KR101548989B1 - Screening Methods of a Substance for Preventing or Treating a Joint Disease Using SirT1 - Google Patents

Abstract

The present invention relates to the regulation of the stability and transcriptional activity of HIF-2α, the master regulator of cartilage regression through activation of SirT1, and its use. According to the present invention, the activation of SirTl of the present invention is essential for the onset of HIF-2 alpha or Nampt-induced arthritic disease. In particular, activation of SirT1 increases the stability and transcriptional activity of the HIF-2 alpha protein and triggers the expression of various matrix-degrading enzymes (e.g., Mmp3, Mmp12, Mmp13, Adamts4, etc.). Therefore, SirTl of the present invention can be used for diagnosis or prognosis of joint diseases, and can be used for the development of therapeutic agents for joint diseases.

Description

TECHNICAL FIELD The present invention relates to a method for screening a substance for preventing or treating joint disease using SirT1,

The present invention relates to the regulation of the stability and transcriptional activity of HIF-2α, the master regulator of cartilage regression through activation of SirT1, and its use.

Osteoarthritis (OA) is a degenerative joint disease that can be characterized as cartilage destruction. Many pathologic risk factors and pathophysiological processes contribute to the progression of osteoarthritis. Factors such as mechanical stress including joint instability and injury and aging which is prone to OA are important among potential OA-induced mechanisms. The factors described above lead to the activation of biochemical pathways in chondrocytes, a unique cell type that produces a variety of catabolism and assimilation factors, which are induced by matrix metalloproteinases (MMPs) and aggrecanases (ADMTS) Degradation of the extracellular matrix (ECM), and dedifferentiation of cartilage cells and the arrest of ECM synthesis through apoptosis (1, 2).

Through previous studies, the inventors (3) and Saito et al. (4) reported that HIF (hypoxia-inducible factor) -2α encoded by the EPAS1 gene is a master regulator of the adaptive response to hypoxia ) As a transcription factor with major functions as a promoter of OA cartilage degradation by up-regulating chondrocyte expression of matrix-degrading enzymes such as Mmp1, Mmp3, Mmp9, Mmp12, Mmp13 and Adamts4. HIF-2αα expression is markedly elevated in OA cartilage tissue, and ectopic expression of HIF-2αα in joint tissues induces experimental OA. Moreover, while chondrocyte-specific HIF-2 alpha transgenic (TG) mice exhibit spontaneous cartilage tissue destruction, heterozygous HIF-2 alpha knockout (KO) mice ( Epas1 ⁺ ) Or cartilage tissue-specific Epas1 condition KO (conditional KO, CKO) mice ( Epas1 ^{fl / fl} ; Col2a1-Cre ) decreased cartilage tissue destruction following DMM (destabilization of medial meniscus) ).

In a preliminary study, we identified Nampt as a gene up-regulated by HIF-2? Through microarray screening in articular chondrocytes. The Nampt gene encodes nicotinamide phosphoribosyltransferase and functions as an intramolecular (eNampt) or extracellular form (eNampt or visfatin). eNampt functions as an adipokine even though its molecular mechanism has not yet been established, whereas iNampt's nicotinamide phospholibosyltransferase enzyme activity regulates the salvage pathway of NAD ⁺ synthesis (9, 10). eNampt exhibits pro-inflammatory functions and appears to be associated with inflammatory diseases such as rheumatoid arthritis (RA) (11, 12). For example, levels of eNampt in serum and synovial fluids in patients with RA are positively associated with disease severity (13-15). In addition, eNampt is known to modulate the expression of chemokines and cytokines in a variety of cell types involved in RA pathogenesis (11,12,16,17). In addition, inhibition of iNampt enzyme activity through the treatment of the non-competitive inhibitor FK866 (18) blocked experimentally induced RA (19,20). Similar to association with RA, increased eNampt levels are positively associated with OA pathogenesis (21). In human OA chondrocytes, eNampt inhibits proteoglycan synthesis (22) and increases the expression of catabolic factors such as MMP3, MMP13, ADAMTS4, and ADMTS5 (23). In addition, overexpression of Nampt mediates the inhibition of IL2 (interleukin) 1β-induced expression of Col2a1 in chondrocytes (24). Although the above results suggest Nampt related functions in the OA outbreak process, the in vivo function of eNampt in OA outbreak is not confirmed.

The main activity of Nampt is the stimulation of the reproductive pathways of NAD ⁺ synthesis (10, 25). NAD ⁺ is an important cofactor of SirT1 (Sirtuin 1), a protein deacetylase (10, 26). The SirT1 regulates gene expression by modulating chromatin function through direct deacetylation of histones and a wide range of transcription factors and co-regulators (25, 26). Several evidence suggests the function of SirT1 in the pathogenesis of OA through modulation of cartilage tissue-specific gene expression and apoptosis of cartilage cells (27, 28). For example, SirT1 appears to be essential for cartilage cell survival, and a loss of SirT1 function results in cartilage cell apoptosis (29-32). Also, although controversial, SirT1 appears to modulate cartilage tissue-specific gene expression. On the other hand, SirT1 activity has been suggested to be essential for the expression of EC2 genes in cartilage tissue containing Col2a1 (33-35). On the other hand, upregulation of SirT1 activity was also reported to inhibit the expression of Col2a1 during IL1β-induced articular cartilage cell de-differentiation in articular cartilage cells (24). However, the function of SirT1 in regulating the expression of genes encoding tissue-destructive proteins such as MMPs is not yet understood. Furthermore, similar to the case of Nampt, the in vivo contribution of SirT1 in the course of OA development has not yet been accurately determined. On the other hand, HIF-2α protein is a target of SirT1 deacetylase activity, and SirT1 is known to stimulate HIF-2α transcription activity in Hep38 cells and HEK293 cells under hypoxic conditions (36, 37). Therefore, it is a very interesting topic to investigate whether the Nampt / NAD ⁺ / SirT1 pathway regulates HIF-2α signaling in articular cartilage cells and contributes to the pathogenesis of OA.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a novel biomolecule capable of effectively preventing or treating joint diseases. As a result, we found that the activation of SirT1 (silent information regulator 1) does not increase the acetylation of HIF-2? (Hypoxia-inducible factor-2?) Protein but the stability and transcriptional activity of HIF- activity of the matrix-degrading enzyme to induce the expression of various matrix-degrading enzymes and induce joint diseases, thereby completing the present invention.

