KR101588332B1 - A production method of yellow fever virus like particles using drosophila expression system - Google Patents

Abstract

The present invention relates to a method for producing yellow fever virus-like particles in a fruit fly expression system, and more particularly, to a method for producing yellow fever virus-like particles by introducing yellow fever virus structural genes (PrM and E genes) into a fruit fly expression system, Virus-like particles can be used to develop candidate substances for yellow fever vaccine.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for producing yellow fever virus-like particles in a Drosophila expression system,

The present invention relates to a method for producing yellow fever virus-like particles in a Drosophila expression system, and more particularly, to a method for producing yellow fever virus-like particles by cloning a structural gene of yellow fever virus vaccine into a Drosophila expression vector, And a method of producing the same.

Yellow fever is a hemorrhagic fever caused by a virus that is prevalent in Africa and South America. It is a symptom of an infection caused by mosquito-borne plaque virus yellow fever virus.

Symptoms of yellow fever can be divided into latency, acute phase, and toxic phase. After a latency period of 3 to 6 days, an acute phase appears. In the acute phase, symptoms such as fever and muscle pain, chills, headache, loss of appetite, nausea and vomiting appear. Although symptoms usually disappear after 3 to 4 days after the onset of acute episodes, about 15% of the patients become toxic. Patients with toxic episodes develop heat again, and sudden jaundice, abdominal pain, vomiting, and other symptoms appear. In addition, bleeding may occur in the mouth, nose, eyes, gastrointestinal tract, etc., and acute renal failure may occur. About half of the patients who enter the toxic phase die within 14 days.

Yellow fever can be diagnosed by detecting IgM antibodies against yellow fever virus in blood or cerebrospinal fluid. During the acute phase, the virus can be detected by culture or diagnosed by nucleic acid test.

As a treatment for yellow fever, a therapeutic agent capable of eliminating yellow fever virus, which is a cause of yellow fever, has not yet been developed, and thus it is a situation that alleviates symptoms when they occur.

Yellow Fever Virus (YFV) belongs to the Flavivirus family with Flaviviridae. It is a globular virus with a size of 17 ~ 28 nm. The nucleic acid is RNA type. It belongs to group B of arborovirus and is mediated by tropical stripe mosquitoes.

The yellow fever virus (YFV) gene has an approximately 11-kb single-stranded positive-sense RNA genome, and RNA contains three structural proteins: core (C) (open reading frames), which encodes the proteins, premembrane (prM), envelope (E) proteins, and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) (Fig. 1).

Among the yellow fever virus proteins, E and M proteins are surface glycoproteins, and E proteins have functions of receptor binding, membrane fusion, and virus assembly. And E-glycoproteins contain virus-specific epitopes, thus producing virus-specific antibodies during viral infection. There has been no report so far that virus-like particles are produced from yellow fever virus by co-expression of only prM and E genes without other viral genes.

The Drosophila expression system is an expression system that combines the advantages of an animal expression system and a baculovirus expression system, and the system is simple and well-analyzed (FIG. 2). Such a Drosophila expression system can be produced efficiently and inexpensively in the production of eukaryotic proteins. Drosophila S2 cells are easily cultured without CO ₂ , are capable of high-density cell culture, and are capable of both static and suspension cell culture. It is also possible to generate proteins with eukaryotic posttranslational modifications such as glycosylation. Since Endogenous Drosophila protein does not generally react with mammalian proteins, Drosophila S2 cells provide a "null background " for functional studies of proteins. In the Drosophila expression system, the protein expression includes intracellular expression and the Drosophila BiP signal sequence, so that the protein is efficiently secreted out of the cell to simplify the purification. The Drosophila expression system has a higher protein expression than the animal expression system and a non-lytic expression that minimizes the degradation of the expressed protein.

Thus, the present inventors have made intensive efforts to produce yellow fever virus-like particles. As a result, they have confirmed the generation of virus-like particles by introducing yellow fever virus structural genes (PrM and E genes) into a fruit fly expression system. The present invention has been accomplished on the basis of the fact that it can be developed as a yellow fever vaccine candidate substance.

Op De Beecke et al., J Virol. 2004 Nov; 78 (22): 12591-602. Charlier N et al., J Virol. 2004 Jul; 78 (14): 7418-26. John A. Schetz et al., Current Protocols in Neuroscience, UNIT 4.16 Protein Expression in the Drosophila Schneider 2 Cell System, 2004.

