KR101582259B1 - Escherichia coli strain fmis2 for producing isoprene and use thereof - Google Patents

Abstract

The present invention relates to an Escherichia coli strain FMIS2 (E. coli BW25113 (DE3) Δpgi/pACYCDue1-dxs-ispG-idi-ispS) which produces isoprene, and a use thereof and, more specifically, to an Escherichia coli strain FMIS2 which easily produces isoprene in large quantity, and a use of the Escherichia coli strain FMIS2. The present invention provides the Escherichia coli strain FMIS2 (E. coli BW25113 (DE3) Δpgi/pACYCDue1-dxs-ispG-idi-ispS) which easily produces isoprene in large quantity. In addition, provided are a method for producing the Escherichia coli FMIS2, and a use thereof.

Description

E. coli strain FMIS2 producing isoprene and its use {ESCHERICHIA COLI STRAIN FMIS2 FOR PRODUCING ISOPRENE AND USE THEREOF}

The present invention relates to an Escherichia coli strain FMIS2 [ E. coli BW25113 (DE3) Δ pgi / pACYCDue1- dxs-ispG-idi-ispS ] producing isoprene and a use thereof, and more particularly to Escherichia coli strain FMIS2 The use of the strain FMIS2 and the coliform strain FMIS2.

Isoprenoid is an isoprene polymer considered useful in pharmaceuticals, functional foods, spices, fragrances and rubber products. However, natural isoprenoid feeds are limited to concerns about the ecosystem. For this reason, in order to provide an isoprenoid composition with fewer impurities and greater uniformity, often produces isoprenoids such as rubber synthetically.

Production of isoprene by biosynthesis is caused by two distinct metabolic pathways (Julsing et al., Appl Microbiol Biotechnol, 75: 1377-1384, 2007). In eukaryotes and primordial creatures, isoprene is formed through the mevalonate (MVA) pathway, while some of the bacteria and higher plants produce isoprene through the methylerythritol phosphate (MEP) pathway. Isoprene emissions from plants are dependent on light and temperature and increase in association with leaf development. However, the yield of isoprene from naturally occurring organisms is commercially inadequate.

Korean Patent Publication No. 10-2011-0020234

The present invention provides an E. coli strain FMIS2 [E. coli BW25113 (DE3) Δ pgi / pACYCDue1- dxs-ispG-idi-ispS] that can easily produce a large amount of the isoprene. Also provided are methods of producing the E. coli FMIS2 and uses thereof.

The present invention provides Escherichia coli strain FMIS2 ( E. coli BW25113 (DE3) Δ pgi / pACYCDue1- dxs-ispG-idi-ispS ), which is deposited with accession number KCTC 12539BP.

The E. coli strain FMIS2 may be one in which a phospho-6-glucose isomerase ( pgi ) gene is knocked out.

The pgi gene may be composed of the nucleotide sequence of SEQ ID NO: 5.

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The E. coli strain FMIS2 may contain an isoprene synthase gene ( ispS ).

The isoprene synthase gene may be composed of the nucleotide sequence of SEQ ID NO: 1.

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The E. coli strain FMIS2 may contain DXP (1-deoxy-D-xylulose 5-phosphate) synthase gene ( dxs ).

The DXP (1-deoxy-D-xylulose 5-phosphate) synthase gene may be composed of the nucleotide sequence of SEQ ID NO: 2.

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The Escherichia coli strain FMIS2 may comprise an IPP (isopentenyl pyrophosphate) isomerase gene ( idi ).

The IPP (isopentenyl pyrophosphate) isomerase gene may be composed of the nucleotide sequence of SEQ ID NO: 3.

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The E. coli strain FMIS2 may contain a 1-hydroxy-2-methyl-2- (E) -butenyl 4-pyrophosphate synthase gene ( ispG ).

The HMBPP (1-hydroxy-2-methyl-2- (E) -butenyl 4-pyrophosphate) synthase gene can be composed of the nucleotide sequence of SEQ ID NO:

However, the gene is not limited to the above-mentioned nucleotide sequence, and one or a few bases in the nucleotide sequence may be added, deleted or substituted to have a nucleotide sequence exhibiting the same function.

