KR101570771B1 - Recombinant vector for polyunsaturated fatty acids biosynthesis and plant transformed by the same - Google Patents

Abstract

The present invention relates to a polyunsaturated fatty acid biosynthesis, and more particularly, to a method for producing a polyunsaturated fatty acid by transforming a plant into a multiple expression vector so that three genes McD6DES , AsELOVL5 and PtD5DES are simultaneously expressed using the pAO815 vector, And omega-6 polyunsaturated fatty acids such as GLA, STA, DGLA, ETA, ARA, EPA, DTA and DPA were biosynthesized in seeds.

Description

Technical Field [0001] The present invention relates to a recombinant vector for polyunsaturated fatty acid biosynthesis and a transformant plant produced using the recombinant vector,

The present invention is directed to the production of polyunsaturated fatty acids in plants using genes encoding a series of enzymes involved in polyunsaturated fatty acid biosynthesis.

Unsaturated fatty acids are chain-like compounds having one or more double bonds in a molecule and are widely distributed in plants and animals, and are generally composed of even numbers of about 12 to 20 carbon atoms. When a fatty acid molecule has only one double bond, it is called a monounsaturated fatty acid and has two or more double bonds and is called a polyunsaturated fatty acid. Unsaturated fatty acids are divided into a cis configuration and a trans configuration depending on the type of double bond followed by the hydrogen atom. The cis type means that the adjacent hydrogen atom is in the same direction as the double bond, and the trans type means that the next two hydrogen atoms are bonded in the opposite direction to the double bond. When a double bond is formed in a fatty acid chain, the hydrogen atom has to be removed, so the term " saturated " in saturated fatty acids means that the hydrogen atom is saturated. In intracellular metabolism, hydrogen-carbon bonds are broken or oxidized for energy production. Thus, unsaturated fatty acids contain less energy than saturated fatty acids of the same size. It is also known that unsaturated fatty acids have a lower melting point, which also increases the fluidity of the cell membrane.

Saturated fatty acid intake is associated with the risk of cardiovascular diseases such as hypercholesterolemia and atherosclerosis while the intake of unsaturated fatty acids is associated with a decrease in blood cholesterol and a reduced risk of developing atherosclerosis Is known to be associated with. Examples of unsaturated fatty acids include palmitoleic acid, oleic acid, myristoleic acid, linoleic acid, arachidonic acid, eicosapentaenoic acid, Eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and the like. Foods containing such unsaturated fatty acids include avocados, nuts, vegetable oils such as canola oil and olive oil. Although unsaturated fatty acids are healthier than saturated fatty acids, the Food and Drug Administration (FDA) recommends that the intake of unsaturated fatty acids should not exceed 30% of the daily calorie intake.

It has been reported that arachidonic acid (ARA, C20: 4 ω6), polyunsaturated fatty acids (PUFAs) of the omega 6 (ω6) and omega 3 (ω3) lines and eicosapentaenoic acid (docosahexaenoic acid, DHA, C22: 6 ω3) is an essential constituent of animal cell membranes and is a form of binding to phosphatidylcholine, To enhance the fluidity of the cell membrane, to reduce blood cholesterol, and to inhibit cancer proliferation. In particular, DHA has been shown to have important functions such as enhancement of brain function and memory, enhancement of brain function and learning of young children, enhancement of learning function, and hormone regulating action as a precursor of hormones such as prostaglandin. Recently, it has formed a big market in the fields of food additives, cosmetic raw materials and pharmaceuticals. In mammals, linoleic acid (LA, C18: 2 ω6) and ω6 / δ12 and ω3 / Δ15 desaturase were not expressed and thus, de novo synthesis of PUFA was not possible. Alpha-linolenic acid (ALA, C18: 3 ω3) must be ingested as food.

DHA is mainly produced from blue fish such as tuna. However, if a large amount of DHA is added to food, it becomes problematic in terms of merchantability due to fish-specific smell of fish, and pure separation and purification for removing the odor are the key. DHA production can also be achieved through marine algae, but due to the low growth rate, high-volume equipment is required for the mass production of DHA. In order to solve these problems and produce low-cost and high-efficiency DHA, interest in the production of PUFAs using expression systems in plant seeds is increasing. PUFAs are biosynthesized through a series of desaturation and 2-carbon chain elongation steps from the precursors LA and ALA (see FIG. 4). Plants do not biosynthesize PUFAs and the introduction of Δ6 desaturase (Δ6 desaturase, Δ6DES), Δ6 chain extension enzyme (Δ6 elongase, Δ6ELS), and Δ5 desaturase (Δ5 DES) to biosynthesize PUFAs from LA and ALA Is required.

