KR101555926B1 - Cancer Remedy Containing Mortalin siRNA - Google Patents

Abstract

The present invention relates to an siRNA or shRNA comprising the nucleotide sequence as set forth in any one of SEQ ID NOS: 1-6 as a target sequence. According to the present invention, an anticancer drug using moralin shRNA can be provided.

Description

Cancer Remedy Containing Mortalin siRNA < RTI ID = 0.0 >

The present invention relates to a cancer therapeutic agent comprising a moralin siRNA. This application also claims priority to Japanese Patent Application No. 2007-162029, filed June 20, 2007, the disclosure of which is incorporated herein by reference.

Mortalin was originally present in the cytoplasmic fraction of normal fibroblasts derived from CD1 ICR mice and cloned as one of the hsp70 families that are not detectable in immortalized fibroblasts (Non-Patent Documents 1 and 2). At present, morpholin has been found to be a dynamic protein whose localization in cells is different from that of normal and immortalized cells, but its distribution in several subcellular organelles, the ability to bind to various proteins, the ability of p53 Inhibition, proteolysis, intracellular molecule transport, mitochondrial membrane transport, and energy production (Non-Patent Documents 3 to 7). Proliferation of normal human fibroblasts (non-patent documents 5 and 8), prolongation of the life of nematodes (non-patent document 9), and proliferation of normal human fibroblasts by mass expression of the morphological gene mot-2 (mouse) or hmot- Malignant tumorigenesis of mouse immortalized cells (Non-Patent Document 10) is caused. In the mouse mot-1 protein, the two amino acids present at the C-terminal side are different from the mot-2, and the difference in the function of the absence of the molecular chaperon function and the induction of the cell senescence phenotype for the immortalized cells (Non-patent documents 2 and 11). The human moralin is a mouse and the other, and its activity is similar to that of mouse mot-2 and is called hmot-2 (Non-Patent Document 10). (Non-Patent Documents 6 and 15), PBP 74 (Non-Patent Document 12), mtHSP70 (Non-Patent Documents 12 and 13), and the like, from a wide range of multifunctionalities such as stress response, intracellular molecular transport, antigen presentation, mitosis, nephrotoxicity, Document 13), GRO75 (non-patent document 14). In a recent study it has been known that Mot-2 binds to the cancer suppressor protein p53 and inhibits its transcriptional activity (Non-Patent Documents 16 to 20). Since inhibition of p53 by Mot-2 causes the phenomenon of malignant tumorigenesis of NIH3T3 (non-patent document 10) and prolongation of the lysis lifetime of human normal fibroblasts (non-patent document 5), morpholin is one of them (Non-Patent Document 10). In addition, Mot-2 cooperates with telomerase to immortalize human poppy fibroblasts (Non-Patent Document 18). It has also been found that knockdown of morpholin with antisense or ribozyme causes slow proliferation inhibition of human cancer cells (Non-Patent Documents 21 to 24).

Non-Patent Document 1: Wadhwa, R., Kaul, S. C., Ikawa, Y., and Sugimoto, Y. (1993) J Biol Chem 268, 6615-6621

Non-Patent Document 2: Wadhwa, R., Kaul, S. C., Sugimoto, Y., and Mitsui, Y. (1993) J Biol Chem 268, 22239-22242

Non-Patent Document 3: Wadhwa, R., Kaul, S. C., Mitsui, Y., and Sugimoto, Y. (1993) Exp Cell Res 207, 442-448

Non-Patent Document 4: Ran, Q., Wadhwa, R., Kawai, R., Kaul, SC, Sifers, RN, Bick, RJ, Smith, JR, and Pereira-Smith, OM (2000) Biochem Biophys Res Commun 275 , 174-179

Non-Patent Document 5: Kaul, S. C., Reddelb, R. R., Sugiharac, T., Mitsuia, Y., and Wadhwac, R. (2000) FEBS Lett 474, 159-164

Non-Patent Document 6: Wadhwa, R., Taira, K. and Kaul, S. C. (2002) Cell Stress Chaperones 7, 309-316

Non-Patent Document 7: Liu, Y., Liu, W., Song, X. D., and Zuo, J. (2005) Mol Cell Biochem 268, 45-51