Accordingly, an object of the present invention is to provide a screening method for substances for the prevention or treatment of joint diseases.

It is still another object of the present invention to provide a method for detecting a joint disease diagnosis or prognostic analysis marker to provide information necessary for diagnosis or prognosis of a joint disease.

It is another object of the present invention to provide a gene delivery system for joint disease.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method of screening a substance for the prevention or treatment of joint diseases comprising the steps of: (a) contacting a hypoxia-inducible factor-2 alpha (HIF- -Encoding nucleotide sequence and a silent information regulator 1 (SirT1) -encoding nucleotide sequence to a cell or tissue; And (b) analyzing the SirT1 protein in the cell or tissue, wherein when the test substance inhibits the stability and transcriptional activity of the HIF-2α protein through inhibition of activation of the SirT1 protein, Wherein the substance is judged to be a substance for preventing or treating a disease.

According to another aspect of the invention, the present invention provides a method for detecting the expression of a nucleotide sequence encoding a SirT1 protein or a SirTl protein in a separate human biological sample in order to provide information necessary for diagnosis of a joint disease or prognosis, A disease diagnosis or a prognostic analysis marker.

The present inventors have sought to develop a novel biomolecule capable of effectively preventing or treating joint diseases. As a result, the present inventors have found that activation of SirT1 does not increase the acetylation of HIF-2? Protein but increases stabilization and transcriptional activity of HIF-2? Protein, induces expression of various matrix-degrading enzymes, Respectively.

A joint is the point where two bones meet, and can usually be classified as a fibrous joint, a cartilagenous joint, and a synoval joint. Joint diseases are diseases or injuries affecting mammalian (eg, human) joints, arthritis is the most well known joint disease, but many other diseases are also included. Joint disease involves permanent pain or discomfort, transient or persistent chronic pain, or very great pain, which can not only be limited to one joint, but can also occur in many parts of the skeleton.

The term "joint disease" as used herein refers to the gradual deterioration or destruction of articular cartilage tissue surrounding the joint. Arthritis is an inflammation of joints caused by various causes. Especially, osteoarthritis (OA) is one of the oldest and most common diseases of arthritic diseases. It is characterized by destruction of joint's cartilage And is also known as degenerative joint disease, ostoarthrosis, hypertrophic arthritis, or degenerative arthritis. It is also known as degenerative arthritis. Thus, osteoarthritis referred to herein may be used interchangeably with other names mentioned above.

Degenerative joint diseases are noninfectious progressive disorders of joints that contain weight. Normal articular cartilage tissue is soft and transparent white and consists of collagen, protein polysaccharides and chondrocytes embedded in a sponge-like matrix composed of water. In the initial primary arthritis stage, cartilage tissue turns opaque yellow, locally showing soft and rough areas. As the degeneration progresses, the soft areas become more and more fragile and worn out, exposing the bone in cartilage tissue. The bones then begin remodeling to increase density. Finally, osteophytes, which are surrounded by cartilage tissue, form the edges of joints. As the resulting mechanical wear increases, cartilage tissue needs to be repaired, but damaged cartilage cells can not produce enough sponge-like matrices and can not overcome it. Furthermore, cartilage tissue does not smoothly supply blood to perform healing. Most degenerative joint diseases are caused by changes in mechanical instabilities or aging of the joints, and include old age degenerative arthritis. Younger cases may be the result of mechanical abrasion due to abnormal anatomic configuration or anterior cruciate ligament rupture such as injury, bruise, hip dysplasia, patellar dislocation or peelable osteochondritis. Degenerative joint disease can occur anywhere in the body's joints, including the knees, hips, shoulders, hands and spine.

Cartilage is a part of the joint that allows the joint to move easily by cushioning the tip of the bone. The destruction of the cartilage causes abrasion between adjacent bones, resulting in stiffness and suffering due to the difficulty of movement of the joints. Arthritis is a highly prevalent disease in which the number of people living with arthritis is estimated to be about 2 million in Korea and about 27 to 35 million in the US (Helmick, C., et al. , Estimates of the Prevalence Arthritis & Rheumatism , 58 (1): 15-25 (2008)). Unfortunately, there is still no cure because of a lack of clear understanding of the etiology. Indeed, since arthritis can be caused by many factors (eg, age, obesity, wounds, excessive use of joints, genetic causes, etc.), treatment methods can vary depending on the onset of the disease.

Osteoarthritis is divided into various stages: (a) the cartilage is more vulnerable to injury by injury or use; (b) The wear of the cartilage causes a change in the underlying bone, which can result in thickening of the bone and cyst formation. Proliferation of bones called spurs or osteophytes occurs at the ends of the bones in the affected joints. Itching and pain; (c) loosely floating a piece of bone or cartilage in a joint space; And (d) inflammation of the synovial membrane or synovial membrane caused by cartilage breakdown, which additionally causes cytokines and enzymes that damage cartilage.

The present invention firstly proved that activation of SirT1 protein can increase the stabilization and transcriptional activity of HIF-2 alpha protein, which is a master regulator of joint diseases, and it has been proved that joint disease can be prevented or treated by using this.