To date, three pathways of PUFA biosynthesis have been known in nature [Qiu X (2003) Biosynthesis of docosahexaenoic acid (DHA, 22: 6-4, 7, 10, 13, 16, 19): two distinct pathways. Prostaglandins Leukot Essent Fatty Acids 68, 181-186.]. (1) Saprolegnia belonging to the water mold family uses a pathway for synthesizing EPA through Δ6 unsaturation, prolongation and Δ5 unsaturation on the precursor ALA [Pereira SL et al. (2004a)], while novel omega 3-fatty acid desaturase involved in the biosynthesis of eicosapentaenoic acid. Biochem J 378, 665-671.), (2) protoplasts such as Euglena biosynthes EPA by Δ9 extension, Δ8 unsaturation and Δ5 unsaturation [Wallis and Browse, (1999) The Delta8-desaturase of Euglena gracills: an alternate pathway for synthesis of 20-carbon polyunsaturated fatty acids. Arch Biochem Biophys 365, 307-316.]. EPA biosynthesized through the above two pathways ultimately biosynthesize DHA by Δ5 extension and Δ4 unsaturation [Pereira et al., 2004b]. Mammalian biosynthesizes DHA via a more complex four-step pathway from EPA, that is, retro-conversion by β-oxidation (Sprecher et al., 1995). . J Lipid Res 36, 2471-2477., 1995; Wallis et al., Polyunsaturated fatty acid synthesis: what will they think of next Trends Biochem Sci 27, 467-473.]. (3) Schizochytrium and marine microorganism (Shewanella) biosynthesize DHA using PKSe (polyketide synthase) pathway [Metz et al., (2001) Production of polyunsaturated fatty acids by polyketide synthases in both prokaryotes and eukaryotes. Science 293,290-293.]. When the enzymes used in the various PUFA biosynthetic pathways are reconstructed and used as genetic resources, studies have been carried out to construct a genetic engineering base for easily producing EPA and DHA, which were mainly consumed only by fish, in plants. However, It was not easy to produce polyunsaturated fatty acids from the seeds of plants by combining different derived genes.

Accordingly, the present inventors have found that the Δ6 desaturase gene McD6DES isolated from marsupials, which is involved in the synthesis of polyunsaturated fatty acids having various physiological activities such as blood circulation system, hormone secretion system, and immune system in high organisms, Δ5 unsaturated The desaturase gene PtD5DES and A fatty acid chain separated from the dome extending enzyme (elongase) was making a vector for plant transformation such gene AsELOVL5 is expressed at the same time, completed the present invention and verify its functionality by identifying its Arabidopsis high biosynthetic activity of unsaturated fatty acids in the rod seeds Respectively.

Korea Patent No. 0316068 Korea Patent No. 0606612

An object of the present invention is to provide a recombinant vector for plant transformation comprising a gene consisting of a nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence of SEQ ID NO: 2 and a nucleotide sequence of SEQ ID NO: 3.

Another object of the present invention is to provide a transgenic plant transformed with the recombinant vector for plant transformation.

Another object of the present invention is to provide a method for producing a plant producing a polyunsaturated fatty acid.

It is another object of the present invention to provide a method for producing polyunsaturated fatty acids from the seeds of the transgenic plants.

The present invention provides a recombinant vector for plant transformation comprising a gene consisting of a nucleotide sequence of SEQ ID NO: 1, a nucleotide sequence of SEQ ID NO: 2 and a nucleotide sequence of SEQ ID NO: 3.

The present invention also provides a transgenic plant transformed with the recombinant vector for plant transformation.

The present invention also provides a method for producing a plant producing a polyunsaturated fatty acid.

In addition, the present invention provides a method for producing polyunsaturated fatty acids from the seeds of the transgenic plants.

