KR101578155B1 - A Pharmaceutical composition comprising inhibitors of heme oxygenase-1 for the prevention and treatment of muscle atrophy - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing and treating muscle atrophy comprising an inhibitor of heme oxygenase-1 (HO-1) as an active ingredient. The HO- The increase of expression by the control of box protein 01 (Forkhead box protein 01, Fox01) deteriorates the muscle damage, and when HO-1 is inhibited, the muscle damage due to muscle atrophy is decreased. In the muscle atrophy animal model, HO- 1 (heme oxygenase-1, HO-1) as a composition for prevention and treatment of muscle atrophy by confirming that muscle damage is increased when the inducer substance expressing Can be used.

Description

TECHNICAL FIELD The present invention relates to a pharmaceutical composition for preventing and treating muscular atrophy comprising hemoxigenase-1 inhibitor as an active ingredient,

The present invention relates to a composition for preventing or treating muscular atrophy comprising heme oxygenase-1 (HO-1) inhibitor as an active ingredient, or a composition for preventing or treating muscle damage.

Atrophy can be defined as loss of muscle tissue caused by not using muscles or damage to the nerves that dominate the muscles or muscles themselves. In general, the muscles are not used, resulting in severe muscle strength loss and gradually progressing to muscle atrophy. In addition, people living in places without gravity also experience muscle weakness by decreasing calcium and muscle strength There may be cases where the symptoms decrease. Myasthenia gravis, dystrophy: Progressive muscular dystrophy, myotonic dystrophy, Duchen type, Becker type, bony type, facial shoulder brachial type, and inflammation of the muscle itself. And muscular atrophy caused by damage to the nerves is caused by spinal muscular amyotrophy: Verdney-Hoffmann type, Kugelberg-Velenders disease, amyotrophic lateral sclerosis (ALS) Lou Gehrig's disease, spinobular muscular atrophy, and Kennedy's disease.

Muscle is an important tissue that stores proteins in the body. However, when oxidative stress and denervation occur in muscles, the protein is excessively degraded and causes skeletal muscle exhaustion (Sacheck, JM et al, 2007, FASEB J, 21, 140 -55). Proteolytic systems have been reported to be important for contraction of contractile proteins and organelles and for muscle fiber shrinkage. In particular, MAFbx (muscular atrophy F-box) and MuRF1 (muscle-specific ring finger protein 1), two muscle-specific ubiquitin ligases, Contributing to muscle atrophy (Bodine, SC et al, 2001, Science, 294, 1704-8). MAFbx and MuRF1 are referred to as atrogenes and these two genes increase through the activation of myogenin and fork headbox protein O (FoxO) during the development of muscle atrophy. MuRF1 or MAFbx gene deficient mice were shown to protect against removal-induced muscle atrophy. Skeletal muscle mass decreased in FoxO1 transgenic mice. On the contrary, when FoxO1 expression was knocked down and blocked, up-regulation of MAFbx gene was observed. In addition, the inflammatory cytokines and nuclear factor kB (NF-kB) signaling pathways are involved in muscle atrophy through the production of reactive oxygen species. In addition, ROS regulation is associated with severe muscle loss.

In another study, nuclear factor erythrocyte 2-related factor 2 (NRF2) / MAF and cytoplasmic inhibition, Kelch-like ECH-related protein 1 (KEAP1), are essential for cell adaptation to oxidative stress (Kensler, TW et al, 2007, Ammi Rev Pharmacol Toxicol 47, 89-116). Oxidative stress separates NRF2 from KEAP1 in the cytoplasm and induces nuclear localization of NRF2. Nuclear NRF2 is an antioxidant (ARE), heme oxygenase-1 (HO-1), glutathione S-transferase α 1/2 (GSTA1 / 2), and NAD (P) H: quinone oxidoreductase 1 Directly binds to the gene promoter of antioxidants and their expression protects against induction of tissue damage due to oxidative stress. However, somatic mutations of NRF2 and KEAP1 have been reported in lung cancer patients and have been reported to inhibit KEAP1-mediated suppression, causing drug resistance in tumors (Hayes, JD et al, 2009, Trends Biochem Sci 34, 176-88). Although NRF2 plays an important role in protecting against oxidative stress, there has been no clear report on the important protective function of NRF2 from damage-induced atrophy.

As a result, the present inventors have found that HO-1 increases expression by regulating fork head box protein 01 (Fox01) during muscle atrophy, thereby deteriorating muscle damage And that the inhibition of HO-1 reduces muscle damage due to muscle atrophy and that when the inducer inducing HO-1 is prolonged in an atrophy animal model, muscle damage is increased, (Heme oxygenase-1, HO-1) can be effectively used as a composition for preventing and treating muscle atrophy. The present invention has been completed based on this finding.

It is an object of the present invention to provide a composition for preventing or treating muscular atrophy comprising heme oxygenase-1 (HO-1) inhibitor as an active ingredient, or a composition for preventing or treating muscle damage.

In order to achieve the above object,

The present invention provides a pharmaceutical composition for the prevention and treatment of muscular atrophy comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The present invention also provides a pharmaceutical composition for preventing and treating muscle damage comprising as an active ingredient an expression or activity inhibitor of heme oxygenase-1 (HO-1).

In addition,

i) measuring the expression or activity of hemeoxygenase-1 in cells or tissues separated from the subject; And

ii) judging that an increase in muscle atrophy or muscle damage occurs when the expression or activity of hemeoxygenase-1 in step i) according to the invention is increased relative to a normal control,

Lt; RTI ID = 0.0 > expression or activity < / RTI > to provide information on the monitoring or diagnosis of atherosclerosis or muscle damage.

In addition, the present invention provides a kit for monitoring or diagnosis of amyotrophic or muscular damage, comprising a primer pair or an aptamer binding to a hemoxigenin-1 gene, or an antibody binding to a hemoxigenin-1.

In addition,

i) treating the test composition or compound with a cell expressing a hemoxigenin-1 protein, or a hemoxigenin-1 protein;

ii) measuring the expression or activity of hemeoxygenase-1 in step i) according to the invention; And

iii) selecting a composition or compound to be tested in which the expression or activity of hemeoxygenase-1 is reduced in step ii) according to the invention compared to a normal control,

The present invention provides a screening method for candidate therapeutic agents for muscular atrophy or muscle damage.

The present invention also provides a health food for preventing and ameliorating muscular dystrophy comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The present invention also provides a health food for preventing and treating muscular injury comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The present invention relates to a pharmaceutical composition for preventing and treating muscle atrophy comprising an inhibitor of heme oxygenase-1 (HO-1) as an active ingredient. The HO- The increase of expression by the control of box protein 01 (Forkhead box protein 01, Fox01) deteriorates the muscle damage, and when HO-1 is inhibited, the muscle damage due to muscle atrophy is decreased. In the muscle atrophy animal model, HO- 1 (heme oxygenase-1, HO-1) as a composition for prevention and treatment of muscle atrophy by confirming that muscle damage is increased when the inducer substance expressing Can be used.

Figure 1 is a diagram showing the skeletal weighing of the tibialis anterior (TA) and gastrocnemius (GN) skeletal nerve injured mouse (NI) and control (SH).
FIG. 2 is a graph showing the expression of proteins in the sciatic nerve injured mouse group (NI) and the control group (SH) in the tibialis anterior (TA) and gastrocnemius (GN) skeleton.
Figure 3 is an illustration of mRNA expression of atrogenes, inflammatory cytokines, and myogenin during the development of muscle atrophy;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*), P <0.005 (**) and P <0.0005 (***).
FIG. 4 shows the expression of NRF2 and Fox01 by immunoblotting during the development of muscle atrophy in mouse group (NI) and control group (SH) in which the sciatic nerve was exposed and the sciatic nerve was damaged.
FIG. 5 shows H & E staining and NRF2 and Fox01 expression by immunofluorescence staining for muscle atrophy during the development of muscle atrophy in mouse group (NI) and control group (SH) in which the sciatic nerve was exposed by exposing the sciatic nerve.
FIG. 6 is a graph showing the effect of NRF2 gene expression on muscle atrophy in NRF2 knockout mouse and rat sciatic nerve injured mouse group (NI) and control group (SH) TA) and gastrocnemius (GN) muscle wasting quantities;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*), P <0.005 (**) and P <0.0005 (***).
FIG. 7 is a histological diagram showing the degree of muscle damage of the sciatic nerve injured (NI) normal mouse control group and the NRF2 knockout mouse group by H &amp; E staining.
Figure 8 shows MyHC, HO-1, atrogenes, myogenin and catalase expression in the sciatic nerve injured (NI) normal mouse control and NRF2 knockout mouse group Fig.
Figure 9 quantitatively shows the expression of atrophy and inflammatory cytokine mRNA in the normal mouse control (WT) and NRF2 knockout mice (KO).
FIG. 10 is a graph comparing quantitatively the expression of NRF2 target gene mRNA in the mouse group (NI) and the control (SH) normal mouse control (WT) and NRF2 knockout mouse group (KO) .
11 shows the expression of fork headbox protein 01 (Fox01) in the normal mouse control (WT) and NRF2 knockout mouse group (KO) of the control (SH) and sciatic nerve injured mouse group (NI).
12 is a graph showing the expression of FoxO1 expression at the same time as staining nuclei of muscle fibers in the tissues of the normal mouse control group (WT) and the NRF2 knockout mouse group (KO) of the control group (SH) and sciatic nerve injured mouse group (NI) to be.
Figure 13 shows the effect of fork headbox protein 01 (Fox01) expression on 293T cells on the regulation of HO-1 gene transcription. In the quantitative analysis, the results are expressed as mean ± standard error of the means, SEM), and Student's t-test analysis showed significant results when the P value was less than 0.05. Significant results were P <0.05 (*), P <0.005 (**) and P < 0.0005 (***).
Figure 14 shows the HO-1 promoting activity by NRF2 and fork headbox protein 01 expression in 293T cells;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*) and P <0.005 (**).
FIG. 15 shows the binding force of the HO-1 gene promoter of the fork head box protein 01 in the control (SH) and sciatic nerve injured (NI) normal mice by immuno-gene sedimentation.
FIG. 16 is a graph showing the binding capacity of the fork head box protein 01 to the HO-1 gene promoter in the control (SH) and sciatic nerve injured (NI) normal mice by immuno-gene settling and real time PCR method;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*).
FIG. 17 shows KEAP1 and BACH1 expression by NRF2 inhibition in normal mouse control and NRF2 knockout mice of the control (SH) and sciatic nerve injured mouse group (NI).
FIG. 18 is a graph showing that the promotion of the activity of the HO-1 promoter by the expression of NRF2 and FoxO1 in 293T cells is inhibited by BACH1 expression;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were shown as P <0.005 (**).
FIG. 19 is a chart showing reduction of muscle fiber atrophy and MyHC expression by dexamethasone treatment in C2C12 cells. FIG.
Figure 20 quantitatively shows increased expression of MAFbx, Murf1 and HO-1 in atrophied muscle cells by treating dexamethasone;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*) and P <0.0005 (***).
FIG. 21 is a graph showing the expression of FoxO1 gene in comparison with a control group by treating siRNA that inhibits the expression of FoxO1 gene in fully differentiated myocytes.
Figure 22 quantitatively expresses HO-1 expression by inhibiting the expression of the FoxO1 gene in fully differentiated myocytes and treating dexamethasone;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*).
FIG. 23 shows the expression of HO-1 protein in comparison with the control group by treating siRNAs that inhibit the expression of HO-1 gene in fully differentiated myocytes;
24 is a graph showing a quantitative decrease in muscle atrophy gene expression caused by inhibition of HO-1 gene expression;
In the quantitative analysis, the results are expressed as mean ± standard error of the means (SEM) and analyzed using the Student's t-test. When the P value was less than 0.05, , And significant results were expressed as P <0.05 (*) and P <0.005 (**).
FIG. 25 is a diagram showing protein expression of MyHc, Ho-1, Fox01 and MuRF1 by treating hematopoietic stem cells with hematin.
FIG. 26 is a graph showing the morphological change of myogenic differentiated cells and the decrease of MyHC expression by immunofluorescence after treatment with hemin.
FIG. 27 is a histological diagram of injured muscles in which hemin is ingested in vivo. FIG.
FIG. 28 shows that the expression of antioxidant enzymes such as GSTA1 / 2 and NQO1 is increased by NRF2 activation and that NRF2 increases the expression of HO-1 for muscle regeneration and protection during muscle injury, The expression of HO-1 by NRF2 was blocked and the expression of HO-1 by FoxO1 was increased. The activation of FoxO1 increased the expression of MAFbx, which is a muscle atrophy inducer, Lt; RTI ID = 0.0 &gt; induction. &Lt; / RTI &gt;