In accordance with the present invention, overexpression of HIF-2 alpha or its downstream target Nampt (i. E. Activity of iNampt) not only not only significantly increases the levels of NAD ⁺ and total NAD (see Figures 7a-7c) RTI ID = 0.0 > SirTl < / RTI > The increase in SirT1 activity did not cause acetylation of HIF-2? But increased the transcriptional activity of HIF-2? Protein (cf. FIGS. 7e and 8a). Furthermore, the regulation of the transcriptional activity of the HIF-2.alpha. Protein is based on the stabilization of the HIF-2.alpha. Protein (see FIGS. 8B-8K).

SirT1 is a homolog of the Sir2 gene of Saccharomyces cerevisiae and a member of the sirtuin family of proteins. SirT1 plays a key role in maintaining deacetylation of histones into dense chromatin. In addition, SirT1 is known to play an important role in a variety of physiological processes including stress resistance, metabolic processes, dysfunction, apoptosis, senescence or aging and differentiation. For example, SirT1 is down-regulated in cells with high insulin resistance and increased expression of the gene increases insulin sensitivity, which implies that SirT1 is involved in improving insulin sensitivity (Liang, F., et al. , Nature reviews Endocrinology, 5: 367-373 (2009)).

According to certain embodiments of the invention, activation of SirT1 of the present invention increases the expression of the matrix-degrading enzyme at the mRNA or protein level, and more specifically, matrix metalloproteinase (MMP) -3, MMP-9, Mmp-12, Mmp-13 and Adamts4 (see Figure 9b).

According to the method of the present invention, a test substance to be analyzed is first treated with a cell or tissue containing a hypoxia-inducible factor-2 (HIF-2 alpha) -encoding nucleotide sequence and a SirTl-encoding nucleotide sequence.

As used herein, the term " treatment "means an administration process in which the test substance is administered to a cell or tissue to induce contact between the cell or tissue and the test substance, May be used interchangeably with " administration " or " contact. &Quot; The cells or tissues comprising the nucleotide sequence of the present invention are not particularly limited and specifically include mammalian cells or tissues, and more specifically, cells or tissues including, but not limited to, joint- It is not.

According to some embodiments of the present invention, the cells or tissues that can be used in the present invention are joint-derived cells or joint tissues, and more specifically articulating joints-derived cells or movable joints Organization.

According to some embodiments of the present invention, the movable joint tissue that may be used in the present invention includes, but is not limited to, wrists, elbows, shoulders, ankles, knees, hips, vertebrae, temporomandibular and carpometacarpal joints . More specifically, the joint tissue includes femoral heads, femoral condyles, tibial plateaus, acetabulofemoral joints, acromioclavicular joints, femoropatellar joints, A femorotibial joint, a glenohumeral joint, a humeroradial joint, a humeroulnar joint, an interphalangeal joint, a metacarpal joint, a radioulnar joint, And talocalcial joints, but are not limited thereto.

The method of the present invention may further comprise a step (pre-a) of inducing a joint disease in said cell or tissue. For example, expression of HIF-2 alpha is increased by mechanical stress such as DMM surgery or proinflammatory cytokines such as IL 1 beta or viral injection, specifically adenovirus (e.g., Ad- Epasl ) By inducing the condition of the joint disease, the following step analysis can be performed more clearly. According to certain embodiments of the invention, the adenovirus of the invention is administered via intra-articular (IA) injection or intraperitoneal (IP) injection.

The term "test substance" used in referring to the screening method of the present invention is used in screening to check whether stability of HIF-2? Protein and transcriptional activity is inhibited through inhibition of activation of SirT1 protein Means an unknown substance used. According to some embodiments of the present invention, the test material that can be used in the present invention is a substance that interferes with the interaction between HIF-2? And HIF-2? -Binding sites in the promoter of Nampt gene, ), shRNA (small hairpin RNA or short hairpin RNA), miRNA (microRNA), ribozyme, DNAzyme, peptide nucleic acids, antisense oligonucleotides, peptides, antibodies, aptamers and natural extracts, But is not limited thereto.

When the test substance to be analyzed by the screening method of the present invention is a chemical, it may be a single compound or a mixture of compounds (e.g., a cell or a tissue culture). The test substance can be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution Be obtained by the synthetic library method required, the '1-bead 1-compound' library method, and the synthetic library method using affinity chromatography screening. Methods for the synthesis of molecular libraries are described in DeWitt, et al. , Proc. Natl. Acad. Sci. USA 90, 6909, 1993; Erb, et al. , Proc. Natl. Acad. Sci. USA 91, 11422, 1994; Zuckermann, et al. , J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell, et al. , Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell, et al. , Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop, et al. , J. Med. Chem. 37, 1233, 1994, and the like.

The screening method of the present invention identifies a test substance that inhibits the activation of SirT1 protein and inhibits the stabilization and transcriptional activity of HIF-2 alpha protein, but it is a substance that directly inhibits protein expression of HIF-2 alpha, Nampt or SirT1, -2α, a substance inhibiting hydrolytic activity and inhibiting proteasome degradation of HIF-2α, and the like. According to some embodiments of the present invention, the protein having hydroxylase activity in the present invention includes, but is not limited to, prolyl-4-hydroxylase domain (PHD) 2 and PHD3 protein. According to some embodiments of the invention, siRNAs, shRNAs, miRNAs, ribozymes, DNAzymes and antisense sequences for HIF-2-encoding nucleotide sequences (SEQ ID No. 1) or SirTl-encoding nucleotide sequences (SEQ ID No. 3) Oligonucleotides can inhibit the expression of HIF-2 or SirTl. However, the main target of the method of the present invention is to identify the substance which inhibits the activation of SirT1 protein and inhibits the stabilization of HIF-2 protein, thereby inhibiting degradation of HIF-2 through the proteasome pathway.