A plant in which a delta-6 unsaturated enzyme gene ( McD6DES ) encoding a series of enzymes involved in polyunsaturated fatty acid biosynthesis according to the present invention, a fatty acid carbon chain extension enzyme gene ( AsELOVL5 ) and a delta-5 unsaturated enzyme gene ( PtD5DES ) The seeds of the plant transformed with the recombinant vector for transformation can be utilized for the production of polyunsaturated fatty acids.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a graphical representation of the McD6DES , AsELOVL5 And PtD5DES Is a schematic view of a plant transformation vector.
Fig. 2 is a graph showing the expression profiles of McD6DES , AsELOVL5 And the PtD5DES gene cassette were introduced.
Figure 3 shows that 160 Arabidopsis plants transformed with the recombinant vector for plant transformation of the present invention were assigned to McD6DES , AsELOVL5 And the introduction of the PtD5DES gene.
FIG. 4 is a diagram showing serial numbers and lipid contents of T2 seeds obtained from 160 transformed Arabidopsis thaliana.
FIG. 5 is a graph showing omega-6 and omega-3 fatty acid compositions of T2 seeds per line of transgenic Arabidopsis thaliana lines of the present invention.
FIG. 6 is a graph showing the content of omega-6 and omega-3 fatty acids in the T2 seeds of the transformed Arabidopsis thaliana lines of the present invention.
FIG. 7 is a graph showing the contents of EPA, which is an omega-3 fatty acid, in T2 seeds according to the transgenic Arabidopsis thaliana lines of the present invention.
FIG. 8 is a graph showing GC analysis of polyunsaturated fatty acids of transgenic Arabidopsis T2 seeds of line 63. FIG.
FIG. 9 is a graph showing the polyunsaturated fatty acid content of the transformed Arabidopsis T2 seed of line number 63; FIG.
FIG. 10 is a diagram showing the conversion rates of omega-3 and omega-6 fatty acid biosynthesis in seeds of the transformed Arabidopsis thaliana according to the present invention.

Hereinafter, the present invention will be described in detail.

In the description of the fatty acid shown in the present invention, "16: 0" is taken as an example, 16 indicates the number of carbon chains, and the numbers after the letters indicate unsaturation. That is, 0 means saturated fatty acid and 1, 2 means unsaturated fatty acid.

As used herein, the term " polyunsaturated fatty acid (PUFA) " refers to a fatty acid containing four or more double bonds. Omega-6 and omega-3 fatty acids, and the class of polyunsaturated fatty acids in the art is well known. In the present invention, it is particularly preferable to use dihomo-gamma-linolenic acid (DGLA), arachidonic acid (ARA), docosatetraenoic acid (DTA), stearidonic acid (STA), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), docosapetaenoic acid And docosahexaenoic acid (DHA).

As used herein, the term "n-3 fatty acid" or "omega 3 (omega 3) fatty acid" refers to a series of fatty acids in which the third carbon has a double bond, counted from the methyl group end of the fatty acid.

As used herein, the term "n-6 fatty acid" or "omega 6 (omega 6) fatty acid" refers to a series of fatty acids in which the sixth carbon is double bond, counted from the methyl group end of the fatty acid.

The present invention provides a recombinant vector for plant transformation comprising a gene ( McD6DES ) consisting of the nucleotide sequence of SEQ ID NO: 1, a gene ( PtD5DE ) comprising the nucleotide sequence of SEQ ID NO: 2 and a gene ( AsELOVL5 ) comprising the nucleotide sequence of SEQ ID NO: Lt; / RTI >

The gene McD6DES is preferably, but not limited to, encoding the delta-6 desaturase derived from the mussel.

The gene PtD5DE preferably encodes a delta-5 desaturase from algae, but is not limited thereto.

The gene AsELOVL5 preferably encodes a fatty acid chain elongase derived from dome, but is not limited thereto.

The gene represented by SEQ ID NO: 1, 2 or 3 of the present invention includes both the genomic DNA encoding the protein and the cDNA.

Variants of the above base sequences are also included within the scope of the present invention. Specifically, the gene has a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1, 2 or 3 May contain a base sequence. "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The recombinant vector for plant transformation comprises a gene consisting of the nucleotide sequence of SEQ ID NO: 1, a gene consisting of the nucleotide sequence of SEQ ID NO: 2 and a nucleotide sequence of SEQ ID NO: 3 in sequence between the vicillin promoter and the octopine terminator But it is not limited thereto.

Preferably, the recombinant vector for plant transformation comprises a herbicide resistance Bar gene, but is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the conventional art. Examples of the vector include ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, There is a resistance gene for neomycin and tetracycline.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be vicillin, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter " refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator and Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The present invention also provides a transgenic plant transformed with a recombinant vector for plant transformation according to the present invention. Plants that are capable of expressing the vector of the present invention stably and continuously in seeds are preferred.

The plant is characterized by the expression of the gene consisting of the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of SEQ ID NO: 2 and the nucleotide sequence of SEQ ID NO: 3, and the omega-3 and omega- It is preferable that the content of the fatty acid is increased, but not limited thereto.