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prevention and treatment of muscular atrophy comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The heme oxygenase-1 is preferably composed of the amino acid sequence of SEQ ID NO: 1 (NP_002124.1; human HO-1) or SEQ ID NO: 2 (NP_034572.1; mouse HO-1) It is not.

It is preferable that the hemoxigenase-1 is encoded by the nucleotide sequence of SEQ ID NO: 3 (NM_002133.2; human, HO-1) or SEQ ID NO: 4 (NM_010442.2, mouse HO-1) But is not limited thereto.

The expression inhibitor of hemeoxygenase-1 is selected from the group consisting of an antisense nucleotide complementarily binding to the mRNA of the hemoxigenin-1 gene, a short interference RNA (short interfering RNA) and a short hairpin RNA But it is not limited thereto.

The activity inhibitor of hemeoxygenase-1 is preferably any one selected from the group consisting of compounds that bind complementarily to hemeoxygenase-1, peptides, peptide mimetics, and antibodies, but are not limited thereto .

The muscular atrophy is preferably skeletal muscle atrophy, but is not limited thereto.

Preferably, the hemoxigenase-1 is expressed or acts independently of NRF2 (Nuclear factor erythroid 2-related factor 2), but is not limited thereto.

Preferably, the hemoxigenase-1 is expressed or acted dependent on FoxO1 (forkhead box protein O1), but is not limited thereto.

In a specific example of the present invention, the present inventors used sciatic nerve injured mouse group (NI) and sciatic nerve injured mouse group (NI) to confirm the increase of NRF2 and Fox01 expression in skeletal injury caused by sciatic nerve injury in vivo The skeletal weights of the tibialis anterior (TA) and gastrocnemius (GN) skins in the control group (SH) showed that the tibialis anterior (TA) and gastrocnemius, GN) skeleton weight was reduced (see Fig. 1).

The present inventors also confirmed protein expression in the sciatic nerve injured mouse group (NI) and the control group (SH) in the tibialis anterior (TA) and gastrocnemius (GN) skeletons. As a result, the mouse tibialis Anterior, TA) skeletal muscle showed a decrease in MyHC expression after 7 days, and antioxidant expression such as heme oxygenase-1 (HO-1) and catalase increased (See Fig. 2).

In addition, the present inventors have examined mRNA expression of atrogenes, inflammatory cytokines, and myogenin during muscle atrophy and found that the sciatic nerve is exposed to the sciatic nerve It was found that mRNA expression of atrogenes, inflammatory cytokines, and myogenin was increased in the nerve-impaired mouse group (see FIG. 3).

The present inventors also examined the expression of NRF2 and Fox01 during the development of muscle atrophy in mouse group (NI) and control group (SH) in which the sciatic nerve was exposed to the sciatic nerve, and as a result, And the expression of NRF2 and Fox01 was increased in the injured mouse group (NI) (see Fig. 4 and Fig. 5). Thus, NRF2 and Fox01 expression were found to be involved in the induction and prevention of muscle atrophy.

In addition, in order to examine the effect of NRF2 gene expression on muscle atrophy, the present inventors investigated the effect of NRF2 gene expression on muscle atrophy in NRF2 knockout mice and rat sciatic nerve injured mice (NI) and control (SH) TA) and muscle wasting of gastrocnemius (GN) were examined. As a result, the tibialis anterior (TA) and the tibialis anterior were found in the NR group and the mouse group (NI) ) And muscle wasting amount of gastrocnemius (GN) were similar (see FIG. 6).

Further, the present inventors confirmed the muscle damage of the sciatic nerve injured (NI) normal mouse control group and the NRF2 knockout mouse group, The sciatic nerve is damaged (NI) Muscle damage was observed in the normal mouse control group and the NRF2 knockout mouse group (see FIG. 7).

In order to confirm the expression of MyHc, HO-1, atrogenes, myogenin, and catalase in the sciatic nerve injured (NI) normal mouse control group and the NRF2 knockout mouse group, Damaged (NI) When MyHc, HO-1, atrogenes, myogenin, and catalase were compared in normal mouse control and NRF2 knockout mice, myHc expression when nerve injury or MuRF1 and HO-1 were induced (See FIG. 8).

In addition, real-time PCR was performed to confirm the expression of atrophy and inflammatory cytokine mRNA in the normal mouse control group (WT) and the NRF2 knockout mouse group (KO). As a result, In the control (WT) and NRF2 knockout mice (KO), it was confirmed that the atrophy and the inflammatory cytokine mRNA were similarly expressed (see FIG. 9).

In addition, the present inventors confirmed the association of NRF2 target gene mRNA expression in normal mouse control group (WT) and NRF2 knockout mouse group (KO) of mouse group (NI) and control group (SH) Real-time PCR was performed to confirm that the NRF2 knockout mouse group did not increase GSTA1 / 2 and NQO1, which are the target genes of NRF2, and that the sciatic nerve injured (NI) NRF2 It was confirmed that heme oxygenase-1 (HO-1), another target gene of NRF2, was similarly expressed in the knockout mouse group (see FIG. 10). Therefore, it was confirmed that the hemoxigenase-1 expression at the atrophy does not depend on NRF2 expression.

In order to confirm the effect of the regulation of the fork head box protein 01 (Fox01) on the expression of HO-1, the present inventors established an expression vector which is transformed into 293T cells, and the cells were treated with NRF2 The vector for expression of Fox01 was inserted to prepare a transformed cell.

The present inventors also confirmed the expression of the fork headbox protein 01 (Fox01) in the normal mouse control (WT) and the NRF2 knockout mouse group (KO) of the control group (SH) and the sciatic nerve injured mouse group (NI) It was confirmed that the expression of the fork headbox protein 01 (Fox01) was increased in the sciatic nerve injured (NI) normal mouse control group and the NRF2 knockout mouse group, and the nuclear stain of the muscle fiber was observed and at the same time, FoxO1 expression was observed See Fig. 12).

In addition, the present inventors confirmed that the expression of fork headbox protein 01 (Fox01) on 293T cells affects the regulation of transcription of HO-1 gene. As a result, it was confirmed that fork headbox protein 01 stimulates HO-1 promoting activity in a concentration- (See Fig. 13).

The present inventors also confirmed that HO-1 promoting activity by expression of NRF2 and fork headbox protein 01 in 293T cells resulted in a cooperative effect of promoting HO-1 activation between NRF2 and fork headbox protein 01 expression, (See Fig. 14).

In addition, the inventors of the present invention found that the binding strength of the HO-1 gene promoter of the fork headbox protein 01 in the control (SH) and sciatic nerve injured (NI) normal mice was measured by immunoprecipitation (ChIP) Reaction qPCR was performed, and it was confirmed that the fork headbox protein 01 was directly bound to the HO-1 gene promoter (stimulated atrophy) (see FIG. 15 and FIG. 16).

In addition, the present inventors confirmed the expression of KEAP1 and BACH1 by NRF2 inhibition in a normal mouse control group and a NRF2 knockout mouse of a control group (SH) and a sciatic nerve injured mouse group (NI). As a result, KEAP1 expression was low in the normal mouse control group and NRF2 knockout mice of the group (NI), and no change was observed in the sciatic nerve-damaged (NI) normal mouse control group and the NRF2 knockout mouse group. (NI) normal mouse control and NRF2 knockout mouse group (see FIG. 17).

In addition, the present inventors confirmed that promoting the activation of the HO-1 promoter by the expression of NRF2 and FoxO1 in 293T cells was inhibited by the expression of BACH1. As a result, the expression of HO-1 promoter by NRF2 and FoxO1 expression (promoter) was inhibited, and it was confirmed that it did not affect the fork headbox protein 01-mediated HO-1 activity (see FIG. 18). Therefore, it was confirmed that BACH1 inhibits NRF2 expression by inducing Fox01 expression to induce H0-1 gene transcription during skeletal atrophy.

In addition, the inventors of the present invention examined in vitro experiments of C2C12 cells treated with dexamethasone to confirm reduction of muscle fiber atrophy and MyHC expression. As a result, when dexamethasone was treated with the cells, (morphologic) of myocytes were changed, and MyHC expression was decreased (see FIG. 19).

The present inventors also examined the expression of MAFbx, Murf1, and HO-1 in atrophy muscle cells by treating dexamethasone. As a result, dexamethasone was treated to inhibit atrogenesis in atrophied muscle cells, And mRNA expression of HO-1 were increased (see Fig. 20).

In addition, the present inventors have also found that transformed cells When FoxO1 siRNA was used to inhibit gene expression, FoxO1 gene expression in the transformed cells treated with siRNAs inhibiting the expression of FoxO1 gene in completely differentiated myocytes was significantly increased in FoxO1 And the expression level was decreased (see Fig. 21).

