KR101549594B1 - A method for evaluating the activity of LGR5 using SRF-RE luciferase - Google Patents

Abstract

The present invention relates to a method for evaluating the activity of a regulator of LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) using SRF-RE (Luciferase) , And the expression of SRF-RE reporter gene was changed according to the expression level of SRE (SRF-RE reporter gene) according to RSPO1, LGR4 and LGR6 , But it was confirmed that the activity of luciferase was increased only by LGR5. In addition, LGR5 uses the G _12/13 -Rho pathway to induce SRF-RE reporter, specifically LGR5 is an extracellular signal-regulated kinase (ERK), a downstream regulatory gene of Rho signaling, a focal adhesion kinase ), NFκB (Nuclear Factor kappa B), and c-fos. Thus, the SRF-RE reporter luciferase activity by LGR5 can be usefully used for evaluating the activity of the LGR5 activity regulator.

Description

A method for evaluating the activity of LGR5 using SRF-RE luciferase {A method for evaluating the activity of LGR5 using SRF-RE luciferase}

The present invention relates to a method for evaluating the activity of LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) activity modulating substance using SRF-RE (serum response factor response element) luciferase.

G-protein coupled receptors (GPCRs) are the largest part of cell membrane receptors (about 800 genes), and GPCRs can be classified as neurotransmitters, endocrine hormones, cytokines, It is activated by various extracellular stimuli to mediate various cellular responses. The extracellular stimulus is transferred to the two kinds of trimers G- protein (Heterotrimeric G-protein), such as _{G s, G q, G i} , and G _12/13. This G-protein is activated by binding to GTP by the receptor, and is then inactivated by changing to GDP form. Activated G-proteins then mediate down-signaling by inducing the activity of various signaling molecules in the cell (Effector). In vivo, GPCRs are known to play a pivotal role in mediating a variety of physiological or pathological phenomena as shown in the examples of chemokine receptors. Therefore, studies on GPCRs are now considered to be important targets for drug development as well as academic research subjects.

GPCRs are activated by binding ligands outside the cell to induce the activity of various intracellular G-proteins. The activated G-proteins may be selected from the group consisting of phospholipase C?, Adenylate cyclase, phosphoinositide-3-kinase, Ras and Rho family G- And induce the activity of the same signaling mediator molecule to transmit the receptor signal. The GPCR regulates the activity of the heterologous trimer G-protein and delivers signals into the cell. The G- protein regulates the α, β, and three divided into unit pieces, of which the Gα protein is a secondary bearer of Ca ^{2 +} and the concentration of the cells cAMP (second messenger) for γ.

LRP 5/6 and Frizzled (R-spondin) receptors are activated by binding to R-spondin (Rspo), the first known glycoprotein hormone receptor (LGR5) ) With Wnt-β-catenin (catenin) signaling. Thus, LGR5 is expressed in various adult stem cells present in small intestine, hair follicle, stomach and the like and plays an important role through regulation of Wnt signaling. In addition, LGR5 is used as a marker of various cancer stem - like cells, and it is thought that LGR5 plays a seedling role in tumorigenesis process. On the other hand, it R- spawn Dean does not induce changes in Ca ^{2 +} ions and in the presence of cAMP LGR5. Also, since β-arrestin is not internalized by R-sponidine, normal GPCR signaling does not appear to play a role in the down-signaling pathway of LGR5.

LGR6, another member of the protein hormone receptor family, specifically expresses in adult stem cells proliferating in hair follicles, intestines, stomachs and skin tissues, whereas LGR4 exhibits an overall expression pattern in stem cells (Van Schoore et al . , 2005; Barker and Clevers, 2010). In addition, LGR4-deficient and LGR5-deficient mice die early, whereas LGR6-deficient mice are healthy and reproducible (Mazerbourg et al. , 2004; Morita et al. al . , 2004; Snippert et al . , 2010).

Therefore, the inventors of the present invention have developed a method for evaluating the activity of LGR5 using SRF-RE (Luciferase) as a result of efforts to know the sub-factors influencing LGR5. Specifically, the expression level of SRE (serum response element) and SRF-RE reporter gene was changed according to the activity of LGR5. At this time, SRF-RE luciferase activity was not changed by RSPO1, LGR4 and LGR6, It was confirmed that the activity of luciferase was increased only by LGR5. Also, LGR5 a G _12/13 using the -Rho path, specifically the LGR5 (Extracellular signal-regulated kinase), (focal adhesion kinase) FAK the substeps of Rho protein signal transduction system to induce ERK SRF-RE reporter , NFκB (Nuclear Factor kappa B), and c-fos. Thus, it was confirmed that the SRF-RE reporter luciferase activity by LGR5 can be usefully used for the evaluation of the activity of the LGR5 activity regulator.

It is an object of the present invention to provide a vector containing a gene comprising LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) gene and a vector comprising a SRF-RE (Luciferase reporter gene) The present invention provides a method for evaluating the activity of an LGR5 activity regulator comprising a cell line.

It is another object of the present invention to provide a method for producing a transfected cell by co-transfecting a vector comprising the LGR5 gene and a vector comprising the SRF-RE luciferase reporter gene into a host cell to prepare a transfected cell, And measuring luciferase activity in the transfected cells. The present invention also provides a method for evaluating the activity of a regulator of LGR5 activity.