Non-Patent Document 8: Kaul, S. C., Yaguchi, T., Taira, K., Reddel, R. R., and Wadhwa, R. (2003) Exp Cell Res 286, 96-101

Non-Patent Document 9: Yokoyama, K., Fukumoto, K., Murakami, T., Harada, S., Hosono, R., Wadhwa, R., Mitsui, Y., and Ohkuma, S. (2002) FEBS Lett 516, 53-57

Non-Patent Document 10: Kaul, S. C., Duncan, E. L., Englezou, A., Takano. S., Reddel, R. R., Mitsui, Y., and Wadhwa, R. (1998) Oncogene 17, 907-911

Non-Patent Document 11: Kaul, S. C., Aida, S., Yaguchi, T., Kaur, K., and Wadhwa, R. (2005) J Biol Chem 280, 39373-39379

Non-Patent Document 12: Domanico, S. Z., DeNagel, D. C., Dahlseid, J, N., Green, J. M., and Pierce, S. K. (1993) Mol Cell Biol 13: 3598-3610

Non-Patent Document 13: Webster, T. J., Naylor, D. J., Hartman, D. J., Hoj, P. B., and Hoogenraad, N.J. (1994) DNA Cell bIOL 13, 1213-1220

Non-Patent Document 14: Merrick, B. A., Walker, V.R., He, C., Patterson, R. M., and Selkirk, J. K. (1997) Cancer Lett 199, 185-190

Non-Patent Document 15: Wadhwa, R., Taira, K., and Kaul, S. C., (2002) Histol Histopathol 17, 1173-1177

Non-Patent Document 16: Wadhwa, R., Takano. S., Robert, M., Yoshida, A., Nomura, H., Reddel, R. R., Mitsui, Y., and Kaul, S.C. (1998) J Biol Chem 273, 29586-29591

Non-Patent Document 17: Kaul, S. C., Reddel, R. R., Mitsui, Y., and Wadhwa, R. (2001) Neoplasia 3,

Non-Patent Document 18: Wadhwa, R., Yaguchi, T., Hasan, M. K., Mitsui, Y., Reddel, R. R., and Kaul, S.C. (2002) Exp Cell Res 274, 246-253

Non-Patent Document 19: Ma, Z., Izumi, H., Kanai, M., Kabuyama, Y., Ahn, N.G., and Fukasawa, K. (2006) Oncogene

Non-Patent Document 20: Walker, C., Bottger, S., and Low, B. (2006) Am J Pathol 168, 1526-1530

Non-Patent Document 21: Wadhwa, R., Takano. S., Taira, K., and Kaul, S.C. (2004) J Gene Med 6, 439-444

Non-Patent Document 22: Wadhwa, R., Ando, H., Kawasaki, H., Taita, K., and Kaul, S.C. (2003) EMBO Rep 4, 595-601

Non-Patent Document 23: Pizzatti, L., Sa, L.A., de Souza, J.M., Bisch, P.M. and Abdelhay, E. (2006) Biochim Biophys Acta

Non-Patent Document 24: Shin, BK, Wang, H., Yim, A, M., Le Naour, F., Brichory, F., Jang, JH, Zhao, R., Puravs, E., Tra. , Michael, CW, Misek, DE, and Hanash, SM (2003) J Biol Chem 278, 7607-7616

The present invention provides a chemotherapeutic agent using moralin siRNA.

Mortalin, one of the heat shock protein 70 families, performs a number of functions including transport of intracellular molecules, mitochondrial membrane transport, energy production, molecular chaperone function, and inhibition of p53 activity. The present inventors paid attention to moralin as a target of chemotherapy and experimentally proved that cancer cells can be killed by using morphine-specific siRNA, and it was confirmed that moralin-specific siRNA is useful as an anticancer agent. It is based on these findings.

That is, according to the present invention, an siRNA or shRNA comprising the nucleotide sequence of any one of SEQ ID NOS: 1 to 6 as a target sequence is provided.

According to the present invention, DNA consisting of a combination of the following sense oligonucleotides and antisense oligonucleotides is provided.

