KR101573824B1 - Primer for K3a Race Typing of Xanthomonas oryzae pv. oryzae and Method of K3a Race Typing of Xanthomonas oryzae pv. oryzae using the same - Google Patents

Abstract

The present invention is to determine the specific DNA fragment and primers for its detection and K3a race of the rice huinip diamond pathogens by using this existing in K3a race rice huinip the rice huinip diamond pathogen (Xanthomonas oryzae pv. Oryzae) pathogens blight of rice ≪ / RTI >
The primer according to the present invention can form an amplification band only for the K3a race of rice blast fungus pathogen, so that the K3a race of the rice blast fungus pathogen can be identified promptly and accurately, unlike the conventional methods.

Description

TECHNICAL FIELD [0001] The present invention relates to a primer for identifying a K3a race of rice blast fungus, and a method for identifying the same. oryzae and Method of K3a Race Typing of Xanthomonas oryzae pv. oryzae using the same}

The present invention relates to a pathogen of rice, a pathogenic bacterium such as Xanthomonas oryzae pv . oryzae K3a lace, a primer for detecting the DNA fragment, and a method for identifying K3a race of rice blast fungus pathogen using the same.

Blight of rice blight is caused by a pathogenic bacterium such as Xanthomonas oryzae pv. oryzae ), and the damage pattern is reduced in yield and quality due to loss of photosynthesis and fruit ripening rate. Blight of rice blight occurs in most rice cultivation areas including Asia, Africa, Latin America and Australia as well as Korea, and is known to be a serious disease particularly in Southeast Asia.

The damage caused by the blight of rice blight may be different depending on the type of the pathogenic bacterium, rice blotch and rice blotch. Therefore, it is important to quickly identify the type of pathogenic microorganisms that are responsible for the occurrence of blight of rice blast fungus in future measures.

A different variety or variant in the same plant pathogenic bacterium is called a race, and a reference variety to distinguish the race is called a differential variety. .

At present, in Korea, the Japanese varieties are replaced with the Korean varieties (Milyang 42, Hangang Challa, Poongsan Rice, Cheongcheong Rice, Milyang 23) and the race is tested. As a result, five races (K1, K2, K3, K4 K2 (29%), K3 (29%), K4 (2%) and K5 (2%) were found in the national races in 2005.

However, the discrimination of lace is time-consuming and time-consuming because it is judged to be susceptible or resistant depending on the symptoms which are obtained by inoculating the pathogenic bacteria into the five discriminating varieties, and the morphological, physiological and biochemical characteristics are not shown, It is difficult to make a quick determination.

 The most widely used method to identify species at the genetic level is DNA fingerprinting. This method is further classified into Restriction Fragment Length Polymorphism (RFLP) analysis, a method using differences in the nucleotide sequence of the ribosomes, and a PCR (polymerase chain reaction) method using specific primers.

In the PCR method, a specific DNA fragment (primer) composed of 10 to 20 mer is annealed to a genomic DNA of a bacterium, and then a heat-resistant DNA polymerase (Taq polymerase) is added and the synthesis reaction is repeated , The region to which the primer is bound is rapidly amplified and the PCR amplification product is electrophoresed on an agarose gel or an acrylamide gel and the mixture is mixed with ethidium bromide and silver stain DNA polymorphism of bacterial species such as the presence or absence of DNA bands after DNA staining

The inventors of the present invention attempted to identify the race of rice blast fungus by using the method of identifying the species at the DNA level by the development of the recent molecular biology technique. Using the PCR process, To determine the race quickly and accurately.

An object of the present invention is to provide a gene having the nucleotide sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a method for treating Xanthomonas oryzae pv. oryzae ) K3a race.

