KR101567921B1 - The composition for preventing and treating retinal degenerative diseases containing Otx2 protein - Google Patents

Abstract

The present invention relates to a composition for preventing and treating abnormalities of mitochondrial diseases comprising OTX2 protein as an active ingredient. Specifically, the single defect of Otx2 gene reduces visual function and electroretinogram (ERG) Cone photoreceptors and bipolar cells, and in particular to severe degeneration of type-II OFF-conical bipolar cells, and also to Otx2 heterozygous mutant mouse-injected Otx2 Confirming that the protein significantly regulates the activity of mitochondria through the retinal nerve cells, it was confirmed that the composition containing the OTX2 protein of the present invention as an active ingredient can be effectively used for prevention and treatment of abnormal mitochondrial diseases .

Description

TECHNICAL FIELD The present invention relates to a composition for prevention and treatment of abnormal mitochondrial diseases containing OTX2 protein as an active ingredient,

The present invention relates to a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases comprising Otx2 (Orthodenticle homeobox 2) protein as an active ingredient.

Diseases caused by mitochondrial dysfunction include dysfunction due to swelling due to mitochondrial membrane potential abnormalities, oxidative stress due to reactive oxygen species or free radicals, dysfunction due to genetic factors, and oxidative phosphorylation for mitochondrial energy production The disease caused by the above causes may include multiple sclerosis, encephalomyelitis, cerebral neuropathy, polyneuropathies, Reye's syndrome, Friedreich's rhythm syndrome, Friedrich's Ataxia, Alper's disease, MELAS, Migraine, psychosis, depression, seizure, dementia, palsy, optic atrophy, Optic neuropathy, glaucoma, retinitis pigmentosa (RP), cataract, hyperaldosis (hyperaldosis) myopathy, myoglobinuria, myoglobinuria, muscle tension, myalgia, decreased exercise tolerance, renal insufficiency, hepatic insufficiency, myocardial infarction, hypotension, hypotension, (Eg, hepatic insufficiency, hepatic dysfunction, hypertrophy, anemia, neutropenia, thrombocytopenia, diarrhea, villous atrophy, atopic dermatitis, atrophy, multiple vomiting, dysphagia, constipation, sensorineural deafness, mental retardation, epilepsy, Alzheimer's disease, Parkinson's disease, Huntington's disease Huntington ' s disease) may occur (U.S. Patent No. 6,183,948, Korean Patent Application Publication No. 2004-7005109, Journal of Clinical Investigation 111, 303-312, 2003, Mitochondria 74, 1188-1199, 2003, Biochimica et Biophysica acta 165 8 (2004) 80-88).

The neural retina of the vertebrate animal is an elaborately organized neural and glial cell, which ultimately transmits visual information to the brain. The retina is composed of an outer nuclear layer composed of photoreceptor cells that accept light, a retinal ganglion cell (RGC) that transmits visual information to the brain, and a relay that connects photoreceptor cells to retinal ganglion cells It consists of an inner nuclear layer composed of interneurons. The outer nuclear layer is composed of a rod photoreceptor and a cone photoreceptor. The inner nuclear layer is composed of bipolar cells, horizontal cells, amacrine cells, Muller glia (Muller glia) is composed of. The neurons constituting these retinas are formed from a common retinal progenitor cell. In this process, a transcription factor that specifically induces the development of a specific cell is essential.

The OTX2 (Orthodenticle homeobox 2) protein, a kind of homeome domain protein, is an evolutionarily conserved transcription factor (TF) expressed in the anterior neural tube and is known to be involved in the development of the whole brain and midbrain (Simeone et al., 2002). Homozygous mutations of the Otx2 gene in organisms such as Drosophila and mo do not lead to the development of the anterior part of the head and brain (Acampora et al., 1995; Ang et al. , 1996; Schroder, 2003; Wieschaus et al., 1984). On the other hand, in the case of the heterozygous mutation of the human Otx2 gene, no morphological defect was found in the whole brain or midbrain, but morphological defects of the eye such as anophthalmia and microphthalmia were found Functional defects such as malnutrition (etinal dystrophy) and night blindness (nyctalopia) have also been reported (Henderson et al., 2009; Ragge et al., 2005; Wyatt et al., 2008). This is according to the human visual development OTX2 Suggesting a dose-sensitive regulation of the amount of the gene.

In mouse eyes, Otx2 expression is maintained from the fetus to the adult, specifically from the dorsal optic vesicle and later to the retinal pigment epithelium (RPE) and the retina (Chow and Lang, 2001; Kim and Kim, 2012; Martinez-Morales et al., 2001).

In fetal retinas, Otx2 is expressed in retinal progenitor cells (RPC) daughter cells following somatic cell division, and in cone photoreceptors Crx (cone-rop homeobox containing gene) and PKCα (Protein kinase C- ) Induce differentiation into photoreceptors and bipolar cells (Koike et al., 2007; Nishida et al., 2003). This has been demonstrated again by the lack of proper photoreceptor and bipolar cell development by specific removal of Otx2 in mouse RPC (Sato et al., 2007).

In the eyes of adult mice, Otx2 is always expressed in RPE as well as photoreceptors and bipolar cells. Induction of homozygous loss of Otx2 in adult mice has been shown to cause degradation of photoreceptors and RPE (Beby et al., 2010). In this process, Otx2 expressed in RPE has been shown to maintain photoreceptors non-cell autonomously (Housset et al., 2013). Otx2 is not only involved in determining the fate of retinal neurons, but also of self-secretion that binds to β-dystroglycan at the pre-synaptic part of the photoreceptor ribbon synapses autocrine protein Pikachurin (Omori et al., 2011; Sato et al., 2008). In addition, it has been shown that Otx2 carries out involuntary function of cells during the visual system development, moving around cells constituting the visual system of mammals (Beurdeley et al., 2012; Miyata et al., 2012; Sugiyama et al., 2008).

Human eye morphogenesis (morphogenesis) and in the retina results of studies with respect to the key role of Otx2, Otx2 heterozygous mutant mice, but the overall shape formed onto some abnormality is found in the eye, retinal function has occurred a defect (Koike Martinez-Morales et al., 2001; Sugiyama et al., 2008). It is possible that Otx2 heterozygous mutant mice do not accompany structural abnormalities of the retina and cause functional abnormalities, as in the case of human Otx2 heterozygous mutation patients.

The inventors of the present invention have investigated the cause of retinal disorders in Otx2 heterozygous mutant mice and found that the single defect of Otx2 gene decreases the visual function and electroretinogram (ERG) response, and cone photoreceptor And depletion of bipolar cells and development, and in particular, severe degeneration of type-II OFF-conical bipolar cells. Further, as a result of injecting Otx2 protein into the Otx2 heterozygous mutant mouse, the Otx2 protein migrates to the mitochondria through the retinal nerve cells, and the mitochondrial structural functional function such as oxidative phosphorylation (OXPHOS) It was confirmed that the composition containing the OTX2 protein of the present invention as an active ingredient can be usefully used for the prevention and treatment of abnormal mitochondrial diseases.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating a disorder of mitochondrial disorder or visual impairment comprising an orthodentricle homeobox 2 (Otx2) protein as an active ingredient.

It is still another object of the present invention to provide a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases containing a vector or cell comprising an polynucleotide encoding Otx2 protein as an active ingredient.

It is still another object of the present invention to provide a method for screening a retinal degeneration-induced sample, which comprises administering a test substance to a sample derived from retinal degeneration and measuring the expression level of Otx2 in the sample, And screening the candidate substance for treating a disorder of mitochondrial disorder comprising the step of screening the test substance.

In order to solve the above-mentioned problems, the present invention provides a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases comprising orthodentricle homeobox 2 (Otx2) as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases comprising a vector or cell comprising a polynucleotide encoding Otx2 protein as an active ingredient.

In addition, the present invention provides a screening method for a candidate agent for treating an abnormal mitochondrial disorder comprising the steps of:

1) treating the test substance with a sample derived from a subject in which retinal degeneration has been induced;

2) measuring the amount of Otx2 that has undergone intercellular migration in the sample of step 1); And

3) Screening the increased test substance in comparison with the control group in which the expression amount of Otx2 in the step 2) was untreated.

Also, the present invention provides a candidate substance for preventing and treating abnormal mitochondrial diseases, which comprises a protein and RNA binding to an Otx2 protein as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for preventing and treating visual impairment containing Otx2 protein as an active ingredient.