(1) an antisense oligonucleotide consisting of a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 and a nucleotide sequence of SEQ ID NO: 8;

(2) a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 and an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 10;

(3) an antisense oligonucleotide consisting of a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 and a nucleotide sequence of SEQ ID NO: 12;

(1) an antisense oligonucleotide consisting of a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 and a nucleotide sequence of SEQ ID NO: 14;

(2) an antisense oligonucleotide consisting of a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 and a nucleotide sequence of SEQ ID NO: 16; or,

(3) an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 and the nucleotide sequence of SEQ ID NO: 18.

According to the present invention, an siRNA or shRNA comprising the nucleotide sequence as set forth in any one of SEQ ID NOS: 1 to 6, which can be obtained by expressing the DNA, is provided.

According to the present invention, there is provided an anticancer agent comprising the siRNA or shRNA or DNA as an active ingredient.

According to the present invention, there is provided a method for treating or preventing cancer using an anticancer agent containing the siRNA or shRNA or DNA as an active ingredient.

According to the present invention there is provided the use of said siRNA or shRNA, or DNA, for producing an anticancer agent.

According to the present invention, there is provided a recombinant expression vector which expresses said siRNA or shRNA comprising said DNA.

The recombinant expression vector of the present invention is preferably obtained by recombining the DNA into an adenovirus vector.

The recombinant vector of the present invention is preferably obtained by recombining the DNA into a vector containing the U6 promoter.

According to the present invention, there is provided an anticancer agent comprising the recombinant expression vector as an active ingredient.

According to the present invention, it was confirmed that the moralin-specific shRNA was effective in killing cancer cells. That is, the present invention provides a therapeutic agent for cancer containing moralin siRNA.

Figure 1 shows the adenovirus vector used in this example.
Figure 2 shows the results of transfection of human osteosarcoma cells with moralin shRNA.
Fig. 3 shows the results of infecting normal cells and cancer cells with morphine shRNA-expressing adenocarcinoma degenerative virus.
Figure 4 shows the proliferation of U2OS cells infected with Adonco-motshRNA and control.
Fig. 5 also shows the results of examining the proliferation in normal human fibroblasts infected with Adonco-motshRNA at 36-48 hours after infection with the cancer cells shown in Fig.
FIG. 6 shows the results of infecting control and morpholin-overexpressing cells with 6 kinds of Adonco-motshRNA as in the previous U2OS cells.

Hereinafter, embodiments of the present invention will be described in detail.

RNAi (RNA interference) is a phenomenon in which the double-stranded RNA introduced into a cell inhibits the expression of a gene having the same sequence. Specific examples of the substance that inhibits expression of moralin by RNAi include siRNA or shRNA described below.

siRNA is an abbreviation for short interfering RNA and means a double stranded RNA having a length of about 21 to 23 bases. The siRNA may be of any type as long as it induces RNAi, for example, an siRNA obtained by chemical synthesis or biochemical synthesis, or in vivo synthesis, or a siRNA obtained by degrading a double-stranded RNA of about 40 bases or more in the body Chain double-stranded RNA of 10 bases or more. The siRNA sequence and the partial sequence of the morphine mRNA are preferably 100% identical, but not necessarily 100% identical.

it is preferable that the region having homology between the base sequence of the siRNA and the base sequence of the moralin gene does not include the translation initiation region of the moralin gene. The sequence having homology is preferably 20 bases apart from the translation initiation region of the moralin gene, but more preferably 70 bases apart. As the sequence having homology, for example, it may be the sequence near the 3 'end of the moralin gene.

As a substance that inhibits the expression of moralin by RNAi, dsRNA of about 40 nucleotides or more which produces siRNA may be used. For example, about 70% or more, preferably 75% or more, more preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, more preferably 90% or more, , Particularly preferably 95% or more, and most preferably 100%, and an RNA or an isoform thereof containing a double-stranded portion can be used. The sequence portion having homology is usually at least 15 nucleotides, preferably at least about 19 nucleotides, more preferably at least 20 nucleotides, and even more preferably at least 21 nucleotides.