Preferably, the plant is an Arabidopsis thaliana or an oil plant. The plant is preferably selected from the group consisting of sesame, rapeseed, sunflower, castor bean, peanut, soybean, coconut, oil palm, and jojoba, But is not limited thereto.

When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, human cells (for example, Chinese hamster ovary, W138, BHK, COS-7, 293 , HepG2, 3T3, RIN and MDCK cell lines), plant cells and plants. The host cell is preferably a plant.

When the host cell is a eukaryotic cell, the vector of the present invention may be delivered by a microinjection method, a calcium phosphate precipitation method, an electroporation method, a liposome-mediated transfection method, an Agrobacterium-mediated transfection method, DEAE-dextran treatment, and gene bombardment, etc., into a host cell.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

The plant according to the present invention is selected from the group consisting of food crops selected from the group consisting of rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and millet; Vegetable crops selected from the group consisting of Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, perilla, peanut and rapeseed; Apple trees, pears, jujubes, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots and banana; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed crops selected from the group consisting of Ryegrass, Red Clover, Orchardgrass, Alpha Alpha, Tall Fescue, and Fereniallaigrus.

In addition,

1) introducing the vector for plant transformation of claim 1 into Agrobacterium;

2) infecting the plant with the Agrobacterium of step 1);

3) treating the herbicide to select transgenic plants; And

4) determining the content of unsaturated fatty acids in the seeds of the selected plants. The present invention also provides a method for producing a plant producing a polyunsaturated fatty acid.

In addition, the present invention provides a method for producing polyunsaturated fatty acids from seeds of a transgenic plant according to the present invention.

The polyunsaturated fatty acids may be selected from the group consisting of dihomo-gamma-linolenic acid (DGLA), arachidonic acid, docosatetraenoic acid (DTA), stearidonic acid (STA), eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), and docosapetaenoic acid , But the present invention is not limited thereto.

The gamma-linolenic acid (DGLA), arachidonic acid (ARA) and docosatetraenoic acid (DTA) produced by the present invention are produced by the transformation of linoleic acid (DGLA) produced by the transgenic Arabidopsis thaliana (EA), eicosapentaenoic acid (ETA), eicosapentaenoic acid (EPA), docosapetaenoic acid (DPA), and docosahexaenoic acid (DHA), which are omega-6 unsaturated fatty acids produced by using LA (C18: 2n- acid is an omega-3 unsaturated fatty acid produced by using α-linolenic acid (ALA; C18: 3n-3) produced by the transgenic Arabidopsis thaliana as a substrate.

The present invention in one embodiment introducing pike eel derived from the Δ6 desaturation enzymes (desaturase) gene McD6DES, the birds derived Δ5 desaturation enzyme (desaturase) extended fatty acid chain of a gene PtD5DES and dome-derived enzyme (elongase) gene AsELOVL5 in a vector The transgenic recombinant vectors were constructed and transfected into Arabidopsis thaliana producing LA and ALA, and the genes expressed from these transgenic lines were successfully produced by GC in the transgenic Arabidopsis thaliana T2 seeds Respectively. Thus, plants transformed with a recombinant vector for plant transformation containing the McD6DES , PtD5DES and AsELOVL5 of the present invention can produce and provide polyunsaturated fatty acids useful for mammals through the omega-6 pathway and the omega-3 pathway .

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

< Example  1> McD6DES , PtD5DES  And AsELOVL5  Generation of vectors for transgenic plant transformation

A vector expressing the Δ6 desaturase gene McD6DES , the Δ5 desaturase gene PtD5DES and the fatty acid chain elongase gene AsELOVL5 was prepared . Specifically, the Δ6 desaturase gene McD6DES (SEQ ID NO: 1) isolated from the marsupial ( Muraenesox cinereus ), the microalgae ( Phaeodactylum the desaturase gene PtD5DES (SEQ ID NO: 2) derived from ticornutum KMCC B-128 and Dome ( Acanthopagrus The gene cassette was prepared by recombining the fatty acid chain elongase gene AsELOVL5 (SEQ ID NO: 3) isolated from Schlegeli with a seed-specific expression vicillin promoter and an octopine terminator, respectively. The constructed gene cassette and pCAMBIA3300 were used to construct pCam-VpAsELOVL5OCS-VpMcD6DOCS-VpPtD5DESOCS (Fig. 1) for expression of three genes simultaneously. The primers of Table 1 below were used for vector production.