In order to solve the above object,

The present invention relates to a cell line transfected with a vector comprising LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) gene and a vector containing SRF-RE (Luciferase reporter gene) Lt; RTI ID = 0.0 > LGR5 < / RTI >

The present invention also relates to a method for producing a transgenic cell by co-transfecting a vector comprising a LGR5 gene and a vector comprising a SRF-RE luciferase reporter gene into a host cell to prepare a transfected cell, Lt; RTI ID = 0.0 > of LGR5 < / RTI > activity modulating substance, which measures luciferase activity in a transfected cell.

The present invention relates to a method for evaluating activity modulators of LGR5 using serum response factor element (SRF-RE) luciferase. Specifically, a method for measuring luciferase activity using the change in expression amount of SRE (serum response element) and SRF-RE reporter gene according to the activity of LGR5 was developed, and SRF-RE luciferase activity Was not changed by RSPO1, LGR4 and LGR6, but it was confirmed that the activity of luciferase was increased only by LGR5. In addition, LGR5 uses the G _12/13 -Rho pathway to induce SRF-RE reporter, specifically LGR5 is an extracellular signal-regulated kinase (ERK), a downstream regulatory gene of Rho signaling, a focal adhesion kinase ), NFκB (Nuclear Factor kappa B), and c-fos. Thus, the SRF-RE reporter luciferase activity by LGR5 can be usefully used for evaluating the activity of the LGR5 activity regulator.

Figure 1 shows luciferase activity following treatment with NFAT-RE, CRE, SRE or SRF-RE reporter or R-spondin 1 (Rspo1) in cells transfected with human LGR5 Error bars are standard deviations).
Fig. 2 shows TOPFLACH activity by LGR5 according to treatment with R-spondin (Rspo) 1, 2, 3, 4 or Wnt3A (error bars are standard deviations).
FIG. 3 shows SRF-RE luciferase (SRF-RE-Luc) activity by LGR5 according to treatment with Rspo 1, 2, 3, 4 or Wnt3A (error bars are standard deviations).
Fig. 4 shows the SRF-RE luciferase activity by LGR5 according to the treatment time of Rspo1 (error bars are standard deviations).
Fig. 5 shows SRR-RE luciferase activity by LGR5 according to the amount of vector containing transfected LGR5 (error bars are standard deviations).
6 is a graph comparing LGR5 with the SRF-RE luciferase activity of LGR4 or LGR6 and confirming the expression levels of LGR4 (B), LGR5 (C) and LGR6 (C) in each transfected cell Bars are standard deviation).
The Figure 7 siRNA (siGα ₁₂ and siGα ₁₃₎ to transfect a vector containing the RhoA N19 mutant in cells, or for the results (A), scrambled siRNA (scr), Gα ₁₂ and Gα ₁₃ A C3 transformation processing enzymes (B and C), and SRF-SE luciferase activity (error bars are standard deviations).
FIG. 8 is a graph showing the phosphorylation of ERK and the phosphorylation of FAK in cells (A) and HT-29 cells (B) transformed with LGR5.
To Figure 9, if the transfected vectors comprising RhoA N19 mutations in cells or C3 transition processing enzymes (A) and scrambled siRNA (scr), Gα ₁₂ and Gα ₁₃ siRNA (siGα ₁₂ and siGα ₁₃₎ for the (B) (c) shows the c-fos luciferase activity (error bars are standard deviations).
The Figure 10 when the transfected vectors comprising RhoA N19 mutations in cells or C3 transition processing enzymes (A) and scrambled siRNA (scr), siRNA (siGα 12 and siGα ₁₃₎ for the Gα ₁₂ and Gα ₁₃ (B) in the case of treatment (error bars are standard deviations).

Hereinafter, the present invention will be described in detail.

The present invention relates to a cell line transfected with a vector comprising LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) gene and a vector containing SRF-RE (Luciferase reporter gene) Lt; RTI ID = 0.0 > LGR5 < / RTI >

LGR5 preferably has the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.

The SRF-RE preferably has the nucleotide sequence shown in SEQ ID NO: 4, but is not limited thereto.

The vector containing the SRF-RE luciferase reporter gene is preferably pGL4.34, but is not limited thereto.

The cell line is preferably 293T or HEK293, but is not limited thereto.

In a specific example of the present invention, 293T transfected cells overexpressing LGR5 using a vector having the cDNA sequence of human LGR5 were transfected with nuclear factor of activated T cell response element (NFAT-RE), cyclic AMP response element, a serum response element (SRE) or SRF-RE luciferase reporter, and then treated with RSPO1 for 16 hours, the activity of NFAT-RE and CRE reporter was not changed compared to the control group , And that the activities of SRE and SRF-RE reporters were significantly increased regardless of RSPO1 (see FIG. 1). That is, the SRE reporter can be induced by ERK and Rho GTPase signaling, and the SRF-RE reporter can be activated by Rho GTPase. Therefore, LGR5, which increases the activity of SRE and SRF-RE reporter, It can be used to evaluate the delivery. Rspo1, 2, 3, 4 or Wnt3A stimulated TOPFLASH reporter activity, while simultaneous addition of Rspo1, 2, 3 or 4 and Wnt3A synergistically activated the reporter 3 to 4 fold (see FIG. 2 ), While SRF-RE luciferase reporter activity was not affected by both Rspo1, 2, 3, 4 and Wnt3A ligands (see FIG. 3). In addition, no significant difference was observed in treatment of Rspo1 with LGR5-expressing cells at different times, confirming that Rspo1 was not a ligand involved in SRF-RE dependent signaling by LGR5 (see FIG. 4). In addition, luciferase activity was measured by transfecting cell lines with different amounts of LGR5 vector. As a result, it was confirmed that luciferase activity was regulated depending on the amount of LGR5 (see FIG. 5).