In addition, the present inventors confirmed the expression of HO-1 by inhibiting the expression of FoxO1 gene in completely differentiated myocytes and treating dexamethasone. As a result, the expression of HO- 1 expression, HO-1 expression was not significantly induced in cells inhibiting the expression of FoxO1 gene (see FIG. 22). Therefore, it was confirmed that FoxO1 gene expression induces HO-1 expression during muscle atrophy.

In addition, the present inventors compared the expression of HO-1 protein with the control group by treating siRNAs that inhibit the expression of HO-1 gene in completely differentiated myocytes and found that the expression of the atypical regulator (See Fig. 23 and Fig. 24).

In addition, the present inventors examined the expression of MyHc, Ho-1, Fox01 and MuRF1 protein by treating hematopoietic stem cells with hematin, and found that expression of HO-1 by HO-1 inducing factor, And the expression of MyHC was decreased, and it was confirmed that the expression of HO-1 and MuRF1 was increased through induction of FoxO1 (see FIG. 25).

The present inventors also examined the morphological changes and MyHC expression of the myeloid cells by treating Hemin to find that the hematin-treated cells were flattened and shrinked, And the expression of MyHC was decreased (see FIG. 26).

In addition, the inventors of the present invention confirmed that damaged muscles were ingested with hemin in vivo. As a result, it was confirmed that muscles were injured in mouse group consumed with hemin for 7 days (see Fig. 27) Overexpression of HO-1 was found to have an adverse effect on myofibers.

In addition, the present inventors have found that the expression of antioxidant enzymes such as GSTA1 / 2 and NQO1 is increased by NRF2 activation for muscle regeneration and protection during muscle injury, while NRF2 can increase the expression of HO-1, As the expression of BACH increases, HO-1 expression by NRF2 is blocked and HO-1 expression by FoxO1 activation is increased. FoxO1 activation increases MAFbx expression, which is a muscle atrophy inducer Causing muscle injury induction (see Fig. 28).

Therefore, HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1, resulting in muscle atrophy (Heme oxygenase-1, HO-1, HO-1, HO-1, and HO-1) 1) can be effectively used as a composition for preventing and treating muscle atrophy.

The present invention also provides a pharmaceutical composition for preventing and treating muscle damage comprising as an active ingredient an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1. 1 (heme oxygenase-1, HO-1), by confirming that muscle damage is increased when prolonged administration of an inducer that expresses HO-1 in an animal model of muscle atrophy, Can be usefully used as a pharmaceutical composition for preventing and treating muscle damage.

The composition of the present invention may contain at least one active ingredient which exhibits the same or similar functions in addition to the above components.

The composition of the present invention may further comprise a pharmaceutically acceptable additive, wherein pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone, colloidal silicon dioxide, calcium hydrogen phosphate, lactose Starch glycolate, sodium starch glycolate, carnauba wax, synthetic aluminum silicate, stearic acid, magnesium stearate, aluminum stearate, calcium stearate, calcium stearate, , White sugar, dextrose, sorbitol and talc. The pharmaceutically acceptable additives according to the present invention are preferably included in the composition in an amount of 0.1 to 90 parts by weight, but are not limited thereto.

That is, the composition of the present invention can be administered in various formulations of oral and parenteral administration at the time of actual clinical administration. In the case of formulation, a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, . &Lt; / RTI &gt; Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose, Sucrose, lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions and syrups, and various excipients such as wetting agents, sweetening agents, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are commonly used simple diluents . Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The composition of the present invention may be administered orally or parenterally in accordance with the intended method, and may be administered orally, parenterally or intraperitoneally, rectally, subcutaneously, intravenously, intramuscularly, . The dosage varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of disease.

The composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the compound according to the present invention may vary depending on the age, sex, and body weight of the patient. In general, 0.1 mg to 100 mg, preferably 0.5 mg to 10 mg per kg of body weight is administered daily or every other day Or one to three times a day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

In addition,

i) measuring the expression or activity of hemeoxygenase-1 in cells or tissues separated from the subject; And

ii) judging that the degree of atrophy or muscle damage is increased when the expression or activity of hemeoxygenase-1 in step i) according to the invention is increased relative to the normal control, Lt; RTI ID = 0.0 &gt; expression or activity &lt; / RTI &gt; assays to provide monitoring or diagnostic information.

The HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1. 1 (heme oxygenase-1, HO-1), by confirming that muscle damage is increased when prolonged administration of an inducer that expresses HO-1 in an animal model of muscle atrophy, Can be usefully used as a method for measuring expression or activity of hemeoxygenase-1 to provide information on the monitoring or diagnosis of muscular dystrophy or muscle damage.

In addition, the present invention provides a kit for monitoring or diagnosis of amyotrophic or muscular damage, comprising a primer pair or an aptamer binding to a hemoxigenin-1 gene, or an antibody binding to a hemoxigenin-1.

The HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1. 1 (heme oxygenase-1, HO-1), by confirming that muscle damage is increased when prolonged administration of an inducer that expresses HO-1 in an animal model of muscle atrophy, May be usefully employed as kits for monitoring or diagnosis of muscular atrophy or muscle damage.

In addition,

i) treating the test composition or compound with a cell expressing a hemoxigenin-1 protein, or a hemoxigenin-1 protein;

ii) measuring the expression or activity of hemeoxygenase-1 in step i) according to the invention; And

iii) Screening method of a candidate substance for treating a prophylactic or muscular injury, comprising the step of selecting a test composition or a compound in which the expression or activity of hemeoxygenase-1 is reduced in step ii) according to the present invention as compared to a normal control .

The HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1. 1 (heme oxygenase-1, HO-1), by confirming that muscle damage is increased when prolonged administration of an inducer that expresses HO-1 in an animal model of muscle atrophy, May be usefully used as a screening method for candidate therapeutic agents for amyotrophy or muscle damage.

The present invention also provides a health food for preventing and ameliorating muscular dystrophy comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

Preferably, the atrophic disease is skeletal muscle atrophy, but the present invention is not limited thereto.

The present invention also provides a health food for preventing and treating muscular injury comprising, as an active ingredient, an expression or activity inhibitor of heme oxygenase-1 (HO-1).

The HO-1 of the present invention increases expression by the regulation of fork head box protein 01 (Fox01) during muscle atrophy, thereby exacerbating muscle damage and inhibiting HO-1. 1 (heme oxygenase-1, HO-1), by confirming that muscle damage is increased when prolonged administration of an inducer that expresses HO-1 in an animal model of muscle atrophy, Can be effectively used as an active ingredient of a health food for preventing or ameliorating muscular dystrophy or a health food for preventing and treating muscular injury.

There is no particular limitation on the kind of the food. Examples of the foods to which the above substances can be added include dairy products including dairy products, meat, sausage, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen and other noodles, gums, ice cream, Beverages, alcoholic beverages and vitamin complexes, dairy products, and dairy products, all of which include health functional foods in a conventional sense.

The expression or activity inhibitor of heme oxygenase-1 (HO-1) of the present invention can be added directly to the food or can be used together with other food or food ingredients and can be used appropriately according to conventional methods have. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (for prevention or improvement). Generally, the amount of the compound in the health food may be 0.1 to 90 parts by weight of the total food. However, in the case of long-term consumption intended for health or hygiene purposes or for health control purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range.

The health functional beverage composition of the present invention is not particularly limited to the other ingredients except that it contains the compound of the present invention as an essential ingredient in the indicated ratios and may contain various flavors or natural carbohydrates as an additional ingredient . Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors (tau martin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavors other than those described above The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 of the composition of the present invention.

In addition to the above, the expression or activity inhibitor of heme oxygenase-1 (HO-1) of the present invention can be used as a flavoring agent such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, A coloring agent and a carbonating agent used for a thickening agent (cheese, chocolate, etc.), a pectic acid and its salt, alginic acid and its salt, an organic acid, a protective colloid thickener, a pH adjusting agent, a stabilizer, a preservative, glycerin, &Lt; / RTI &gt; In addition, the expression or activity inhibitor of heme oxygenase-1 (HO-1) of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks. These components may be used independently or in combination. Although the ratio of these additives is not so important, it is generally preferred that the expression or activity inhibitor of heme oxygenase-1 (HO-1) of the present invention is selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight to be.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention in detail, and the present invention is not limited to the examples.

< Example  1> Mouse-induced sciatic nerve injury

<1-1> Breeding of mice

C57BL / 6 wild-type mice and NRF2 gene knockout mice were purchased from Jackson Laboratory (Bar Harbor, ME) and RIKEN Bio Resource Center (Tsukuba, Japan) and were given an adaptation time . 12 hours of bright light and 12 hours of dark illumination were fed in a PF (pathogen free) environment where water and feed were freely given and maintained at 23 ± 1 ° C and 56% relative humidity. The mouse-related process used in the experiment was reviewed and approved by the IACUC Animal Study Committee (IACUC-2011-01-027 and 2012-01-035).

<1-2> Mouse-induced sciatic nerve injury

A mouse (12 weeks old, male, 25-30 g) raised by the method described in the above Example <1-1> was treated with isoflurane and under the inhalation anesthesia, a hip bone parallel to the sciatic nerve, The skin of the mouse was incised downward. The tissue adhered to the sciatic nerve was removed and ligated tightly with a 6-0 silk suture around 1/3 to 1/2 of the diameter of the sciatic nerve. In addition, the sciatic nerve injury group (SNI) and Sham operation group (Sham) were sutured again without injury to the sciatic nerve to induce sciatic nerve injury in the mice. Respectively. Skin sutures were performed using conventional surgical methods. The mice were sacrificed 7 days later to analyze the tibialis anterior (TA) and gastrocnemius (GN) skeleton.

< Example  2> In vivo in vivo )in  Sciatic nerve sciatic nerve For skeletal damage due to damage NRF2  And Fox01  Confirmation of increased expression

<2-1> Sciatic nerve injured mouse group ( NI ) And control ( SH ) To the tibialis anterior ( tibialis  anterior, TA ) And gastrocnemius ( gastrocnemius , GN ) Skeleton weighing

The tibialis anterior (TA) and gastrocnemius (GN) skeletal weights were measured in the mouse group (NI) and the control group (SH) in which the sciatic nerve was injured by exposing the sciatic nerve by the method described in the above Example <1-2> The following method was performed for the measurement.

Specifically, the skeletal weight of the tibialis anterior (TA) and gastrocnemius (GN) skeletons of the sciatic nerve injured mouse group (NI) and the control group (SH) prepared by the method described in Example <1-2> To measure, use SCUP to make a hole between the tibialis anterior (TA) and the bone, then open the hole with scissors, then pull the forceps with the other hand Using the Achilles tendon, the muscles opened by scissors were cut at the knee level and the Achilles tendon was cut. In addition, the gastrocnemius (GN) amputation was performed by cutting the inner part of the knee under the knee slightly with scissors, and then spreading it between the bone and the muscle using scissors. The ankle muscle was cut with scissors, and the upper knee was cut. The tissue was then weighed on a scales (Explorer Pro (EPG214C)) to measure muscle mass.