The present invention also relates to a method for producing a gene encoding a phospho-6-glucose isomerase ( pgi ) gene, which comprises knocking out a phospho-6-glucose isomerase ( pgi ) gene in E. coli (step 1); A step of restriction enzyme treatment of the vector pACYCDuet-1 with isoprene synthase gene ( ispS ) and ligating with ligase to prepare pACYC-ispS (step 2); Step (step 3) of treating pACYC-ispS and DXP synthase gene ( dxs ) with restriction enzyme and ligating with ligase to prepare pACYC-dxs-ispS ; (Step 4) of producing pACYC-dxs-idi-ispS by restriction enzyme treatment of the pACYC-dxs-ispS and IPP isomerase gene ( idi ) and ligating with the ligase; (Step 5) of producing pACYC-dxs-ispG-idi-ispS by digesting pACYC-dxs-idi-ispS and HMBPP synthase gene ( ispG ) with restriction enzymes and ligating them with ligase; And introducing the pACYC-dxs-ispG-idi-ispS into Escherichia coli obtained in step 1 (step 6).

The restriction enzymes of step 2 may be Nde I and Bgl II.

The restriction enzymes of step 3 above may be Bam HI and Eco RI.

The restriction enzymes of step 4 above may be Bgl II and Xho II.

The restriction enzyme in step 5 may be SacI .

The knock-out in step 1 is preferably performed by a method of destroying a gene using a gene disruption cassette. However, the knock-out method is not limited thereto, and any gene knockout method used in the art can be used.

The present invention also includes a step of culturing an Escherichia coli strain FMIS2 [ E. coli BW25113 (DE3) Δ pgi / pACYCDue1- dxs-ispG-idi-ispS ] to prepare a culture solution, and recovering isoprene produced from the culture solution To provide an isoprene production process.

The culture is preferably performed at 30 to 40 ° C for 36 to 72 hours, but is not limited thereto.

The culture may be performed in a medium containing a carbon source.

According to the present invention, a recombinant E. coli strain FMIS2 ( E. coli BW25113 (DE3) Δ pgi / pACYCDue1- dxs-ispG-idi-ispS ] excellent in the production of isoprene can be provided and a method for easily synthesizing the same.

Figure 1 shows a MEP-dependent isoprene biosynthesis pathway consisting of a feeding module and a 2-C-methyl-D-erythritol 4-phosphate pathway module.
FIG. 2 is a graph illustrating the activity and yield of isoprene according to each feeding module shown in FIG. 1; FIG.

Hereinafter, the present invention will be described in more detail with reference to examples. The objects, features and advantages of the present invention can be easily understood through the following embodiments. It is to be understood that both the foregoing general description and the following detailed description of the present invention are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Therefore, the scope of the present invention should not be limited by the following examples.

Example:

FMIS2 [ E. coli BW25113 (DE3) DELTA pgi / pACYCDue1- dxs-ispG-idi-ispS ] synthesis

Strain and plasmid synthesis

Gene deletion experiments were performed by the one-step inactivation method (Datsenko and Wanner, Proc Natl Acad Sci USA 2000 97: 6640-6645). The phospho-6-glucose isomerase ( pgi ) gene was disrupted from E. coli strain BW25113 (DE3). destroying pgi cassette (disruption cassette) is used as a template was amplified using the following primers and pKD3: forward primer (CTTCTCAGAAGCGATTATTTCCGGTGAGTGGAAAGGTTATCATATGAATATCCTCCTTAGT, SEQ ID NO: 6) and reverse primer (TACCGTTACGGTCAACATACTTACCGTTGGACTCCATATTGTGTAGGCTGGAGCTGCTTCG, SEQ ID NO: 7). The PCR product thus prepared contains a chloramphenicol resistance gene having a FRT site on the side and 40 base pairs corresponding to the 5 th and 3 rd end regions of pgi and the like.

KD46 plasmid was used as a red recombinant expression vector and introduced into E. coli BW25113 (DE3). The pgi disruption cassette was then introduced into E. coli BW25113 (DE3) / pKD46 to complete homologous recombination. The strains produced have the following genotypes: E. coli BW25113 (DE3) Δ pgi . Disruption of pgi was confirmed by PCR using the following primers: forward primer (TACTCCAAAAACCGCATCAC, SEQ ID NO: 16) and reverse primer (CGAAGAAGTTAGACAGCAGT, SEQ ID NO: 17).