As a substance that inhibits the expression of morpholin by RNAi, shRNA (short hairpin RNA) composed of a short hairpin structure having a protruding portion at the 3 'end may be used. A shRNA is a molecule of about 20 bases or more having a double-stranded structure in a molecule and having a hairpin-like structure by partially containing a circular sequence in a single-stranded RNA. In addition, it is preferable that the shRNA has a 3 'protruding end. The length of the double strand is not particularly limited, but is preferably 10 nucleotides or more, and more preferably 20 nucleotides or more. Here, the 3 'protruding end is preferably DNA, more preferably DNA of at least 2 nucleotides or more, and more preferably 2 to 4 nucleotides.

Materials that inhibit the expression of moralin by RNAi may be chemically synthesized artificially or DNA of hairpin structure in which DNA sequences of sense and antisense strands are ligated in the reverse direction is treated with T7 RNA polymerase in vitro ). ≪ / RTI > When synthesized under laboratory conditions, antisense and sense RNA can be synthesized from template DNA using T7 RNA polymerase and T7 promoter. After annealing them in a laboratory condition, they are introduced into cells to induce RNAi and inhibit the expression of moralin. Introduction into cells can be carried out by, for example, calcium phosphate method or various transfection reagents (for example, oligofectamine, lipofectamine, lipofection, etc.).

As a substance that inhibits expression of moralin by RNAi, an expression vector containing a nucleic acid sequence encoding the siRNA or shRNA described above may be used, or a cell containing the expression vector may be used. The type of the expression vector or cell is not particularly limited, but an expression vector or cell already used as a medicament is preferable.

In the present invention, siRNA or shRNA using the nucleotide sequence of any one of SEQ ID NOS: 1 to 6 as a target sequence may be used. Specifically, for example, siRNA or shRNA using the nucleotide sequence of SEQ ID NO: 1 to 6 as a target sequence, which is obtained by expressing DNA consisting of a combination of the following sense oligonucleotides and antisense oligonucleotides, is used .

The route of administration of the anticancer agent containing the morphine siRNA of the present invention is not particularly limited, and the oral administration or parenteral administration (for example, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, , Intravaginal administration, topical administration to a patient, skin administration, etc.). Forms suitable for oral administration may be solid or liquid forms. Forms suitable for parenteral administration may be in the form of injections, drops, suppositories, external preparations, eyedrops, eye drops, and the like. The anticancer agent of the present invention may contain a pharmaceutically acceptable additive, if necessary, depending on the form of the anticancer agent. Specific examples of the pharmaceutically acceptable additives include additives such as excipients, binders, disintegrators, lubricants, antioxidants, preservatives, stabilizers, isotonizing agents, colorants, mildewers, diluents, emulsifiers, suspending agents, , Extenders, buffers, delivery carriers, carriers, excipients and / or pharmaceutical adjuvants.

As the anticancer agent of the present invention in the form of a solid preparation for oral use, for example, an excipient is added to an active ingredient, morpholin siRNA, and if necessary, additives such as a binder, a disintegrant, a lubricant, a coloring agent or a mating agent And then the mixture can be formulated into tablets, granules, powders and capsules according to a conventional method. The anticancer agent of the present invention in the form of an oral liquid preparation may be prepared by adding one or more kinds of additives for formulation such as morpholin and siRNA which are effective ingredients, such as a mating agent, a stabilizer or a preservative, Liquid preparations, syrup preparations, elixirs, and the like.

As the solvent used for prescribing the anticancer agent of the present invention as a liquid preparation, any of water and non-aqueous solvents may be used. Liquid preparations can be prepared by methods well known in the art. For example, the injection may be prepared by dissolving the injectable solution in a solvent such as physiological saline, a buffer such as PBS, sterilized water, etc., filtering sterilized with a filter paper or the like, and then filling the sterilized container (for example, ampule). The injectable preparation may contain a conventional pharmaceutical carrier if necessary. Also, an administration method using a non-invasive catheter may be used. Carriers usable in the present invention include neutral, buffered physiological saline, or physiological saline containing serum albumin.

With respect to gene delivery such as morphine siRNA or siRNA expression vector, the method is not particularly limited as long as it expresses an RNA or siRNA expression vector encoding a moralin siRNA in the cell to which it is applied. For example, , It is possible to use gene introduction using a liposome. Examples of the viral vector include animal viruses such as retroviruses, vaccinia viruses, adenoviruses, and sindividual semicircular viruses.