The term "antisense oligonucleotide" used in the present invention means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in the mRNA, It acts to inhibit the translation into protein. As used herein, the term "complementary" means that the antisense oligonucleotide is sufficiently complementary to hybridize selectively under a given hybridization or annealing condition, preferably physiological conditions, to one or more Mismatch nucleotide sequence and has a meaning that encompasses both 'substantially complementary' and 'perfectly complementary', and more specifically means that it is completely complementary do. The length of the antisense oligonucleotide is 6 to 100 bases, more specifically 8 to 60 bases, most specifically 10 to 40 bases.

The term "siRNA" as used herein means a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99/07409 and WO 00/44914). Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method. siRNA has been first discovered in plants, worms, fruit flies and parasites, and the recent development / use of siRNA to have been applied to mammalian-cell research (Degot S, et al 2002; . Degot S, et al 2004;. Ballut L, et al., 2005).

The siRNA molecule of the present invention may have a structure in which the target sense strand and the antisense strand are located on opposite sides to form a double strand. Also, according to another embodiment, the siRNA molecules of the invention may have a single stranded structure with self-complementary sense and antisense strands. The siRNA is not limited to a complete pair of double-stranded RNA portions that are paired with each other, but is paired by a mismatch (the corresponding base is not complementary), a bulge (no base corresponding to one chain) May be included. The total length is 10 to 100 bases, specifically 15 to 80 bases, more specifically 20 to 70 bases, and most particularly 20 to 30 bases.

The siRNA terminal structure is capable of blunt or cohesive termini as long as it can inhibit expression of the target by RNAi (RNA interference) effect. The sticky end structure can be a 3'-end protruding structure and a 5'-end protruding structure. SiRNA molecules of the present invention may have a form in which a short nucleotide sequence (e.g., about 5-15 nt) is inserted between the self-complementary sense and antisense strands, wherein the siRNA molecule formed by the expression of the nucleotide sequence is a molecule The hairpin structure is formed by hybridization, and the stem-and-loop structure as a whole is formed. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

According to some embodiments of the invention, the siRNA of the invention has a sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 3. According to the invention, Ad- Epas1 or cartilage cells infected with Ad- Nampt: (for example, mouse articular cartilage cells), as handles SirT1 inhibitors (e.g., EX527, SirT1- targeting siRNA) or HIF-2- induced Nampt- The expression levels of matrix-degrading enzymes (e.g., Mmmp3, Mmp9 , Mmp12, Mmp13 and Adamts4 ) were markedly reduced (see FIG.

The term "shRNA (small hairpin RNA or short hairpin RNA) " referred to in the present invention refers to a sequence of RNA that produces a robust hairpin turn, which can be used to silence gene expression through RNA interference. shRNA uses a vector for introducing cells and mainly uses a U6 promoter capable of expressing shRNA. These vectors are always transferred to daughter cells, allowing genetic silencing to be inherited. The shRNA hairpin structure is degraded into an intracellular machinery siRNA and bound to an RNA-induced silencing complex. The above-described complex binds to and degrades mRNA matched to the siRNA bound thereto. shRNAs are transcribed by RNA polymerase III, and production of shRNAs in mammalian cells may cause interferon responses as cells recognize shRNA as a viral attack and find defensive means. In addition, shRNAs can also be used in plants and other systems, and the U6 promoter is not necessary. In the case of plants, the CaMV (cauliflower mosaic virus) 35S promoter, which is a conventional promoter having a very strong continuous expression ability, can be used.

As used herein, the term "microRNA (miRNA)" refers to a material that binds to the 3'-UTR of mRNA (messenger RNA) as a single strand RNA molecule of 21-25 nucleotides and controls gene expression of eukaryotes (Bartel DP, et al. , Cell, 23: 116 (2): 281-297 (2004)). The production of miRNA is made into a stem-loop structure precursor miRNA (pre-miRNA) by Drosha (RNase III type enzyme), and it is transferred to the cytoplasm and cleaved by Dicer to make mature miRNA [Kim VN, et al. , Nat Rev Mol Cell Biol., 6 (5): 376-385 (2005)]. MiRNAs prepared as described above are involved in development, cell proliferation and death, lipid metabolism, tumor formation, etc. by controlling the expression of target proteins [Wienholds E, et al. , ≪ / RTI > Science, 309 (5732): 310-311 (2005); Nelson P, et al. , Trends Biochem Sci., 28: 534-540 (2003); Lee RC, et al. , Cell, 75: 843-854 (1993); And Esquela-Kerscher A, et al. , Nat Rev Cancer, 6: 259-269 (2006)].

As used herein, the term "peptide" refers to a linear molecule formed by peptide bonds and amino acid residues joined together. . The peptide of the present invention the chemical synthesis methods known in the art, particularly solid-phase synthesis technique (solid-phase synthesis techniques; Chem Merrifield, J. Amer Soc 85:. 2149-54 (1963); Stewart, et al,. Solid Phase Peptide Synthesis , 2nd ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891).

Next, the activity of the SirT1 protein is measured in the cells treated with the test substance. The expression level and activity can be measured as described below. When the activity of the SirT1 protein, which is a marker of the present invention, is reduced, the test substance can be determined as a substance for preventing or treating joint disease have.

According to some embodiments of the present invention, the joint disease of the present invention is useful for the treatment and / or prophylaxis of degenerative arthritis, peelable osteochondritis, arthritis or arthritis after meniscus injury, malunion of joints, avascular necrosis, arthroses, Chondromalacia patellae, synovitis, bursitis, traumatic effusion, ligamentous deficiency arthroses, osteochondritis dissecans (OCD), patellar instability (patellar instability) ), Rheumatoid arthritis, childhood idiopathic arthritis, juvenile arthritis, traumatic arthritis, inflammatory arthritis, septic arthritis, lupus, scleroderma, tendonitis, But are not limited to, fibromuscular and multifocal myositis. More specifically, the joint disease of the present invention is degenerative arthritis.