As a result, as shown in Fig. 1, in the mice prepared by the method described in Example 1-2, 7 days after injury of the sciatic nerve, the tibialis anterior (TA) and gastrocnemius (GN) And the weight was reduced (Fig. 1).

<2-2> Sciatic nerve injured mouse group ( NI ) And control ( SH ) Of the tibialis anterior ( tibialis  anterior, TA ) And gastrocnemius ( gastrocnemius , GN ) Confirm protein expression in skeleton

In order to confirm protein expression in the tibialis anterior (TA) skeleton of mouse group (NI) and control group (SH) in which the sciatic nerve was injured by exposing the sciatic nerve by the method described in the above Example <1-2> And the running was performed.

Specifically, protein expression was confirmed in the tibialis anterior (TA) skeleton of the mouse group (NI) and the control group (SH) in which the sciatic nerve was injured by exposing the sciatic nerve by the method described in Example <1-2> Tissues of the above mouse group were obtained. The tissue was disrupted and obtained as a protein extract. The whole protein was separated on SDS-PAGE gel, transferred to a nitrocellulose membrane and blocked with bovine serum albumin (BSA). After blocking, the membrane was treated with anti-MyHC antibody (product number: MF-20, DSHB, USA) and anti-myogenin antibody as a primary antibody for 16 hours at room temperature, washed with TBST, The membrane was treated with TBST containing 1% bovine serum albumin (BSA) using mouse IgG (anti-mouse IgG, Santa Cruz Biotech Inc, USA) as a secondary antibody and allowed to stand for one hour, (immunoblotting). Actin (Santa Cruz Biotechnology, USA) was used as a control for comparing the degree of expression, and the expression of [beta] -actin was confirmed by performing the same method as described above using the primary antibody .

As a result, as shown in FIG. 2, the expression of MyHC was decreased 7 days after the tibialis anterior (TA) skeleton of the mouse prepared by the method described in Example <1-2> The expression of antioxidants such as heme oxygenase-1, HO-1 and catalase was increased (FIG. 2).

<2-3> Atrophy (muscle atrophy)  During the onset, atrogenes ), Inflammatory cytokines ( inflammatory cytokines ) And myogenin ( myogenin mRNA  Confirmation of expression

In the case of muscular atrophy (NI) and control (SH) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in the above-mentioned Example <1-2>, atrophy of atrophy, inflammatory cytokines) and myogenin mRNA expression were examined in the following manner.

Specifically, protein expression was confirmed in the tibialis anterior (TA) skeleton of the mouse group (NI) and the control group (SH) in which the sciatic nerve was injured by exposing the sciatic nerve by the method described in Example <1-2> Tissues of the above mouse group were obtained. The tissue was disrupted to obtain it as a protein extract, The whole RNAs of the cells were suspended in a TRIzol (Invitrogen, USA) reagent according to the manufacturer's protocol, and the RNAs of SEQ ID NOS: 5 to 16 and superscript II kit , MuRF1, IL-1β IL-6, myogenin, and HO-1 were synthesized by reverse transcription using the primers (Invitrogen, USA) The synthesized cDNA was subjected to real-time PCR using ABI 7300 real time PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix, and MAFbx, MuRF1, IL-1β, IL-6, (myogenin) and mRNA expression of the HO-1 gene were quantitatively confirmed. Actin (SEQ ID NO: 17 and SEQ ID NO: 18) as a control for correcting the expression of the gene was confirmed by performing the same method as described above and corrected based on the results. MAFbx, MuRF1, IL -1β IL-6, myogenin, and HO-1 gene were quantitatively compared. In addition, all the results were expressed as mean ± SD in order to evaluate the statistical significance, and the unpaired Student's t-test was performed and the P-value was obtained. The obtained P-value was determined to be a level of 0.05 or less.

As a result, as shown in Fig. 3, in the mouse group (NI) in which the sciatic nerve was injured by the method described in the above-mentioned example <1-2>, the sciatic nerve was injured by atrogenes, inflammatory cytokines cytokines) and myogenin mRNA expression was increased (FIG. 3).

 Primer sequences for amplification of MAFbx, MuRF1, IL-l [beta], IL-6, myogenin, HO- Amplified gene Name of the primer SEQ ID NO: order MAFbx
MAFbx_F SEQ ID NO: 5 aaggctgttggagctgatagca MAFbx_R SEQ ID NO: 6 cacccacatgttaatgttgcc MuRF1
MuRF1_F SEQ ID NO: 7 tgaccacagagggtataag MuRF1_R SEQ ID NO: 8 tgtctcactcatctccttcttc IL-1?
IL-1? _F SEQ ID NO: 9 gtgtgccgtctttcattacacag IL-1? _R SEQ ID NO: 10 ggacagaatatcaaccaagtgata IL-6
IL-6_F SEQ ID NO: 11 gaggataccactcccaacaga IL-6_R SEQ ID NO: 12 aagtgcatcatcgttgttcataca Miogenen
(myogenin)
Myogenin _F SEQ ID NO: 13 ccagcccatggtgcccagtg Myogenin _R SEQ ID NO: 14 gcgtctgtagggtcagccgc HO-1

HO-1_F SEQ ID NO: 15 accgccttcctgctcaacattgag HO-1_R SEQ ID NO: 16 tgttcctctgtcagcatcacc
beta -actin act_F SEQ ID NO: 17 agagggaaatcgtgcgtgac act_R SEQ ID NO: 18 caatagtgatgacctggccgt

<2-4> Atrophy (muscle atrophy)  Muscle Atrophy During Development NRF2  And Fox01 expression confirmation

In order to confirm muscle atrophy and NRF2 and Fox01 expression during the development of muscle atrophy in the mouse group (NI) and the control group (SH) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in the above Example <1-2> H & E staining, immunoblotting and immunofluorescence staining were performed.

 Specifically, the expression of NRF2 and Fox01 in the tibialis anterior (TA) skeleton of the mouse group (NI) and the control group (SH) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in the above Example <1-2> Tissue of the mouse group is harvested for confirmation. Then, tissues of the mouse group were digested by the same method as described in Example <2-2>, and then electrophoresis (SDS-polyamide gel electrophoresis) and blocking were performed. After blocking, the membrane was treated with an anti-Fox01 antibody (Cell signaling technoligy, Inc., Danvers, MA) as a primary antibody and allowed to stand at low temperature for 16 hours. The membrane was washed with TBST to obtain anti- mouse IgG Santa Cruz Biotech Inc, USA) as a secondary antibody and treated with TBST containing 1% bovine serum albumin (BSA) for 1 hour to perform immunoblotting. Actin (Santa Cruz Biotechnology, USA) was used as a control for comparing the degree of expression, and the expression of [beta] -actin was confirmed by performing the same method as described above using the primary antibody . In order to perform histological analysis, a paraffin-embedded block was prepared by fixing the tibialis anterior (TA) extracted from the mice with formalin for 24 hours. ㎛ thick, and then stained with H & E (Hematoxilin Eosin). Antibodies against NRF2 and FoxO1 (cell signaling) were cultured using IgG and hydrogen peroxide / DAB (Vector laboratories, burlingame, CA, USA) fluorescence tagged and then observed under a microscope.

As a result, as shown in FIG. 4 and FIG. 5, NRF2 and Fox01 expression was increased in the mouse group (NI) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in Example <1-2> (Figs. 4 and 5).

Thus, the results of Example <2-3> confirm that NRF2 and Fox01 expression are involved in the induction and prevention of muscle atrophy.

< Example  3> NRF2  Gene Expression Is Related to Muscular Dystrophy muscle atrophy)  Identify the impact

<3-1> In mice group (NI) and control (SH) in which sciatic nerve injury of NRF2 knockout mouse and normal mouse was damaged, tibialis anterior , TA ) And gastrocnemius ( gastrocnemius , GN) muscle wear muscle wasting ) Check quantity

(Tibialis anterior, TA) and gastrocnemius (GN) in the mouse group (NI) and the control group (SH) in which the sciatic nerve was damaged in the NRF2 knockout mouse prepared by the method described in Example <1-2> ) Was measured in the same manner as in Example <2-1> to confirm the amount of muscle wasting.

As a result, as shown in Fig. 6, the NRF2 knockout mouse and the normal mouse control (NI) And muscular wasting of the tibialis anterior (TA) and gastrocnemius (GN) in the control group (SH) were similar (FIG. 6).

<3-2> The sciatic nerve was damaged ( NI ) &Lt; / RTI &gt; normal mouse control and NRF2  knockout Muscle of mouse group  damaged( muscle damage ) Confirm

The sciatic nerve fabricated by the method described in Example < 1-2 > was damaged (NI) H & E staining was performed to determine muscle damage of the normal mouse control group and the NRF2 knockout mouse group.

Specifically, in order to perform a histological analysis, a paraffin-embedded block was prepared by fixing the tibialis anterior (TA) extracted from the mouse with formalin for 24 hours with 10% formalin, 5 μm thick, and then stained with H & E (Hematoxilin Eosin).

As a result, as shown in Fig. 7, when the sciatic nerve produced by the method described in the above-mentioned Example < 1-2 > Muscle damage was observed in the normal mouse control group and the NRF2 knockout mouse group (Fig. 7).

<3-3> The sciatic nerve was damaged ( NI ) &Lt; / RTI &gt; normal mouse control and NRF2  In the knockout mice group MyHc  Confirmation of expression

HO-1, atrogenes, myogenin, and catalase expression in the sciatic nerve-damaged (NI) normal mouse control group and NRF2 knockout mouse group by the method described in Example <1-2> , Immunoblotting was performed.

Specifically, tissues of the mouse group were obtained in order to confirm protein expression in the tibialis anterior (TA) skeleton of the mouse group. Then, tissues of the mouse group were digested by the same method as described in Example <2-2>, and then electrophoresis (SDS-polyamide gel electrophoresis) and blocking were performed. After blocking, the membrane was incubated with primary anti-MyHC antibody (product number: MF-20, DSHB, USA), anti-myogenin antibody, anti-MuRF1 (ECM Bioscience LLC, vERSAILLES, (BSA), anti-mouse IgG (Santa Cruz Biotech, USA) was used as a secondary antibody, and the cells were washed with TBST for 16 hours at a low temperature. And incubated for one hour to perform immunoblotting. Actin (Santa Cruz Biotechnology, USA) was used as a control for comparing the degree of expression, and the expression of [beta] -actin was confirmed by performing the same method as described above using the primary antibody .

As a result, MyHC, HO-1, atrogenes, myogenin and Catalase expression were compared in the sciatic nerve-injured (NI) normal mouse control group and the NRF2 knockout mouse group , MyHc expression was decreased when nerve injury or MuRF1 and HO-1 were induced (Fig. 8).