The codon-optimized isoprene synthase gene ( ispS, SEQ ID NO: 1) of Populus alba was purchased from Bioneer (South Korea) and was amplified with pAcYCDuet-1 using Nde I and Bgl II Lt; RTI ID = 0.0 & gt ; pACYC-ispS . ≪ / RTI & gt ; Bam HI and Eco RI were used to link the DXP synthase gene ( dxs ) to pACYC-ispS . Then, an IPP isomerase gene ( idi ) was further ligated using Bgl II and Xho I. This plasmid is designated pACYC-dxs-idi-ispS . for the production of pACYC-dxs-ispG-idi- ispS, using the Sac I was ligated to HMBPP synthase gene (ispG) to pACYC-dxs-idi-ispS. Except for the ispS gene, all DNA inserts were amplified from the E. coli chromosome. All primers used for plasmid synthesis are listed in Table 1.

All primers used in plasmid synthesis ^a primer The sequence (5'-3 ') function IspS-F CGAT CCATGG ATGAGATGTAGCGTGT (SEQ ID NO: 8) for PCR amplification of ispS
IspS-R CGT AGATCT TTAGCGAACAAACGGC (SEQ ID NO: 9) Dxs-F CGTC GGATCC ATGAGTTTTGATATTGCCA (SEQ ID NO: 10) For PCR amplification of dxs Dxs-R CGG GAATTC TTATGCCAGCCAGGCCTTG (SEQ ID NO: 11) Idi-F CGT AGATCT AAGGAGATATAATGCAAACGGAACA (SEQ ID NO: 12) idi for PCR amplification Idi-R CGG CTCGAG TTATTTAAGCTGGGT (SEQ ID NO: 13) IspG-F CAC GAGCTC AGGAGATATACCATGCATAACCAGGCTCCAAT (SEQ ID NO: 14) For PCR amplification of spG IspG-R CGT GAGCTC TTATTTTTCAACCTGCTGAACGT (SEQ ID NO: 15)

^a underline is the restriction enzyme site, and the shadow is the ribosome binding site.

Experimental Example: Isoprene yield analysis

For culture of strains for isoprene production, a 40 mL semi-defined medium consisting of M9 salt, 5 g L ^-1 yeast extract, 10 g L ^-1 essential carbon source and 1 mM thiamine pyrophosphate (TPP) A 160 mL serum bottle was used. For strains containing plasmids, 50 μg mL ^-1 kanamycin and / or 35 μg mL ^-1 chloramphenicol were added to the medium as appropriate antibiotics. One mL of the culture obtained by culturing in a serum bottle overnight was inoculated and cultured at 37 DEG C at a stirring speed of 150 rpm. When the optical density (OD ₆₀₀ ) of the culture reached 0.3 AU, 0.5 mM IPTG (Isopropyl beta -D-1-thiogalactopyranoside) was added. For isoprene accumulation, after adding IPTG, the serum bottle was sealed with a silicon plug, transferred to a shaking incubator (shaking incubator, 150 rpm) at 30 ° C, and cultured for 48 hours.

Cell growth was measured at OD ₆₀₀ conditions. For the calculation of biomass production, the standard curve of dry cell weight is associated with OD ₆₀₀ . Samples were collected and pelletized (at 8,000 g for 10 minutes) in 2-mL pre-weighed pre-dried centrifuge tubes. After discarding the supernatant, the pellet was washed twice with distilled water and dried at 105 ° C. One OD ₆₀₀ unit was 0.29 g L ^-1 (dry cell weight).

Prior to isoprene analysis, the incubated sealed bottle was incubated at 60 ° C for 20 minutes. The concentration of isoprene in the headspace of the serum bottle was analyzed by GC HP6890 equipped with a flame ionization detector (FID). An HPFFAP column (50m x 20m x 34m) was used as the column. Nitrogen was used as the carrier gas (linear velocity 1 mL min ^-1 ). The column temperature was maintained at 50 < 0 > C. The identity of the product was confirmed by commercial standard (Sigma-Aldrich, USA).

In the carbon source assay, the culture samples were pelleted by centrifugation and the collected aqueous supernatant was analyzed using a Waters HPLC equipped with Bio-Rad Aminex HPX-87H column (300 x 7.8 mm). The eluent was pumped (5 mM H 2 SO 4) at a flow rate of 0.4 mL min ^-1 . The column temperature was maintained at 55 占 폚 and the peaks were detected with a Waters 2414 refractive index detector.

 A strain according to each of the five different isoprene formation modules shown in FIG. 1 was prepared (see Table 2 below), and the yield of isoprene according to each module was analyzed. The result is shown in FIG. In Figure 2, the titer refers to the final isoprene concentration. That is, the higher the yield, the better the yield.