It is still another object of the present invention to provide a primer set for discriminating K3a from rice blossom bloom, which comprises a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

It is another object of the present invention to provide a method for treating Xanthomonas oryzae pv . oryzae ) to extract DNA; PCR amplifying the extracted DNA using the primer set; PCR amplification results in Rice huinip diamond pathogen (Xanthomonas oryzae pv. Oryzae), specific genes of K3a race (SEQ ID NO: 1) providing all or a determination method of Rice huinip diamond pathogens K3a race including the step to determine whether some of the amplification of the .

It is still another object of the present invention to provide a PCR kit for discriminating rice bloom pathogenic K3a lace comprising the primer set.

In order to solve the above problems, the present invention provides a gene having the nucleotide sequence of SEQ ID NO: 1.

In addition, the present invention relates to a method for the treatment of Xanthomonas oryzae pv. oryzae ) K3a race.

Further, the present invention provides a primer set for discriminating K3a from rice bran blight pathogen comprising a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

In addition, the present invention relates to a method for producing rice bran cultivar ( Xanthomonas oryzae pv . oryzae ) to extract DNA; PCR amplifying the extracted DNA using the primer set; PCR amplification results in Rice huinip diamond pathogen (Xanthomonas oryzae pv . oryzae ) K3a race (SEQ ID NO: 1) in the whole or part of the K3a race.

In addition, the present invention provides a PCR kit for discriminating rice bloom pathogenic K3a lace comprising the primer set.

The use of the primer set for discrimination of rice bloom leaf pathogenic K3a of the present invention enables rapid and accurate determination of the race discrimination of rice bloom leaf pathogens, and thus it is possible to cope early, so that the time required for the race classification method according to the pathogenicity test according to the rice variety And the cost can be drastically reduced.

Fig. 1 shows the K3a specific band of rice blast fungus through AFLP-PCR analysis.
FIG. 2 is a diagram showing the result of specifically detecting the K3a race of rice blotter blight disease through PCR analysis.
FIG. 3 is a diagram showing the result of specifically detecting the K3a race of rice blast fungi through PCR analysis.
FIG. 4 is a graph showing bands depending on the elapsed time after inoculation of rice blast fungus.
FIG. 5 is a chart for confirming the detection from various regions of rice leaves infected with rice blast fungus.
(A) Rice leaves 5 days after artificial inoculation, (B) Detection of infected rice leaves from various regions

Hereinafter, the present invention will be described in detail.

In order to solve the above problems, the present invention provides a gene having the nucleotide sequence of SEQ ID NO: 1. The gene of SEQ ID NO: 1 is a pathogenic bacterium such as Xanthomonas oryzae pv. oryzae ) K3a race.

The gene having the nucleotide sequence of SEQ ID NO: 1 is Xanthomonas oryzae pv. oryzae ) K3a race, it can be used as a genetic marker for discrimination of K3a race.

The inventors of the present invention performed AFLP (amplified fragment length polymorphism) analysis to specifically identify the K3a race of rice blast fungus, which has been identified as dominant in Korea, and performed amplification product cloning and sequencing analysis specific for rice blast fungus K3a Respectively. Based on these results, the present inventors have completed the present invention by selecting a final one of the above-mentioned gene markers, developing a specific primer for the same, and developing a method of discriminating the K3a race of rice blossom bloom through PCR analysis using the specific primer.

Further, the present invention provides a primer set for discriminating K3a from rice bran blight pathogen comprising a primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.

The primer set may be prepared on the basis of the nucleotide sequence of SEQ ID NO: 1. In order to facilitate PCR, a primer set may be prepared using a computer program (Primer Designer V. 1.01, Scientific and educational software )). ≪ / RTI > Preferably, the primer for discrimination of rice blast fungus pathogenic K3a comprises 15 to 25 mer, and the content of G and C in the primer is preferably 50% or more.

In addition, the present invention relates to a method for producing rice bran cultivar ( Xanthomonas oryzae pv . oryzae ) to extract DNA; PCR amplifying the extracted DNA using the primer set; PCR amplification results in Rice huinip diamond pathogen (Xanthomonas oryzae pv . oryzae ) K3a race (SEQ ID NO: 1) in the whole or part of the K3a race.