Otx2 heterozygous mutant mice have decreased visual function and electroretinogram (ERG) responses due to a decrease in Otx2 expression, and inhibit the development of cone photoreceptors and bipolar cells, -II OFF- Conical bipolar cells were degenerated. The Otx2 protein injected into the Otx2 heterozygous mutant mouse migrated through the retinal nerve cell to the mitochondrial outer membrane and then significantly enhanced mitochondrial function including oxidative phosphorylation (OXPHOS) by the mitochondrial electron transport system By confirming the improvement, the composition containing the OTX2 protein of the present invention as an active ingredient can be usefully used for prevention and treatment of abnormalities of mitochondrial diseases and visual disorders.

FIG. 1 is a block diagram of an orthodentric homeobox 2 ) ^{+ / GFP} genotype to compare the results of the trial run between the blinded and wild type mice:
y axis: average number of turns of the mouse;
Error bar: standard deviation; And
*: P < 0.05.
FIG. 2 is a graph showing the results of measurement of amplitude by the retinal electric potential (ERG) test for a blind and a wild type mouse having the Otx2 ^{+ / GFP} genotype:
y-axis: average;
Error bars: standard deviation;
*: P < 0.05;
**: P < 0.01; And
***: P < 0.001.
FIG. 3 is a diagram showing the results of measurement of latency through the examination of retinal potential (ERG) for a blind and wild type mouse having the Otx2 ^{+ / GFP} genotype.
FIG. 4 is a chart showing the number of cells (nuclei) in each retinal layer by H & E staining of a retinal section (6 탆) of Otx2 ^{+ / GFP} mouse in developmental stages:
y-axis: average for 6 different retinas (3 independent experiments); And
Error bars: SD ( p <0.005).
Figure 5 shows progressive retinal deterioration of Otx2 ^{+ / GFP} mice by H & E staining of retinal section (6 [mu] m) against Otx2 ^{+ / GFP} and wild type mice at P30, P90, P120, Fig.
Scale bar: 100 占 퐉;
ONL: outer nuclear layer;
INL: inner nuclear layer;
GCL: ganglion cell layer;
y-axis: average for 6 different retinas (3 independent experiments);
Error bars: standard deviation;
*: P < 0.05;
** P < 0.01; And
*** P <0.001.
6 is a graph showing the relative expression levels of mRNA and protein of Otx2 and GFP in wild-type (WT) and Otx2 ^{+ / GFP} mouse retina by quantitative RT-PCR and Western blotting (WB).
Figure 7 shows the degradation of cone photoreceptors in P90 Otx2 ^{+ / GFP} mice:
A) Retinal ganglion cells (RGC), aortic photoreceptors and cone photoreceptors in the P90 wild type (WT) and Otx2 ^{+ / GFP single} mouse mouse retinas were treated with anti-Brn3b, anti-rhodopsin and anti- Lt; RTI ID = 0.0 &gt; M-opsin < / RTI &gt;
B) A graph showing the results of counting the number of Brn3b-, rhodopsin-, or M-opsin-positive cells in a confocal image (250 占 퐉 x 250 占 퐉);
C) the relative proportion of the results of Otx2 ^{+ / GFP to} the results of the wild type;
Scale bar: 100 占 퐉;
y-axis: average of four retinal samples from each of three independent littermate sets;
Error bars: SD (n = 6 for all samples); And
*: P < 0.05.
Figure 8 shows the number of Otx2-positive cells in INL and ONL in immunostained images (250 [mu] m x 250 [mu] m) by co-immunostaining the retinal section with rabbit anti-Otx2 antibody and mouse anti- And the results are shown in FIG.
y-axis: 6 wild-type and 3 mutant Otx2 ^{+ / GFP} mutants from three independent littermates. Mean values from five retinal specimens;
Error bars: SD; And
***: P < 0.001.
Figure 9 is a diagram showing the distribution of subsets as a result of co-immuno-staining using an anti-GFP antibody and a subset of antibodies in the INL retina:
Subset: bipolar cells (Vsx2, upper row), Muller glia (Sox9, second row), horizontal cells (calbindin, arrowhead image in the third row) (amacrine cells; Pax6, bottom line);
y-axis: the mean of the number of positive cells in the image as a result of using four different wild-type (WT) and Otx2 ^{+ / GFP} mutant retinal samples from three independent litters each;
Error bars: SD;
***: P < 0.001; And
Scale bar: 100 占 퐉.
FIG. 10 shows immunohistochemical staining for reduced bipolar cell types in the P90 Otx2 ^{+ / GFP} mouse retina. As a result, the sensitivity (A and B) of the bipolar subtype to single defect, the number of bipolar cell subtypes (C ) And the ratio (D) of bipolar cell subtypes in the retina of the P90 Otx2 ^{+ / GFP} mutant compared to the P90 wild type:
PKCα: spindle bipolar cells, upper line of A;
G0α: ON-conical bipolar cells; The bottom line of A;
Vsx1: OFF-conical bipolar cell, upper line of B;
recoverin: T2 OFF- cone bipolar cells, B lower line;
Error bars: SD of the results obtained from 6 individual samples from 3 independent litters;
**: P < 0.01;
***: P < 0.001; And
Scale bar: 100 占 퐉.
Figure 11 shows subtype-specific defects due to Otx2 single defect in bipolar cell development:
A) Detection of Otx2-expressing cells and Vsx2-expressing pan-bipolar cells by immunostaining with anti-PKCa, anti-G0a, anti-Vsxl or anti- Fig. 4 shows the development of bipolar cell subtypes determined by observing the distribution of cell subtypes:
Arrow: Bipolar cells co-expressing GFP;
Arrow head: GFP-negative bipolar cells; And
Scale bar: 100 占 퐉 (left two columns) and 20 占 퐉 (right column).
Figure 12 shows subtype-specific defects of bipolar cell development induced by Otx2 single defect:
A) Number and relative proportions of each subset of bipolar cells:
Black bars: P13 Otx2 ^{+ / GFP} mouse retina;
White bars: wild type (WT) mouse retina open bars;
y-axis: the average of the results for four different retinas obtained from three independent litters;
Error bars: SD;
**: P < 0.01;
***: P < 0.001; And
B) Bipolar cell population showing co-expressed GFP in each bipolar subtype:
Error bars: SD.
Figure 13 shows subtype-specific sensitivity in the death of bipolar cells in the Otx2 ^{+ / GFP} mouse retina:
A) Apoptotic bipolar cells in the P30 wild type (WT) and Otx2 ^{+ / GFP} mouse retinas detected by co-staining of TUNEL and PKCa (laparoscopic bipolar cell marker) or recoverin (T2 OFF-conical bipolar cell marker) ;
B) TUNEL / PKCα (n = 3) and TUNEL / recoverin (n = 4) counts of deadly bipolar cells and T2 OFF-conical bipolar cells estimated from confocal images (250 μm × 250 μm).
Error bars: SD;
**: P < 0.01; And
***: P < 0.001.
Figure 14 is a graphical representation of the P13 Otx2 ^{+ / GFP} mouse retinal section cut with Alexa 647-linked rabbit anti-Otx2 (blue), Alexa 568-linked rabbit anti-Recoverin (red) and mouse anti- Immunostaining and observation with a confocal microscope:
Arrow head: Otx2-positive, GFP-negative, liquorrin-positive T2 OFF-conical bipolar cells;
Arrow: GFP-positive, liquorin-negative cells expressing Otx2; And
Scale bar: upper panel (panel) 100 탆, lower panel 20 탆.
Figure 15 shows that either mouse immunoglobulin IgG (1 ㎍) or mouse anti-Otx2 monoclonal antibody (1 ㎍) was injected into the P13 wild-type (WT) mouse eye and then Alexa 647-linked rabbit anti-Otx2 ) And Alexa 568-linked rabbit anti-liquorrin (red)
Arrow head: Otx2-positive, liquorrin-positive T2 OFF-conical bipolar cells;
Arrow: Otx2-positive, liquorrin-positive T2 OFF- Significant reduction of immunostaining intensity of conical bipolar cells; And
Scale bar: 20 탆.
FIG. 16 is a graph showing the average intensity values of the Otx2 immunostained signal in the liquerin-positive T2 OFF-conical bipolar cells of the P15 mouse retina measured by the Image-J software program and then in the cells.
FIG. 17 shows the ERG profile as a result of injection of Otx2 protein (black line) or control PBS (blue line) respectively recombined into the intravitreal space of right and left eyes.
Fig. 18 is a graph showing average amplitudes measured in dark-adapted ERG a-wave and b-wave:
White bars: Left eye of PBS injected mouse;
Black bar: right eye of Otx2 protein injected mouse;
Gray bars: untreated wild type (WT) mice; And
Error bars: SD ( P < 0.05).
19 is Otx2 ^{+ / GFP} And The right eye was treated with Otx2 protein, treated with Otx2, Vsx2, PKCα, recoverin, M-opsin, and Brn3b Lt; RTI ID = 0.0 &gt; immunoglobulin < / RTI &gt;
Scale bar: 100 占 퐉.
y-axis: average number of cells expressing each marker measured in four different retinas;
Error bars: SD;
*: P &lt; 0.05;
**: P &lt; 0.01, and
***: P &lt; 0.001.
FIG. 20 shows the results obtained by treating the rat retinal ganglion cell 5 (RGC5) cells with recombinant Otx2-myc / His protein (10 ng / ml) for 4 hours and then, using anti-Otx2 antibody and various cell organellar markers, The location of my exogenous Otx2 protein was also confirmed:
Tom20: mitochondria;
Lamp2a: lysosome;
GM130: Golgi apparatus
Arrow: Otx2 protein spot within intracellular organelles.
Right column: merged images of the parts of the Otx2 protein spot; And
Scale bar: 25 占 퐉.
Figure 21 shows the location of Otx2 (green) at the cellular level by co-staining using intracellular organelle markers (Tom-20 (red): mitochondrial markers) in bipolar cells and RGCs:
Scale bar: 100 占 퐉.
Figure 22 shows the location of Otx2 protein in mitochondria by fractionation through centrifugation and Western blotting:
Total: Whole lysates of retinal cells (50 ug) without cell fractionation;
Cyto: cytoplasmic fraction (fraction, 50 [mu] g);
Mito: mitochondrial fractions (50 [mu] g);
Mito + NaCl: Mitochondrial fractions were treated with 0.5 M NaCl solution at 4 ° C for 30 minutes to proteolytically degrade mitochondria (50 μg);
Mito + Pro-K: proteolysis of mitochondrial outer membrane (50 ㎍) by treating Proteinase-K with 0.1 ㎍ / ㎖ at 30 ℃ for 10 minutes in mitochondrial fraction;
Ndufa9: marker for mitochondrial fractions;
Tom20: Markers for mitochondrial outer membrane fractions; And
tubulin: cytosolic marker.
Figure 23 shows the results obtained from the supernatant of oligodendrocyte intracellular organelles of Otx2 ^{+ / GFP} mouse (P [mu] g13) injected with wild type (WT) mouse (P15), Otx2 ^{+ / GFP} mouse (P15) and Otx2 protein Ultrastructure was observed by transmission electron microscopy (TEM), showing that nuclei were located at the top layer of INL and mitochondria were present at the post-synaptic part of OPL Also:
Scale bar: 0.5 占 퐉;
Arrow head: Large mitochondria with a swollen inner matrix; And
Arrow: Mitochondria showing normal shape.
Figure 24 compares Tom20 distributions in the retina of Otx2 ^{+ / GFP} mice (P13) injected with wild type (WT) mice (P15), Otx2 ^{+ / GFP} mice (P15) and Otx2 protein (10 ng)
Scale bar: 100 占 퐉.
Figure 25 compares retinal intracellular ATP of Otx2 ^{+ / GFP} mice (P13) injected with wild type (WT) mice (P15), Otx2 ^{+ / GFP} mice (P15) and Otx2 protein (10 ng)
y-axis: average of three different retinal samples;
Error bars: SD;
**: P &lt; 0.01; And
***: P &lt; 0.001.
Figure 26 shows the OXPHOS activity of the mitochondria of the mouse retina via activity of the mitochondrial electron transport complex II component SDH (above) and component III / IV and component COX (below)
Scale bar: 100 占 퐉.
Figure 27 Fig. 2 is a summary of protection mechanisms of T2 OFF-conical bipolar cells and RGCs by an exogenous Otx2 protein.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases containing an orthodentricle homeobox 2 (Otx2) protein as an active ingredient.