Although LGR4, LGR5, and LGR6 were all overexpressed in each transfected cell, LGR4 and LGR6 were not affected as in the untreated control group, but only in LGR5, luciferase Lt; / RTI > (see FIG. 6). In addition, the C3 transferase, a dominant negative form of N19, a Rho GTPase, and an exoenzyme, regulates the SRF-RE reporter activity induced by LGR5 significantly, so that the Rho GTPase binds to LGR5 Lt; RTI ID = 0.0 > SRF-RE < / RTI > The scrambled siRNA showed high luciferase activity whereas the Gα ₁₂ and Gα ₁₃ siRNAs (siGα ₁₂ and siGα ₁₃ ) inhibited the luciferase activity induced by LGR5, and the expression inhibition efficiency of the Gα _12/13 protein by sufficient to reduce the level significantly, LGR5 was confirmed that adjusting the Rho through G _12/13 (see Fig. 7B and 7C). In LGR5-overexpressed HEK293 and HT-29 cell lysates, the expression of LGR5 was significantly decreased by siRNA, whereas the phosphorylation level of ERK (extracellular signal-regulated kinase) remained unchanged, but FAK (focal adhesion kinase) Gt; Tyr397 < / RTI > phosphorylation was significantly reduced (see FIG. 8).

In the examples of the present invention, the c-fos luciferase activity decreased rapidly when the overexpression LGR5 was treated with the N19 mutation, and the c-fos luciferase activity was significantly decreased when the overexpressing LGR5 was treated with the C3 transferase, It was confirmed that c-fos luciferase activity raised by LGR5 was significantly inhibited by G? _12/13 siRNA (see Fig. 9). It was confirmed that NFκB reporter activity which regulates stem cell regeneration ability and differentiation was strongly induced by LGR5 (see FIG. 10).

Therefore, the present invention has developed a method for measuring the activity of luciferase using the change in the expression level of the SRF-RE reporter gene according to the activity of LGR5, wherein the SRF-RE luciferase activity is measured by RSPO1, LGR4, but is not changed by the LGR6, luciferase activity is increased, and G _12/13 downstream of the use -Rho path, and passes a signal to specifically LGR5 Rho LGR5 is to induce the reporter only by SRF-RE LGR5 Confirming the regulation of the regulatory genes ERK, FAK, NFκB (Nuclear Factor kappa B), and c-fos, the vector containing the LGR5 gene of the present invention and the vector containing the SRF-RE luciferase reporter gene The transfection method can be usefully used as an activity evaluation kit for a substance that modulates LGR5 activity.

Activity evaluation kit for a substance that controls LGR5 activity of the present invention is (i) LGR5, SRF-RE luciferase, Rho GTPase, or G _12/13 specific for the protein enemy (capture reagent) 1 difference acquiring a reagent that binds and (ii) a secondary acquisition reagent that does not bind to the primary acquisition reagent.

The primary acquisition reagent is an antibody or a metal chelate, preferably an antibody, and the secondary acquisition reagent is a secondary antibody as a conjugate labeled with a chromogenic enzyme, a fluorescent substance, a radioactive isotope or a colloid. The chromogenic enzyme may be a peroxidase, an alkaline phosphatase or an acid phosphatase (e.g. horseradish peroxidase), and in the case of a fluorescent substance, a fluorescenecarboxylic acid ( FCA), fluorescein isothiocyanate (FITC), fluorescein thiourea (FTH), 7-acetoxycarin-3-yl, fluorescein-5-yl, 2 ', 7'-dichlorofluorescein-6-yl, dihydrotetramethyl rosamin-4-yl, tetramethylrhodamine-5-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a, 4a-diaza-s-indacene-3-ethyl or 4,4-difluoro- 5,7-diphenyl-4-bora-3a, 4a-diaza-s-indacene-3-ethyl.

When brought into contact with an antibody that specifically binds to the test substance to the primary acquisition reagent, preferably LGR5, SRF-RE luciferase, Rho GTPase, or G _12/13 protein, the sample is diluted appropriate before contact with the antibody And the antibody can be immobilized in a solid form to facilitate subsequent steps such as washing or separation of the complex. The solid form can be glass or plastic, for example a microtiter plate, rod, bead or microbead. Antibodies can also be conjugated to probe substrates or protein chips. The sample can be placed at a constant temperature with the antibody and then washed to measure the antibody-marker complex. This is done by placing the washed mixture at a constant temperature with a secondary acquisition reagent, preferably a secondary antibody. Measurement of the amount of antibody-marker complex or detection of its presence can be accomplished through fluorescence, luminescence, chemiluminescence, absorbance, reflection or transmission. In addition to the above methods, markers in a sample can be detected by performing an indirect analysis method, for example, by analyzing a competition or inhibition reaction with a monoclonal antibody that binds to another epitope of the marker. In addition, the kit may include a washing solution or an eluting solution capable of removing a substrate to be color-developed with the enzyme and unbound protein, and retaining only the bound biomarker.