Materials that inhibit the expression of moralin by RNAi may be injected directly into cells.

The dosage of the anticancer agent of the present invention can be determined by those skilled in the art in consideration of the intended use, the degree of addiction to the disease, the age, body weight, sex, history, or the kind of the substance used as the active ingredient. The dosage of the anticancer agent of the present invention is, for example, from about 0.1 ng to about 100 mg / kg, preferably from 1 ng to about 10 mg, per adult, preferably from 0.0001 to 100 mg , Preferably 0.001 to 10 mg, more preferably 0.01 to 1 mg. The administration frequency of the anticancer agent of the present invention may be, for example, once per day to several months.

The present invention will be described in more detail by way of the following examples, but the present invention is not limited thereto. Various modifications and alterations of these embodiments are possible for those skilled in the art, and these modifications and formulas are also included in the present invention.

Example

(1) Materials and methods

(a) cell culture, transfection, viral infection

Human normal epithelial cells (TIG-1, WI-38), osteosarcoma cells (U2OS, moralin overexpressed U2OS), fibrosarcoma cells (HT1080) were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), penicillin, streptomycin , Dulbecco's modified Eagle's minimal essential medium (DMEM) supplemented with fungizone (Life Technologies, Inc.) was used as a culture medium and incubated in an incubator with a carbon dioxide concentration of 5%, a humidity of 95% Lt; / RTI >

Fugene (Roche Applied Science) was used for the transfection of the shRNA expression plasmid targeting morantin. Typically, 3 g of plasmid DNA was transfected into cells of about 6 cm culture dish, 60% confluent. They were then selected for 48 hours in media supplemented with puromycin (2 ug / ml). Immunostaining was performed on cover glasses for 24 hours after transfection and stained with anti-morphological antibody. The cell proliferation rate was examined by a proliferation assay by microscopic observation and a colony formation experiment.

The replication-competent carcinogenic adenovirus (Adonco virus) was constructed using previously reported methods (see Kim, E., Kim, JH, Shin, HY, Lee, H., Yang, JM, Kim, J., Sohn, JH, Kim, H., and Yun, CO (2003) Hum Gene Ther 14, 1415-1428). To construct a shRNA targeting morontin, a DNA fragment for expression of a human moralin-targeting shRNA was constructed by annealing a sense oligonucleotide and an antisense oligonucleotide,

No. 1 (target sequence: gcgtctcatt ggccggcgat a (SEQ ID NO: 1))

Sense oligonucleotides:

caccgcgtcttattggtcggtgatacgtgtgctgtccgttcttctttcagcttgttgcttttt (SEQ ID NO: 7)

Antisense oligonucleotides:

gcataaaaagcgtctcattggccggcgatagaacggacagcacacgttcttctttcaacttatcgc (SEQ ID NO: 8)

No. 2 (target sequence: gatgctggcc agatatctgg a (SEQ ID NO: 2))

Sense oligonucleotides:

caccgatgctggtcagatatctggacgtgtgctgtccgttcttctttcagcttgttgcttttt (SEQ ID NO: 9)

Antisense oligonucleotides:

gcataaaaagatgctggccagatatctggagaacggacagcacacgttcttctttcaacttatcgc (SEQ ID NO: 10)

No. 3 (target sequence: gactttgacc aggccttgct a (SEQ ID NO: 3))

Sense oligonucleotides:

caccgactttgatcaggtcttgctacgtgtgctgtccgttcttctttcagcttgttgcttttt (SEQ ID NO: 11)

Antisense oligonucleotides:

gcataaaaagactttgaccaggccttgctagaacggacagcacacgttcttctttcaacttatcgc (SEQ ID NO: 12)

No. 4 (target sequence: gcaacaagct gaaagaaga (SEQ ID NO: 4))

Sense oligonucleotides:

caccgcgataagttgaaagaagaacgtgtgctgtccgttcttctttcagcttgttgcttttt (SEQ ID NO: 13)

Antisense oligonucleotides:

gcataaaaagcaacaagctgaaagaagaacggacagcacacgttcttctttacaacttatcgc (SEQ ID NO: 14)