It is an object of the present invention to provide a method for producing yellow fever virus-like particles comprising cloning yellow fever virus structural genes (PrM and E genes) into a fruit fly expression vector and transforming the yellow fever cell line, Like particles, and yellow fever virus-like particles as an active ingredient.

To achieve the above object, the present invention provides a method for producing a recombinant expression vector, comprising the steps of: 1) preparing a recombinant expression vector by introducing PrM (premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, into a Drosophila expression vector; 2) transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of step 1) to prepare a transformant; And 3) culturing the transformant of step 2) and then separating virus-like particles from the cell or cell culture medium. Provide a production method.

In addition, the present invention provides a recombinant expression vector in which PrM (premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, are introduced into a Drosophila expression vector.

In addition, the present invention provides a transformed cell that produces yellow fever virus-like particle prepared by transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of the present invention Lt; / RTI >

The present invention also provides yellow fever virus-like particles produced by the production method of the present invention.

The present invention also provides a yellow fever vaccine composition comprising the yellow fever virus-like particle of the present invention in a pharmaceutically effective amount.

The present invention also provides a method for inducing immunity against yellow fever virus infection of an individual comprising administering the yellow fever virus-like particle of the present invention to a subject.

In addition, the present invention provides a method for producing an antibody against a yellow fever virus in a subject, which comprises administering the yellow fever virus-like particle of the present invention to a subject.

In the present invention, yellow fever virus structural genes (PrM and E genes) were introduced into a fruit fly expression system to confirm generation of yellow fever virus-like particles. In the present invention, virus-like particles are produced only by the structural gene against yellow fever virus, and mass production can be accomplished by a simple process by using such a fruit fly expression system. In addition, the yellow virus virus-like particles composed of PrM and E proteins thus generated are generated in the same proteolytic processing and glycosylation process as viral structural proteins, and are composed of structural and biochemical properties It is almost as safe as infectious virions but as non-infectious particles. Therefore, it can be safely handled at the BSL-2 facility, not at the biosafety level 3 (BSL-3) facility.

1 is a diagram showing the structure of a yellow fever virus gene.
Figure 2 is a representation of a Drosophila expression system (Source: Invitrogen, USA).
Figure 3 is a map showing the map of pMT / BiP / V5-His vector (Source: Invitrogen, USA).
Fig. 4 is a diagram showing the directions and positions of primers for PCR amplification from the structural gene PrM / E of yellow fever virus.
Figure 5 shows the results of PCR amplification from the structural gene PrM / E of the yellow fever virus:
Lane M: 1 Kb plus DNA ladder; And
Lane 1: YFV PrM / E.
FIG. 6 is a diagram showing the structure of the vector cloned with the structural gene PrM / E cDNA of yellow fever virus.
Figure 7 shows the results of identifying positive colonies using a colony PCR method:
Lane M: 1 Kb plus DNA ladder;
Lanes 1-16: sample colonies; And
Lanes 10 & 12: Positive clones of YFV PrM / E (PCR fragment size ~ 2Kb).
8 is a diagram showing the result of sequencing of the structural gene PrM / E of the yellow fever virus.
Figure 9 is an electron micrograph showing yellow fever virus-like particles (YFV VLPs) derived from Drosophila S2 cells transfected with pMT / BiP / V5 / His-YFV PrM /
Here, YFV VLPs (A, B) were stained spontaneously and analyzed by TEM. The scale bar is shown below. Panel A is derived from transfected Drosophila S2 cells and Panel B is derived from cell culture supernatants.
10 shows the results of detection of yellow fever virus-like particles (YFV VLP) derived from Drosophila S2 cells transfected with pMT / BiP / V5 / His-YFV PrM / E through indirect immunofluorescence assay (IFA) This is a picture showing:
Here, YFV VLPs in Drosophila S2 cells were detected with human serum derived from vaccinated human against YFV 17D vaccine strain. Panel A is the negative control group, and panel B is the YFV VLP.

Hereinafter, the present invention will be described in detail.