In addition, the kit for evaluating activity of the LGR5 activity modulator of the present invention is characterized in that, in order to measure the activity of luciferase by SRF-RE luciferase, a sample containing luciferin is added to the transfected cells, But is not limited thereto.

The present invention also provides a method for evaluating the activity of an LGR5 activity modulating substance, comprising the steps of:

1) co-transfecting a vector comprising the LGR5 gene and a vector comprising the SRF-RE luciferase reporter gene into a host cell to produce a transfected cell;

2) treating the test substance with the transfected cells of step 1); And

3) measuring luciferase activity in the reacted transfected cells of step 2) above.

In the above method, LGR5 of step 1) is preferably but not limited to having the nucleotide sequence of SEQ ID NO: 1.

In the above method, the SRF-RE of step 1) is preferably but not limited to have the nucleotide sequence of SEQ ID NO: 4.

The method according to claim 1, wherein the vector comprising the SRF-RE luciferase reporter gene of step 1) is pGL4.34.

In this method, the host cell of step 1) is preferably 293T or HEK293, but is not limited thereto.

In this method, the transfected cells of step 1) are preferably cultured for 22 to 26 hours, but are not limited thereto.

In the above method, the measurement of step 3) is preferably, but not limited to, measurement of luminescence after addition of a sample containing luciferin to the transfected cells.

The present invention provides a cell line capable of measuring the activity of luciferase using the change in the expression level of the SRF-RE reporter gene according to the activity of LGR5, wherein the SRF-RE luciferase activity is expressed in RSPO1, LGR4, and LGR6 by include, but not change, luciferase activity is increased, and LGR5 a G _12/13 using the -Rho path and downstream modulation of the particular transmission LGR5 Rho signals to derive the SRF-RE reporter gene only by the LGR5 Confirming the regulation of ERK, FAK, NFκB, and c-fos, the cell line cotransfected with the vector containing the LGR5 gene of the present invention and the vector containing the SRF-RE luciferase reporter gene showed LGR5 activity And can be usefully used as a method for evaluating the activity of a substance to be regulated.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited by the examples.

< Example  1> Cell culture

The cells were washed with 95% humidity, CO ₂ 5%, and 37 &lt; 0 &gt; C. Specifically, 293T cells and HEK293 cells (American Type Culture Collection) were incubated with 10% (v / v) FBS (fetal bovine serum) and 1% (v / v) penicillin / streptomycin (Life Technologies Inc., HT-29 cells (Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology) were cultured in a DMEM medium (Dulbecco's Modified Eagle's Medium; Welgene, Daegu, Korea) containing 10% FBS and 1% penicillin / streptomycin (Welgene, Daegu, Korea) containing RPMI medium (Life Technologies Inc., Carlsbad, Calif., USA).

< Example  2> LGR5  Over-expression Rho GTPase  Verifying the Dependency Reporter's Activity

To investigate the downstream signaling of heterotrimeric G-proteins, we used NFAT-RE (nuclear factor of activated T cell response element), CRE (cyclic AMP response element), SRE luciferase reporter plasmid containing the above-described plasmid, SRF-element or SRF-RE was prepared, and then a luciferase reporter test was performed on the plasmid-introduced cell line.

Specifically, the full length human LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) cDNA (SEQ ID NO: 1) was first provided by Dr. Hans Clevers (Hubrecht Institute, Utrecht, Netherlands) LGR5 cDNA was cloned into Myc-tagged pIRESneo3 vector (Clontech, Mountain View, CA, USA) using a primer (SEQ ID NO: 2: GCGGCTAGCGCCACCATGGACACCTCCCGGCTC, SEQ ID NO: 3: CGGGGTACCGAGACATGGGACAAATGCCAC). Also, luciferase reporter plasmids pGL4.34-NFAT-RE: luc, SRE: luc and SRF-RE: luc were purchased from Promega (Madison, Wis., USA). The pIRESneo3-LGR5: Myc plasmid and any one of the pGL4.34-NFAT-RE: luc, pGL4.34-SRE: luc, pGL4.34-SRF-RE: luc and pCRE: luc and Fugene6 (Promega, Madison, WI , USA), transiently co-infected with 293T cells according to the manufacturer's protocol. Stably transfected HEK293 cell lines were then selected and maintained at 0.5 mg / mL G418.

Cell-infected cells were cultured for 24 hours with serum removed. After stimulation, luciferase activity was measured according to the manufacturer's method using a Dual-Luciferase Assay Kit (Promega, Madison, WI, USA). In addition, 25 ng / mL RSPO1 (R & D Systems, Minneapolis, MN, USA) was used to confirm the activity of LGR5-induced luciferase activity by the addition of Spondin 1 (RSPO1). Data values were normalized using pGL4.34 activation results as controls and each reaction was performed twice.