In addition, the present invention provides a PCR kit for discriminating rice bloom pathogenic K3a lace comprising the primer set.

The K3a lace identification of the rice blast fungus pathogenic bacterium using the PCR of the present invention is carried out using a primer, and the PCR conditions are preferably in the usual conditions and can be suitably adjusted according to the characteristics of the primer.

The primer set forms a single band of about 1024 bp (i.e., amplifies) only for the rice blast fungus pathogen K3a lace and does not form any bands for other races. In addition, it can be detected from 2 days after infection with rice blast fungus, and it is possible to detect the presence of pathogens up to 8 cm without symptoms, The pathogen K3a race can be distinguished.

In the specific examples and experimental examples of the present invention, a specific primer set of a specific size (SEQ ID NO: 2 and SEQ ID NO: 3) was used, but any size It is obvious to those skilled in the art that the same K3a race of rice blast fungus can be discriminated even if a primer set of the sequence of SEQ ID NO:

The term 'capable of amplifying all or a part of the gene' (SEQ ID NO: 1) means that only the entire sequence is amplified, only a part of the sequence is amplified, or amplified to the periphery including the entire sequence, It can be amplified to the periphery including a part thereof.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example  1> rice Bacterial  Selection and K3a Amplification product  analysis

Xanthomonas oryzae pv . 3 or 7 strains were selected from each race for the development of K3a race specific gene markers and primers of oryzae as shown in Table 1 below. PCR was carried out using a total of 64 combinations of AFLP primers in the selected strains. As a result, a product specifically amplified only in K3a was confirmed (FIG. 1).

number Strain name race number Strain name race One KACC10331 K1 12 KACC10877 K2 2 KACC10380 K1 13 KACC10882 K2 3 KACC10861 K1 14 HB01001 K3a 4 KACC10862 K1 15 HB01002 K3a 5 KACC10878 K1 16 HB01003 K3a 6 KACC10879 K1 17 HB01005 K3a 7 KACC10880 K1 18 HB01009 K3a 8 KACC10382 K2 19 KACC10859 K1 9 KACC10383 K2 20 HB04037 K5 10 KACC10873 K2 21 HB04044 K5 11 KACC10876 K2 22 HB04054 K5

< Example  2> Rice blight pathogenic bacteria of K3a  Lace identification Marker  analysis

Specific amplified fragments were cloned by AFLP (amplified fragment length polymorphism) analysis for the production of specific primers for PCR analysis for discrimination of K3a lace from rice blast fungus. It was confirmed that the size of the gene marker was 1024 bp for the discrimination of the K3a race of rice blast fungus, and the sequence is shown in SEQ ID NO: 1.

< Example  3> Bacterial pathogen of K3a  Specific for race discrimination primer  making

Of the marker for the K3a lace discrimination of the rice blotch pathogens of SEQ ID NO: 1 analyzed in Example 2 above Based on the nucleotide sequence, one pair of specific primers for PCR was prepared and shown in Table 2 below.

name The sequence (5'-3 ') Size (bp)  K3a forward primer (SEQ ID NO: 2) TCTGATTCGCAACGCTTTTGAGGAC 1024
K3a reverse primer (SEQ ID NO: 3) CTTCCTAATCAATAGTCACCTTGAA

< Experimental Example  1> rice Bacterial K3a  Race-specific detection analysis

PCR was carried out using the primers prepared in Example 3, which were widely collected in Korea for the specific detection and analysis of K3a racemia of rice blossom blight.

Specifically, the PCR amplification reaction was carried out using a MyCycler thermal cycler (BioRad, USA), and the reaction was carried out in a Pro-Hot Start PCR Master Mix (TNT Research, Korea) 5 pmole of the K3a forward primer of SEQ ID NO: 2 and K3a reverse primer of SEQ ID NO: 3 were added to 1 mu l of the gDNA described in Table 3, respectively, so that the total amount was 20 mu l. The PCR reaction was carried out 25 times at 96 ° C for 15 seconds, 65 ° C for 15 seconds, and 72 ° C for 30 seconds.