The Otx2 has the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

The mitochondrial disorder may include multiple sclerosis, encephalomyelitis, cerebral neuropathy, polyneuropathies, Reye's syndrome, Friedrich's Ataxia, Alper's disease, stroke (MELAS), migraine, psychosis, depression, seizure, dementia, palsy, optic atrophy, optic neuropathy, glaucoma, Retinitis pigmentosa (RP), cataract, hyperaldosteronism, hypoparathyroidism, myopathy, myatrophy, myoglobinuria, muscle tension inhibition Renal insufficiency, hepatic insufficiency, hepatic dysfunction, hypertrophy, iron anemia (anemia), neutropenia, leukopenia, diabetic retinopathy, diabetic retinopathy, Neutropenia, thrombocytopenia, diarrhea, villous atrophy, multiple vomiting, dysphagia, constipation, sensorineural deafness, mental retardation, epilepsy And is preferably selected from the group consisting of epilepsy, Alzheimer's disease, Parkinson's disease, Huntington's disease, and the like. In particular, it is preferably selected from the group consisting of optic nerve atrophy, optic neuropathy, glaucoma, And cataracts are more preferable.

The present invention also provides a pharmaceutical composition for preventing and treating abnormal mitochondrial diseases comprising a vector or cell comprising a polynucleotide encoding Otx2 (orthodentricle homeobox 2) protein as an active ingredient.

The Otx2 has the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

The vector is preferably a linear DNA, a plasmid DNA or a recombinant viral vector, but is not limited thereto.

Wherein said recombinant virus is selected from the group consisting of retrovirus, adenovirus, adeno-associated virus (AAV), herpes simplex virus, lentivirus But it is not limited thereto.

The cell is preferably any one selected from the group consisting of hematopoietic stem cells, dendritic cells, autologous tumor cells and established tumor cells. , But is not limited thereto.

Wherein said mitochondrial disorder disorder is selected from the group consisting of multiple sclerosis, encephalomyelitis, cerebral neuropathy, peripheral neuropathy, Reye's syndrome, Friedrich's gait disorder, Alper's disease, stroke, migraine, psychosis, depression, seizures, dementia, paralysis, optic atrophy, Hyperlipidemia, hyperlipidemia, hyperlipidemia, cataract, cataract, hyperalgesia, hypoparathyroidism, myopathy, muscle atrophy, myoglobinuria, muscle tension inhibition, myalgia, decreased exercise tolerance, renal insufficiency, liver failure, hepatic dysfunction, Wherein the disease is any one selected from the group consisting of anemia, neutropenia, low blood platelets, diarrhea, villus atrophy, multiple vomiting, dysphagia, constipation, sensory neural deafness, mental retardation, epilepsy, Alzheimer's disease, Parkinson's disease, Huntington's disease And is preferably selected from the group consisting of optic atrophy, optic neuropathy, glaucoma, retinitis pigmentosa, cataract It is one of the more preferred.

The present invention also provides a pharmaceutical composition for the prevention and treatment of visual impairment comprising an orthodentricle homeobox 2 (Otx2) protein as an active ingredient.

The Otx2 has the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

The visual disorder is preferably selected from the group consisting of microphthalmia, optic atrophy, optic neuropathy, glaucoma, retinitis pigmentosa (RP) It does not.

In a specific example of the present invention, an optomotor test and an electroretinogram (ERG) test were conducted to confirm whether or not the visual function of a single defect mutant mouse having an autosomalally normal eye developmental Otx2 ^{+ / GFP} genotype was impaired, As a result of the inspection, visual function deterioration was confirmed (FIG. 1), confirming that there were major defects in the internal regulation of the internal retinal disorder, especially the lower limbs and the conical path (see FIGS. 2 and 3). In addition, histopathological examination of the severity of bipolar cell damage in the retina of Otx2 single defect mutant mice revealed that the degradation of the outer nuclear layer (ONL) and the ganglion cell layer (GCL) In contrast to late onset, the number of inner nuclear layer (INL) cells has already begun to decrease in the early stages (see FIGS. 4 and 5).