No. 5 (target sequence: gccagaagga caacatatg (SEQ ID NO: 5))

Sense oligonucleotides:

caccgctagaaggataacgtataacgtgtgctgtccgttatatgttgtccttctggcttttt (SEQ ID NO: 15)

Antisense oligonucleotides:

gcataaaaagccagaaggacaacatataacggacagcacacgttatacgttatccttctagc (SEQ ID NO: 16)

No. 6 (target sequence: gaatgaggct agaccttta (SEQ ID NO: 6))

Sense oligonucleotides:

caccgagtgaggttagatctttaacgtgtgctgtccgttaaaggtctagcctcattcttttt (SEQ ID NO: 17)

Antisense oligonucleotides:

gcataaaaagaatgaggctagacctttaacggacagcacacgttaaagatctaacctcactc (SEQ ID NO: 18)

His fragment was recombined with the BamH1 and Hind3 loci of the adenovirus pSP72-E3 shuttle vector (see Cancer Gene Therapy, 12, p61-71, 2005) to construct pSP72-E3-shMot. The SP72ΔE3-shMot shuttle vector was linearized with XmnI in order to construct germline adenovirus expressing moralin-specific shRNA. Then, Es1- and E1B-double-mutated all adenovirus vector pdl-ΔB7 treated with SpeI were simultaneously transformed into Escherichia coli BJ5183 and homologous recombination was carried out to construct a pΔB7-shMo adenovirus vector . To confirm homologous recombination, the plasmid DNA was purified from one E. coli culture and digested with HindIII to analyze the cleavage pattern. Appropriate homologous recombinant Ad plasmid DNA was digested with PacI and transfected into 293 cells to construct the adenovirus Ad-B7-shMot. E1A, E1A, E1B) and replication-adenovirus (E1A, E1B) mutants that resulted in deletion of the E1, E1A, E1B, Ad1 (Ad-ΔE1, deletion of the nucleotide sequence of Ad genome 1341-3535; Int. J. Cancer, 88 p454-463, (Ad-B7). Whole viruses were grown in 293 cells, purified by CsCl density centrifugation and stored at -80 ° C in 10 mM Tris and 4% sucrose, 2 mM MgCl ₂ preservation solution. The number of viral particles was measured by absorbance at OD260 of 260 nm. 1 light absorbing unit corresponded to 10 ¹² / ml of virus. In addition, the infecting titer (plaque forming unit (CFU) / ml) was determined by limiting dilution of 293 cells. MOI was calculated as infection efficiency. Virus infections were prepared by placing the cells in 48-well plates and infecting MOI from 10-300. The rate of cell proliferation due to viral infection was analyzed by the method described above.

Figure 1 shows the adenovirus vector used in this example. The entire adenovirus vector shown in Fig. 1 was recombined into E. coli plasmids using a full-length adenovirus gene. Ad-ΔE1 deletes the entire E1 region. Deletion of E1A and E1B regions with mutations in the Ad-ΔB7 retinoblastoma (RB) binding site. Ad-ΔB7-shMot drives a morphine-specific shRNA controlled by the U6 promoter. ΔE1A, ΔE1B and ΔE3 indicate that E1A, E1B and E3 genes were deleted, respectively. ITR = inverted terminal repeat; Ψ = packaging site; IX = protein IX; The ester risk label indicates the variation of the Rb protein binding site of E1A.

(b) Construction of siRNA expression vector

For constructing the siRNA expression vector, a vector having a U6 promoter inducible by tetracycline was used (Miyagishi, M., and Taira, K. (2002) Nat Biotechnol 20, 497-500) (Miyagishi, M , Sumimoto, H., Miyoshi, H., Kawakami, Y., and Taira, K. (2004) J Gene Med 6, 715-723). Target regions of siRNA were designed using algorithms (http://www.igene-therapeutics.co.jp). Table 1 shows the sequences of moralin as a target of siRNA.