<3-4> Normal mouse control ( WT ) And NRF2  knockout In the mouse group (KO)  Atrophy and inflammatory cytokines mRNA  Expression Confirm

In order to confirm the expression of atrophy and inflammatory cytokine mRNA in the normal mouse control group (WT) and NRF2 knockout mouse group (KO) raised by the method described in Example <1-1>, real-time PCR PCR) was performed.

Specifically, in order to confirm protein expression in the tibialis anterior (TA) of the normal mouse control group (WT) and the NRF2 knockout mouse group raised by the method described in Example <1-1> above, . Then, cDNAs were synthesized as described in the above Example <2-3>. The synthesized cDNA was subjected to real-time PCR using an SYBR Green PCR Master Mix in an ABI 7300 real time PCR system (Applied Biosystems, USA) to obtain the sequence shown in Table 1 Expression numbers 5 to 14 were quantitatively confirmed. Actin (SEQ ID NO: 17 and SEQ ID NO: 18) gene was confirmed by performing the same method as described above as a control for correcting the expression of the gene and corrected based on the expression, The expression level of the gene was quantitatively compared.

In addition, as shown in Fig. 9, it was confirmed that the atrophy and the inflammatory cytokine mRNA were similarly expressed in the normal mouse control group (WT) and the NRF2 knockout mouse group (KO) (Fig. 9).

&Lt; 3-5 > Normal mouse control group of sciatic nerve injured mouse group (NI) and control group (SH) WT ) And NRF2  knockout In the mouse group (KO) NRF2 of target  gene mRNA  Confirmation of expression

(WT) and the NRF2 knockout mouse group (KO) of the mouse group (NI) and the control group (SH) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in the above Example <1-2> Real-time PCR was performed to confirm gene mRNA expression.

(NI) and control (SH) normal mouse group (WT) and NRF2 knockout mouse group (KO) in which the sciatic nerve was damaged by exposing the sciatic nerve by the method described in Example <1-2> Tissue of the mouse group was obtained to confirm protein expression in the tibialis anterior (TA). Then, the total RNAs of the cells were extracted by the same method as in Example <2-3>, and then subjected to reverse transcription using the primers and superscript II kit (Invitrogen, USA) (reverse transcription) to synthesize cDNAs of GSTA, NQO1 and HO-1 (SEQ ID NO: 13 and SEQ ID NO: 14), respectively. The synthesized cDNA was quantitatively analyzed for expression of GSTA, NQO1 and HO-1 genes by real-time PCR using ABI 7300 real time PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix . As a control for correcting the expression of the gene, the expression of the? -Actin gene was confirmed by the same method as described above, and the expression level of the GSTA, NQO1 and HO-1 genes was quantitatively Respectively.

As a result, as shown in Fig. 10, it was confirmed that mRNA expression of GSTA1 / 2 and NQO1, which are the target genes of NRF2, did not increase in the NRF2 knockout mouse group and NRF2 knockout mouse group (NI) (Heme oxygenase-1, HO-1) mRNA expression, which is another target gene of the present invention, was similarly expressed (FIG. 10). Thus, the results of Example <3-4> confirmed that hemoxigenase-1 expression did not depend on NRF2 expression in the atrophy.

Primer sequences for amplification of GSTA and NQO1 Amplified gene Name of the primer SEQ ID NO: order GSTA
GSTA_F SEQ ID NO: 19 ggagattgatgggatgaagc GSTA_R SEQ ID NO: 20 aacaccttttcaaaggcagg NQO1
NQO1_F SEQ ID NO: 21 gacatgaacgtcattctctg NQO1_R SEQ ID NO: 22 ctagctttgatctggttgtc

< Example  4> Fork Headbox  The regulation of protein 01 HO -1 expression

&Lt; 4-1 > Production of Expression Vector Transformed into 293T Cells

To confirm the promotion of HO-1 promoter activity by overexpression of Fox01, the present inventors introduced an expression vector which is transformed into 293T cells.

Specifically, 293T cells were seeded in a 6-well plate at 2 x 10 &lt; ⁵ &gt; cells per well and the promoter reporter gene (pHO4.3k-luc, Dr. J Alam, Alton Ochsner Medical Foundation, New Orleans, Renal Physiol. 2003 Apr; 284 (4): F743-52) and a FoxO1 overexpression vector (Addgene, provided by D. Domenico Accili) were introduced into the cells by the calcium phosphate method. pCMVbeta-gal was introduced together with internal control to standardize transfection effeciency per cell. After the introduction, the cells were disrupted using a reporter lysis buffer (Promega) at 48 hours to obtain a protein extract. Luciferase activity and beta-galactosidase activity were measured using 10 μl of each of them. The luciferase activity was divided by beta-galactosidase activity and the control value was set to 1, which was expressed as fold induction

&Lt; 4-2 > 293T cell transformation ( Transient transfection ) Cell Manufacturing

293T cells (ATCC, CRL-3126, USA) were transfected with pH0-luc and NRF2 or Fox01 expression vectors to prepare transformed cells.

Specifically, 293T cells were seeded in a 6-well plate at 2 × 10 ⁵ cells per well and cultured in an o-o-reporter gene (pHO4.3k-luc, Dr. J Alam, Alton Ochsner Medical Foundation, New Orleans, The expression vector of NRF2 (Dr. YJ SUGO, Seoul National University, ANTIOXIDANTS & REDOX SIGNALING 13, 1639-1648, 2010) or the FoxO1 overexpression vector (Addgene, provided by Physiol Renal Physiol. 2003 Apr; 284 (4): F743-52) by D. Domenico Accili) was introduced into the cells by the calcium phosphate method. pCMVbeta-gal was used as an internal control to standardize the transfection efficiency of each cell. Cells were disrupted using a reporter lysis buffer (Promega) at 48 hours after the introduction to obtain protein extracts. Ten of these were used to measure the activity of luciferase and beta-galactosidase, respectively. The luciferase activity was divided into beta-galactosidase activity and the control value was set to 1, which was expressed as fold induction.

<4-3> Control group SH ) And sciatic nerve injured mouse group ( NI ) &Lt; / RTI &gt; normal mouse control ( WT ) And NRF2  Knockout mice ( KO )in Fork Headbox  Protein 01 ( Fox01 ) Expression confirmation

In the tissues of the normal mouse control (WT) and the NRF2 knockout mouse group (KO) of the control group (SH) and the sciatic nerve injured mouse group (NI) prepared by the method described in Example <1-2> And at the same time, the expression of FoxO1 was observed in the following manner.

Specifically, the normal mouse control (WT) and NRF2 knockout mouse group (KO) of mouse group (NI) and control group (SH) in which the sciatic nerve was injured by exposing the sciatic nerve by the method described in Example <1-2> Tissue from the mouse group was obtained to identify fork headbox protein 01 (Fox01) in the tibialis anterior (TA). Then, the whole RNA of the tissue was extracted in the same manner as in Example <2-3>, and reverse transcription was performed using a superscript II kit (Invitrogen, USA) technology, Inc., Danvers, Mass.) were synthesized. The synthesized cDNA was quantitatively analyzed by real-time PCR using ABI 7300 real time PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix. As a control for correcting the expression of the gene, expression of the β-actin gene was confirmed by performing the same method as described above, corrected based on the expression, and then the expression level of the Fox01 gene was quantitatively compared. In the tissues of the normal mouse control group (WT) and the NRF2 knockout mouse group (KO) of the control group (SH) and the sciatic nerve injured mouse group (NI) prepared by the method described in Example <1-2> The muscle tissue of the mouse was obtained, fixed with 10% formalin solution, made into a paraffin block (Praffin block), and then cut to a thickness of 5 μm. Blocking solution to block non-specific protein binding and react with FoxO1 antibody. After washing and reacting with Alexa 488 dye labeled anti-mouse IgG (anti-mouse IgG), signals were detected in a confocal microscope.

As a result, as shown in FIG. 11 and FIG. 12, the nuclei of muscle fibers were stained in the normal mouse control group and the NRF2 knockout mouse group in which the control group (SH) and sciatic nerve injured mouse group sciatic nerve injured (NI) Box protein 01 (Fox01) (Fig. 11 and Fig. 12).

<4-4> In 293T cells Fork Headbox  Protein 01 ( Fox01 ) Expression HO -1 gene transcription regulation

The following method was performed to confirm the effect of expression of NRF2 and fork headbox protein 01 (Fox01) on 293T cells by the method described in the above Example <4-2> on HO-1 gene transcription control.

Specifically, The 293T cells prepared by the method described in Example <4-2> were amplified by PCR and then ligation was carried out on the expression vector. Then, NRF2 expression vector and fork headbox protein 01 (Fox01) expression vector were subjected to bacterial transfection After confirming that the plasmid was obtained by cutting with a specific restriction enzyme, cDNA was confirmed by sequencing, and the protein expressed by intracellular introduction was identified and then the experiment was conducted. Then, immunoblotting was performed in the same manner as in Example <2-2>.

As a result, as shown in Fig. 13, it was confirmed that the fork head box protein 01 stimulates the HO-1 promoting activity in a concentration-dependent manner (Fig. 13).

<4-5> Identification of HO-1 promoting activity by expression of NRF2 and fork headbox protein 01 in 293T cells

In order to confirm the HO-1 promoting activity of NRF2 and fork headbox protein 01 expression in 293T cells by the method described in the above Example <4-2>, the following method was performed.

Specifically, 293T cells prepared by the method described in Example <4-2> were amplified by PCR and then ligated into an expression vector. Then, NRF2 expression vector and fork headbox protein 01 (Fox01) expression vector were transformed into bacterial traits After confirming that the plasmid was obtained by bacterial transformation and cut with a specific restriction enzyme, cDNA was confirmed by sequencing, and the protein expressed by intracellular introduction was confirmed and then the experiment was performed Respectively. Then, immunoblotting was performed in the same manner as in Example <2-2>.

As a result, as shown in FIG. 14, it was confirmed that there was no cooperative effect between the expression of NRF2 and the fork headbox protein 01 in the cells by HO-1 promoting activity (FIG. 14).

<4-6> Control group SH ) And sciatic nerve injured ( NI ) In normal mouse group Fork head Box of Protein 01 HO -1 Confirmation of Binding Promoter

The HO-1 gene promoter binding ability of the fork headbox protein 01 in the control group (SH) and the sciatic nerve injured (NI) normal mouse group prepared by the method described in Example <1-2> And real - time PCR.