Gene name Primer name The sequence (5 '- &gt; 3') SEQ ID NO: McD6DES
McD6D-F ATGGGGGGCGGAGGTCAACAGACG 4 McD6D-R TTATTTGGAGATACGCATCCAGCCACAGATCT 5 PtD5DES
PtD5D-F ATGGCTCCGGATGCGGATAAGCTT 6 PtD5D-R TTACGCCCGTCCGGTCAAGGGATTTT 7 AsELOVL5
AsELOVL5-F ATGGAGACCTTCAATCACAAACTGAACGTTTAC 8 AsELOVL5-R TCAATCCACTCTCAGTTTCTTGTGTGCAGTGT 9

As a result, it was confirmed by PCR that the three gene cassettes were normally introduced into the multi-expression carrier prepared above (Fig. 2).

< Example  2> Production of transgenic Arabidopsis

The Arabidopsis thaliana was introduced into Agrobacterium GV3101 for transformation of the multi-expression carrier prepared in Example 1 above. After the seeds of the Arabidopsis thaliana seedlings transduced with the multimodal transporter were inoculated, the transformed Arabidopsis thaliana seedlings were selected by treating with 0.3% of Basta when the four leaves were developed. Thereafter, 1-2 selected leaves were picked from the 160 Arabidopsis thaliana poles, and genomic DNA was isolated. AsELOVL5 and PtD5DES were confirmed by PCR using the primers shown in Table 1 above. Since the ORF size 1338 bp overlapped with the PtD5DES ORF size 1410 bp and applied on the gel, the McD6DES primer (SEQ ID NOs: 10 and 11 ) Used the nucleotide sequence in the ORF to yield a 625 bp product.

As a result, it was possible to select Arabidopsis lines in which the above three genes were completely transformed (Fig. 3).

< Example  3> Transgenic Arabidopsis thaliana T2  Securing seeds

160 transgenic Arabidopsis thaliana T1 plants prepared in Example 2 were planted in the pot to obtain T2 seeds. A serial number was newly assigned to the seed thus obtained (Fig. 4).

< Example  4> Transgenic Arabidopsis thaliana T2  Identification of fatty acid composition of seeds

McD6DES , AsELOVL5 And transgenic lines (1, 2, 5, 11, 12, 14, 15, 18, and 18) transduced with the PtD5DES gene and expressing delta 6-desaturase, fatty acid elongase and delta 5- T2 seeds (0.1 g) of 20, 21, 23, 26, 27, 28, 33, 41, 44, 63, 64 and 65 were obtained and then pulverized. 5 ml of a 2: 1 mixture of chloroform and methanol and 0.1 ml of internal standard (pentadecanoic acid in MeOH, 1000 ppm, 1 mg.ml) were added to 0.1 g of well pulverized seeds and shocked with ultrasonic waves for 1 hour. The lipids were extracted to the organic solvent. Then, 5 ml of 0.58% NaCl was added, ultrasonicated for 10 minutes, and the layers were separated by centrifugation at 2000 rpm for 20 minutes. In the lower layer of the separated layer, the solvent was removed with nitrogen gas, and 0.5 ml of toluene and 2 ml of 0.5 N NaOH were added to the sample containing only lipid, followed by reaction at 85 ° C for 5 minutes. After the reaction, the mixture was cooled, 2.5 ml of 14% BF ₃ was added thereto, and the mixture was reacted at 85 ° C for 5 minutes. The reaction solution was transferred to a new tube, 10 ml of petroleum ether and 15 ml of ddH ₂ O were added and vortexed. After that, the supernatant was centrifuged at 2000 rpm for 20 minutes and the solvent was removed with nitrogen gas to obtain a lipid. The lipid was dissolved in 300 μl of petroleum ehter and analyzed by gas chromatography (GC) (GC-2010 Plus, SHIMADZU) based on commercialized lipid standard (Sigma, St. Louis, MO) The GC-MS was analyzed by time zone, and the fatty acid content of the T2 seeds by the methanol concentration and the fatty acid contents of the T2 seeds by the line for the total fatty acid products were expressed in%.

