Ala                 325 330 335 Val Ala His Cys Pro Ser Ser Asn Phe Ser Leu His Ser Gly Ile Leu             340 345 350 Asn Val Lys Lys Val Leu Lys His Asn Val Lys Val Gly Leu Gly Thr         355 360 365 Asp Val Ala Gly Gly Tyr Ser Ala Ser Met Leu Asp Ala Ile Arg Lys     370 375 380 Thr Val Val Ala Ser Asn Ala Leu Lys Ile Asn Lys Val Ser Glu Ala 385 390 395 400 Gly Leu Thr Leu Lys Glu Ala Phe Arg Leu Ala Thr Leu Gly Gly Ser                 405 410 415 Gln Ala Leu Gly Leu Asp Asp Val Ile Gly Asn Phe Glu Val Gly Lys             420 425 430 Glu Phe Asp Ala Leu Leu Ile Asn Thr Lys Ala Ser Asp Ser Pro Phe         435 440 445 Asp Leu Phe Ser Ala Asp Thr Phe Glu Asp Cys Leu Gln Lys Phe Leu     450 455 460 Tyr Leu Gly Asp Asp Arg Asn Ile Ser Glu Val Tyr Val Ala Gly Lys 465 470 475 480 Gln Val Val Pro Phe Ser Ser Ser Val                 485

Claims (18)

As a gene biomarker specific to environmental stress in poultry,
m-calpain, Caspase 3, Cathepsin B, and the like.
The method according to claim 1,
Wherein the m-calpain has a nucleotide sequence and an amino acid sequence of SEQ ID NOS: 1 and 4, and a gene marker specific to environmental stress of the poultry.
The method according to claim 1,
Wherein the Caspase 3 has the nucleotide sequence and the amino acid sequence of SEQ ID NOS: 2 and 5, and the gene biomarker specific to the environmental stress of the poultry.
The method according to claim 1,
Wherein said Cathepsin B has the nucleotide sequence and amino acid sequence of SEQ ID NOS: 3 and 6, and a gene biomarker specific to environmental stress of the poultry.
A method for predicting environmental stress potential of poultry using gene biomarkers specific to environmental stress of the poultry of claim 1.
A method for predicting an egg production rate using a gene biomarker specific to environmental stress of the poultry of claim 1.
A marker composition for environmental stress diagnosis of poultry,
Selected from the group consisting of Tropomyosin (TPM2) of SEQ ID NO: 7, Keratin19 (KRT19) of SEQ ID NO: 8, Desmin (DES) of SEQ ID NO: 9, Vimentin (VIM) of SEQ ID NO: 10 and Lysozyme C Wherein the at least one egg white protein is expressed when environmental stress is likely to be high.
A composition for diagnosing environmental stress in poultry comprising an antibody specifically binding to environmental stress-specific protein of the poultry of claim 7 as an active ingredient.
9. The method of claim 8,
Wherein the antibody is a monoclonal antibody.
A kit for environmental stress diagnosis of poultry comprising an antibody specifically binding to environmental stress-specific protein of the poultry of claim 7 as an active ingredient.
A marker composition for environmental stress diagnosis of poultry,
(Actin), aortic smooth muscle (ACT) of SEQ ID NO: 12, F-actin-capping protein subunit alpha-2 (CAPZA2) of SEQ ID NO: 13, Capping protein (actin filament) muscle Z-line of SEQ ID NO: 14, beta isoform 1 TUBLIN alpha (TUBA) of SEQ ID NO: 16, Tublin beta-3 chain (TUBB2C) of SEQ ID NO: 17, Cathepsin B precursor (CTSB) of SEQ ID NO: 18, SEQ ID NO: (ANT) of SEQ ID NO: 21, Apolipoprotein A-1 preproprotein (APOA 1) of SEQ ID NO: 21, Serum albumin precursor (ALB) of SEQ ID NO: 22, PRISMATED subunit beta type- (SEQ ID NO: 23), Tissue transglutaminase (TGases) of SEQ ID NO: 26, SEQ ID NO: 23, SEQ ID NO: 27, Adenylosuccinate synthetase isozyme 2 (ADSS) of SEQ ID NO: 28, PREDICTED of SEQ ID NO: 29: similar to guanine nucl wherein at least one egg white protein is selected from the group consisting of an eotope exchange factor for ADP ribosylation factor 6 (PSD 3), an IG light chain (Ig-Lc) of SEQ ID NO: 30 and a PIT 54 protein And the expression is increased when the possibility is high.
A composition for diagnosing environmental stress of poultry comprising an antibody specifically binding to environmental stress specific protein of the poultry of claim 11 as an active ingredient.
13. The method of claim 12,
Wherein the antibody is a monoclonal antibody.
An environmental stress diagnosis kit for poultry comprising an antibody specifically binding to environmental stress specific proteins of the poultry of claim 11 as an active ingredient.
A marker composition for environmental stress diagnosis of poultry,
(OVM) of SEQ ID NO: 33, ATP synthase subunit beta, mitochondrial precursor (ATP5B) of SEQ ID NO: 34, Sorting nexin-B3 of SEQ ID NO: 32, PREDICTED: similar to sorbin and SH3 domain containing 1 37, Protein disulfide-isomerase A3 (PDIA3) of SEQ ID NO: 38, Protein disulfide-isomerase A3 (SEQ ID NO: 38) of SEQ ID NO: characterized in that expression is reduced when one or more egg white protein (s) selected from the group consisting of: - isomerase A4 (PDIA4) and PREDICTED: similar to mKIAA1258 protein (mKIAA 1258) of SEQ ID NO: 40 is highly likely to be environmentally stressed A marker composition for stress diagnosis.
A composition for diagnosing environmental stress of poultry comprising an antibody that specifically binds to environmental stress-specific protein of the poultry of claim 15 as an active ingredient.
17. The method of claim 16,
Wherein the antibody is a monoclonal antibody.
An environmental stress diagnosis kit for poultry comprising an antibody specifically binding to environmental stress specific proteins of the poultry of claim 15 as an active ingredient.

Images