Specifically, the tibialis anterior (TA) and gastrocnemius (GN) skeleton 25 of the control group (SH) and the sciatic nerve injured (NI) normal mouse group prepared by the method described in Example <1-2> mg were milled in cold PBS and cross-linked using 1% formaldehyde. The muscle was treated with Fox01 antibody or control IgG antibody and reacted for 1 hour in PBS. Protein A / G-agarose beads were added and reacted at 4 ° C for 24 hours. The beads were washed 3 times with PBS containing 1 mM DTT and immunoprecipitated. The precipitated DNA bound to the protein was washed with LiCl wash buffer and Tris-EDTA, and elution was performed by adding elution buffer containing 1% SDS and 0.1 N NaHCO3. Cross-links were separated and reconstituted with 20 mM NaCl and 1% SDS, extracted with phenol / chloroform, and extracted with ethanol precipitation. Then, real-time PCR was performed in the same manner as in Example <2-3>. PCR amplification was standardized for the collected DNA (input fraction) after sonication. The primers used in the real-time PCR are as shown in Table 4 below.

As a result, as shown in FIG. 15 and FIG. 16, it was confirmed that when the fork head box protein 01 directly binds to the HO-1 gene promoter (direct binding), it is stimulated to muscle atrophy 16).

A primer sequence for amplification of the HO-1 promoter gene Amplified gene Name of the primer SEQ ID NO: order HO-1 promoter
HO-1_Chip-FWD SEQ ID NO: 23  tgtgccatcactacccagaa HO-1_Chip-REV SEQ ID NO: 24  agcagggtataggcttggaat

<4-7> Control group ( SH ) And sciatic nerve injured mouse group ( NI ) &Lt; / RTI &gt; normal mouse control and NRF2  In the knockout mice group NRF2  By inhibition KEAP1  And BACH1  Confirmation of expression

To confirm the expression of KEAP1 and BACH1 by inhibition of NRF2 in the normal mouse control and NRF2 knockout mice of the control group (SH) and the sciatic nerve injured mouse group (NI) prepared by the method described in Example <1-2> Was carried out.

Specifically, expression of KEAP1 and BACH1 by NRF2 inhibition was confirmed in the normal mouse control and NRF2 knockout mice of the control group (SH) and the sciatic nerve injured mouse group (NI) prepared by the method described in Example <1-2> Tissues of the above mouse group were obtained. Then, the tissue was disrupted by the same method as described in Example <2-2> to obtain a protein extract. Then, the whole protein was separated on SDS-PAGE gel, transferred to a nitrocellulose membrane And blocked with bovine serum albumin (BSA). After blocking, the membrane was treated with anti-anti-KEAP1 and anti-BACH1 antibodies as primary antibodies and allowed to stand at low temperature for 16 hours and washed with TBST (anti-mouse IgG, Santa Cruz Biotech Inc, USA) The cells were treated with TBST containing 1% bovine serum albumin (BSA) as an antibody and incubated for 1 hour to perform immunoblotting. Actin (Santa Cruz Biotechnology, USA) was used as a control for comparing the degree of expression, and the expression of [beta] -actin was confirmed by performing the same method as described above using the primary antibody .

As a result, as shown in Fig. 17, KEAP1 expression was low in the normal mouse control group and the NRF2 knockout mouse of the control group (SH) and the sciatic nerve injured mouse group (NI), and the sciatic nerve- And NRF2 knockout mouse group, and BACH1 expression was increased in the sciatic nerve-injured (NI) normal mouse control group and the NRF2 knockout mouse group (FIG. 17).

<4-8> In 293T cells BACH1  Expression NRF2  And FoxO1 By the expression of HO -1 promoter ( promoter ) On the activation of

The following method was performed to confirm that the promotion of the activation of the HO-1 promoter by the expression of NRF2 and FoxO1 in 293T cells was inhibited by BACH1 expression.

Specifically, the NRF2 or Fox01 expression vector containing the pH0-luciferase (luc) reporter gene was transformed into 293T cells prepared in Example <4-2> to obtain NRF2-luc and Fox01-luc cells . Then, the NRF2-luc cell line and Fox01-luc cell line prepared above were transformed with BACH1 expression vector. After culturing, the cultured cells were suspended in a reporter lysis buffer to extract cellular proteins. NRF2 or Fox01 inducing the HO promoter by measuring luminescence with a luminometer (Berthold, Germany) after mixing with 10 l of the extracted cell protein with luciferase substrate (promega, USA) Expression levels were confirmed. As a control for the correction, beta-galactosidase activity following the expression of pCMVbeta-gal gene was measured together with NRF2 or Fox01 expression vector, and then the transfection efficiency was corrected to determine the HO promoter activity Was expressed as fold induction or percentage (%) in comparison with the control group. As a control, pHO-luc and mock cell lines not containing NRF2 or Fox01 expression were prepared. As a control group with and without BACH1, NRF2-luc and Fox01-luc cell lines were transfected with NRF2 Or Fox01 expression level (-BACH1).

As a result, as shown in Fig. 18, it was confirmed that the promotion of the activation of the HO-1 promoter by the expression of NRF2 and the fork headbox protein 01 was suppressed by the expression of BACH1, and the fork headbox protein 01-mediated HO -1 activity (Fig. 18).

Thus, the results of Example <4-6> show that BACH1 inhibits NRF2 expression by inducing Fox01 expression to induce H0-1 gene transcription during skeletal atrophy.

< Example  5> Muscle atrophy  In progress Fork Headbox  Protein 01 HO -1 expression

<5-1> C2C12  To the cell Treatment of dexamethasone resulted in muscle fiber atrophy and MyHC  Confirmation of expression

In vitro, C2C12 cells were treated with dexamethasone to examine myofiber atrophy and MyHC expression in the following manner.

Specifically, C2C12 (ATCC, Manassa, VA) was inoculated into a medium containing 2% horse sereum (Invitrogen, Carlsbad, Calif.) And cultured for 6 days until it became 100% confluent Respectively. The cells were then treated with 500 uM of dexamethasone for 24 hours to induce atrophy. After induction, the morphology of the cells was confirmed with a microscope, and HyHC, a fundamental marker, was fluorescently immunostained in muscle cells. An anti-MyHC antibody was used as the primary antibody for the fluorescent immuno-staining, and nuclei were stained with DAPI to compare nucleotide positions and fluorescence expression.

As a result, as shown in FIG. 19, when the cells were treated with dexamethasone, the morphologic shape of the differentiated myocytes was changed and the expression of MyHC was decreased (FIG. 19).

<5-2> Dexamethasone ( dexamethasone ) To treat atrophied In muscle cells MAFbx , Murf1 and HO -1 expression

In order to confirm the increased expression of MAFbx, Murf1 and HO-1 in the atrophied muscle cells by treating dexamethasone with C2C12 cells prepared in the same manner as in Example <5-1>, the following method was performed .

Specifically, C2C12 cells as a source cell were inoculated into a DMEM medium containing 10% FBS, cultured until saturation of 100%, treated with dexamethasone at a concentration of 10 μM, and cultured for 6 days. Myocytes were induced to differentiate into mature muscle cells. After induction, differentiated muscle cells were treated with 500 μM of dihydrochloride (DEX) for 24 hours to induce atrophy, and then the total RNA of the cells was extracted in the same manner as in Example <2-3> , And MAFbx, Murf1 and HO-1 cDNAs were synthesized by reverse transcription using the primers and the superscript II kit (Invitrogen, USA) of Table 1 above. The synthesized cDNA was quantitatively analyzed for expression of MAFbx, Murf1, and HO-1 genes by real-time PCR using ABI 7300 real time PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix . As a normal control, normal cells not treated with DEX were used for differentiated muscle cells, and DMSO not containing dexamethasone was treated as a solvent control in the same manner as above.

As a result, as shown in FIG. 20, dexamethasone was treated to increase the expression of atrogenes and HO-1 mRNA in atrophied muscle cells (FIG. 20).

<5-3> In transformed cells FoxO1  Confirmation of expression

In order to perform gene expression inhibition experiments using FoxO1 siRNA on cells prepared by the method described in the above Example <5-1>, the following method was performed.

Specifically, three different siRNAs (small interfering RNAs) were synthesized to inhibit the expression of the FoxO1 gene and to compare with the control group. The nucleotide sequences of the siRNAs are shown in Table 4 below (Bioneer). The siRNA was introduced into cells using HiPerFect Transfection Reagent (Qiagen) and proceeded according to the manufacturer's instructions. The thus-constructed transformed cell line was dispensed into a 6-well plate to a volume of 2.3 ml per well and a cell number of 1 × 10 ⁵ cells / well. The next day, dilute 37.5 ng of siRNA into 100 μl of serum-free culture medium, make final concentration 5 nM, add 3 μl of hiPerFect reagent, and react at room temperature for about 5-10 minutes to form siRNA transfection complex. Drop the transfected complexes into the cells, gently shake the plate, and incubate in an incubator. After 3 days of siRNA introduction, cells are washed twice with PBS and cells are lysed with lysis buffer. Then, immunoblotting was carried out in the same manner as described in Example <2-2> above.

As a result, as shown in FIG. 21, when the expression of FoxO1 gene in the transformed cells treated with siRNA which inhibited the expression of FoxO1 gene in completely differentiated myocytes was compared with the control group, the expression level of FoxO1 decreased (Fig. 21).

Primer sequences for amplification of siFox01 and siCon genes Amplified gene Name of the primer SEQ ID NO: order siCon siCon SEQ ID NO: 25 ccuacgccaccaauuucgu siFox01

siFox01 # 1 SEQ ID NO: 26 ccagaccaggauaauuggu siFox01 # 2 SEQ ID NO: 27 cuaaugugucucaaacauu siFox01 # 3 SEQ ID NO: 28 caucuaugcagccuuguuu

<5-4> The expression of FoxO1 gene is suppressed in differentiated myocytes and treated with dexamethasone HO -1 expression confirmation

In the same manner as in Example < 5-1 > In order to inhibit the expression of FoxO1 gene in completely differentiated myocytes and to examine the expression of HO-1 by treating dexamethasone, the following method was performed.

Specifically, in order to confirm the expression of HO-1 by inhibiting the expression of FoxO1 gene and treating dexamethasone in completely differentiated myocytes by the method described in Example <5-1> above, . Then, the total RNA of the cells was extracted in the same manner as in the above Example <2-3>, and the nucleotide sequences of SEQ ID NOs: 15 and 14 shown in Table 1 and SEQ ID NOs: 27 to 26 And reverse transcription was performed using a superscript II kit (Invitrogen, USA) to synthesize HO-1 cDNAs, respectively. The synthesized cDNA was quantitatively analyzed by real-time PCR using ABI 7300 real time PCR system (Applied Biosystems, USA) using SYBR Green PCR Master Mix. As a control for correcting the expression of the gene, the expression of the? -Actin gene was confirmed by performing the same method as described above, and the expression level of the HO-1 gene was quantitatively compared after the correction.

As a result, as shown in FIG. 22, when HO-1 expression was compared between cells inhibiting Fox01 gene expression and control cells, HO-1 expression was significantly induced in cells inhibiting the expression of FoxO1 gene (Fig. 22). Thus, the results of Example <5-3> confirmed that FoxO1 induces HO-1 expression during the atrophy.