In order to confirm the relationship between the cell damage and the expression of Otx2 in the cell during development, RT-PCR (reverse transcription polymerase chain reaction) and Western blotting were carried out. As a result, Otx2 ^{+ / GFP} mutant mice (P90 ) Otx2 mRNA and protein expression level of the retina was significantly decreased as compared with the wild type (see FIG. 6). In addition, immunostaining was performed to histologically confirm the degree of cell damage at developmental stage. As a result, the cone photoreceptor was more sensitive to the damage of one Otx2 allele than the sensory photoreceptor (see FIG. 7 ), And the presence of Otx2 protein in retinal ganglion cells (RGC) induces intercellular delivery (see FIG. 8). In addition, GFP-positive cells of INL were mostly positive for the bipolar cell marker Vsx2 (Visual system homeobox 2), and most of the cells expressing Otx2 in INL were bipolar cells (see FIG. 9). In addition, immunological staining was performed to investigate a decreased number of retinal dipolar cell subtypes. As a result, the number of ON and ON conical bipolar cells was significantly decreased, and specifically, pan-OFFF-conical bipolar cells Type-I (T1) OFF-conical bipolar cells (see FIG. 10). On the other hand, between the 13th and 90th postnatal days, the level of progression of islet and conical bipolar cell degeneration is low, so that the damage of T2 OFF- conical bipolar cells is mainly due to degeneration, And the reduction of the type of OFF-conical bipolar cells was due to the combined effect of the developmental defects and degeneration of the eyes (see Figs. 11 to 14).

In addition, in order to investigate the possibility of influencing the cell survival by injecting Otx2 protein into T2 OFF-conical bipolar cells, liquorbrene and Otx2 were co-expressed in T2-OFF conical bipolar cells in the mouse retina and immunostained As a result, it was confirmed that the Otx2 protein level in the liquorrin-positive T2-OFF conical bipolar cells was significantly decreased, and the Otx2 in the T2-OFF conical bipolar cells was introduced from the extracellular space (FIGS. 15 and 16). However, it was confirmed that retinal bipolar cell degeneration was not induced in adult mice by the single injection of anti-Otx2 IgG. To investigate whether exogenous Otx2 protein could restore the damaged retinas composed of T2 OFF-conical bipolar cells, Otx2 protein was injected into Otx2 ^{+ / GFP} mice with impaired retinal function, The effect of inhibiting retinal degeneration was not observed when administered within 2 weeks, but it was confirmed that damaged retinas were normalized when injected for 2 weeks or more (see FIGS. 18 and 19). It was confirmed that the injected Otx2 protein was located in the cell organelles and that the injected Otx2 protein was not located in Golgi bodies and lysosomes but was located in the posterior synapses of the bipolar cells and in the cell bodies of RGCs And FIG. 21), it was confirmed by Western blotting that the injected Otx2 protein was present in the outer membrane of mitochondria (see FIG. 22).

As a result of confirming the effect of mitochondrial structure by the Otx2 protein, it was confirmed that when the Otx2 protein was injected into the mutant, the mitochondrial inner membrane was enlarged and fragmented, but when the Otx2 protein was injected into the wild type, there was no significant change (Figs. 23 and 24 (SDH), an electron transfer system II component of mitochondria, and cytochrome c oxidase (III / IV), which is a component of the electron transfer system III / IV, cytochrome oxidase (COX) activity, the SDH and COX activities were generally higher in the wild type than in the inner segment (IS), the outer plexiform layer (OPL), and the inner plexiform layer (OPL). IPL), but was significantly decreased in the retinas of Otx2 ^{+ / GFP} single defect mutant mice (see FIG. 25). As a result, it was confirmed that the Otx2 protein regulates the development of bipolar cells and photoreceptors in a spontaneous manner in a cell, and is also involved in the survival of these cells by moving to distant cells such as T2-OFF conical bipolar cells and RGCs (See Fig. 27).

Therefore, the reduction of Otx2 protein expression by the Otx2 gene single defect mutation of the present invention decreases the visual function of the mouse and the electroretinogram (ERG) response, and cone photoreceptors and bipolar cells, In particular, the Otx2 protein injected into the Otx2 heterozygous mutant mouse migrates to the mitochondria through the retinal nerve cells, resulting in severe degeneration of type-II OFF-conical bipolar cells. It is possible to confirm that the function of mitochondria including oxidative phosphorylation (OXPHOS) by the electron transport system is controlled, whereby the vector comprising the OTX2 protein of the present invention or the polynucleotide encoding the same, or a pharmaceutical The compositions are useful for the prevention or treatment of disorders of the mitochondrial disorder or of visual impairment It can be used.

The therapeutically effective amount of the composition of the present invention may vary depending on a variety of factors, such as the method of administration, the site of the subject, the condition of the patient, and the like. Therefore, when used in the human body, the dosage should be determined in consideration of safety and efficacy. It is also possible to estimate the amount used in humans from the effective amount determined through animal experiments. Such considerations in determining the effective amount are described, for example, in Hardman and Limbird, eds., Goodman and Gilman ' s Pharmacological Basis of Therapeutics, 10th ed. (2001), Pergamon Press; And E.W. Martin ed., Remington ' s Pharmaceutical Sciences, 18th ed. (1990), Mack Publishing Co.

Compositions of the present invention may also include carriers, diluents, excipients, or a combination of two or more thereof commonly used in biological formulations. The pharmaceutically acceptable carrier is not particularly limited as long as the composition is suitable for in vivo delivery, for example, Merck Index, 13th ed., Merck & Inc. A buffered saline solution, a buffer solution, a dextrose solution, a maltodextrin solution, glycerol, ethanol, and one or more of these components may be mixed and used, and if necessary, an antioxidant, a buffer, Conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into main dosage forms such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules or tablets. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990) in a suitable manner in the art.

The composition of the present invention may further contain one or more active ingredients showing the same or similar functions. The composition of the present invention comprises 0.0001 to 10% by weight, preferably 0.001 to 1% by weight, of the fragment of the protein relative to the total weight of the composition.

The composition of the present invention may be administered orally or parenterally (for example, intravenously, subcutaneously, intraperitoneally or topically) orally, and the dose may be appropriately determined depending on the body weight, age, sex, The range varies depending on diet, administration time, method of administration, excretion rate, and severity of the disease. The daily dose of the composition according to the present invention is 0.0001 to 10 mg / ml, preferably 0.0001 to 5 mg / ml, more preferably administered once to several times a day.

The vector containing the polynucleotide encoding the Otx2 protein of the present invention or the vector containing the cell preferably contains 0.05 to 500 mg, more preferably 0.1 to 300 mg, and more preferably contains the poly In the case of a recombinant virus comprising the nucleotide, it is preferable that it contains 10 ³ to 10 ¹² IU (10 to 10 ¹⁰ PFU), more preferably 10 ⁵ to 10 ¹⁰ IU, but it is not limited thereto.

In addition, in the case of a cell comprising a polynucleotide encoding the Otx2 protein of the present invention, it is preferable that the cell contains 10 ³ to 10 ^8, more preferably 10 ⁴ to 10 ⁷ , but is not limited thereto .

The effective dose of a vector containing a polynucleotide encoding the Otx2 protein of the present invention or a composition containing cells as an active ingredient is 0.05 to 12.5 mg / kg in the case of a vector per 1 kg of body weight, 10 ⁷ to 10 ¹¹ viral particles (10 ⁵ to 10 ⁹ IU) / kg, in the case of cells, 10 ³ to 10 ⁶ cells / kg, preferably 0.1 to 10 mg / kg in the case of vector, 10 ⁸ to 10 ¹⁰ particles, the case of (10 ⁶ to 10 ⁸ IU) / ㎏, cells, and 10 ² to 10 ⁵ cells / ㎏, it may be administered twice or three times a day. Such composition is not necessarily limited to this, but may vary depending on the condition of the patient and the severity of the mitochondrial disorder.

In addition, the present invention provides a screening method for a candidate agent for treating an abnormal mitochondrial disease comprising the steps of:

1) treating the test substance with a sample derived from a subject in which retinal degeneration has been induced;

2) measuring the expression level of Otx2 in the sample of step 1); And

3) Screening the increased test substance in comparison with the control group in which the expression amount of Otx2 in the step 2) was untreated.