 In Figure 2, module 1 is the EMP of strain FMIS 1; Module 2 is the EDP + PPP of strain FMIS 2; Module 3 is the EDP of the strain FMIS 3, module 4 is the PPP of the strain FMIS 4, and module 5 is the result of the Dahms pathway of the strain FMIS 5. Modules 1 and 3 used glucose as a carbon source, and modules 4 and 5 used D-xylose.

The strains used in the experiment Strain
(Strain)  Features (Genotype)  resource FMIS 1 E. coli BW25113 (DE3) / pACYC-dxs-ispG-idi-ispS Direct manufacturing FMIS 2 E. coli BW25113 (DE3)? Pgi / pACYC-dxs-ispG-idi-ispS Direct manufacturing FMIS 3 E. coli BW25113 (DE3) Δpgi Δ gnd / pACYC-dxs-idi-ispG-ispS Direct manufacturing FMIS 4 E. coli W3110 (DE3) / pACYC-dxs-ispG-idi-ispS Direct manufacturing FMIS 5 E. coli W3110 (DE3) ΔxylA / pET28a-xdh; pACYC-dxs-ispG-idi-ispS Direct manufacturing

In Table 2 ,? Indicates that the gene has been destroyed. That is Δpgi, Δgnd, ΔxylA indicates that each of pgi (phospho-6-glucose isomerase ), gnd (6-phosphogluconate dehydrogenase), xylA (β-Xylosidase) that the gene is destroyed.

The genes and enzymes described in the isoprene generation module of Figure 1 are derived from E. coli except that all genes are specifically indicated. The terms used in the isoprene generation module of Fig. 1 refer to the following.

Genetic symbols and enzymes:

dxs, DXP synthase;

ispC, DXP reduction isomerase (DXP reductionisomerase);

ispD, DXP-ME synthase (DXP-ME synthase;

ispE, CDP-ME kinase (CDP-ME kinase);

ispF, MECPP synthase;

ispG, HMBPP synthase;

ispH, HMBPP reductase;

idi, IPP isomerase;

ispS, isoprene synthase (P.alba).

Pathway intermediates:

G3P, glyceraldehyde-3-phosphate;

DXP, 1-deoxy-D-xylulose 5-phosphate;

MEP, 2-C-methyl-D-erythritol 4-phosphate;

CDP-ME, 4-diphosphocytidyl-2-C-methyl-D-erythritol;

CDP-MEP, 4-diphosphocytidyl-2-C-methyl-D-erythritol 2-phosphate;

MECPP, 2-C-methyl-D-erythritol 2,4-cyclopyrophosphate (2-C-methyl-D-erythritol 2,4-cyclopyrophosphate);

HMBPP, 1 -hydroxy-2-methyl-2- (E) -butenyl 4-pyrophosphate;

IPP, isopentenyl pyrophosphate;

DMAPP, dimethylallyl pyrophosphate;

DHAP, dihydroxyacetone 3-phosphate.

As shown in FIG. 2, the FMIS2 strain using a pathway combining EDP (Entner-Doudoroff Pathway) and PPP (Pentose Phosphate Pathway) is used as a feeding module It was confirmed that the yield of isoprene was considerably increased. This shows that when the same mole of G3P and pyruvate are fed, they can exhibit higher isoprene yields. On the other hand, in the case of the module 3, since the substrate (glucose) consumption is smaller than that of the module 2 and the ability to convert the substrate (glucose) into isoprene can be limited and the pgi and gnd genes are all broken down, "post- A problem may arise in that the balance in the production of pyruvate and G3P by EDP is broken through a " post-glycolysis "pathway. Consequently, it is preferable to produce isoprene according to Module 2 using the FMIS2 strain.