As a result, as shown in Fig. 1, treatment of RSPO1 with transfected 293T cells overexpressing LGR5 and luciferase reporter (NFAT-RE, CRE, SRE or SRF-RE) for 16 hours revealed that NFAT- By confirming that the CRE reporter activity does not show significant changes, LGR5 is associated with Gα _q , Gα _s , or Gα _i (Carmon, Gong et al., 2011; de Lau, Barker et al., 2011) (Fig. 1, lane 1-6). On the other hand, the activity of SRE and SRF-RE reporter was significantly increased over LGR5 overexpression compared to the control group (Fig. 1, lane 7-12). Since SRE reporters can be induced by ERK and Rho GTPase signaling, and SRF-RE reporters can be activated by Rho GTPase (Jaffe and Hall, 2005), the activity of both SRE and SRF-RE reporters is increased LGR5 can be used to assess Rho signaling. In addition, when LGR5 was overexpressed, it was confirmed that RSPO1 did not stimulate SRE and SRF-RE reporter activity (Fig. 1, lanes 9 and 12).

designation order LGR5 cDNA (SEQ ID NO: 1) TCATTTTGCTCTGTGCCCTGCTGGCCTTGACCATGGCCGCAGTTCCCCTGCTGGGTGGCAGCAAGTATGGCGCCTCCCCTCTCTGCCTGCCTTTGCCTTTTGGGGAGCCCAGCACCATGGGCTACATGGTCGCTCTCATCTTGCTCAATTCCCTTTGCTTCCTCATGATGACCATTGCCTACACCAAGCTCTACTGCAATTTGGACAAGGGAGACCTGGAGAATATTTGGGACTGCTCTATGGTAAAACACATTGCCCTGTTGCTCTTCACCAACTGCATCCTAAACTGCCCTGTGGCTTTCTTGTCCTTCTCCTCTTTAATAAACCTTACATTTATCAGTCCTGAAGTAATTAAGTTTATCCTTCTGGTGGTAGTCCCACTTCCTGCATGTCTCAATCCCCTTCTCTACATCTTGTTCAATCCTCACTTTAAGGAGGATCTGGTGAGCCTGAGAAAGCAAACCTACGTCTGGACAAGATCAAAACACCCAAGCTTGATGTCAATTAACTCTGATGATGTCGAAAAACAGTCCTGTGACTCAACTCAAGCCTTGGTAACCTTTACCAGCTCCAGCATCACTTATGACCTGCCTCCCAGTTCCGTGCCATCACCAGCTTATCCAGTGACTGAGAGCTGCCATCTTTCCTCTGTGGCATTTGTCCCATGTCTCTAA LGR5 forward primer
(SEQ ID NO: 2) GCGGCTAGCGCCACCATGGACACCTCCCGGCTC
LGR5 reverse primer
(SEQ ID NO: 3) CGGGGTACCGAGACATGGGACAAATGCCAC SRF-RE
(SEQ ID NO: 4) AGTATGTCCATATTAGGACATCTACCATGTCCATATTAGGACATCTACTATGTCCATATTAGGACATCTTGTATGTCCATATTAGGACATCTAAAATGTCCATATTAGGACATCT

< Example  3> LGR5  R in activity Spondin  And Wnt Confirm the correlation of

Recombination of LGR5 transfected cells with SRF-RE or TOPFLASH reporter (reporter for the Wnt / [beta] -catenin pathway) was performed to confirm the influence of the R spondin and Wnt ligand, (RSPO1, 2, 3, 4), and / or Wnt3A protein.

Specifically, the cells transfected with the reporter and LGR5 were used as in Example 2, and the recombinant RSPO1, 2, 3, 4, and Wnt3A proteins were purchased from R & D Systems (Minneapolis, MN, USA) . R sponges (RSPO) were treated at 25 ng / ml for 16 hours and Wnt3A at 25 ng / ml for 16 hours. The reporter activity test was performed according to the method of <Example 2>.

As a result, Rspo1, 2, 3, 4 or Wnt3A stimulates TOPFLASH reporter activity, and simultaneous addition of Rspo1,2,3 or 4 and Wnt3A, as shown in Figures 2-3, (Fig. 2), whereas SRF-RE luciferase reporter activity was not affected by both Rspo1, 2, 3, 4 and Wnt3A ligands (Fig. 3). In addition, as shown in FIG. 4, when the Rspo1 cells were treated differently with 0, 2, 4, 6, 10, and 16 hours in the LGR5 expressing cells, Rspo1 did not show the SRF- (Fig. 4). &Lt; / RTI &gt; Further, as shown in Fig. 5, the luciferase activity was measured by varying the amount of the LGR5 expression construct. As a result, it was confirmed that the SRF-RE luciferase activity was regulated depending on the amount of LGR5 (Fig. 5) .

< Example  4> LGR5 Wow LGR4  And LGR6 Active comparison of

In order to confirm that LGR5 specifically induced SRF-RE luciferase activity, comparative experiments were conducted with glycoprotein hormone receptors belonging to the GPCR family and LGR4 and LGR6 as homologous proteins.

Specifically, the human LGR4 cDNA was first purified from the Missouri S & T cDNA Research Center (Rolla, MO, USA), the construct for expressing human LGR6 tagged with Myc and FLAG was purchased from Origene Technologies (Rockville, Lt; / RTI &gt; 293T cells were transfected for 48 hours using 2 ug LGR4 and LGR6 construct plasmids in the same manner as in <Example 2>. Western blotting was carried out to confirm the expression levels of LGR4, LGR5 and LGR6 in the transfected cells. Cells were first treated with a protease inhibitor cocktail (Roche, Basel, Switzerland) and a RIPA buffer (50 mM Tris-Cl pH 7.4, 150 mM NaCl, 0.25% sodium deoxycholate (sodium deoxycholate, 0.1% SDS). The cell lysate was centrifuged at 18,000 g for 20 minutes and then the sample (Cleared lysate) except for the debris was mixed with Laemmli SDS sample buffer solution. Proteins loaded on SDS PAGE gels were transferred to PROTRAN Nitrocellulose membranes (Whatman, Kent, UK). Then use, to the membrane primary antibody as a probe was performed Western Blot: anti -GPR49 (LGR5) (Abchem), wherein -Myc (9E10) (Covance, Princeton , NJ, USA), wherein -Gα ₁₂ (Cell Signaling Technology, USA), anti-FAK (Santa Cruz, CA, USA), anti-Gα ₁₃ Cell Signaling Technology, USA), or anti-phosphoTyr397-FAK (Cell Signaling Technology, USA). HRP-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) were further reacted and then washed and visualized with the Westzol plus kit (Intron, Seongnam, Gyeonggi-do, Korea). The luciferase activity test was carried out in the same manner as in <Example 2>.