The HIF-2 alpha -encoding nucleotide sequence and the SirTl-encoding nucleotide sequence used in the present invention are represented by SEQ ID NO: 1 (GenBank Accession No. NM_010137.3) and SEQ ID NO: 3 (GenBank Accession No. NM_001159589.1) And the amino acid sequences of the proteins expressed from the respective nucleotide sequences are shown in SEQ ID No. 2 (GenBank Accession No. NP_034267.3) and Sequence Listing No. 4 (GenBank Accession No. NP_001153061.1).

Changes in the amount of SirT1 protein can be performed according to various quantitative or qualitative immunoassay protocols developed conventionally and include, for example, immuno staining, radioimmunoassay, radioimmunoprecipitation, Western blotting, immunoprecipitation, ELISA linked immunosorbent assay, capture-ELISA, inhibition or competition assay, sandwich assay, flow cytometry, immunofluorescent staining and immunoaffinity purification.

Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.

For example, if the method of the present invention is carried out according to the method radioactive immunoassay, radioactive isotope is an antibody labeled (e.g., C ^14, I ^125, P ³² and S ³⁵⁾ of detecting the marker molecules of the present invention .

When the method of the present invention is carried out by an ELISA method, the present invention relates to a method for screening a solid substrate, comprising the steps of: (i) coating the surface of a solid substrate with an analyte of an unknown cell sample to be analyzed; (ii) reacting said cell lysate with an antibody to a target as a primary antibody; (iii) reacting the result of step (ii) with an enzyme-conjugated secondary antibody; And (iv) measuring the activity of the enzyme.

Suitable as said solid substrate are hydrocarbon polymers (e.g., polystyrene and polypropylene), glass, metal or gel, and more particularly microtiter plates.

The enzyme bound to the secondary antibody may include an enzyme catalyzing a chromogenic reaction, a fluorescence reaction, a luminescent reaction, or an infrared reaction, but is not limited thereto. For example, an alkaline phosphatase,? -Galactosidase, Radish peroxidase, luciferase, and cytochrome P ₄₅₀ . In the case where alkaline phosphatase is used as an enzyme binding to the secondary antibody, it is preferable that the substrate is selected from the group consisting of bromochloroindole phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS -Bl-phosphate and ECF (enhanced chemifluorescence) are used. When horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2'- Azine-di [3-ethylbenzthiazoline sulfonate]), o - phenylenediamine (OPD) and naphthol / pie Ronin, glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS a substrate such as phenzaine methosulfate may be used All.

When the method of the present invention is carried out in a Capture-ELISA fashion, certain embodiments of the present invention comprise (i) incubating an antibody against a target of the invention (e. G., A SirTl protein) as a capturing antibody on the surface of a solid substrate Coating; (ii) reacting the capture antibody with a cell sample; (iii) reacting the result of step (ii) with a detecting antibody which is labeled with a signal generating label and specifically reacts with a SirT1 protein; And (iv) measuring a signal originating from the label.

The detection antibody has a label that generates a detectable signal. Wherein the label is a chemical (e.g., biotin), an enzyme (alkaline phosphatase, β- galactosidase, horseradish peroxidase, and cytochrome P _450), the radioactive material (for example, ¹⁴ C, ¹²⁵ I, P ³² and S ³⁵ ), fluorescent materials (e.g., fluorescein), luminescent materials, chemiluminescent materials and fluorescence resonance energy transfer (FRET). Various labels and labeling methods are described in Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press,

In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. The detection of such signals enables a qualitative or quantitative analysis of the target of the present invention. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal.

In addition, the activity of the SirT1 protein can be analyzed by fluorescence analysis using commercially available kits. According to some embodiments of the invention, the SirTl protein activity of the present invention is increased about 1.5-fold by Ad- Epasl or Ad- Nampt infusion (see Figure 7d).

As used herein, the term "biological sample " means, but is not limited to, any sample obtained from a human or mammal, for example, a cell or tissue of cartilage (especially articular cartilage). According to some embodiments of the present invention, the SirTl of the present invention is included in a cartilage tissue, particularly an articular cartilage sample. Therefore, SirTl of the present invention can be an index for the generation and development of joint diseases, and can be used for diagnosing the occurrence of joint diseases and development. As used herein, the term "diagnosis" is intended to include determining the susceptibility of an object to a particular disease or disorder, determining whether an object currently has a particular disease or disorder, Determining the prognosis (e.g., determining the identity or stage of a joint disease condition, or determining the responsiveness of a joint disease to treatment), or determining the prognosis (e.g., Lt; / RTI > to monitor the state of the object in order to provide < RTI ID = 0.0 >

As used herein, the term "prognosis " includes disease progression processes, in particular disease progression, disease regeneration, and prediction in terms of recurrence of joint disease. Specifically, the prognosis in the present invention means the possibility that a disease of a patient having a joint disease is cured.

According to some embodiments of the present invention, the present invention may be practiced by an immunoassay method, that is, an antigen-antibody reaction method. In this case, an antibody or an aptamer that specifically binds to a marker (e.g., SirTl) of the above-mentioned joint disease of the present invention is used.

The antibody used in the present invention is a polyclonal or monoclonal antibody, specifically a monoclonal antibody. Antibodies can be produced using methods commonly practiced in the art, such as the fusion method (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), the recombinant DNA method (US Patent No. 4,816,56) Or phage antibody library methods (Clackson et al., Nature , 352: 624-628 (1991) and Marks et al . , J. Mol. Biol. , 222: 58, 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known and readily practicable by those skilled in the art. Polyclonal antibodies can be obtained by injecting a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

When the method of the present invention is carried out using an antibody or an aptamer, the present invention can be carried out according to a conventional immunoassay method and used to diagnose joint diseases.