Korea Biotechnology Research Institute KCTC12539BP 20140108

<110> MYONGJI UNIVERSITY INDUSTRY AND ACADEMIA COOPERATION FOUNDATION <120> ESCHERICHIA COLI STRAIN FMIS2 FOR PRODUCING ISOPRENE AND USE          THEREOF <130> P14-0167 / MJU <160> 17 <170> Kopatentin 2.0 <210> 1 <211> 1683 <212> DNA <213> Populus alba <400> 1 atgagatgta gcgtgtccac cgaaaatgtg tctttcaccg aaactgaaac cgaagctcgt 60 cgttctgcga actacgaacc taacagctgg gactatgatt acctgctgtc ctccgacacg 120 gacgagtcca tcgaagtata caaagacaaa gcgaaaaagc tggaagccga agttcgtcgc 180 gagattaata acgaaaaagc agaatttctg accctgctgg aactgattga caacgtccag 240 cgcctgggcc tgggttaccg tttcgagtct gatatccgtg gtgcgctgga tcgcttcgtt 300 tcctccggcg gcttcgatgc ggtaaccaag acttccctgc acggtacggc actgtctttc 360 cgtctgctgc gtcaacacgg ttttgaggtt tctcaggaag cgttcagcgg cttcaaagac 420 caaaacggca acttcctgga gaacctgaag gaagatatca aagctatcct gagcctgtac 480 gaggccagct tcctggctct ggaaggcgaa aacatcctgg acgaggcgaa ggttttcgca 540 atctctcatc tgaaagaact gtctgaagaa aagatcggta aagagctggc agaacaggtg 600 aaccatgcac tggaactgcc actgcatcgc cgtactcagc gtctggaagc agtatggtct 660 atcgaggcct accgtaaaaa ggaggacgcg aatcaggttc tgctggagct ggcaattctg 720 gattacaaca tgatccagtc tgtataccag cgtgatctgc gtgaaacgtc ccgttggtgg 780 cgtcgtgtgg gtctggcgac caaactgcac tttgctcgtg accgcctgat tgagagcttc 840 tactgggccg tgggtgtagc attcgaaccg caatactccg actgccgtaa ctccgtcgca 900 aaaatgtttt ctttcgtaac cattatcgac gatatctacg atgtatacgg caccctggac 960 gaactggagc tgtttactga tgcagttgag cgttgggacg taaacgccat caacgacctg 1020 ccggattaca tgaaactgtg ctttctggct ctgtataaca ctattaacga aatcgcctac 1080 gacaacctga aagataaagg tgagaacatc ctgccgtatc tgaccaaagc ctgggctgac 1140 ctgtgcaacg ctttcctgca agaagccaag tggctgtaca acaaatctac tccgaccttt 1200 gacgactact tcggcaacgc atggaaatcc tcttctggcc cgctgcaact ggtgttcgct 1260 tacttcgctg tcgtgcagaa cattaaaaag gaagagatcg aaaacctgca aaaataccat 1320 gacaccatct ctcgtccttc ccatatcttc cgtctgtgca atgacctggc tagcgcgtct 1380 gcggaaattg cgcgtggtga aaccgcaaat agcgtttctt gttacatgcg cactaaaggt 1440 atctccgaag aactggctac cgaaagcgtg atgaatctga tcgatgaaac ctggaaaaag 1500 atgaacaagg aaaaactggg tggtagcctg ttcgcgaaac cgttcgtgga aaccgcgatc 1560 aacctggcac gtcaatctca ctgcacttat cataacggcg acgcgcatac ctctccggat 1620 gagctgaccc gcaaacgcgt tctgtctgta atcactgaac cgattctgcc gtttgaacgc 1680 taa 1683 <210> 2 <211> 1863 <212> DNA <213> Escherichia coli <400> 2 atggttttg atattgccaa atacccgacc ctggcactgg tcgactccac ccaggagtta 60 cgactgttgc cgaaagagag tttaccgaaa ctctgcgacg aactgcgccg ctatttactc 120 gacagcgtga gccgttccag cgggcacttc gcctccgggc tgggcacggt cgaactgacc 180 gtggcgctgc actatgtcta caacaccccg tttgaccaat tgatttggga tgtggggcat 240 caggcttatc cgcataaaat tttgaccgga cgccgcgaca aaatcggcac catccgtcag 300 aaaggcggtc tgcacccgtt cccgtggcgc ggcgaaagcg aatatgacgt attaagcgtc 360 gggcattcat caacctccat cagtgccgga attggtattg cggttgctgc cgaaaaagaa 420 ggcaaaaatc gccgcaccgt ctgtgtcatt ggcgatggcg cgattaccgc aggcatggcg 480 tttgaagcga tgaatcacgc gggcgatatc cgtcctgata tgctggtgat tctcaacgac 540 aatgaaatgt cgatttccga aaatgtcggc gcgctcaaca accatctggc acagctgctt 600 tccggtaagc tttactcttc actgcgcgaa ggcgggaaaa aagttttctc tggcgtgccg 660 ccaattaaag agctgctcaa acgcaccgaa gaacatatta aaggcatggt agtgcctggc 720 acgttgtttg aagagctggg ctttaactac atcggcccgg tggacggtca cgatgtgctg 780 gggcttatca ccacgctaaa gaacatgcgc gacctgaaag gcccgcagtt cctgcatatc 840 atgaccaaaa aaggtcgtgg ttatgaaccg