As a result, although LGR4, LGR5 and LGR6 were all over-expressed in each transfected cell (Fig. 6B and Fig. 6C), LGR4 and LGR6 were not affected as in the untreated control group , And LGR5 can promote luciferase reporter activity significantly more than about 8 times (Fig. 6A).

< Example  5> LGR5 On by SRF - RE  For the reaction Rho GTPase  Verify Active

To test the hypothesis that Rho mediates the LGR5 signaling pathway, we compared the luciferase activity using the Rho N19 mutation (N19) and the C3 transferase.

Specifically, the LGR5 transfected cells of Example 2 were cultured in a serum-free medium for 24 hours, followed by addition of 1 μg / mL of C3 transferase and further incubation for 4 hours. The C3 transferase was purchased from Cytoskeleton (Denver, CO, USA). The activity of luciferase activity was examined as in Example 2 above.

As a result, as shown in FIG. 7A, the C3 transferase, N19, a dominant negative form of Rho GTPase, and an exoenzyme, was found to be capable of ADP-ribosylating and inactivating Rho GTPase (Fig. 7A). That is, it was confirmed that the Rho GTPase is essential for the SRF-RE reporter activity by LGR5, since the N19 and C3 transferase significantly down-regulate the SRF-RE reporter activity induced by LGR5 (Fig. 7A).

< Example  6> LGR5  For active G _{12 / 13} Mediation of

Two kinds of trimers a type of G ₁₂ and G ₁₃ of the G- proteins are known to regulate the RhoGEF protein to induce Rho GTPase active form (Bian et al . , 2006). These G _12/13 is to ensure that the parameters of the path LGR5, LGR5 and transfected with adding Gα _12/13 siRNAs in cells including SRF-RE reporter following infection, luciferase activity in the co-transfected cells, and Protein levels of Gα _12/13 were identified.

Specifically, 293T cells transfected with LGR5 and SRF-RE reporter of Example 2 were further co-transfected with siRNAs to the plasmid using X-tremeGENE siRNA cell infection reagent for 48 hours. Scrambled (SCR) siRNA (Dharmacon, Lafayettte, CO, USA), Gα ₁₂ siRNA (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was used for the experiments with three experimental and non- ) And G? ₁₃ siRNA (Santa Cruz Biotechnology, Santa Cruz, Calif., USA). In order to confirm the expression efficiency of siRNAs used, western blotting was carried out according to the method described in Example 4 using anti-Gα ₁₂ antibody and anti-Gα ₁₃ antibody.

As a result, as shown in Figure 7B and Figure 7C, it scrambled siRNA, on the other hand with a high luciferase activity, Gα ₁₂ and Gα ₁₃ siRNA (siGα ₁₂ and siGα ₁₃₎ suppresses the luciferase activity induced by LGR5 (Fig. 7B). Expression control efficiency of these siRNA are, LGR5 was confirmed that adjusting the Rho through G _12/13 by sufficiency (Figure 7C) to reduce the level of protein Gα _12/13 significantly.

< Example  7> LGR5 of ERK  And FAK  Identify the effect on phosphorylation

Through G _12/13 -Rho path is thyroid stimulating hormone (thyrotropin) receptor and activate ERK (Buch et al . , 2008). In order to examine the effect of LGR5 on phosphorylation of ERK, SRE reporters dependent on ERK signaling via TCF (ternary complex factor) and SRF were induced by LGR5 (Fig. 1) Western blot analysis was performed to confirm the expression level of pERK. In addition, FAK (focal adhesion kinase) is a G _12/13 One of the downstream targets of -Rho path and will mediate the regulation of tumor adhesion assembly (focal adhesion assembly) by the G _12/13 -Rho path (Needham and Rozengurt , 1998; Chikumi et al. , 2002; Torsoni et & lt ; RTI ID = 0.0 & gt ; al . , 2005), the expression levels of FAK and phosphorylated FAK (pFAK) were confirmed in LGR5 / HEK293 cell line and HT-29 cell line.

Specifically, cells transfected with LGR5 ON-TARGETplus SMARTpool siRNA (Dharmacon, Lafayettte, CO, USA) or scrambled siRNAs for 48 hours were transfected with anti-ERK Western blot was performed using anti-PKK (Cell Signaling Technology, USA), anti-pERK (Cell Signaling Technology, USA), anti-FAK The expression levels of FAK and pFAK were compared and confirmed. The expression level of LGR5 was used as a control.