According to another variant of the invention, an aptamer which specifically binds to the marker of the invention can be used in place of the antibody. Aptamers are oligonucleic acid or peptide molecules, and the general contents of aptamers are described in Bock LC et al., Nature 355 (6360): 5646 (1992); Hoppe-Seyler F, Butz K "Peptide aptamers: powerful new tools for molecular medicine". J Mol Med. 78 (8): 42630 (2000); Cohen BA, Colas P, Brent R. "An artificial cell-cycle inhibitor isolated from a combinatorial library". Proc Natl Acad Sci USA . 95 (24): 142727 (1998).

By analyzing the intensity of the final signal by the above-described immunoassay procedure, the joint disease can be diagnosed. That is, when the marker protein of the present invention is highly expressed in a biological sample and the signal is stronger than a normal biological sample (for example, articular cartilage cell or tissue), it is diagnosed as a joint disease. In addition, when a matrix-degrading enzyme (for example, Mmp3, Mmp9, Mmp12, Mmp13, etc.) whose expression is controlled by the marker protein of the present invention is highly expressed than a normal biological sample, it is diagnosed as a joint disease.

The probe or primer used in the diagnosis using the method of the present invention has a sequence complementary to the SirTl nucleotide sequence.

The kit for diagnosing joint diseases of the present invention can be carried out based on hybridization. In this case, a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention described above is used. Hybridization-based analysis may be performed using a probe hybridized to the nucleotide sequence of the marker of the present invention to determine whether arthritis is present.

The label of the probe may provide a signal to detect hybridization, which may be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (P ³² and S ³⁵ ), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), joins, substrates for enzymes, heavy metals such as gold and antibodies, streptavidin , Haptens with specific binding partners such as biotin, digoxigenin and chelating groups. Markers can be generated using a variety of methods routinely practiced in the art such as the nick translation method, the Multiprime DNA labeling systems booklet (Amersham, 1989) and the kaination method (Maxam & Gilbert, Methods in Enzymology , 65: 499 (1986)). The label provides signals that can be detected by fluorescence, radioactivity, color measurement, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

The nucleic acid sample to be analyzed can be prepared using mRNA obtained from various biological samples (biosamples), preferably using mRNA obtained from articular cartilage tissue cells. Instead of the probe, the cDNA to be analyzed may be labeled and subjected to a hybridization reaction-based analysis.

When a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and washing time, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. The detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999). For example, high stringency conditions were hybridized at 65 ° C in 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA, followed by addition of 0.1 x SSC / 0.1% SDS Lt; RTI ID = 0.0 > 68 C < / RTI > Alternatively, high stringency conditions means washing at < RTI ID = 0.0 > 48 C < / RTI > in 6 x SSC / 0.05% sodium pyrophosphate. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 ° C.

After the hybridization reaction, a hybridization signal generated through the hybridization reaction is detected. The hybridization signal can be carried out in various ways depending on, for example, the type of label attached to the probe. For example, when a probe is labeled with an enzyme, the substrate of the enzyme can be reacted with the result of hybridization reaction to confirm hybridization. Combinations of enzymes / substrates that may be used include, but are not limited to, peroxidases (such as horseradish peroxidase) and chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis- Acetyl-3,7-dihydroxyphenox), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2) , 2'-Azine-di [3-ethyl benzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine; (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate, and ECF substrate; alkaline phosphatase and bromochloroindoleyl phosphate; Glucose oxidase and t-NBT (nitroblue tetrazolium) and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate. Therefore, when the method for detecting a joint disease marker of the present invention is carried out based on hybridization, specifically (i) hybridizing a probe having a sequence complementary to the nucleotide sequence of the marker of the present invention to a nucleic acid sample; (ii) detecting whether the hybridization reaction has occurred. By analyzing the intensity of the hybridization signal by the hybridization process, it is possible to judge whether or not the joint disease is present. That is, when the hybridization signal to the nucleotide sequence of the marker of the present invention is stronger than the normal sample (for example, articular cartilage cell or cartilage tissue) in the sample, it is diagnosed as a joint disease.

According to some embodiments of the present invention, the human joint disease diagnostic kit of the present invention may be a gene amplification kit. According to some embodiments of the present invention, the expression of the SirTl gene of the present invention can be detected according to a polymerase chain reaction (PCR). PCR is the most well-known nucleic acid amplification method, and many variations and applications thereof have been developed. The term "amplification reaction" as used herein refers to a reaction to amplify a nucleic acid molecule. A variety of amplification reactions have been reported in the art, including PCR (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT- Molecular Cloning, A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al (EP 329,822), multiplex PCR (McPherson and Moller, 2000 ), Ligase chain reaction (LCR), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) / 10315), self sustained sequence replication (WO 90/06995), selective amplification of target polynucleotide sequences (US Patent No. 6,410,276), consensus sequence primer polymerase The consensus sequence primed polymerase chain reaction, CP-PCR, U.S. Patent No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR; U.S. Patent Nos. 5,413,909 and 5,861,245), nucleic acid sequence based amplification , NASBA; U.S. Pat. Nos. 5,130,238; 5,409,818; 5,554,517; and 6,063,603) and strand displacement amplification, the teachings of which are incorporated herein by reference . Other amplification methods that may be used are described in U.S. Patent Nos. 5,242,794, 5,494,810, 4,988,617, and U.S. Patent No. 09 / 854,317.

As used herein, the term "primer " means an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid chain (template) is induced, that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Specifically, the primer is a deoxyribonucleotide and a single strand. The primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a number of factors, such as temperature, application, and the source of the primer. The term " annealing " or " priming " as used herein means that an oligodeoxynucleotide or nucleic acid is apposited to a template nucleic acid, wherein the polymerase is capable of polymerizing a nucleotide to form a nucleic acid complementary to the template nucleic acid, To form molecules.