gcagaaaaag acccgatcac tttccacgcc 900 gtgcctaaat ttgatccctc cagcggttgt ttgccgaaaa gtagcggcgg tttgccgagc 960 tattcaaaaa tctttggcga ctggttgtgc gaaacggcag cgaaagacaa caagctgatg 1020 gcgattactc cggcgatgcg tgaaggttcc ggcatggtcg agttttcacg taaattcccg 1080 gatcgctact tcgacgtggc aattgccgag caacacgcgg tgacctttgc tgcgggtctg 1140 gcgattggtg ggtacaaacc cattgtcgcg atttactcca ctttcctgca acgcgcctat 1200 gatcaggtgc tgcatgacgt ggcgattcaa aagcttccgg tcctgttcgc catcgaccgc 1260 gcgggcattg ttggtgctga cggtcaaacc catcagggtg cttttgatct ctcttacctg 1320 cgctgcatac cggaaatggt cattatgacc ccgagcgatg aaaacgaatg tcgccagatg 1380 ctctataccg gctatcacta taacgatggc ccgtcagcgg tgcgctaccc gcgtggcaac 1440 gcggtcggcg tggaactgac gccgctggaa aaactaccaa ttggcaaagg cattgtgaag 1500 cgtcgtggcg agaaactggc gatccttaac tttggtacgc tgatgccaga agcggcgaaa 1560 gtcgccgaat cgctgaacgc cacgctggtc gatatgcgtt ttgtgaaacc gcttgatgaa 1620 gcgttaattc tggaaatggc cgccagccat gaagcgctgg tcaccgtaga agaaaacgcc 1680 attatgggcg gcgcaggcag cggcgtgaac gaagtgctga tggcccatcg taaaccagta 1740 cccgtgctga acattggcct gccggacttc tttattccgc aaggaactca ggaagaaatg 1800 cgcgccgaac tcggcctcga tgccgctggt atggaagcca aaatcaaggc ctggctggca 1860 taa 1863 <210> 3 <211> 549 <212> DNA <213> Escherichia coli <400> 3 atgcaaacgg aacacgtcat tttattgaat gcacagggag ttcccacggg tacgctggaa 60 aagtatgccg cacacacggc agacacccgc ttacatctcg cgttctccag ttggctgttt 120 aatgccaaag gacaattatt agttacccgc cgcgcactga gcaaaaaagc atggcctggc 180 gtgtggacta actcggtttg tgggcaccca caactgggag aaagcaacga agacgcagtg 240 atccgccgtt gccgttatga gcttggcgtg gaaattacgc ctcctgaatc tatctatcct 300 gactttcgct accgcgccac cgatccgagt ggcattgtgg aaaatgaagt gtgtccggta 360 tttgccgcac gcaccactag tgcgttacag atcaatgatg atgaagtgat ggattatcaa 420 tggtgtgatt tagcagatgt attacacggt attgatgcca cgccgtgggc gttcagtccg 480 tggatggtga tgcaggcgac aaatcgcgaa gccagaaaac gattatctgc atttacccag 540 cttaaataa 549 <210> 4 <211> 1119 <212> DNA <213> Escherichia coli <400> 4 atgcataacc aggctccaat tcaacgtaga aaatcaacac gtatttacgt tgggaatgtg 60 ccgattggcg atggtgctcc catcgccgta cagtccatga ccaatacgcg tacgacagac 120 gtcgaagcaa cggtcaatca aatcaaggcg ctggaacgcg ttggcgctga tatcgtccgt 180 gtatccgtac cgacgatgga cgcggcagaa gcgttcaaac tcatcaaaca gcaggttaac 240 gtgccgctgg tggctgacat ccacttcgac tatcgcattg cgctgaaagt agcggaatac 300 ggcgtcgatt gtctgcgtat taaccctggc aatatcggta atgaagagcg tattcgcatg 360 gtggttgact gtgcgcgcga taaaaacatt ccgatccgta ttggcgttaa cgccggatcg 420 ctggaaaaag atctgcaaga aaagtatggc gaaccgacgc cgcaggcgtt gctggaatct 480 gccatgcgtc atgttgatca tctcgatcgc ctgaacttcg atcagttcaa agtcagcgtg 540 aaagcgtctg acgtcttcct cgctgttgag tcttatcgtt tgctggcaaa acagatcgat 600 cagccgttgc atctggggat caccgaagcc ggtggtgcgc gcagcggggc agtaaaatcc 660 gccattggtt taggtctgct gctgtctgaa ggcatcggcg acacgctgcg cgtatcgctg 720 gcggccgatc cggtcgaaga gatcaaagtc ggtttcgata ttttgaaatc gctgcgtatc 780 cgttcgcgag ggatcaactt catcgcctgc ccgacctgtt cgcgtcagga atttgatgtt 840 atcggtacgg ttaacgcgct ggagcaacgc ctggaagata tcatcactcc gatggacgtt 900 tcgattatcg gctgcgtggt gaatggccca ggtgaggcgc tggtttctac actcggcgtc 960 accggcggca acaagaaaag cggcctctat gaagatggcg tgcgcaaaga ccgtctggac 1020 aacaacgata tgatcgacca gctggaagca cgcattcgtg cgaaagccag tcagctggac 1080 gaagcgcgtc gaattgacgt tcagcaggtt gaaaaataa 1119 <210> 5 <211> 1650 <212> DNA <213> Escherichia coli <400> 5 atgaaaaaca tcaatccaac gcagaccgct gcctggcagg cactacagaa acacttcgat 60 