As a result, It was confirmed that only the K3a race was specifically amplified (1024 bp) (Fig. 2).

< Experimental Example  2> rice Bacterial pathogen K3a  Discrimination primer  analysis

In order to analyze the specificity of the primer prepared in Example 3, 13 K3a lace strains, 15 Xathomonas genus strains and 3 Pseudomonas genus strains were subjected to detection PCR.

Specifically, the PCR amplification reaction was carried out using a MyCycler thermal cycler (BioRad, USA), and the reaction was carried out in a Pro-Hot Start PCR Master Mix (TNT Research, Korea) 5 pmole of K3a forward primer of SEQ ID NO: 2, and K3a reverse primer of SEQ ID NO: 3 were added 13 μl of K3a race, 15 of Xathomonas sp . And 3 of Pseudomonas sp . 20 &lt; / RTI &gt; The PCR reaction was carried out 25 times at 96 ° C for 15 seconds, 65 ° C for 15 seconds, and 72 ° C for 30 seconds.

As a result, it was confirmed that only the K3a race of rice blast fungus was detected and discriminated, and it was confirmed that it was specifically detected and discriminated only in the K3a race of rice blast fungus (Fig. 3).

< Experimental Example  3> rice Bacterial pathogen K3a  Discrimination Primer  Sensitivity analysis

<3-1> Rice Bacterial pathogen K3a  Discrimination Primer  Detection sensitivity analysis

The detection sensitivity was analyzed to confirm the possibility of using the on-site disease outbreak prediction using the primer for discriminating K3a of rice blast fungus pathogen produced in Example 3 above.

Specifically, K3a of rice blast fungus was inoculated into IR24 of Byeongseong Rice, and inoculation sites were collected daily from day 0 of inoculation. Then, an artificially inoculated rice leaf (1 cm) infected was immersed in 200 μl of distilled water for 20 minutes, and the immersion liquid was directly used for the PCR reaction. The PCR reaction was carried out using a MyCycler thermocycler (BioRad, USA). The reaction was carried out in a Pro-Hot Start PCR Mastermix (Master Mix, TNT Research, 2 K3a forward primer of SEQ. ID. NO. 3 and 1 .mu.l of K3a reverse primer of SEQ. ID. NO. 3 and 18 .mu.l of immersion solution to make the total amount to 20 .mu.l. The PCR reaction was carried out 25 times at 96 ° C for 15 seconds, 65 ° C for 15 seconds, and 72 ° C for 30 seconds.

As a result, it was not possible to detect it at 0 to 1 day after inoculation with rice blast fungus, but it was confirmed that it could be detected in 2 - day - old leaves. Thus, it was confirmed that rapid analysis can be performed without any additional process such as separation of the isolate and extraction of DNA to be practically applied in the field (FIG. 4).

<3-2> Rice Bacterial pathogen K3a  Discrimination Primer Symptom  Sensitivity analysis

The sensitivity of the disease was analyzed in order to confirm the possibility of using the on-site disease occurrence prediction using the primer for discriminating K3a of rice blast fungus pathogen produced in Example 3 above.

Specifically, K3a of rice blast fungus strain K3a was inoculated into IR24 of Diseased rice variety, and 1 cm of each sample was taken from 1 to 8 cm from the diseased part of the rice leaf after 5 days passed, and immersed in 200 쨉 l of distilled water for 20 minutes The immersion liquid was directly used for the PCR reaction. The PCR reaction was carried out using a MyCycler thermocycler (BioRad, USA). The reaction was carried out in a Pro-Hot Start PCR Mastermix (Master Mix, TNT Research, 2 K3a forward primer of SEQ. ID. NO. 3 and 1 .mu.l of K3a reverse primer of SEQ. ID. NO. 3 and 18 .mu.l of immersion solution to make the total amount to 20 .mu.l. The PCR reaction was carried out 25 times at 96 ° C for 15 seconds, 65 ° C for 15 seconds, and 72 ° C for 30 seconds.