As a result, it was confirmed that the three genes introduced into the vector of the present invention are omega-3 fatty acids using linoleic acid (LA; 18: 2n-6) and α-linolenic acid (ALA; 18: 3n- 6 fatty acid synthesis pathway, a double bond was formed in the LA fatty acid by delta 6-desaturase expressed by the transgene McD6DES and converted to gamma-linolenic acid (GLA; 18: 3n-6) by a fatty acid elongase expression by AsELOVL5 the carbon chain is extended two di-homo-linolenic acid (DGLA , 20: 3n-6) was converted to. DGLA was converted to arachidonic acid (ARA; 20: 4n-6) by the formation of double bonds by delta 5-desaturase expressed by the transgene PtD5DES . This ARA was converted back to docosatetraenoic acid (DTA, 22: 4n-6) by extending the two carbon chains back by AsELOVL5. The three genes were sequestered with stearidonic acid (STA, 18: 4n-3), eicosatetraenoic acid (ETA, 20: 4n-3) and eicosapentaenoic acid (EPA, 20 : 5n-3) and docosapentaenoic acid (DPA, 222: 5n-3) were synthesized. The results are shown in FIG. 4 in terms of the intensity of the polyunsaturated fatty acid biosynthesis in each line, and the results are shown in FIG. 5 as the intensity of the newly synthesized omega-6 and omega-3 The content of fatty acids in terms of their total content is expressed in% (Figs. 5 and 6). According to the results, the transformants containing 0.20-0.25% of the content of omega-3 polyunsaturated fatty acid EPA were 63, 64 and 12, respectively. The transformants that were 0.15-0.19% were 44, 33, 18, 15 and 11, and the transformants which were 0.07-0.11% were 65, 41, 23, 21, 20 and 14, respectively. The transformants that were 0.02-0.05% were 28, 27, 26, 5, 2, and 1, respectively. FIG. 7 is a graph showing only the EPA content of each transformant line.

< Example  5> line 63 (line, line) Transgenic Arabidopsis thaliana T2  Identification of fatty acid composition of seeds

GC analysis was performed by extracting lipids from a predetermined amount of T2 seed (0.1 g) of a line (line) of a transformant line (line) that produces a large amount of EPA among the lines identified in Example 4 above.

As a result of GC analysis, it was found that the three genes introduced into the vector of the present invention synthesized GLA, DGLA, ARA and DTA using LA as a substrate according to the omega-6 fatty acid synthesis pathway in the Arabidopsis thaliana line (line 63) And that the three genes synthesized STA, ETA, EPA and DPA using ALA as a substrate according to the omega-3 fatty acid synthesis pathway (FIG. 8). In addition, the production fatty acid composition of the line 63 line is shown in FIG.

As described above, the conversion of STA (omega-3) to GLA (omega-6) was not observed even though the substrate ALA (used for the omega-3 pathway) ) And the production of DPA (omega - 3) just before two stages of DHA production was higher than that of DTA (omega - 6). Thus, it can be seen that the three genes used for transformation are more strongly involved in omega-3 fatty acid biosynthesis in the pathway for producing polyunsaturated fatty acids (FIG. 10).