The present invention

1) preparing a recombinant expression vector by introducing PrM (Premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, into a Drosophila expression vector;

2) transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of step 1) to prepare a transformant; And

3) Production of yellow fever virus-like particles comprising culturing the transformant of step 2) and isolating virus-like particles from the cell or cell culture medium ≪ / RTI >

In the method, PrM gene of step 1) is preferably composed of the base sequence in SEQ ID NO: 1 (5'-gtgaccttggtgcggaaaaacagatggttgctcctaaatgtgacatctgaggacctcgggaaaacattctctgtgggcacaggcaactgcacaacaaacattttggaagccaagtactggtgcccagactcaatggaatacaactgtcccaatctcagtccaagagaggagccagatgacattgattgctggtgctatggggtggaaaacgttagagtcgcatatggtaagtgtgactcagcaggcaggtctaggaggtcaagaagggccattgacttgcctacgcatgaaaaccatggtttgaagacccggcaagaaaaatggatgactggaagaatgggtgaaaggcaactccaaaagattgagagatggttcgtgaggaaccccttttttgcagtgacggctctgaccattgcctaccttgtgggaagcaacatgacgcaacgagtcgtgattgccctactggtcttggctgttggtccggcctactca-3 '), and in which one or some of the bases in the base sequence is added, deleted or substituted Nucleotide sequences are also possible.

In the method, E gene of step 1) is preferably made up of SEQ ID NO: 2 tgatcttacagcggcaatcaataaaggcattttggttacagttaaccccatcgcctcaaccaatgatgatgaagtgctgattgaggtgaacccaccttttggagacagctacattatcgttgggagaggagattcacgtctcacttaccagtggcacaaagagggaagctcaataggaaagttgttcactcagaccatgaaaggcgtggaacgcctggccgtcatgggagacaccgcctgggatttcagctccgctggagggttcttcacttcggttgggaaaggaattcatacggtgtttggctctgcctttcaggggctatttggcggcttgaactggataacaaaggtcatcatgggggcggtacttatatgggttggcatcaacacaagaaacatgacaatgtccatgagcatgatcttggtaggagtgatcatgatgtttttgtctctaggagttggggcg-3 '), and it is also possible one or some of the base is added in, deleted or substituted base sequence in the base sequence.

In this method, the Drosophila metallothionein (MT) promoter and the Drosophila BiP signal sequence can be used as the Drosophila expression vector of step 1), and the pMT / BiP / V5-His vector, pDNR-Dual vector (Clonetech, USA) or pVALIUM1 vector (PlasmID, USA) can be used and most preferably pMT / BiP / V5-His vector.

In the above method, the host cell of step 2) may be a Drosophila melanogaster Kc cell in addition to Drosophila Schneider 2 (S2) cells.

In addition, the present invention provides a recombinant expression vector in which PrM (premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, are introduced into a Drosophila expression vector.

In addition, the present invention also relates to a method for producing yellow fever virus-like particles prepared by transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of the present invention Lt; RTI ID = 0.0 > transformed < / RTI >

The PrM gene is preferably composed of the nucleotide sequence of SEQ ID NO: 1, and the E gene is preferably composed of the nucleotide sequence of SEQ ID NO: 2, wherein one or a part of bases in the respective nucleotide sequences are added, deleted or substituted Are also possible.

The Drosophila metallothionein (MT) promoter and the Drosophila BiP signal sequence can be used as the Drosophila expression vector. Preferably, the Drosophila metallothionein (MT) promoter and the Drosophila BiP signal sequence are pMT / BiP / V5- Do.

The present invention also provides yellow fever virus-like particles produced by the production method of the present invention.

The yellow virus virus-like particles composed of the PrM and E proteins are generated in the same proteolytic processing and glycosylation process as the viral structural proteins, and in terms of structure and biochemical properties, almost identical to infectious virions, are safe as non-infectious particles.

The present invention also provides a yellow fever vaccine composition comprising the yellow fever virus-like particle of the present invention in a pharmaceutically effective amount.

The vaccine composition may contain from 0.1 part by weight to 90 parts by weight of the yellow fever virus-like particles relative to 100 parts by weight of the total composition.

The vaccine composition may contain at least one active ingredient which exhibits the same or similar function in addition to the yellow fever virus-like particle.

The vaccine composition may be administered orally or parenterally at the time of clinical administration and may be administered orally, parenterally, intraperitoneally, rectally, subcutaneously, intravenously, intramuscularly, intraperitoneally, intracerebrally, May be administered by injection, and may be used in the form of a general pharmaceutical preparation.

The vaccine composition may be used alone or in combination with methods using radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

The daily dose of the vaccine composition is about 0.0001 to 100 mg / kg, preferably 0.001 to 10 mg / kg. It is preferable to administer the vaccine once or several times a day, but it is preferable that the dose, The range varies depending on diet, administration time, method of administration, excretion rate, and severity of the disease.