gaaatgaaag acgttacgat cgccgatctt tttgctaaag acggcgatcg tttttctaag 120 ttctccgcaa ccttcgacga tcagatgctg gtggattact ccaaaaaccg catcactgaa 180 gagacgctgg cgaaattaca ggatctggcg aaagagtgcg atctggcggg cgcgattaag 240 tcgatgttct ctggcgagaa gatcaaccgc actgaaaacc gcgccgtgct gcacgtagcg 300 ctgcgtaacc gtagcaatac cccgattttg gttgatggca aagacgtaat gccggaagtc 360 aacgcggtgc tggagaagat gaaaaccttc tcagaagcga ttatttccgg tgagtggaaa 420 ggttataccg gcaaagcaat cactgacgta gtgaacatcg ggatcggcgg ttctgacctc 480 ggcccataca tggtgaccga agctctgcgt ccgtacaaaa accacctgaa catgcacttt 540 gtttctaacg tcgatgggac tcacatcgcg gaagtgctga aaaaagtaaa cccggaaacc 600 acgctgttct tggtagcatc taaaaccttc accactcagg aaactatgac caacgcccat 660 agcgcgcgtg actggttcct gaaagcggca ggtgatgaaa aacacgttgc aaaacacttt 720 gcggcgcttt ccaccaatgc caaagccgtt ggcgagtttg gtattgatac tgccaacatg 780 ttcgagttct gggactgggt tggcggccgt tactctttgt ggtcagcgat tggcctgtcg 840 attgttctct ccatcggctt tgataacttc gttgaactgc tttccggcgc acacgcgatg 900 gacaagcatt tctccaccac gcctgccgag aaaaacctgc ctgtactgct ggcgctgatt 960 ggcatctggt acaacaattt ctttggtgcg gaaactgaag cgattctgcc gtatgaccag 1020 tatatgcacc gtttcgcggc gtacttccag cagggcaata tggagtccaa cggtaagtat 1080 gttgaccgta acggtaacgt tgtggattac cagactggcc cgattatctg gggtgaacca 1140 ggcactaacg gtcagcacgc gttctaccag ctgatccacc agggaaccaa aatggtaccg 1200 tgcgatttca tcgctccggc tatcacccat aacccgctct ctgatcatca ccagaaactg 1260 ctgtctaact tcttcgccca gaccgaagcg ctggcgtttg gtaaatcccg cgaagtggtt 1320 ggcaggaat atcgtgatca gggtaaagat ccggcaacgc ttgactacgt ggtgccgttc 1380 aaagtattcg aaggtaaccg cccgaccaac tccatcctgc tgcgtgaaat cactccgttc 1440 agcctgggtg cgttgattgc gctgtatgag cacaaaatct ttactcaggg cgtgatcctg 1500 aacatcttca ccttcgacca gtggggcgtg gaactgggta aacagctggc gaaccgtatt 1560 ctgccagagc tgaaagatga taaagaaatc agcagccacg atagctcgac caatggtctg 1620 attaaccgct ataaagcgtg gcgcggttaa 1650 <210> 6 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for kpgi <400> 6 cttctcagaa gcgattattt ccggtgagtg gaaaggttat catatgaata tcctccttag 60 t 61 <210> 7 <211> 61 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for kpgi <400> 7 taccgttacg gtcaacatac ttaccgttgg actccatatt gtgtaggctg gagctgcttc 60 g 61 <210> 8 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for ispS <400> 8 cgatccatgg atgagatgta gcgtgt 26 <210> 9 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for ispS <400> 9 cgtagatctt tagcgaacaa acggc 25 <210> 10 <211> 29 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for dxs <400> 10 cgtcggatcc atgagttttg atattgcca 29 <210> 11 <211> 28 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for dxs <400> 11 cgggaattct tatgccagcc aggccttg 28 <210> 12 <211> 34 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for idi <400> 12 cgtagatcta aggagatata atgcaaacgg aaca 34 <210> 13 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for idi <400> 13 cggctcgagt tatttaagct gggt 24 <210> 14 <211> 41 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for ispG <400> 14 cacgagctca ggagatatac catgcataac caggctccaa t 41 <210> 15 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for ispG <400> 15 cgtgagctct tatttttcaa cctgctgaac gt 32 <210> 16 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Forward primer for pgi <400> 16 tactccaaaa accgcatcac 20 <210> 17 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Reverse primer for pgi <400> 17 cgaagaagtt agacagcagt 20