As a typical example of the siRNA construct, a sense sequence oligomer (5'-cacc GttGCtCACTtCAAGAGAG gtgtgctgtcc CTCTCTTGGAGTGGGCGGC tttttt-3 ') and antisense sequence oligo (5'-GCATaaaaaa GCCGCCCACTCCAAGAGAG ggacagcacac CTCTCTTGaAGTGaGCaaC -3') were constructed. The underlined part represents the sequence of the target site. C to T, and G to A was inserted only in the sense sequence. 5 μl of 100 μM sense and antisense oligonucleotides were mixed and diluted with a final volume (20 μl) in 100-150 mM NaCl in a thermal cycler (2 min at 99 ° C., ). ≪ / RTI > The annealed oligonucleotides were diluted (1: 200), and 2 μl of the annealed oligonucleotides were digested with BspMI and purified. The purified pciPur vector was ligated using a Hi ligation kit (Takara). The sequence of the plasmid DNA prepared from the transformed bacteria was determined using an antisense vector primer (CAGGAAACAGCTATGAC) (SEQ ID NO: 19), and the cloned DNA fragment was identified.

Mortalin target sequence for shRNA construction turn shRNA construct name Target sequence One 596 GCGTCTCATTGGCCGGCGATA 2 696 GATGCTGGCCAGATATCTGGA 3 906 GACTTTGACCAGGCCTTGCTA 4 7 GCAACAAGCTGAAAGAAGA 5 8 GCCAGAAGGACAACATATG 6 9 GAATGAGGCTAGACCTTTA

(2) Results

Mortalin increases expression upon carcinogenesis and is involved in malignant cancer cells (Wadhwa, R., Takano, S., Kaur, K., Deocaris, CC, Pereira-Smith, OM, Reddel, RR, and Kaul , SC (2006) Int J Cancer, and Dundas, SR, Lawrie, LC, Rooney, PH, and Murray, GI (2005) J Pathol 205, 74-81. The present inventors constructed a morphine-expressing siRNA and examined the effect on human cancer cells. (i) the U6 promoter (Miyagishi, M., and Taira, K. (2002) Nat Biotechnol 20, 497-500), (ii) Adonoc-motoshRNAs (Kim, E. et al. (2003) Hum Gene Ther 14, 1415-1428) was used to measure the concentration of a compound of the present invention. Two types of siRNA were constructed. Mortalin shRNAs (596, 696, 906) and homeostatic Adonoc-motshRNAs (7,8,9) were constructed using the tetracycline-inducible U6 promoter (see Table 1, Figure 1). The following data demonstrate that moralin shRNA has the effect of killing cancer cells and can be used for cancer treatment.

In Fig. 2, the indicated moralin shRNA was transfected into human osteosarcoma cells. Transfect cells were cultured and selected for 48 to 96 hours in medium supplemented with puromycin (2 ug / ㎕). The tetracycline-inducible construct was induced by adding ethoxy cyclin (1 ug /)) to the medium.

Figure 2A shows immunostaining of moralin in morphological shRNA transfect and control cells. The moraine shRNA transfected cells showed a fairly weak staining of about 60%.

In Fig. 2B, the vector-transfect cells were normal, but the morphological shRNA transfection cells were killed.

In Fig. 2C, puromycin-selected cells were plated at low density (2000 cells / 10 cm dish) and colonial formation was observed for 15 days. It was confirmed that the colony formation rate was significantly lowered.

As shown in Fig. 3, a malignant shRNA-expressing adenocytic tumor degenerative virus was constructed (see Kim, E., Kim, JH, Shin, HY, Lee, H., Yang, JM, Kim, J., Sohn, JH, Kim, H., and Yun, CO (2003) Hum Gene Ther 14, 1415-1428). These viruses represent selective replication in human cancer cells. They were infected with normal and cancer cells at a MOI of 100.

Figure 3A shows crystal violet staining of Adonco-mot shRNA virus infected cells. Normal cells (TIG-1 and WI38) did not show any effect after 48-60 hours of infection, but cancer cells (U2OS and HT1080) showed marked deaths in shRNA of each sarcoma.

In Figure 3B, cell viability was examined at 36-48 hours post-infection. Cancer cells showed a particularly low survival rate, but no significant effect was found in any of the six shRNAs in normal cells.

Figure 4 shows the growth of U2OS cells infected with Adonco-motshRNA and control at MOI 0-300. At MOI 25, # 7 and # 9 cells began to die and 100% of cells died at MOI 300. # 8 and control virus cells induced death by mass infection (infection area of MOI 200-500).