As a result, it was confirmed that pathogens existed from the symptom to 8 cm without any symptoms (FIG. 5). Thus, it is possible to confirm the existence of the pathogenic bacterium of the rice blotch in the actual rice growing area.

K1, K2, K3, K4, K5: Race of the domestic rice blossom blight pathogen

<110> REPUBLIC OF KOREA <120> Primer for K3a Race Typing of Xanthomonas oryzae pv. oryzae and          Method of K3a Race Typing of Xanthomonas oryzae pv. oryzae using          the same <130> P130793 <160> 3 <170> Kopatentin 2.0 <210> 1 <211> 1024 <212> DNA <213> Xanthomonas oryzae pv. oryzae K3a <400> 1 tctgattcgc aacgcttttg aggacctcct cggagaagac ttcgaggggc gttttgaatc 60 caagtatctt gcgcggacga ttgtagagcc gctgctcgat ccatcgcagg tgcgcatcgg 120 tgatggtgct gaaatcggtc tgtcgtggca agtattggcg tgtcaatccg ttggcattct 180 cgttgctgcc gcgctgccat gggcagtacg gatctgcgaa atagaaatcg ctctgcaggc 240 aggcggcaat gagccgatga tcagcgaact ccttgccgtt gtcggcggtg agggtgtgaa 300 ctgcatggcg caggccgccc agtcgctgga caatggcgtt gcgcacgttc tcggcggtgc 360 cgtcgggcga gtaagccagc agatgcaggc gactgcggcg ttcggtcatg ctgaccacca 420 cgccatttcc gtgcgaggcc ctgatggtct ccagctccca gtcgccgata cggcttcgct 480 gctcaaccac actggggcgc tgtgtccagc tgcgccgatg cgtcagctgc ccgcggccat 540 cgcgcacgcc acgccgacgg cgcttgcggc ggcgtttgcg tagatgcatg aacaactgac 600 caccgcgctt ctgatcggcg tcgatgtgcc gatagatcca tgcgtgactg gccaagccgg 660 tgcgaccggc gatctgttcg ggactgacgt cctccctcag caggacctcg atctggcgga 720 tacgctcggc gtcgatgcgt ggacgccggc tggcctgcgt gcgccgatgg gcgctgatgc 780 gctgcgcgtg atcgggctgg taccgcgcag cgtgctgatt gcggcgcagc tcacgactga 840 tcgtgctggg cgcacgcgcc aatacatcgg cgatggcgcg catcgacatc ccggtttcat 900 ataaagcacg cagacgctga ggtttcccca catttcttcc tgcgagatca agcacttggt 960 gggccatgcg gtggaagaag gtgcgcgcat ggggcacgct tcaaggtgac tattgattag 1020 gaag 1024 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> K3a-Forward primer <400> 2 tctgattcgc aacgcttttg aggac 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> K3a-Reverse primer <400> 3 cttcctaatc aatagtcacc ttgaa 25

Claims (5)

delete SEQ ID NO: rice huinip diamond containing a gene consisting of the nucleotide sequence of the pathogen 1 (Xanthomonas oryzae pv. Oryzae) K3a race determine composition.
A primer having the nucleotide sequence of SEQ ID NO: 2 and a primer having the nucleotide sequence of SEQ ID NO: 3.
A pathogenic bacterium of rice blight ( Xanthomonas oryzae pv. oryzae ) to extract DNA;
PCR amplifying the extracted DNA using the primer set according to claim 3;
PCR amplification results showed that Xanthomonas oryzae pv. oryzae ) K3a race (SEQ ID NO: 1) is amplified in the presence or absence of the gene.
A PCR kit for discriminating rice bloom pathogenic K3a lace comprising the primer set according to claim 3.

Images