When the method of the present invention is carried out using a primer, the gene amplification reaction is performed to extract and detect mRNA from an analyte (for example, a joint tissue-derived cell). Therefore, in principle, the present invention uses a mRNA in a sample as a template and performs a gene amplification reaction using a primer that binds to mRNA or cDNA.

To obtain mRNA, total RNA is isolated from a sample (specifically, cells). The isolation of total RNA can be carried out according to conventional methods known in the art (see Sambrook, J., et al. , Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C., et al, Plant Mol Biol Rep, 9:..... 242 (1991); Ausubel, FM, et al, Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P , et al. , Anal. Biochem., 162: 156 (1987)). For example, Trizol can be used to easily isolate total RNA in a cell. Next, cDNA is synthesized from the separated mRNA, and this cDNA is amplified. Because the total RNA of the present invention is isolated from eukaryotic cells, it has a poly-A tail at the end of mRNA, and cDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics : PNAS USA, 85: 8998 ( 1988); Libert F, et al, Science, 244:.... 569 (1989); and Sambrook, J., et al, Molecular Cloning A Laboratory Manual, 3rd ed Cold Spring Harbor Press (2001)). Next, the synthesized cDNA is amplified through gene amplification reaction.

The primer used in the present invention is hybridized or annealed at one site of the template to form a double-stranded structure. Nucleic acid hybridization conditions suitable for forming such a double-stranded structure can be found in Nucleic Acid Hybridization < RTI ID = 0.0 > (" , A Practical Approach, IRL Press, Washington, DC (1985).

The term "hybridization " in this specification means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur either in perfect match between single stranded nucleic acid sequences or in the presence of some mismatching nucleotides. The degree of complementarity required for hybridization can vary depending on hybridization reaction conditions, and can be controlled by temperature. The terms " annealing " and " hybridization " are not different and are used interchangeably herein.

A variety of DNA polymerases may be used in the amplification of the present invention, including the 'cleaun' fragment of E. coli DNA polymerase I, the thermostable DNA polymerase and the bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase that can be obtained from a variety of bacterial species, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Pyrococcus furiosus (Pfu), Thermus Thermus spp. 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermus spp. 17, Thermus spp. 17, Thermus spp. 17, Thermus spp. 17, Thermus calbiophilus, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, But are not limited to, DNA polymerase from Thermosipho africanus .

When performing the polymerization reaction, it is preferable to provide the reaction vessel with an excessive amount of the components necessary for the reaction. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially restricted to the concentration of the component. It is desirable to provide the reaction mixture with such joins as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to such an extent that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, buffers make all enzymes close to optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reaction without changing the conditions such as the addition of reactants.

In the present invention, annealing is carried out under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. The stringent conditions for annealing are sequence-dependent and vary with environmental variables.

Therefore, when the method of the present invention is carried out based on the amplification reaction using cDNA, specifically, (i) performing amplification reaction using a primer sequence complementary to the nucleotide sequence of the SirTl gene; And (ii) analyzing the result of the amplification reaction.

The result of the amplification reaction is subjected to gel electrophoresis and the resultant band is observed and analyzed to confirm the expression and presence of the SirT1 gene.

According to some embodiments of the present invention, the human joint disease diagnostic kit of the present invention may be a gene amplification kit. According to some embodiments of the present invention, the kit of the present invention is performed using real-time PCR. Real-time PCR is a technique for monitoring and analyzing the increase of PCR amplification products in real time (Levak KJ, et al. , PCR Methods Appl. , 4 (6): 357-62 (1995)). The PCR reaction can be monitored by recording fluorescence emission in each cycle during the exponential phase, during which the increase in PCR product is proportional to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the faster the fluorescence increase is observed and the lower the C _T threshold cycle. A pronounced increase in fluorescence above the baseline value measured between 3-15 cycles implies detection of accumulated PCR products. Compared to conventional PCR methods, real-time PCR has the following advantages: (a) conventional PCR is measured in a plateau, while real-time PCR provides data during the exponential growth phase have; (b) the increase in the reporter fluorescence signal is directly proportional to the number of amplicons generated; (c) The degraded probe provides permanent record amplification of the amplicon; (d) increase in detection range; (e) requires at least 1,000 times less nucleic acid than conventional PCR methods; (f) detection of amplified DNA without separation by electrophoresis is possible; (g) using a small amplicon size can achieve increased amplification efficiency; And (h) the risk of contamination is low.

When the amount of PCR amplified acid reaches a detectable amount by fluorescence, the amplification curve begins to occur, and the signal rises exponentially to reach the stagnation state. The higher the amount of initial DNA, the faster the amplification curve because the amount of amplified acid is less than the detectable amount of cycles. Therefore, when real-time PCR is performed using a stepwise diluted standard sample, an amplification curve is obtained in which the initial DNA amounts are arranged in the order of the same intervals. Here, when a threshold is set at an appropriate point, a point C _T at which the threshold and the amplification curve intersect is calculated.

In real-time PCR, PCR amplification products are detected through fluorescence. The detection methods are largely an interchelating method (SYBR Green I method) and a method using a fluorescent label probe (TaqMan probe method).

First, the interchelating method is a method using a double-stranded DNA-binding die, in which an amplicon production including non-specific amplification and primer-dimer complexes is performed using a non-sequence specific fluorescent intercalating reagent (SYBR Green I or ethidium bromide) . The reagent does not bind ssDNA. SYBR Green I is a fluorescent dye that binds to the minor groove of double-stranded DNA. It is an interchelator that shows little fluorescence in solution but strong fluorescence when combined with double-stranded DNA (Morrison TB, Biotechniques. 24 (6): 954-8, 960, 962 (1998)). Therefore, since the fluorescence is released through the linkage between SYBR Green I and double-stranded DNA, the amount of amplification product can be measured. SYBR green-silk-time PCR is accompanied by optimization procedures such as melting point or dissociation curve analysis for amplicon identification. Normally, SYBR green is used in a singleplex reaction, but can be used in a multiplex reaction if accompanied by a melting curve analysis (Siraj AK, et al. , Clin Cancer Res. , 8 12: 3832-40 (2002); and Vrettou C., et al. , Hum. Mut. , Vol 23 (5): 513-521 (2004)).