< Example  6> HO -1 gene expression inhibition muscle atrophy ) Gene expression reduction confirmation

<6-1> Fully differentiated myoblasts ( myocytes )on HO -1 gene expression Suppress HO -1 protein expression confirmation

In order to compare the HO-1 protein expression with the control group by treating the completely differentiated myocytes prepared in the same manner as in the above Example <5-1> with siRNA that inhibits the expression of the HO-1 gene, Method.

Specifically, the expression of HO-1 protein was compared with the control group by treating siRNAs that inhibited the expression of the HO-1 gene in fully differentiated myocytes prepared in the same manner as in Example <5-1> Three different siRNAs (small interfering RNAs) were synthesized in order to inhibit the expression of the HO-1 gene and to compare with the control group. The nucleotide sequences of the siRNAs are shown in Table 5 below (Bioneer). The siRNA was introduced into cells using HiPerFect Transfection Reagent (Qiagen) and proceeded according to the manufacturer's instructions. The thus-constructed transformed cell line is dispensed in a 6-well plate to a volume of 2.3 ml per well and a cell number of 1 × 10 ⁵ . The following day, the siRNA transfection complex is formed by diluting 37.5 ng of siRNA in 100 μl of serum-free culture medium to a final concentration of 5 nM, adding 3 μl of hiPerFect reagent thereto at room temperature for about 5-10 minutes . Drop the transfected complexes into the cells, gently shake the plate, and incubate in an incubator. After 3 days of siRNA introduction, cells are washed twice with PBS and cells are lysed with lysis buffer. Then, immunoblotting was carried out in the same manner as in Example <2-2>.

As a result, as shown in FIG. 23 and FIG. 24, it was confirmed that the expression of the modulator of the atrophy was significantly decreased in the cells (FIGS. 23 and 24).

Primer sequences for amplification of siHO 1, siHO 2 and siHO 3 genes Amplified gene Name of the primer SEQ ID NO: order siHO-1

siHO-1 SEQ ID NO: 29 cagaucagcacuagcucau siHO-2 SEQ ID NO: 30 caccaaggagguacacauc siHO-3 SEQ ID NO: 31 ccugaaucgagcagaacca

<6-2> In the differentiated cells Hemin  Identify the impact

In order to confirm the protein expression of MyHc, HO-1, Fox01 and MuRF1 by treating Hemin with the differentiated cells according to the method described in the above Example <5-1>, the following method was performed.

Specifically, the cells were obtained in order to examine the protein expression of MyHc, Ho-1, Fox01 and MuRF1 by treating hemin with cells differentiated by the method described in the above Example <5-1>. Then, the cells were disrupted by the same method as described in Example <2-2> to obtain a protein extract. Then, the entire protein was separated on SDS-PAGE gel, transferred to a nitrocellulose membrane And blocked with bovine serum albumin (BSA). After blocking, the membrane was treated with anti-MyHC antibody, anti-HO-1 antibody, anti-Fox01 antibody and anti-MuRF1 antibody as a primary antibody for 16 hours at low temperature and washed with TBST to obtain anti-mouse IgG (anti-mouse IgG, Santa Cruz Biotech Inc, USA) as a secondary antibody and treated with TBST containing 1% bovine serum albumin (BSA) for 1 hour, followed by immunoblotting Respectively. Actin (Santa Cruz Biotechnology, USA) was used as a control for comparing the degree of expression, and the expression of [beta] -actin was confirmed by performing the same method as described above using the primary antibody .

As a result, as shown in Fig. 25, it was confirmed that HO-1 protein expression was induced by the HO-1 inducing factor, hemin, and protein expression of MyHC was decreased, and protein expression of HO-1 and MuRF1 Was increased through the induction of FoxO1 (Fig. 25).

<6-3> Hemin ( hemin ) To confirm the induction of differentiation into myoblasts

The cells differentiated by the method described in the above Example < 5-1 > were treated with hemin to separate the myeloid differentiated cells The morphological changes and MyHC expression were examined in the following manner.

Specifically, C2C12 (ATCC, Manassa, VA) was inoculated into a medium containing 2% horse sereum (Invitrogen, Carlsbad, Calif.) And cultured for 6 days until it became 100% confluent Respectively. The cells were then treated with 500 uM of Hemin for 24 hours. After the treatment, the morphology of the cells was confirmed with a microscope, and myhc, a fundamental marker, was fluorescently immunostained in muscle cells. An anti-MyHC antibody was used as the primary antibody for the fluorescent immuno-staining, and nuclei were stained with DAPI to compare nucleotide positions and fluorescence expression.

Further, as shown in FIG. 26, the cells were changed to a flattened shape after treatment with hemin, and shrinking was performed, and the expression of MyHC was decreased (FIG. 26).

<6-4> Hemin ( Hemin ) Mouse group  Confirm muscle damage

In order to identify the damaged muscle by taking hemin in vivo, the following method was performed.

Specifically, twelve muscle-damaged mouse models prepared in Example <1-2> were selected and divided into two groups of 6 mice each. Each mouse model group was administered with vehicle control of 25 mg / kg, Hemin was intraperitoneally injected for 10 days. Then, muscle tissue was obtained at the sacrifice of the mouse model, and fixed with paraffin according to a known method to stain the muscle tissue with hematoxylin-Eosin staining to determine the histological damage degree of the muscle Respectively.

As a result, as shown in Fig. 27, it was confirmed that the muscles were damaged in the mouse group in which hemin was ingested for 7 days (Fig. 27).

Thus, the results of Example <6-4> above show that HO-1 overexpression affects muscle fibers by hemin treatment.

.