The Otx2 of the step 2) has the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

The expression level of Otx2 in the step 2) may be an amount of Otx2 that has undergone intercellular movement, but is not limited thereto.

The expression level of Otx2 in the step 2) is preferably measured by a method selected from the group consisting of quantitative RT-PCR, Western blotting and immunochemistry , But is not limited thereto.

The candidate substance for treating a disorder of mitochondrial disorder may be one comprising, as an active ingredient, a protein and RNA binding to an Otx2 protein, but is not limited thereto.

The reduction of Otx2 protein expression by the Otx2 gene single defect mutation of the present invention reduces the visual function and retinal potential response of the mouse, causes denaturation and development of cone photoreceptors and bipolar cells, It was confirmed that the Otx2 protein injected into the ocularly injected Otx2 heterozygous mutant mouse through the retinal nerve cell regulates the oxidative phosphorylation by the mitochondrial electron transport system, A vector or a cell comprising an OTX2 protein or a polynucleotide encoding the OTX2 protein may be usefully used as a screening method for candidate agents for treating mitochondrial disorders.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples and preparations are merely illustrative of the present invention, and the content of the present invention is not limited by the following examples and production examples.

< Example  1> Mouse breeding condition

One Otx2 ( orthodentricle homeobox 2) allele (Table 1) Otx2 ^{+ / GFP} mutant mouse into a single defect neokin (knocked in) GFP (green fluorescence protein) was used to looking at objects Di Salvio et al. (2010). Experiments using mice were performed on November 24, 1986, in accordance with the guidelines of the European Commission and the Korea Institute of Science and Technology (KAIST) IACUC-12-110. In order to confirm the genotype of the mouse, PCR (polymerase chain reaction) was carried out using Mal and GFP-Q primers shown in [Table 2] below by a method well known in the art, and the mouse genotype used in the present invention was Otx2 ^{+ It} was confirmed that the mutant was a heterozygous mutation in ^GFP .

Primer information used in PCR for genotyping designation Sequence information (5 '> 3') SEQ ID NO: Mal ACTCCAGGCGAATCGAGACCGTC 3 GFP-Q CTTGAAGAAGTCGTGCTGCTTCA 4

< Example  2> Otx2  Identification of retinal disorders in heterozygous mutant mice

Mutations in the Otx2 heterozygosity in humans cause anatomical abnormalities (Henderson et al., 2009; Ragge et al., 2005; Wyatt et al., 2008) 2010; Henderson et al., 2009) have been reported. Optomotor test and electroretinogram (ERG) test were performed to confirm whether the visual function of the Otx2 heterozygous mutant mouse of Example 1 was impaired.

Specifically, we performed visual system function tests at the Institut de la Vision (Paris, France) and the Catholic Medical University (Seoul, Korea). Eight Otx2 ^{+ / GFP} mutant mice at 90 days (P90) littermate and 12 wild type mice were included in the experiment. Measurement of retinal potential was carried out according to a known method (http://www.genome.northwestern.edu/neuro/pdfs/Vision_assay.pdf). In order to evaluate the retinal potency response of the mice under dark and light conditions, the flash intensity was measured as 0.01 cds / m ² , 0.1 cds / m ² , 1 cds / m ² , 2.5 cds / m ² and 10 cds / m ^{2 2} ), the intensity of the retina (a-wave and b-wave) amplitudes was varied by varying the flash intensity to 10 cds / m ² under the condition of the light intensity (25 cd / m ² for background light to saturate rods) Were measured. In addition, flicker response conditions gradually increased the frequency of light flicker to 10, 15, and 30 Hz. Visual acuity was measured by the method of ascertainment described in Abdeljalil et al. (2005) and Torero Ibad et al. (2011). Mice were used at 2.5 months of age ( Otx2 ^{+ / GFP} , n = 6; wild type (WT), n = 4) and 4 months of age ( Otx2 ^{+ / GFP} , n = 7; wild type, n = 5). First, a mouse adapted to ambient light was inserted into a drum made of a vertical stripe pattern of black and white inside, and then the drum was rotated at 2 rpm using a motor. During rotation, the mouse perceived the change of the pattern and measured the number of turns of the head direction.

As a result, as shown in Figs. 1 to 3, it was confirmed that the number of transitions of Otx2 ^{+ / GFP} mutant mice was significantly lower than that of wild type at both 2.5 months and 4 months of age (Fig. 1). As a result, loss of visual function was observed in mice similar to humans due to the loss of the Otx2 allele gene, and it was confirmed that the visual function deterioration of Otx2 ^{+ / GFP} mice was caused by defects of sensory organs such as the retina (Fig. 1 ). In addition, in order to evaluate the retinal function at 90 days of age, analysis of the a-wave amplitude of the retinal potential under dark conditions showed that Otx2 ^{+ / GFP} And (Fig. 2), it was confirmed that there was no significant difference in the a-wave latency between the two genotype mice (Fig. 3). This a-wave result confirmed that the number of the photoreceptors was not the cause of visual impairment. On the other hand, the measurement of the b-wave amplitude of the retinal dislocation showed that the amplitude of the Otx2 single mutant mouse was significantly lower than that of the wild type, indicating that the simple change of the photoreceptor was caused by the internal retina rather than the cause (Fig. 2A). This decrease in the b-wave amplitude value is due to dysfunction of the amacrine cells of bipolar cells, confirming the presence of major defects in the sub-control stage of the islets (Figs. 2D and 3D). In addition, measurement of photoreceptor response to light adaptation and fast frequency of striking light showed that compared to normal control, Otx2 ^{+ / GFP} Mutation It was confirmed that the main disturbance in the conical path exists due to the significant decrease in the amplitude value in the mouse (Fig. 2B-C and Fig. 3B-C).

< Example  3> for retinal cells Otx2  Identify the effects of single defect mutations

<3-1> Histological examination of retinal cell injury

Cell morphology and cell number were examined histologically using a microscope in order to confirm the degree of damage of the bipolar cells of the retina of Otx2 single defect mutant mice by developmental stage.

Specifically, one-year-old Otx2 ^{+ / GFP} Mutant and wild-type mice were prepared as follows: 14 days (P14), 30 days (P30), 90 days (P90), 120 days (P120), and 1 year (P365). First, the prepared mice were anesthetized with tribromoethanol (Avertin), and then PBS (phosphate buffered saline) containing 4% paraformaldehyde (PFA) was sprayed and eyes were removed to prepare samples. Then, a cryosection, which is fixed with distilled water containing 4% PFA and 20% isopropyl alcohol for 2 days at room temperature for paraffin cleavage, or frozen cutting with a cryostat, 0.0 &gt; 4% &lt; / RTI &gt; PFA / PBS and 25% sucrose / PBS for 16 hours. Samples prepared to perform paraffin-embedded cutting (5 占 퐉) or creo-section (10 占 퐉) were respectively embedded in paraffin or OCT medium and the sample was placed on a Superfrost glass slide for cross- Nuclei were stained with hematoxylin and eosin (H & E). Images of the retinal section were obtained using an Eclipse 90i microscope (Nikon Corporation, Towa Optics, New Delhi, India) and the entire eye image was synthesized using NIS software. The number of cells in the other cuts was calculated manually and then statistically analyzed.

As a result, when H & E staining of Otx2 ^{+ / GFP} mutant mouse retina fragments at the P14, P30, P90, P120 and P365 periods, as shown in Fig. 4 and Fig. 5, disorganization or deformation was not found (Figs. 4 and 5). Specifically, it was confirmed that there was no significant difference in thickness and cell number of outer nuclear layer (ONL) and ganglion cell layer (GCL) between wild type and Otx2 ^{+ / GFP} mouse until 90 days after birth 4 and 5). On the other hand, after 120 days of age, Otx2 ^{+ / GFP} In the case of mutant mice, ONL and GCL cell numbers were found to decrease (FIGS. 4 and 5). In contrast to the late start of ONL and GCL degradation, INL cell counts have already begun to decline at an early stage, and specifically, compared with wild type mice, Otx2 ^{+ / GFP} The number of INL cells in the mice decreased to 15%, 19%, 30%, 37% and 50% at the P14, P30, P90, P120 and P365 periods, respectively (FIGS. 4 and 5).

<3-2> Determination of degree of retinal cell damage

Cell damage and intracellular Otx2 protein by developmental stage RT-PCR (reverse transcription polymerase chain reaction) and Western blotting were performed to quantitatively measure the relative expression levels of Otx2 mRNA and protein.