<110> republic of Korea <120> Recombinant vector for polyunsaturated fatty acids biosynthesis          and plant transformed by the same <130> p131050 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 1335 <212> DNA <213> Muraenesox cinereus <400> 1 atggggggcg gaggtcaaca gacggagtcg gaatcgagct gtgggcgagg aggcggcgtt 60 ttcacctggg aagaggtgca gcggcattcc cacaaggggg accagtggtt ggtaatcgac 120 agaaaggtgt gcaacatcac cgactgggtg aaaagacatc caggcggcgc ccgggtcatc 180 agccactatg ccggggagga cgccacggat gcttttgctg cattccatcc agagcctgac 240 tttgtgcgca agtttctgaa gccactgctg attggtgagc ttgcaacctc tgagcccaac 300 caggaccggg acaaaaattc tgtgttgaca caggctttcc gcgaactgcg cgaggaggta 360 gagagggagg gcctcttcag gactcagccg ctgttctttt gcctccacct ggggcatatt 420 cttctcctgg aggccctggc ttacttgctg atttgggtgt atggaacagg ctggctccag 480 accctgctgt gtgcagtaat actggccacc tcacagtctc aggccggatg gctccagcat 540 gacttcggcc acctttccgt cttcaaaaag tcccgctgga accacctgct gcacaagttt 600 gtcatcggac accttaaggg tgcttcggct aactggtgga accatcggca tttccagcac 660 catgcaaaac ccaacatctt cagtaaagac cctgatgtca acatgctcca cacctttgtg 720 ctaggaaaga cccagccagt ggagtatgga ataaagaaga tcaagtacat gccttacaac 780 caccagcacc agtacttctt cctcattgga cctcctatgc ttatcccagt gtatttccac 840 atccagatca tgcaaaccat gttctttcga cgtgattggg tggacctcgt ctggtcaatg 900 agctactacc tgcgctactt cacctgctac acgccctttt acggagtttt tggagctgtg 960 gcgctcatca gcttcgttag gtttctggag agccactggt ttgtgtgggt gacccaaatg 1020 aaccacattc ccatggacat tgaccacgag aagcacgagg attggctgac catgcagctg 1080 aaggccacct gcaacattga gcagtcattc ttcaacgact ggttcagcgg acacctcaac 1140 ttccaaatcg aacaccatct gtttcccaca atgccccggc acaactactg ccgcgtggcc 1200 cctctggtgc gcaaggtgtg tgagaagcat ggcgtcacct accaggagaa gaccctgtgg 1260 agcggcttca gagacgtggt cagctctcta cgggagtctg gagatctgtg gctggatgcg 1320 tatctccata aataa 1335 <210> 2 <211> 1410 <212> DNA <213> Phaeodactylum tricornutum <400> 2 atggctccgg atgcggataa gcttcgacaa cgccagacga ctgcggtagc gaagcacaat 60 gctgctacca tatcgacgca ggaacgcctt tgcagtctgt cttcgctcga cggcgaagaa 120 gtctgcatcg acggaatcat ctatgacctc caatcattcg atcatcccgg gggtgaaacg 180 atcaaaatgt ttggtggcaa cgatgtcact gtacagtaca agatgattca cccgtaccat 240 accgagaagc atttggaaaa gatgaagcgc gtcggcaagg tgacggattt cgtctgcgag 300 tacaagttcg ataccgaatt tgaacgcgaa atcaaacgag aagtcttcaa gattgtgcga 360 cgaggcaagg atttcggtac tttgggatgg ttcttccgtg cgttttgcta cattgccatt 420 ttcttctacc tgcagtacca ttgggtcacc acgggaacct cttggctgct ggctgtggcc 480 tacggagtct cccaagcgat gattggcatg aatgtccagc acgatgccaa ccacggggcc 540 acctccaagc gtccctgggt caacgacatg ctaggcctcg gtgcggattt tattggtgga 600 tccaagtggc tctggcagga acaacactgg acccaccacg cttacaccaa tcacgccgag 660 atggatcccg atagctttgg tgccgaacca atgctcctat tcaacgactg tcccttggat 720 catcccgctc gtacctggct acatcgcttt caagcagtct tttacatgcc cgtcttggct 780 ggatactggt tgtccgctgt cttcaatcca caaattcttg acctccagca acgcggcgca 840 gt; ttctggcggg ccgtgtacat tgcggtgaac gtgattgctc cgttttacac caactccggc 960 ctcgaatggt cctggcgtgt ctttggaaac attatgctca tgggtgtggc ggaatcgctc 1020 gcgctggcgg tcctgttttc gttgtcgcac aatttcgaat ccgccgatcg cgatccgacc 1080 gccccactga aaaagacggg agaaccagtc gactggttca agacacaggt cgaaacttcc 1140 tgcacttacg gtggattcct ttccggttgc ttcacgggag gtctcaactt tcaggttgaa 1200 caccacttgt tcccacgcat gagcagcgcc tggtacccct acattgcccc caaggtccgc 1260 gaaatttgcg ccaaacacgg cgtgcactac gcctactacc cgtggatcca ccaaaactt 1320 ctctccaccg tccgctacat gcacgcggcc gggaccggtg ccaactggcg ccagatggcc 1380 agagaaaatc ccttgaccgg acgggcgtaa 1410 <210> 3 <211> 885 <212> DNA <213> Acanthopagrus schlegeli <400> 3 atggagacct tcaatcacaa actgaacgtt tacttcgaga catggatggg tccccgagat 60 cagcgggtgc ggggatggct actgctcgac aactacccac caacctttgc actcacagtc 120 atgtaccttc tgatcgtgtg gatggggccc aagtacatga aacaccggca gccgtacccc 180 tgcagaggcc tcctggtgct ctacaatctg ggcctcacac tcctctcctt ctacatgttc 240 tatgagcttg ttactgctgt gtggtatggc ggctacaatt tctactgcca ggacactcac 300 agtgcacagg aagtggataa taagatcata aatgtccttt ggtggtacta cttctccaag 360 ctcattgagt tcatggacac ctttttcttc atactacgga agaataatca ccagatcacc 420 tttcttcaca cctaccacca cgccagcatg ctgaatatct ggtggtttgt tatgaactgg 480 gtaccctgcg gccactcgta cttcggtgcc tccctaaaca gcttcgtcca cgtcgtgatg 540 tattcttact acggcctctc agccatccca gccatgcggc cgtacctttg gtggaagaag 600 tacatcacac agttccagct gatccagttc tttttaacca tgtcccagac aatatttgca 660 gtcatatggc cgtgtggctt ccccgacgga tggctttact tccaaatagg ttacatggtc 720 acgctaattt tcctgttctc aaacttctac attcagacct acaacaagca cagtgcatct 780 ctaaggaagg agcaccagaa cggctctcct ctatcaacaa atggacatgc aaacgggacg 840 ccatcgatgg agcacactgc acacaagaaa ctgagagtgg attga 885 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> McD6D-F primer <400> 4 atggggggcg gaggtcaaca gacg 24 <210> 5 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> McD6D-R primer <400> 5 ttatttatgg agatacgcat ccagccacag atct 34 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > PtD5D-F primer <400> 6 atggctccgg atgcggataa gctt 24 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PtD5D-R primer <400> 7 ttacgcccgt ccggtcaagg gatttt 26 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> AsELOVL5-F primer <400> 8 atggagacct tcaatcacaa actgaacgtt tac 33 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> AsELOVL5-R primer <400> 9 tcaatccact ctcagtttct tgtgtgcagt gt 32 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> McD6D-106-F primer <400> 10 tggttggtaa tcgacagaaa ggtgt 25 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> McD6D-730-R primer <400> 11 tctttcctag cacaaaggtg tggag 25