As a result, LGR5 expression was significantly decreased by siRNA in the LGR5 / HEK293 cell line (FIG. 8A) and HT-29 cell line (FIG. 8B), while the phosphorylation level of ERK was not changed (Figures 8A and 8B first and second panels). In addition, it was confirmed that Tyr397 phosphorylation of FAK in the same cell lysates was significantly reduced in LGR5 / HEK293 cell line and HT-29 cell line (FIGS. 8A and 8B, third and fourth panels).

< Example  8> c- fos  Through activation LGR5  And Rho  Identify path associations

To confirm the promoter activity of c-fos, one of the target genes of the Rho pathway, the c-fos promoter was ligated and transfection and luciferase activity tests were performed.

Specifically, c-fos luciferase activity was examined when the LGR5 expressing cells were treated with N19 and C3 transferase according to the method described in Example 5 above. The c-fos promoter-luciferase construct (Addgene plasmid 11983, produced by Dr. Ron Prywes (Cen et al . , 2003) were purchased from Addgene (Cambridge, Mass., USA). In addition, c-fos luciferase activity was examined by treating scrambled siRNA, Gα ₁₂ siRNA and Gα ₁₃ siRNA in the same manner as in Example 6 above.

As a result, as shown in Fig. 9, c-fos luciferase activity decreased rapidly when N19 mutation was overexpressed in overexpressed LGR5, and c-fos luciferase activity when C3 transgenic enzyme was treated with overexpressing LGR5 (Fig. 9A). In addition, it was confirmed that c-fos luciferase activity raised by overexpressing LGR5 was significantly inhibited by G? _12/13 siRNA (Fig. 9B).

< Example  9> NF KB activation LGR5  And Rho  Identify path associations

About NFκB is known to be activated by a G _12/13 -Rho path (Perona et al, 1993;. Iguchi et al . , 2008) Luciferase activity test was conducted to examine whether LGR5 regulates the activity of NFκB.

Specifically, the experiment was carried out in the same manner as in Example 8, except that the NFκB-RE luciferase reporter plasmid was used in place of the c-fos promoter-luciferase construct. The NFKB-RE luciferase reporter plasmid was purchased from Promega (Madison, Wis., USA).

As a result, as shown in Fig. 10, it was confirmed that NFKB reporter activity was strongly induced by LGR5. Always <Example 8> and method G _12/13 Blocking the -Rho path was reduced the reporter activity induced by LGR5 (Fig. 10A and 10B) like. NFkB is associated with inflammation and tumor development induced through the Rho signaling pathway (Karin et &lt; RTI ID = 0.0 &gt; al . , 2002; Benitah et al . , 2003; Lin and Karin, 2003; Segain et al . , 2003), and in particular plays an important role in regulating stem cell regeneration ability and differentiation (Schugar et al . , 2008) From the point of view, G _12/13 -Rho path in stem cells and cancer LGR5 expression is coupled with LGR5 according LGR5 was confirmed that the control of NFκB activity via Rho GTPase transmission signal that (Fig. 10 ).