Specifically, various adult retinal neurons of the Otx2 ^{+ / GFP} mutant mouse retina were used. Total RNA was isolated from mouse retina using Trizol, and 1 mg of total RNA isolated was synthesized by ImProm-II Reverse Transcription System (Promega) according to the manufacturer's instructions. RT-PCR was performed on the synthesized cDNA, and the relative expression amount was visualized by loading on 1.5% agarose gel. Actin was used as a control, and the total mRNA and protein expression level of each gene was normalized using the mRNA and protein band intensity of β-actin. The primers used for carrying out the RT-PCR are as shown in Table 3 below.

In order to perform Western blotting, proteins were first extracted from mouse retinas by a purification method well known in the art, and the separated proteins were separated by PAGE size in a PAGE gel. It was then transferred to a PVDF membrane and fixed with 8% acetic acid, then the membrane was washed with distilled water and dried overnight. The membrane was pretreated with methanol and incubated at room temperature for 30 minutes with blocking buffer. By washing into a primary antibody was diluted and then hybridized using the ^{WesternBreeze ® (Invitrogen) Chromogenic Western Blot} Immunodetection kit carried out according to the manufacturer's method was visualize the result. Information on used antibodies is shown in [Table 4].

As a result, as shown in FIGS. 6 and 7, it was confirmed that the Otx2 mRNA and protein expression level of Otx2 ^{+ / GFP} mutant mouse retina at the P90 time was reduced by 48.5% and 44.5%, respectively, compared to the wild type (FIG. 6) . In addition, it was confirmed that Otx2 positive cells of Otx2 ^{+ / GFP} mouse retinal INL decreased to 40.3% as compared with the wild type at the time of P90, but ONL and GCL were not significantly different from those of wild type mice And FIG. 6). The number of rat retinal ganglion cells (RGCs) in which Brn3b (brain-specific homeobox / POU domain protein 3B) is expressed (FIG. 7, upper row) and the number of sensory receptors in which rhodopsin is expressed 7); however, the M-opsin-positive cone photoreceptor of the Otx2 ^{+ / GFP} mouse retina decreased to 76% of the wild type (FIG. 7; bottom Line), conical photoreceptors respond more sensitively to sensory receptors than damage to one Otx2 allele, and this result is consistent with the photorefractive ERG and stray light results of FIGS. 2A-2C Respectively.

Primer information used for RT-PCR Name of the primer Sequence information (5 '> 3') SEQ ID NO: GAPDH Forward TGATGACATCAAGAAGGTGGTGAAG 5 GAPDH Reverse TCCTTGGAGGCCATGTAGGCCAT 6 β-actin Forward TTCTTTGCAGCTCCTTCGTTGCCG 7 β-actin Reverse TGGATGGCTACGTACATGGCTGGG 8 GFP Forward ATGGTGAGCAAGGGCGAGGA 9 GFP Reverse CTGAAGCACTGCACGCCGTA 10

<3-3> Histological examination of degree of retinal cell damage

Immunostaining was performed to histologically identify the degree of cell damage at each developmental stage.

To perform immunostaining, tissues embedded in paraffin were first cut into 4 μm thickness and collected on glass slides, then dehydrated in ethanol and stored at -20 ° C. The sections were hydrated with PBS containing 0.2% Tween 20 and then blocked with PBS containing 1% Triton X-100, 0.2% Tween 20 and 10% fetal bovine serum (FBS) Permeability. Otx2 ^{+ / GFP} A known method (Di Salvio et al., 2010) was used to indirectly track the activity of the Otx2 locus through GFP expression in mouse, and the antibody information used for immunological labeling is as shown in Table 4 below . To visualize the antibody signal, the nuclei of the cells were visualized with 200 nM Hoescht 33342 (Sigma) using a secondary antibody conjugated with Alexa488, Cy3 or Cy5 and images were acquired using an Olympus Fluoview 1000 confocal microscope Respectively.

As a result, as shown in FIG. 8 and FIG. 9, GFP and Otx2 immunostaining signals were detected in INL and ONL of Otx2 ^{+ / GFP} mouse (P90) retinas. However, GFP was not observed in the cell-presenting GCL, confirming that the presence of the Otx2 protein in RGC induces intercellular transfer (Fig. 8). GFP-positive cells of INL were mostly positive for the vasculature marker Vsx2 (FIG. 9), and most of the cells expressing Otx2 in INL were bipolar cells (Koike et al., 2007; Nishida et al. , 2003). Compared to the wild type, Otx2 ^{+ / GFP} Mutant mice had a 58.3% reduction in the number of Vsx2-positive bipolar cells (Figure 9, top row). On the other hand, positive Sox9- Muller glial cells do not express GFP, the number of the cells by confirming that no changes in the mutant (Fig. 9, the second line) ERG b- wave defect is Muller glial cells in the Otx2 ^{+ / GFP} mouse But not in the bipolar cells. The number of calbindin-positive horizontal cells was also decreased in Otx2 ^{+ / GFP} mice, but the number of Pax6-expressing amacrine cells was unchanged and both types of cells were commonly GFP-negative (Fig. 9, third and last line). Horizontal cells were found to bind synapses with photoreceptors and bipolar cells.

< Example  4> Dipole  In cell development and degeneration Otx2  Subtype of single defect ( subtype ) Identification of specific effects

To investigate the cause of ERG b-wave defects, immunohistochemical staining was performed to investigate retinal dipolar subtypes in Otx2 ^{+ / GFP} mice 90 days after birth (P90).

Specifically, immunostaining was carried out according to the method described in Example < 3-3 >. Antibody information used in immunoblotting for G0α (G-protein 0- α), PKCα (protein kinase C-α), Vsx1, NK3R (NK-3 receptor), and recoverin is shown in [Table 4] As shown in Fig.

As a result, as shown in FIGS. 10 to 13, it was confirmed that the number of ON bipolar cells labeled with G0α was 61.4% lower than that of wild-type mice in single defect mutant mice (FIGS. 10A and 10C). In addition, by confirming that the number of PKCa-positive, ON-bipolar cells is reduced to 63.5% in wild-type mice in single deficient mutant mice (Figs. 10A and 10C), the ON number of ON consensus and ON conical bipolar cells are equally reduced Respectively. In addition, the number of Vsx1-positive pan-OFF-conical bipolar cells was reduced to only 50.8% of that of wild-type mice (top row of FIG. 10B and FIG. 10D). The number of NK3R-positive type-I (T1) OFF-conical bipolar cells decreased to 51% of that of wild-type mice, and liquerrin-positive type-II (T2) OFF- conical bipolar cells were found in P90 Otx2 ^{+ / GFP} mice (The bottom row of FIG. 10B and FIG. 10D).

In addition, the decrease in the number of bipolar cells in the retina of Otx2 ^{+ / GFP} adult mouse (P90) was found to degrade or deteriorate. The number of bipolar cells in the mouse at postnatal day 13 (P13), at which the development of the retina was completed, showed that the numbers of Otx2-positive INL cells and Vsx2-positive bipolar cells were 32.3% and 32.6% (Fig. 11, top line and Fig. 12A). P13 was not significantly different from that of P90 in the Otx2 ^{+ / GFP} mouse of P13, indicating that the level of progression of islet and ON-cone bipolar cell degeneration was low between 13 days and 90 days after birth (the third line and the third line in Fig. 11) Line 4, and FIG. 12A). 11-day-old Otx2 ^{+ / GFP} mice showed a decrease in the number of Vsx1-positive OFF-cone bipolar cells to 67% of wild-type mice (line 5 in FIG. 11 and FIG. 12A), while the Licharin- The number of positive T2 OFF-conical bipolar cells was not significantly different for P13 (Fig. 11, bottom row and Fig. 12A). Based on these results, it is concluded that T2 OFF- conical bipolar cell damage is mainly due to degeneration, and that the reduction of the islets, ON-conical bipolar cells and other kinds of OFF-conical bipolar cells is due to the combined effect of the developmental defects and degeneration of the eye Respectively. Also, it was found that the number of TUNEL-positive killed kernels at the P30 time was higher in the Otx2 ^{+ / GFP} mutant mice than in the wild type, and the increased degree of degeneration of bipolar cells in Otx2 ^{+ / GFP} mice was large (Fig. 13). Comparison of GFP and bipolar cell marker immunoreactivity signals in the INL of the P13 Otx2 ^{+ / GFP} mouse retina revealed that the liquorrin T2 OFF-conical bipolar cell marker and GFP did not overlap, but in the luminal and ON-conical bipolar cells GFP and their subtype specific markers PKCa and G0a were coexpressed (Fig. 11, right column). In addition, it was confirmed that GFP-negative T2 OFF-conical bipolar cells also contained Otx2 protein (Fig. 14).