Claims (12)

A △ 6 desaturase gene isolated from the marsupial ( Muraenesox cinereus ) described in the nucleotide sequence of SEQ ID NO: 1, a △ 6 desaturase gene isolated from the microalgae ( Phaeodactylum ticornutum KMCC B-128) described in the nucleotide sequence of SEQ ID NO: 5 stearidonic acid and DPA (docosapetaenoic acid) in plant seeds, including the desaturase gene of SEQ ID NO: 3 and the fatty acid chain elongase gene isolated from the dome ( Acanthopagrus schlegeli ) acid to increase the production efficiency of the plant.
delete delete delete The recombinant vector for plant transformation according to claim 1, wherein the recombinant vector for plant transformation comprises a gene consisting of the nucleotide sequence of SEQ ID NO: 1 between a vicillin promoter and an Octopine terminator, A gene consisting of a nucleotide sequence and a gene consisting of a nucleotide sequence of SEQ ID NO: 3, respectively.
A transgenic plant transformed with the recombinant vector for plant transformation of claim 1.
The plant according to claim 6, wherein the plant is selected from the group consisting of a △ 6 desaturase gene isolated from the marsupial ( Muraenesox cinereus ) described in the nucleotide sequence of SEQ ID NO: 1, a microorganism ( Phaeodactylum tricornutum Expression of the Δ5 desaturase gene isolated from KMCC B-128 and the expression of a fatty acid chain elongase gene isolated from dome ( Acanthopagrus schlegeli ), which is described in the nucleotide sequence of SEQ ID NO: 3, wherein the production efficiency of stearidonic acid and docosapetaenoic acid (DPA) is enhanced.
The transgenic plant according to claim 6, wherein the plant is a Arabidopsis thaliana plant or an oil plant.
9. The transgenic plant according to claim 8, wherein the preserved plant is selected from the group consisting of sesame, rapeseed, sunflower, castor bean, peanut, soybean, coconut, oil palm and jojoba.
1) introducing the vector for plant transformation of claim 1 into Agrobacterium;
2) infecting the plant with the Agrobacterium of step 1);
3) treating the herbicide to select transgenic plants; And
4) A method for producing a plant having increased production efficiency of stearidonic acid (STA) and docosapetaenoic acid (DPA) in plant seeds, comprising the step of confirming the content of unsaturated fatty acids in the seeds of the selected plants.
A method for producing polyunsaturated fatty acids from seeds of the transgenic plant of claim 6.
12. The method of claim 11, wherein the polyunsaturated fatty acid is selected from the group consisting of gamma-linolenic acid (DGLA), dihomo-gamma-linolenic acid (DGLA), arachidonic acid (ARA), docosatetraenoic acid (DTA), stearidonic acid (STA), eicosatetraenoic acid acid, EPA (eicosapentaenoic acid), and DPA (docosapetaenoic acid).

Images