Fig. 5 also examined the proliferation of normal fibroblasts infected with Adonco-mot shRNA with the cancer cells shown in Fig. 4 at 36-48 hours after the infection. Apoptosis was almost selective in each of the six infected cancer cells.

Figure 6 overexpresses moralin within U2OS cells by retroviruses as previously indicated (Wadhwa, R., Takano, S., Kaur, K., Deocaris, CC, Pereira-Smith, OM, Reddel , RR, and Kaul, SC (2006) Int J Cancer). Control and morpholin-overexpressed cells were infected with 6 Adonco-motshRNAs as in the previous U2OS cells. Although morpholin-overexpressing U2OS cells remained, the former U2OS cells effectively died by each of the six Adonco-motshRNAs. This result indicates that knockdown caused by shRNA induces the death of cancer cells.

<110> Advanced Industrial Science and Technology <120> A cancer therapeutic agent containing mortalin siRNA <160> 19 <170> Kopatentin 1.71 <210> 1 <211> 21 <212> DNA <213> Human <400> 1 gcgtctcatt ggccggcgat a 21 <210> 2 <211> 21 <212> DNA <213> Human <400> 2 gatgctggcc agatatctgg a 21 <210> 3 <211> 21 <212> DNA <213> Human <400> 3 gactttgacc aggccttgct a 21 <210> 4 <211> 19 <212> DNA <213> Human <400> 4 gcaacaagct gaaagaaga 19 <210> 5 <211> 19 <212> DNA <213> Human <400> 5 gccagaagga caacatatg 19 <210> 6 <211> 19 <212> DNA <213> Human <400> 6 gaatgaggct agaccttta 19 <210> 7 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 7 caccgcgtct tattggtcgg tgatacgtgt gctgtccgtt cttctttcag cttgttgctt 60 ttt 63 <210> 8 <211> 66 <212> DNA <213> Synthetic DNA <400> 8 gcataaaaag cgtctcattg gccggcgata gaacggacag cacacgttct tctttcaact 60 tatcgc 66 <210> 9 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 9 caccgatgct ggtcagatat ctggacgtgt gctgtccgtt cttctttcag cttgttgctt 60 ttt 63 <210> 10 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 10 gcataaaaag atgctggcca gatatctgga gaacggacag cacacgttct tcttttcaact 60 tatcgc 66 <210> 11 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 11 caccgacttt gatcaggtct tgctacgtgt gctgtccgtt cttctttcag cttgttgctt 60 ttt 63 <210> 12 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 12 gcataaaaag actttgacca ggccttgcta gaacggacag cacacgttct tcttttcaact 60 tatcgc 66 <210> 13 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 13 caccgcgata agttgaaaga agaacgtgtg ctgtccgttc ttctttcagc ttgttgcttt 60 tt 62 <210> 14 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthtic DNA <400> 14 gcataaaaag caacaagctg aaagaagaac ggacagcaca cgttcttctt tcaacttatc 60 gc 62 <210> 15 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 15 caccgctaga aggataacgt ataacgtgtg ctgtccgtta tatgttgtcc ttctggcttt 60 tt 62 <210> 16 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 16 gcataaaaag ccagaaggac aacatataac ggacagcaca cgttatacgt tatccttcta 60 gc 62 <210> 17 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 17 caccgagtga ggttagatct ttaacgtgtg ctgtccgtta aaggtctagc ctcattcttt 60 tt 62 <210> 18 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 18 gcataaaaag aatgaggcta gacctttaac ggacagcaca cgttaaagat ctaacctcac 60 tc 62 <210> 19 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA <400> 19 caggaaacag ctatgac 17

Claims (8)

An siRNA or an siRNA having a target sequence as a target sequence of SEQ ID NO: 5 obtained by expressing a DNA obtained by combining a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 and an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: .
A siRNA or an siRNA according to claim 1, which is obtained by recombining a DNA obtained by combining a sense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 and an antisense oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 into an adenovirus vector A recombinant expression vector.
An anticancer agent comprising the siRNA or shRNA of claim 1 or the recombinant vector of claim 2 as an active ingredient.
delete delete delete delete delete

Images