< Example  5> T2 OFF -cone Dipole  Exogenous from the cell Derived Otx2  Check the effect of protein

Similar to the case of RGCs (Sugiyama et al., 2008), in order to investigate the possibility of influencing the cell survival by injecting Otx2 protein into T2 OFF-conical bipolar cells, And Otx2 were co-expressed and immunostained and observed.

Specifically, 15-day old wild-type mice were subjected to co-expression of liquorrin and Otx2 in the retinal T2-OFF conical bipolar cells of the mouse, and extracellular Otx2 protein was injected into the vitreous of P13 mouse eyes Lt; RTI ID = 0.0 &gt; anti-Otx2 &lt; / RTI &gt; Cellular immunostaining was performed in the same manner as in Example <3-3>.

As a result, as shown in FIG. 15 and FIG. 16, the Otx2 protein level in the liqueur-positive T2-OFF conical bipolar cells was significantly decreased by the above treatment, (Figs. 15 and 16). However, as observed in adult Otx2 ^{+ / GFP} mice, it was confirmed that retinal bipolar cell degeneration was not induced in adult mice by the single injection of anti-Otx2 IgG.

< Example  6> Guide Otx2  By protein injection T2 OFF -cone Dipole  Identify the protective effect of cells

To investigate whether extrinsic Otx2 protein can restore the damaged retinas composed of T2 OFF- conical bipolar cells, such as RGCs (Torero Ibad et al., 2011), Otx2 protein was injected into Otx2 ^{+ / GFP} mice with impaired retinal function The effect was observed.

Specifically, mice were injected with 10 ng of recombinant Otx2 protein or PBS (control group) in the right and left eye vitamins in four 13-day-old Otx2 ^{+ / GFP} mice and 3 wild-type mice, They were raised in normal habitats. Then, the mouse was allowed to darken for 16 hours, and then the dark-dark barrier potential (ERG) response test was performed in the same manner as in Example 2 above. At this time, the intensity of light was treated at 2.5 cds on the right and left eyes simultaneously. Immunostaining was performed using antibodies against Otx2, Vsx2, PKCα, liquorrin, M-opsin and Brn3b proteins (Table 4) in the same manner as in Example <3-3>.

As a result, as shown in Fig. 17 to Fig. 19, when the Otx2 protein was administered within 1 week, the effect of suppressing retinal deterioration was not observed, but it was confirmed that the injured retina was normalized when injected for 2 weeks or more. Specifically, it was confirmed that the amplitude of the a-wave and the b-wave in the ERG test showed significant recovery similar to that of the wild-type untreated group (FIG. 17) . As a result of measurement of the number of bipolar cells in the right eye and the untreated left eye injected with Otx2 into Otx2 ^{+ / GFP} mice at the time of P30, it was confirmed that not only the liquerrin-positive T2 OFF- conical bipolar cells in the Otx2- , Vsx2-positive pan-bipolar cells and M-opsin-positive cone photoreceptors (Figs. 18 and 19). This confirms that the influx of exogenous Otx2 protein is important for the survival of cone photoreceptors and bipolar cells. As a result, it was confirmed that Otx2 is located in the nucleus and cytoplasm of liquoron-positive T2 OFF-conical bipolar cells, and only in cytoplasm in RGCs (Figs. 11 to 16). In addition, based on reports that injected Otx2-myc proteins are also present in the cytoplasm of RGC and INL neurons (Torero Ibad et al., 2012), exogenously derived Otx2 proteins are involved in the cytoplasm of T2OFF-conical bipolar cells and RGCs And that it plays an important role in

< Example  7> Exogenous within the retinal nerve cell mitochondria Otx2 The location of

Cellular staining was performed to determine whether exogenous Otx2 protein is located in the organelles of the RGC5 retinal ganglion cell line.

Specifically, recombinant Otx2-myc / His protein (10 ng / ml) prepared by a purification method well known in the art was treated for 4 hours in rat retinal ganglion cell (RGC5) cells, Cells were stained in the same manner as in Example <3-3>. The cell organelle markers used (Table 4) are as follows: translocase of outer membrane 20 of mitochondria, lysosomal-associated membrane protein 2 of lysosome, GM130. In addition, stepwise centrifugation was performed by a method known by Heo et al. (2012) to separate mitochondria from retinal cells. Western blotting was carried out using the thus-obtained mitochondrial fraction (50 占 퐂) in the same manner as described in Example <3-2> above. The fraction (Mito + NaCl) and proteinase-K (Proteinase-K) containing the protein corresponding to 50 占 퐂 were treated with 0.5 M NaCl solution at 4 占 폚 for 30 minutes at a concentration of 0.1 占 퐂 / (Mito + Pro-K) was also subjected to Western blotting by treating with a mitochondrial fraction at 30 ° C for 10 minutes, and then fractionating a protein containing 50 μg of proteolytically degraded mitochondrial outer membrane. At this time, Ndufa9 was used as a marker for mitochondrial fractions, Tom20 as a marker for mitochondrial outer membrane fraction, and tubulin as a loading control (Table 4).

As a result, as shown in FIG. 20 to FIG. 22, it was confirmed that Otx2 of cytoplasm overlapped with mitochondrial marker Tom20, but did not overlap with Golgi marker GM130 or lysosomal protein Lamp2a (FIG. 20). Similarly, Tom20 and Otx2 proteins were found to coexist in the posterior synapses of the bipolar cells in vivo and in the cell bodies of RGCs (Fig. 21). Specifically, Western blotting of fractions of mitochondria extracted from mouse retinal nerve cells confirmed the existence of the presence of Otx2 protein injected into mitochondria (FIG. 22). As a result of analyzing the position of Otx2 in the mitochondria by treating protein kinase-K, which degrades the exogenous protein, or 0.5M NaCl solution that breaks the molecular bond outside the isolated mitochondria, Otx2 is the mitochondrial outer membrane And was located outside the mitochondria through molecular association with lipid or outer membrane proteins (Fig. 22).

< Example  8> Otx2 ^{+ / GFP}  Exogenous from the mouse Otx2 Of Mitochondrial Recovery of Damaged Retina

To confirm the role of Otx2 protein in mitochondria, the mitochondrial structure of wild type mouse and Otx2 single defect mutant mouse retina was observed using transmission electron microscopy (TEM). Oxidative phosphorylation (OXPHOS) by the electron transport system IV located in the mitochondrial inner membrane is known to maintain the membrane potential through mitochondrial inner membrane essential for ATP synthesis (Schultz and Chan, 2001). In order to confirm whether the enlargement and fragmentation of mitochondrial inner membrane affects the homeostasis of the electron transport system and ATP production, succinate dehydrogenase (succinate dehydrogenase), a component of the electron transport system II of mitochondria at 15 days old wild type and Otx2 ^{+ / GFP} mouse, dehydrogenase (SDH), and cytochrome oxidase (COX), a component of the III / IV electron transport system.

Specifically, ATP assay system bioluminescence kit (Promega) was used to measure ATP level of the retina according to the manufacturer's procedure. The dissected retina was dissolved in 0.5 mL of 0.3% TCA solution And incubated at 4 [deg.] C for 30 minutes. Then, centrifugation was carried out at 13,000 rpm, 5 minutes and 4 ° C, and a 4-fold volume of Neutralization solution (250 mM Tris-acetate pH 7.75) was added to the supernatant. All samples were measured with MICROLUMAT LB96P Reader (BERTHOLD), and each sample was repeated 3 times independently with 10 μl of each sample to ensure internal consistency in the experiment. The ATP concentration was estimated from a standard curve of 0.01 to 100 nM concentration. In addition, to perform SDH and COX activity assays, retinal tissue sections were prepared according to the method known by Ross. Eyes were first extracted from PBS-sprayed mice, frozen in OCT medium, and then 14-μm eye sections were prepared on glass slides. After washing with PBS to remove the OCT on the cut surface, the cells were washed with SDH medium (Tris-Hcl 50 mM, 0.1% cytochrome c type IV, 0.5% DAB hydrochloride pH 7.4) (Tris-Hcl 50 mM, 0.1% Nitro Blue Tetrozolium, 0.2% Succunic Acid Sigma S-7501, pH 7.4) for 1 hour. Images were then acquired using a microscope (Olympus DP71).