<110> Korea Research Institute of Bioscience and Biotechnology <120> A method for evaluating the activity of LGR5 using SRF-RE          luciferase <130> 13p-06-16 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 2724 <212> DNA <213> Homo sapiens <400> 1 atggacacct cccggctcgg tgtgctcctg tccttgcctg tgctgctgca gctggcgacc 60 gggggcagct ctcccaggtc tggtgtgttg ctgaggggct gccccacaca ctgtcattgc 120 gagcccgacg gcaggatgtt gctcagggtg gactgctccg acctggggct ctcggagctg 180 ccttccaacc tcagcgtctt cacctcctac ctagacctca gtatgaacaa catcagtcag 240 ctgctcccga atcccctgcc cagtctccgc ttcctggagg agttacgtct tgcgggaaac 300 gctctgacat acattcccaa gggagcattc actggccttt acagtcttaa agttcttatg 360 ctgcagaata atcagctaag acacgtaccc acagaagctc tgcagaattt gcgaagcctt 420 caatccctgc gtctggatgc taaccacatc agctatgtgc ccccaagctg tttcagtggc 480 ctgcattccc tgaggcacct gtggctggat gacaatgcgt taacagaaat ccccgtccag 540 gcttttagaa gtttatcggc attgcaagcc atgaccttgg ccctgaacaa aatacaccac 600 ataccagact atgcctttgg aaacctctcc agcttggtag ttctacatct ccataacaat 660 agaatccact ccctgggaaa gaaatgcttt gatgggctcc acagcctaga gactttagat 720 ttaaattaca ataaccttga tgaattcccc actgcaatta ggacactctc caaccttaaa 780 gaactaggat ttcatagcaa caatatcagg tcgatacctg agaaagcatt tgtaggcaac 840 ccttctctta ttacaataca tttctatgac aatcccatcc aatttgttgg gagatctgct 900 tttcaacatt tacctgaact aagaacactg actctgaatg gtgcctcaca aataactgaa 960 tttcctgatt taactggaac tgcaaacctg gagagtctga ctttaactgg agcacagatc 1020 tcatctcttc ctcaaaccgt ctgcaatcag ttacctaatc tccaagtgct agatctgtct 1080 tacaacctat tagaagattt acccagtttt tcagtctgcc aaaagcttca gaaaattgac 1140 ctaagacata atgaaatcta cgaaattaaa gttgacactt tccagcagtt gcttagcctc 1200 cgatcgctga atttggcttg gaacaaaatt gctattattc accccaatgc attttccact 1260 ttgccatccc taataaagct ggacctatcg tccaacctcc tgtcgtcttt tcctataact 1320 gggttacatg gtttaactca cttaaaatta acaggaaatc atgccttaca gagcttgata 1380 tcatctgaaa actttccaga actcaaggtt atagaaatgc cttatgctta ccagtgctgt 1440 gcatttggag tgtgtgagaa tgcctataag atttctaatc aatggaataa aggtgacaac 1500 agcagtatgg acgaccttca taagaaagat gctggaatgt ttcaggctca agatgaacgt 1560 gaccttgaag atttcctgct tgactttgag gaagacctga aagcccttca ttcagtgcag 1620 tgttcacctt ccccaggccc cttcaaaccc tgtgaacacc tgcttgatgg ctggctgatc 1680 agaattggag tgtggaccat agcagttctg gcacttactt gtaatgcttt ggtgacttca 1740 acagttttca gatcccctct gtacatttcc cccattaaac tgttaattgg ggtcatcgca 1800 gcagtgaaca tgctcacggg agtctccagt gccgtgctgg ctggtgtgga tgcgttcact 1860 tttggcagct ttgcacgaca tggtgcctgg tgggagaatg gggttggttg ccatgtcatt 1920 ggttttttgt ccatttttgc ttcagaatca tctgttttcc tgcttactct ggcagccctg 1980 gagcgtgggt tctctgtgaa atattctgca aaatttgaaa cgaaagctcc attttctagc 2040 ctgaaagtaa tcattttgct ctgtgccctg ctggccttga ccatggccgc agttcccctg 2100 ctgggtggca gcaagtatgg cgcctcccct ctctgcctgc ctttgccttt tggggagccc 2160 agcaccatgg gctacatggt cgctctcatc ttgctcaatt ccctttgctt cctcatgatg 2220 accattgcct acaccaagct ctactgcaat ttggacaagg gagacctgga gaatatttgg 2280 gactgctcta tggtaaaaca cattgccctg ttgctcttca ccaactgcat cctaaactgc 2340 cctgtggctt tcttgtcctt ctcctcttta ataaacctta catttatcag tcctgaagta 2400 attaagttta tccttctggt ggtagtccca cttcctgcat gtctcaatcc ccttctctac 2460 atcttgttca atcctcactt taaggaggat ctggtgagcc tgagaaagca aacctacgtc 2520 tggacaagat caaaacaccc aagcttgatg tcaattaact ctgatgatgt cgaaaaacag 2580 tcctgtgact caactcaagc cttggtaacc tttaccagct ccagcatcac ttatgacctg 2640 cctcccagtt ccgtgccatc accagcttat ccagtgactg agagctgcca tctttcctct 2700 gtggcatttg tcccatgtct ctaa 2724 <210> 2 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> LGR5 forward primer <400> 2 gcggctagcg ccaccatgga cacctcccgg ctc 33 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> LGR5 reverse primer <400> 3 cggggtaccg agacatggga caaatgccac 30 <210> 4 <211> 115 <212> DNA <213> Artificial Sequence <220> <223> SRF-RE <400> 4 agtatgtcca tattaggaca tctaccatgt ccatattagg acatctacta tgtccatatt 60 aggacatctt gtatgtccat attaggacat ctaaaatgtc catattagga catct 115

Claims (13)

LGR5 comprising a cell line co-transfected with a vector comprising LGR5 (Leucine-rich repeat-containing G-protein coupled receptor 5) gene and a vector comprising SRF-RE (Luciferase reporter gene) A kit for evaluating activity of an activity modulating substance.
The kit for evaluating the activity of an LGR5 activity regulating substance according to claim 1, wherein the LGR5 comprises the nucleotide sequence of SEQ ID NO: 1.
The kit for evaluating the activity of an LGR5 activity regulating substance according to claim 1, wherein the SRF-RE comprises the nucleotide sequence of SEQ ID NO: 4.
The kit for evaluating activity of an LGR5 activity regulator according to claim 1, wherein the vector comprising the SRF-RE luciferase reporter gene is pGL4.34.
The kit of claim 1, wherein the cell line is 293T or HEK293.
1) co-transfecting a vector comprising the LGR5 gene and a vector comprising the SRF-RE luciferase reporter gene into a host cell to produce a transfected cell;
2) treating the test substance with the transfected cells of step 1); And
3) measuring luciferase activity in the reacted transfected cells of step 2) above.
7. The method according to claim 6, wherein LGR5 of step 1) is composed of the nucleotide sequence of SEQ ID NO: 1.
7. The method according to claim 6, wherein the SRF-RE of step 1) is composed of the nucleotide sequence of SEQ ID NO: 4.
7. The method according to claim 6, wherein the vector comprising the SRF-RE luciferase reporter gene of step 1) is pGL4.34.
7. The method according to claim 6, wherein the host cell of step 1) is 293T or HEK293.
The method according to claim 6, wherein the transfected cells of step 1) are cultured for 22 to 26 hours.
[7] The method according to claim 6, wherein the measurement of step 3) comprises measuring a luminescence after adding a sample containing luciferin to a transfected cell.
1) co-transfecting a vector comprising the LGR5 gene and a vector comprising the SRF-RE luciferase reporter gene into a host cell to produce a transfected cell;
2) treating the test substance with the transfected cells of step 1); And
3) measuring the SRF-RE reporter luciferase activity in the reacted transfected cells of step 2).

Images