Claims (20)

Escherichia coli strain FMIS2 deposited with Accession No. KCTC 12539BP, isoprene-producing.
The method according to claim 1,
Wherein the E. coli strain FMIS2 is knocked out of a phospho-6-glucose-isomerase ( pgi ) gene.
The method of claim 2,
Wherein the pgi gene comprises the nucleotide sequence of SEQ ID NO: 5.
The method according to claim 1,
The Escherichia coli strain FMIS2 comprises an isoprene synthase gene.
The method of claim 4,
Wherein said isoprene synthase gene comprises the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 1,
Wherein said Escherichia coli strain FMIS2 comprises a DXP (1-deoxy-D-xylulose 5-phosphate) synthase gene.
The method of claim 6,
Wherein the DXP synthase gene comprises the nucleotide sequence of SEQ ID NO: 2.
The method according to claim 1,
The Escherichia coli strain FMIS2 comprises an IPP (isopentenyl pyrophosphate) isomerase gene.
The method of claim 8,
Wherein the IPP isomerase gene comprises the nucleotide sequence of SEQ ID NO: 3.
The method according to claim 1,
Wherein the Escherichia coli strain FMIS2 comprises an HMBPP (1-hydroxy-2-methyl-2- (E) -butenyl 4-pyrophosphate) synthase gene.
The method of claim 10,
Wherein the HMBPP synthase gene comprises the nucleotide sequence of SEQ ID NO: 4.
Knocking out the phospho-6-glucose isomerase ( pgi ) gene in E. coli (step 1);
A step of restriction enzyme treatment of the vector pACYCDuet-1 with isoprene synthase gene ( ispS ) and ligating with ligase to prepare pACYC-ispS (step 2);
Step (step 3) of treating pACYC-ispS and DXP synthase gene ( dxs ) with restriction enzyme and ligating with ligase to prepare pACYC-dxs-ispS ;
(Step 4) of producing pACYC-dxs-idi-ispS by restriction enzyme treatment of the pACYC-dxs-ispS and IPP isomerase gene ( idi ) and ligating with the ligase;
(Step 5) of producing pACYC-dxs-ispG-idi-ispS by digesting pACYC-dxs-idi-ispS and HMBPP synthase gene ( ispG ) with restriction enzymes and ligating them with ligase; And
(Step 6) of introducing pACYC-dxs-ispG-idi-ispS into Escherichia coli obtained in step 1.
In claim 12,
Wherein the restriction enzymes of step 2 are Nde I and Bgl II.
In claim 12,
Wherein the restriction enzymes of step 3 are Bam HI and Eco RI.
In claim 12,
Wherein the restriction enzymes of step 4 are Bgl II and Xho II.
In claim 12,
Wherein the restriction enzyme of step 5 is Sac I.
In claim 12,
Wherein the knockout of step 1 is carried out using a gene disruption cassette.
Culturing the strain of claim 1 to produce a culture medium; and
And recovering the isoprene produced from the culture liquid.
19. The method of claim 18,
Wherein the culturing is performed at 30 to 40 DEG C for 36 to 72 hours.
19. The method of claim 18,
Wherein the culture is carried out in a medium containing a carbon source.

Images