As a result, as shown in Fig. 23 and Fig. 24, the morphology of the bipolar cells and RGCs of the retina in Otx2 ^{+ / GFP} mouse at 15 days of age were accumulated in mitochondria in the posterior synaptic region compared to the wild type, It was confirmed that the outer membrane structure was preserved (FIG. 23). In addition, the mitochondrial inner membrane of cristae was enlarged and fragmented (Fig. 23) and subtle changes were also observed in the RGC cell bodies. However, there was no change in the inner segments or RPE of the RGC cells and the retinal dipolar cells and RGCs (Fig. 24) in the number and distribution of mitochondria. Also, as shown in Fig. 25, SDH and COX activity are generally observed in the wild type, such as the inner segment (IS), the outer plexiform layer (OPL), and the inner plexiform layer (IPL) But highly decreased in the retina of the Otx2 ^{+ / GFP} single defect mutant mouse (Fig. 25). In addition, it was confirmed that OXPHOS activity and intracellular ATP levels were normalized again in P15 Otx2 ^{+ / GFP} mouse retina injected with Otx2 protein at the time of P13 (Fig. 25). In particular, it was confirmed that ATP rapidly increased in cultured retinal neurons treated with recombinant Otx2 protein. It was confirmed that the exogenous Otx2 protein added to the mouse retinal nerve cells could regulate mitochondrial function by inhibiting the swollen of mitochondria which induces neuronal death.

<110> Korea Advanced Institute of Science and Technology <120> The composition for preventing and treating retinal degenerative          diseases containing Otx2 protein <130> 13p-07-23 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 868 <212> DNA <213> Artificial Sequence <220> <223> Otx2 <400> 1 atgatgtctt atctaaagca accgccttac gcagtcaatg ggctgagtct gaccacttcg 60 ggtatggact tgctgcatcc ctccgtgggc taccccgcca ccccccggaa acagcgaagg 120 gagaggacga catttactag ggcacagctc gacgttctgg aagctctgtt tgccaagacc 180 cggtacccag acatcttcat gagggaagag gtggcactga aaatcaactt gccagaatcc 240 agggtgcagg tatggtttaa gaatcgaaga gctaagtgcc gccaacagca gcagcagcag 300 cagaatggag gtcagaacaa agtgaggcct gccaagaaga agagctctcc agctcgggaa 360 gtgagttcag agagtggaac aagtggccag ttcagtcccc cctctagtac ctcagtccca 420 accattgcca gcagcagtgc tccagtgtct atctggagcc cagcgtccat ctccccactg 480 tctgacccct tgtccacttc ctcctcctgc atgcagaggt cctatcccat gacctatact 540 caggcttcag gttatagtca aggctatgct ggctcaactt cctactttgg gggcatggac 600 tgtggatctt atttgacccc tatgcatcac cagcttcctg gaccaggggc cacactcagt 660 cccatgggta ccaatgctgt taccagccat ctcaatcagt ccccagcttc tctttccacc 720 cagggatatg gagcttcaag cttgggtttt aactcaacca ctgattgctt ggattataag 780 gaccaaactg cctcttggaa gcttaacttc aatgctgact gcttggatta taaagatcag 840 acgtcctcat ggaaattcca ggttttgt 868 <210> 2 <211> 297 <212> PRT <213> Artificial Sequence <220> <223> Otx2 amino acid sequences <400> 2 Met Met Ser Tyr Leu Lys Gln Pro Pro Tyr Ala Val Asn Gly Leu Ser   1 5 10 15 Leu Thr Thr Ser Gly Met Asp Leu Leu His Ser Ser Val Gly Tyr Pro              20 25 30 Gly Pro Trp Ala Ser Cys Pro Ala Ala Thr Pro Arg Lys Gln Arg Arg          35 40 45 Glu Arg Thr Thr Phe Thr Arg Ala Gln Leu Asp Val Leu Glu Ala Leu      50 55 60 Phe Ala Lys Thr Arg Tyr Pro Asp Ile Phe Met Arg Glu Glu Val Ala  65 70 75 80 Leu Lys Ile Asn Leu Pro Glu Ser Arg Val Gln Val Trp Phe Lys Asn                  85 90 95 Arg Arg Ala Lys Cys Arg Gln Gln Gln Gln Gln Gln Gln Asn Gly Gly             100 105 110 Gln Asn Lys Val Arg Pro Ala Lys Lys Lys Ser Ser Pro Ala Arg Glu         115 120 125 Val Ser Ser Glu Ser Gly Thr Ser Gly Gln Phe Ser Pro Pro Ser Ser     130 135 140 Thr Ser Val Pro Thr Ile Ala Ser Ser Ser Ala Pro Val Ser Ile Trp 145 150 155 160 Ser Pro Ala Ser Ile Ser Pro Leu Ser Asp Pro Leu Ser Thr Ser Ser                 165 170 175 Ser Cys Met Gln Arg Ser Tyr Pro Met Thr Tyr Thr Gln Ala Ser Gly             180 185 190 Tyr Ser Gln Gly Tyr Ala Gly Ser Thr Ser Tyr Phe Gly Gly Met Asp         195 200 205 Cys Gly Ser Tyr Leu Thr Pro Met His His Gln Leu Pro Gly Pro Gly     210 215 220 Ala Thr Leu Ser Pro Met Gly Thr Asn Ala Val Thr Ser His Leu Asn 225 230 235 240 Gln Ser Pro Ala Ser Leu Ser Thr Gln Gly Tyr Gly Ala Ser Ser Leu                 245 250 255 Gly Phe Asn Ser Thr Thr Asp Cys Leu Asp Tyr Lys Asp Gln Thr Ala             260 265 270 Ser Trp Lys Leu Asn Phe Asn Ala Asp Cys Leu Asp Tyr Lys Asp Gln         275 280 285 Thr Ser Ser Trp Lys Phe Gln Val Leu     290 295 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Goods <400> 3 actccaggcg aatcgagacc gtc 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GFP-Q <400> 4 cttgaagaag tcgtgctgct tca 23 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Forward <400> 5 tgatgacatc aagaaggtgg tgaag 25 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> GAPDH Reverse <400> 6 tccttggagg ccatgtaggc cat 23 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Forward <400> 7 ttctttgcag ctccttcgtt gccg 24 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> beta-actin Reverse <400> 8 tggatggcta cgtacatggc tggg 24 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFP Forward <400> 9 atggtgagca agggcgagga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GFP Reverse <400> 10 ctgaagcact gcacgccgta 20

Claims (12)

A pharmaceutical composition for preventing and treating nyctalopia containing Otx2 (orthodentricle homeobox 2) protein as an active ingredient.
[Claim 2] The pharmaceutical composition according to claim 1, wherein the Otx2 has the amino acid sequence of SEQ ID NO: 2.
delete A pharmaceutical composition for the prevention and treatment of night blindness comprising a vector or cell comprising a polynucleotide encoding Otx2 (orthodentricle homeobox 2) protein as an active ingredient.
The pharmaceutical composition according to claim 4, wherein the vector is linear DNA, plasmid DNA or recombinant viral vector.
6. The pharmaceutical composition according to claim 5, wherein the recombinant virus is any one selected from the group consisting of retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, and lentivirus.
The method according to claim 4, wherein the cell is any one selected from the group consisting of hematopoietic stem cells, dendritic cells, autologous tumor cells, and established tumor cells. And a pharmaceutical composition for therapeutic use.
1) treating the test substance with a sample derived from a subject in which retinal degeneration has been induced;
2) measuring the expression level of Otx2 in the sample of step 1); And
3) screening the candidate substance for treatment of night blindness, wherein the expression amount of Otx2 in the step 2) is increased compared with the control group in which the test substance is untreated.
9. The method according to claim 8, wherein the expression level of Otx2 in step 2) is selected from the group consisting of a reverse transcription polymerase chain reaction (RT-PCR), Western blotting and immunochemistry Wherein the method comprises the steps of:
delete delete delete

Images