The vaccine composition may be administered in various forms of parenteral administration at the time of actual clinical administration. In the case of formulation, the vaccine composition is prepared using diluents or excipients such as fillers, extenders, binders, humectants, disintegrants, . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The present invention also provides a method for inducing immunity against yellow fever virus infection of an individual comprising administering the yellow fever virus-like particle of the present invention to a subject.

In addition, the present invention provides a method for producing an antibody against a yellow fever virus in a subject, which comprises administering the yellow fever virus-like particle of the present invention to a subject.

Preferably, the subject includes all of humans, primates, rodents, mammals, and birds.

The administration can be administered to an individual by oral, intradermal, intranasal, intramuscular, intraperitoneal, intravenous or subcutaneous routes.

Hereinafter, the present invention will be described in more detail by way of examples of the present invention.

However, the following examples are intended to assist the understanding of the present invention, and the scope of the present invention is not limited to the following examples.

< Example  1> yellow fever virus structural gene Cloning

<1-1> Obtaining yellow fever virus

Yellow fever virus 17D strain (Yellow fever virus 17D, YFV 17D) was purchased from the National Collection of Pathogenic Viruses (NCPV). The yellow fever virus vaccine is currently classified as a high-risk pathogen by the CDC and can be used only in the BSL-3 facility, but the YFV VLP can be handled safely in the BSL-2 facility.

<1-2> Acquisition of Drosophila Expression Vector

The pMT / BiP / V5-His vector used in the cloning experiments was purchased from Invitrogen. The pMT / BiP / V5-His vector contains the Drosophila metallothionein (MT) promoter, which is an inducible promoter, and the Drosophila BiP signal sequence for protein secretion ).

<1-3> Primer  making

A specific primer at the envelope (E) gene end of the yellow fever virus was prepared and a sense primer containing the signal sequence portion of the capsid C-terminal for the efficient secretion of virus-like particles was prepared. (Fig. 4 and Table 1). The sense primer contains a start codon and a restriction enzyme KpnI and inserts one nucleotide (c) to align with the ORF of the vector. The antisense primer is also a restriction enzyme (XhoI) And one nucleotide (c) was inserted to match the ORF of the vector (Table 1).

Primers used for PCR amplification virus designation location polarity order
(5 'to 3') comment YFV 422F 422-435
(capsid) Sense cgg ggtacc c atg tcc cat gat gtt ct (SEQ ID NO: 3)
KpnI 2452R 2441-2452
(envelope) Antisense ccg ctcgag c cgc ccc aac tcc (SEQ ID NO: 4)
XhoI

<1-4> RT - PCR  Perform

CDNA synthesis to encode the viral structural gene was generated from viral RNA according to the manufacturer's method using a specific antisense primer for E gene and SuperScript ™ III (Invitrogen, USA), a reverse transcriptase . The PCR reaction contained a specific primer, antisense primer, Pfu DNA polymerase (TaKaRa, Japan) and cDNA for the PrM / E gene of the virus. After an inactivation step at 95 ° C for 2 minutes, the reaction was carried out at 95 ° C for 20 seconds, 58 ° C for 40 seconds, and 72 ° C for 4 minutes for 35 cycles. Finally, the reaction was allowed to proceed at 72 ° C for 5 minutes to obtain PCR products. As a result, the PrM / E gene size of the PCR-amplified virus was 2,031 bp, and the desired PCR band was confirmed when compared with 1 Kb plus DNA ladder on 1% agarose gel (FIG. 5).

<1-5> Cloning  Perform

The PCR product amplified by RT-PCR was purified using QIAquick PCR purification kit (Qiagen, USA). The vector was purified using Invisorb plasmid Midi kit (Invitek, Germany) Enzymes were treated (Table 2).

Restriction enzyme digestion of PCR products and vectors virus PCR product vector Restriction enzyme Restriction enzyme buffer solution Reaction temperature YFV PrM-E (2,031 bp) pMT / BiP / V5-His KpnI-PrM-E-XhoI NEB buffer # 1 / BSA 37 ℃

The restriction enzyme-treated PCR products and vectors were separated by agarose gel electrophoresis and purified using QIAquick Gel extraction kit (Qiagen, USA). The PCR product and vector ratio were adjusted to about 3: 1, treated with T4 DNA ligase (Gibco, USA), and reacted at 25 ° C. for 5 hours to obtain a plasmid in which the insert DNA was inserted into the vector (FIG.