<110> Ewha WOMANS UNIVERSITY <120> A pharmaceutical composition comprising inhibitors of heme          oxygenase-1 for the prevention and treatment of muscle atrophy <130> 13p-11-29 <160> 31 <170> Kopatentin 2.0 <210> 1 <211> 288 <212> PRT <213> Homo sapiens <400> 1 Met Glu Arg Pro Gln Pro Asp Ser Met Pro Gln Asp Leu Ser Glu Ala   1 5 10 15 Leu Lys Glu Ala Thr Lys Glu Val His Thr Gln Ala Glu Asn Ala Glu              20 25 30 Phe Met Arg Asn Phe Gln Lys Gly Gln Val Thr Arg Asp Gly Phe Lys          35 40 45 Leu Val Met Ala Ser Leu Tyr His Ile Tyr Val Ala Leu Glu Glu Glu      50 55 60 Ile Glu Arg Asn Lys Glu Ser Pro Val Phe Ala Pro Val Tyr Phe Pro  65 70 75 80 Glu Glu Leu His Arg Lys Ala Ala Leu Glu Gln Asp Leu Ala Phe Trp                  85 90 95 Tyr Gly Pro Arg Trp Gln Glu Val Ile Pro Tyr Thr Pro Ala Met Gln             100 105 110 Arg Tyr Val Lys Arg Leu His Glu Val Gly Arg Thr Glu Pro Glu Leu         115 120 125 Leu Val Ala His Ala Tyr Thr Arg Tyr Leu Gly Asp Leu Ser Gly Gly     130 135 140 Gln Val Leu Lys Lys Ile Ala Gln Lys Ala Leu Asp Leu Pro Ser Ser 145 150 155 160 Gly Glu Gly Leu Ala Phe Phe Thr Phe Pro Asn Ile Ala Ser Ala Thr                 165 170 175 Lys Phe Lys Gln Leu Tyr Arg Ser Arg Met Asn Ser Leu Glu Met Thr             180 185 190 Pro Ala Val Arg Gln Arg Val Ile Glu Glu Ala Lys Thr Ala Phe Leu         195 200 205 Leu Asn Ile Gln Leu Phe Glu Glu Leu Gln Glu Leu Leu Thr His Asp     210 215 220 Thr Lys Asp Gln Ser Pro Ser Arg Ala Pro Gly Leu Arg Gln Arg Ala 225 230 235 240 Ser Asn Lys Val Gln Asp Ser Ala Pro Val Glu Thr Pro Arg Gly Lys                 245 250 255 Pro Pro Leu Asn Thr Arg Ser Gln Ala Pro Leu Leu Arg Trp Val Leu             260 265 270 Thr Leu Ser Phe Leu Val Ala Thr Val Ala Val Gly Leu Tyr Ala Met         275 280 285 <210> 2 <211> 289 <212> PRT <213> mouse <400> 2 Met Glu Arg Pro Gln Pro Asp Ser Met Pro Gln Asp Leu Ser Glu Ala   1 5 10 15 Leu Lys Glu Ala Thr Lys Glu Val Ile Gln Ala Glu Asn Ala Glu              20 25 30 Phe Met Lys Asn Phe Gln Lys Gly Gln Val Ser Arg Glu Gly Phe Lys          35 40 45 Leu Val Met Ala Ser Leu Tyr His Ile Tyr Thr Ala Leu Glu Glu Glu      50 55 60 Ile Glu Arg Asn Lys Gln Asn Pro Val Tyr Ala Pro Leu Tyr Phe Pro  65 70 75 80 Glu Glu Leu His Arg Arg Ala Leu Glu Gln Asp Met Ala Phe Trp                  85 90 95 Tyr Gly Pro His Trp Gln Glu Ile Ile Pro Cys Thr Pro Ala Thr Gln             100 105 110 His Tyr Val Lys Arg Leu His Glu Val Gly Arg Thr His Pro Glu Leu         115 120 125 Leu Val Ala His Ala Tyr Thr Arg Tyr Leu Gly Asp Leu Ser Gly Gly     130 135 140 Gln Val Leu Lys Lys Ile Ala Gln Lys Ala Met Ala Leu Pro Ser Ser 145 150 155 160 Gly Glu Gly Leu Ala Phe Phe Thr Phe Pro Asn Ile Asp Ser Pro Thr                 165 170 175 Lys Phe Lys Gln Leu Tyr Arg Ala Arg Met Asn Thr Leu Glu Met Thr             180 185 190 Pro Glu Val Lys His Arg Val Thr Glu Glu Ala Lys Thr Ala Phe Leu         195 200 205 Leu Asn Ile Glu Leu Phe Glu Glu Leu Gln Val Met Leu Thr Glu Glu     210 215 220 His Lys Asp Gln Ser Pro Ser Gln Met Ala Ser Leu Arg Gln Arg Pro 225 230 235 240 Ala Ser Leu Val Gln Asp Thr Ala Pro Ala Glu Thr Pro Arg Gly Lys                 245 250 255 Pro Gln Ile Ser Thr Ser Ser Ser Gln Thr Pro Leu Leu Gln Trp Val             260 265 270 Leu Thr Leu Ser Phe Leu Leu Ala Thr Val Ala Val Gly Ile Tyr Ala         275 280 285 Met     <210> 3 <211> 1606 <212> DNA <213> Homo sapiens <400> 3 aaatgtgacc ggccgcggct ccggcagtca acgcctgcct cctctcgagc gtcctcagcg 60 cagccgccgc ccgcggagcc agcacgaacg agcccagcac cggccggatg gagcgtccgc 120 aacccgacag catgccccag gatttgtcag aggccctgaa ggaggccacc aaggaggtgc 180 acacccaggc agagaatgct gagttcatga ggaactttca gaagggccag gtgacccgag 240 acggcttcaa gctggtgatg gcctccctgt accacatcta tgtggccctg gaggaggaga 300 ttgagcgcaa caaggagagc ccagtcttcg cccctgtcta cttcccagaa gagctgcacc 360 gcaaggctgc cctggagcag gacctggcct tctggtacgg gccccgctgg caggaggtca 420 tcccctacac accagccatg cagcgctatg tgaagcggct ccacgaggtg gggcgcacag 480 agcccgagct gctggtggcc cacgcctaca cccgctacct gggtgacctg tctgggggcc 540 aggtgctcaa aaagattgcc cagaaagccc tggacctgcc cagctctggc gagggcctgg 600 ccttcttcac cttccccaac attgccagtg ccaccaagtt caagcagctc taccgctccc 660 gcatgaactc cctggagatg actcccgcag tcaggcagag ggtgatagaa gaggccaaga 720 ctgcgttcct gctcaacatc cagctctttg aggagttgca ggagctgctg acccatgaca 780 ccaaggacca gagcccctca cgggcaccag ggcttcgcca gcgggccagc aacaaagtgc 840 aagattctgc ccccgtggag actcccagag ggaagccccc actcaacacc cgctcccagg 900 ctccgcttct ccgatgggtc cttacactca gctttctggt ggcgacagtt gctgtagggc 960 tttatgccat gtgaatgcag gcatgctggc tcccagggcc atgaactttg tccggtggaa 1020 ggccttcttt ctagagaggg aattctcttg gctggcttcc ttaccgtggg cactgaaggc 1080 tttcagggcc tccagccctc tcactgtgtc cctctctctg gaaaggagga aggagcctat 1140 ggcatcttcc ccaacgaaaa gcacatccag gcaatggcct aaacttcaga gggggcgaag 1200 ggatcagccc tgcccttcag catcctcagt tcctgcagca gagcctggaa gacaccctaa 1260 tgtggcagct gtctcaaacc tccaaaagcc ctgagtttca agtatccttg ttgacacggc 1320 catgaccact ttccccgtgg gccatggcaa tttttacaca aacctgaaaa gatgttgtgt 1380 cttgtgtttt tgtcttattt ttgttggagc cactctgttc ctggctcagc ctcaaatgca 1440 gtatttttgt tgtgttctgt tgtttttata gcagggttgg ggtggttttt gagccatgcg 1500 tgggtgggga gggaggtgtt taacggcact gtggccttgg tctaactttt gtgtgaaata 1560 ataaacaaca ttgtctgata gtagcttgaa aaaaaaaaaaaaaaa 1606 <210> 4 <211> 1634 <212> DNA <213> mouse <400> 4 gctcacggtc tccagtcgcc tccagagttt ccgcatacaa ccagtgagtg gagcctgccc 60 gcgcagagcc gtctcgagca tagcccggag cctgaatcga gcagaaccag cctgaactag 120 cccagtccgg tgatggagcg tccacagccc gacagcatgc cccaggattt gtctgaggcc 180 ttgaaggagg ccaccaagga ggtacacatc caagccgaga atgctgagtt catgaagaac 240 tttcagaagg gtcaggtgtc cagagaaggc tttaagctgg tgatggcttc cttgtaccat 300 atctacacgg ccctggaaga ggagatagag cgcaacaagc agaacccagt ctatgcccca 360 ctctacttcc ctgaggagct gcaccgaagg gctgccctgg agcaggacat ggccttctgg 420 tatgggcctc actggcagga aatcatccct tgcacgccag ccacacagca ctatgtaaag 480 cgtctccacg aggtggggcg cactcaccct gagctgctgg tggcccacgc atatacccgc 540 tacctgggtg acctctcagg gggtcaggtc ctgaagaaga ttgcacagaa ggccatggcc 600 ttgcccagct ctggggaggg cctggctttt tttaccttcc cgaacatcga cagccccacc 660 aagttcaaac agctctatcg tgctcgaatg aacactctgg agatgacacc tgaggtcaag 720 cacagggtga cagaagaggc taagaccgcc ttcctgctca acattgagct gtttgaggag 780 ctgcaggtga tgctgacaga ggaacacaaa gaccagagtc cctcacagat ggcgtcactt 840 cgtcagaggc ctgctagcct ggtgcaagat actgcccctg cagagacacc ccgagggaaa 900 ccccagatca gcactagctc atcccagaca ccgctcctcc agtgggtcct cactctcagc 960 ttcctgttgg caacagtggc agtgggaatt tatgccatgt aaatgcaata ctggccccca 1020 ggggctgtga actctgtcca atgtggcctt ctctctgtaa gggagaatct tgcctggctc 1080 tcttctcttg ggcctctaag aaagcttttg gggtccctag cccactccct gtgtttcctt 1140 tctctctgga atggagggag atacctgaca cagttccctc accaaaagca catccagcca 1200 gtggcctgaa ctttgaaacc agcagcccca aatcctgcag cagagcccca aaactggcct 1260 gtaaaagcag ctgttctgag cccagtgccc atggttgtaa gcatccatgt tgactgacca 1320 cgactgctgt cccccagtgc catggccact ttgatatccg tttccagaca tttctgtctc 1380 gtatttctgt cttgtttttt attatttccc cagttctacc agagtaatgg tattttgttg 1440 ttttgttttg tcttgttttt cctaacaaag tggggctatc ttttgagggg tgggtgggaa 1500 agaattattt aatagttgta accttggtct ctaacttctg tgtgaaataa taaatggcat 1560 tatctaacag tcactaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1620 aaaaaaaaaa aaaa 1634 <210> 5 <211> 22 <212> DNA <213> MAFbx_F <400> 5 aaggctgttg gagctgatag ca 22 <210> 6 <211> 21 <212> DNA <213> MAFbx_R <400> 6 cacccacatg ttaatgttgc c 21 <210> 7 <211> 18 <212> DNA <213> MuRF1_F <400> 7 tgaccacaga gggtaaag 18 <210> 8 <211> 22 <212> DNA <213> MuRF1_R <400> 8 tgtctcactc atctccttct tc 22 <210> 9 <211> 23 <212> DNA <213> IL-1 beta_F <400> 9 gtgtgccgtc tttcattaca cag 23 <210> 10 <211> 24 <212> DNA <213> IL-1 beta_R <400> 10 ggacagaata tcaaccaagt gata 24 <210> 11 <211> 21 <212> DNA <213> IL-6_F <400> 11 gaggatacca ctcccaacag a 21 <210> 12 <211> 24 <212> DNA <213> IL-6_R <400> 12 aagtgcatca tcgttgttca taca 24 <210> 13 <211> 20 <212> DNA <213> myogenin_F <400> 13 ccagcccatg gtgcccagtg 20 <210> 14 <211> 20 <212> DNA <213> myogenin_R <400> 14 gcgtctgtag ggtcagccgc 20 <210> 15 <211> 24 <212> DNA <213> HO-1_F <400> 15 accgccttcc tgctcaacat tgag 24 <210> 16 <211> 21 <212> DNA <213> HO-1_R <400> 16 tgttcctctg tcagcatcac c 21 <210> 17 <211> 20 <212> DNA <213> act_F <400> 17 agagggaaat cgtgcgtgac 20 <210> 18 <211> 21 <212> DNA <213> act_R <400> 18 caatagtgat gacctggccg t 21 <210> 19 <211> 20 <212> DNA <213> GSTA_F <400> 19 ggagattgat gggatgaagc 20 <210> 20 <211> 20 <212> DNA <213> GSTA_R <400> 20 aacacctttt caaaggcagg 20 <210> 21 <211> 20 <212> DNA <213> NQO1_F <400> 21 gacatgaacg tcattctctg 20 <210> 22 <211> 20 <212> DNA <213> NQO1_R <400> 22 ctagctttga tctggttgtc 20 <210> 23 <211> 20 <212> DNA <213> HO-1_Chip-FWD <400> 23 tgtgccatca ctacccagaa 20 <210> 24 <211> 20 <212> DNA <213> HO-1_Chip-REV <400> 24 agcagggtaa ggcttggaat 20 <210> 25 <211> 19 <212> RNA <213> siCon <400> 25 ccuacgccac caauuucgu 19 <210> 26 <211> 19 <212> RNA <213> siFox01_1 <400> 26 ccagaccagg auaauuggu 19 <210> 27 <211> 19 <212> RNA <213> siFox01_2 <400> 27 cuaauguguc ucaaacauu 19 <210> 28 <211> 19 <212> RNA <213> siFox01_3 <400> 28 caucuaugca gccuuguuu 19 <210> 29 <211> 19 <212> RNA <213> siHO-1 <400> 29 cagaucagca cuagcucau 19 <210> 30 <211> 19 <212> RNA <213> siHO-2 <400> 30 caccaaggag guacacauc 19 <210> 31 <211> 19 <212> RNA <213> siHO-3 <400> 31 ccugaaucga gcagaacca 19

Claims (14)

A small interfering RNA (short interfering RNA) complementarily binding to the mRNA of a gene of heme oxygenase-1 (HO-1), comprising a base sequence consisting of any one of SEQ ID NOS: 29 to 31 A pharmaceutical composition for preventing and treating muscular atrophy containing siRNA as an active ingredient.
The method according to claim 1, wherein the heme oxygenase-1 comprises an amino acid sequence of SEQ ID NO: 1 (NP_002124.1; human HO-1) or SEQ ID NO: 2 (NP_034572.1; mouse HO-1) A pharmaceutical composition for the prevention and treatment of muscular atrophy.
delete delete The pharmaceutical composition for preventing and treating muscular atrophy according to claim 1, wherein the muscular atrophy is skeletal muscle atrophy.
The pharmaceutical composition according to claim 1, wherein the hemoxigenin-1 is expressed or acts independently of NRF2 (Nuclear factor erythroid 2-related factor 2).
delete delete delete delete delete A small interfering RNA (short interfering RNA) complementarily binding to the mRNA of a gene of heme oxygenase-1 (HO-1), comprising a base sequence consisting of any one of SEQ ID NOS: 29 to 31 A health food for preventing and improving muscular dystrophy containing siRNA as an active ingredient.
13. The health food for preventing and improving muscular atrophy according to claim 12, wherein the muscular atrophy is skeletal muscle atrophy.




delete

Images