10 μl of the ligation mixture (PCR product and vector) was added to E. coli TOP10 strain (Invitrogen, USA), reacted for 30 minutes on ice, and then heat-shocked at 42 ° C for 30 seconds. Ice for 2 minutes and 250 μl of SOC medium was added and incubated for 1 hour in a shaking incubator at 37 ° C. and then plated on an agar medium containing ampicillin and incubated for 18 hours at 37 ° C. in an incubator .

A colony PCR method was performed to identify clones in which the PCR products were properly transformed (Fig. 7). The clones identified by colony PCR were cultured in LB medium, and DNA was purified using QIAprep Spin Plasmid Miniprep kit (Invitrogen, USA). The fragment was digested with restriction enzymes and confirmed by agarose gel electrophoresis. The result was confirmed to be the same as the expected fragment size.

Clones confirmed to be inserted by restriction enzyme treatment were subjected to sequence analysis to confirm the ORF and restriction enzyme sites, thereby obtaining a total of three clones (FIG. 8).

< Example  2> Transformation of Drosophila cells using a recombinant vector

<2-1> Acquisition of Drosophila cells

The Drosophila Schneider 2 (S2) cells used for the Drosophila expression system are derived from Drosophila melanogaster and are easily cultured without CO ₂ . S2 cells used in the experiment were purchased from Invitrogen. The cells were cultured in a Schneider's Drosophila Medium medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 U / ml penicillin-streptomycin) in a thermostat at 28 ° C without CO ₂ to form a monolayer And then used in various experiments.

&Lt; 2-2 >

To confirm the production of recombinant virus-like particles, a yellow fever virus structural gene plasmid (pMT / BiP / V5 / His-YFV PrM / E) was transfected into S2 cells. That is, S2 cells cultured on Schneider's Drosophila Medium medium were washed with PBS, and serum-free medium (Invitrogen, USA) was added. Then, plasmid DNA was mixed with a serum-free medium (Invitrogen, USA) After transfection reagent (TransIT-2020, MIRUS Bio LLC) was added, reaction was carried out at room temperature for 20 minutes. After adding a mixture to the S2 cells containing the serum-free medium, the cells were transfected for 24 hours, and CuSO ₄ solution (final concentration 500 μM) was added to induce recombinant protein synthesis in the plasmid. After 24 hours, And used for the next experiment.

< Example  3> Confirmation of generation of yellow fever virus-like particles in transformed Drosophila cells

<3-1> Cultivation of transformed Drosophila cells and separation of yellow fever virus-like particles

DNA-transfected S2 cells were cultured in a serum-free medium (Invitrogen, USA) at 28 ° C without CO ₂ in a serum-free medium and transfected for 48 hours to obtain cell and cell culture media. The cell and cell culture supernatant was secured and centrifuged (8,000 rpm, 10 minutes) to separate the cell pellet and the supernatant. The supernatant was subjected to ultrafast centrifugation (32,000 rpm, 1 hour) to obtain a pellet. The pellet was suspended in TE buffer (50 mM Tris [pH 8.0], 10 mM EDTA).

<3-2> Confirmation of generation of yellow fever virus-like particles

From the pellets obtained from the cell pellet and the supernatant, the formation of intracellular yellow fever virus-like particles and the yellow virus virus-like particles secreted out of the cells were confirmed by an electron microscope observation and an indirect immunofluorescence assay (IFA).

As a result of electron microscopic observation, yellow virus virus-like particles (YFV VLP) of 40-50 nm in size were observed by electron microscopy in S2 transfected DNA for 48 hours (FIG. 9A), and the cell culture supernatant was subjected to ultra- (YFV VLP) secreted out of the cell was also confirmed (Fig. 9B).

As a result of the indirect immunofluorescent antibody assay, yellow fluorescent virus-like particles (YFV VLPs) were confirmed by indirect immunofluorescent antibody method using sera of a person inoculated with yellow fever virus vaccine in S2 transfected DNA for 48 hours (Fig. 10B).

<110> Korea Center for Disease Control and Prevention <120> A PRODUCTION METHOD OF YELLOW FEVER VIRUS LIKE PARTICLES USING          DROSOPHILA EXPRESSION SYSTEM <130> NP13-1191 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 492 <212> DNA <213> Yellow fever virus 17D <400> 1 gtgaccttgg tgcggaaaaa cagatggttg ctcctaaatg tgacatctga ggacctcggg 60 aaaacattct ctgtgggcac aggcaactgc acaacaaaca ttttggaagc caagtactgg 120 tgcccagact caatggaata caactgtccc aatctcagtc caagagagga gccagatgac 180 attgattgct ggtgctatgg ggtggaaaac gttagagtcg catatggtaa gtgtgactca 240 gcaggcaggt ctaggaggtc aagaagggcc attgacttgc ctacgcatga aaaccatggt 300 ttgaagaccc ggcaagaaaa atggatgact ggaagaatgg gtgaaaggca actccaaaag 360 attgagagat ggttcgtgag gaaccccttt tttgcagtga cggctctgac cattgcctac 420 cttgtgggaa gcaacatgac gcaacgagtc gtgattgccc tactggtctt ggctgttggt 480 ccggcctact ca 492 <210> 2 <211> 1479 <212> DNA <213> Yellow fever virus 17D <400> 2 gctcactgca ttggaattac tgacagggat ttcattgagg gggtgcatgg aggaacttgg 60 gtttcagcta ccctggagca agacaagtgt gtcactgtta tggcccctga caagccttca 120 ttggacatct cactagagac agtagccatt gatagacctg ctgaggtgag gaaagtgtgt 180 tacaatgcag ttctcactca tgtgaagatt aatgacaagt gccccagcac tggagaggcc 240 cacctagctg aagagaacga aggggacaat gcgtgcaagc gcacttattc tgatagaggc 300 tggggcaatg gctgtggcct atttgggaaa gggagcattg tggcatgcgc caaattcact 360 tgtgccaaat ccatgagttt gtttgaggtt gatcagacca aaattcagta tgtcatcaga 420 gcacaattgc atgtaggggc caagcaggaa aattggacta ccgacattaa gactctcaag 480 tttgatgccc tgtcaggctc ccaggaagtc gagttcattg ggtatggaaa agctacactg 540 gaatgccagg tgcaaactgc ggtggacttt ggtaacagtt acatcgctga gatggaaaca 600 gagagctgga tagtggacag acagtgggcc caggacttga ccctgccatg gcagagtgga 660 agtggcgggg tgtggagaga gatgcatcat cttgtcgaat ttgaacctcc gcatgccgcc 720 actatcagag tactggccct gggaaaccag gaaggctcct tgaaaacagc tcttactggc 780 gcaatgaggg ttacaaagga cacaaatgac aacaaccttt acaaactaca tggtggacat 840 gtttcttgca gagtgaaatt gtcagctttg acactcaagg ggacatccta caaaatatgc 900 actgacaaaa tgttttttgt caagaaccca actgacactg gccatggcac tgttgtgatg 960 caggtgaaag tgtcaaaagg agccccctgc aggattccag tgatagtagc tgatgatctt 1020 acagcggcaa tcaataaagg cattttggtt acagttaacc ccatcgcctc aaccaatgat 1080 gatgaagtgc tgattgaggt gaacccacct tttggagaca gctacattat cgttgggaga 1140 ggagattcac gtctcactta ccagtggcac aaagagggaa gctcaatagg aaagttgttc 1200 actcagacca tgaaaggcgt ggaacgcctg gccgtcatgg gagacaccgc ctgggatttc 1260 agctccgctg gagggttctt cacttcggtt gggaaaggaa ttcatacggt gtttggctct 1320 gcctttcagg ggctatttgg cggcttgaac tggataacaa aggtcatcat gggggcggta 1380 cttatatggg ttggcatcaa cacaagaaac atgacaatgt ccatgagcat gatcttggta 1440 ggagtgatca tgatgttttt gtctctagga gttggggcg 1479 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 422F sense primer <400> 3 cggggtaccc atgtcccatg atgttct 27 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2452R antisense primer <400> 4 ccgctcgagc cgccccaact cc 22

Claims (11)

1) Drosophila metallothionein (MT) promoter and Drosophila BiP signal sequence (PrP (premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, Into a Drosophila expression vector to produce a recombinant expression vector;
2) transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of step 1) to prepare a transformant; And
3) Production of yellow fever virus-like particles comprising culturing the transformant of step 2) and isolating virus-like particles from the cell or cell culture medium Way.
2. The method according to claim 1, wherein the PrM gene of step 1) comprises the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 1, wherein the E gene of step 1) comprises the nucleotide sequence of SEQ ID NO: 2.
delete The method according to claim 1, wherein the Drosophila expression vector is pMT / BiP / V5-His vector.
A recombinant expression vector in which PrM (premembrane) gene and E (envelope) gene, which are structural genes of yellow fever virus, are introduced into a Drosophila expression vector.
A transformed cell prepared by transforming Drosophila Schneider 2 (S2) cells with the recombinant expression vector of claim 6.
delete delete delete delete

Images