The C _t (cycle threshold) value is the number of cycles over which the fluorescence generated in the reaction exceeds the threshold, which is inversely proportional to the number of initial copies. Therefore, the C _t value assigned to a particular well reflects the number of cycles in which a sufficient number of amplicons have accumulated in the reaction. The C _t value is the cycle in which the increase of DELTA Rn is detected for the first time. Rn denotes the magnitude of the fluorescence signal generated during PCR at each time point, and? Rn denotes the fluorescence emission intensity (normalized reporter signal) of the reporter die divided by the fluorescence emission intensity of the reference die. The C _t value is also referred to as Cp (crossing point) in the LightCycler. The C _t value indicates when the system begins to detect an increase in fluorescence signal associated with exponential growth of the PCR product in the log-linear phase. This period provides the most useful information about the reaction. The slope of the log-linear phase represents the amplification efficiency (Eff) ( http://www.appliedbiosystems.co.kr/ ).

TaqMan probes, on the other hand, typically contain primers (e.g., 20-30 nucleotides) that include a fluorophore at the 5'-end and a quencher (e.g., TAMRA or non-fluorescent quencher (NFQ) Lt; RTI ID = 0.0 > oligonucleotides. ≪ / RTI > The excited fluorescent material transfers energy to nearby quenchers rather than to fluorescence (FRET = Frster or fluorescence resonance energy transfer; Chen, X., et al. , Proc Natl Acad Sci USA 94 (20): 10756-61 (1997)). Therefore, when the probe is normal, no fluorescence is generated. The TaqMan probes are designed to anneal to internal parts of the PCR product. Specifically, the TaqMan probe can be designed as an internal sequence of the SirTl gene of the third sequence of the sequence listing.

The TaqMan probe specifically hybridizes to the template DNA in the annealing step, but the fluorescence is inhibited by the quencher on the probe. During the extension reaction, the TaqMan probe hybridized to the template is degraded by the 5 'to 3' nuclease activity of the Taq DNA polymerase, and the fluorescent dye is released from the probe and the inhibition by the quencher is released, indicating fluorescence. At this time, the 5'-end of the TaqMan probe should be located downstream of the 3'-terminal of the extension primer. That is, when the 3'-end of the extension primer is extended by a template-dependent nucleic acid polymerase, the 5'-3 'nuclease activity of the polymerase cleaves the 5'-end of the TaqMan probe, A fluorescence signal is generated.

The reporter molecule and the quencher molecule attached to the TaqMan probe include a fluorescent substance and a non-fluorescent substance. Fluorescent reporter molecules and quencher molecules that can be used in the present invention can be any of those known in the art, examples of which are (the number of parentheses is the maximum emission wavelength in nanometers): Cy2 ^{TM (506), YO-PRO} TM -1 (509), YOYO TM -1 (509), Calcein (517), FITC (518), FluorX TM (519), Alexa TM (520), Rhodamine 110 (520) , 5-FAM 522, Oregon Green ^TM 500 522, Oregon Green ^TM 488 524, RiboGreen ^TM 525, Rhodamine Green ^TM 527, Rhodamine 123 529, Magnesium Green ^TM 531, 565, BODIPY TMR 568, BODIPY 558/568 (568), BODIPY 558/550 (550), Calcium Green ^TM 533, TO-PRO ^TM -1 533, TOTO 1 533, JOE 548, ), BODIPY564 / 570 (570) , Cy3 TM (570), Alexa TM 546 (570), TRITC (572), Magnesium Orange TM (575), Phycoerythrin R & B (575), Rhodamine Phalloidin (575), Calcium Orange TM ( 576), Pyronin Y 580, Rhodamine B 580, TAMRA 582, Rhodamine Red ^TM 590, Cy3.5 ^TM 596, ROX 608, Calcium Crimson ^TM 615, A ^{lexa TM 594 (615), Texas} Red (615), Nile Red (628), YO-PRO TM -3 (631), YOYO TM -3 (631), R-phycocyanin (642), C-Phycocyanin (648) , TO-PRO ^TM -3 (660), TOTO 3 (660), DiD DilC (5) 665, Cy5 ^TM 670, Thiadicarbocyanine 671, Cy5.5 694, HEX 556, TET 536, VIC 546, BHQ-1 534, BHQ-2 579, BHQ-3 672, Biosearch Blue 447, CAL Fluor Gold 540 544, CAL Fluor Orange 560 559, , CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM 520, Fluorescein 520, Fluorescein-C3 520, Pulsar 650 566, Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength in nanometers.

Suitable reporter-quencher pairs are disclosed in many references: Pesce et al. editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al. , FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2nd EDITION (Academic Press, New York, 1971); Griffiths, COLOR and CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; US Pat. Nos. 3,996,345 and 4,351,760.

In addition, the reporter molecule coupled to the TaqMan probe and the non-transmembrane material used in the quencher molecule may comprise a minor groove binding (MGB) moiety. The term "TaqMan MGB-conjugate probe" as used herein means a TaqMan probe conjugated with MGB at the 3'-end of the probe. MGB is a substance that binds to the minor groove of DNA with a high affinity. It is composed of dihydrocyclopyrrolloindole tripeptide (DPI3), netropsin, distamycin, lexitropsin, mithramycin, Chromomycin A3, olivomycin, anthramycin, sibiromycin, pentamidine, stilbamidine, berenyl, CC-1065, Hoechst 33258, Dimer, tetramer and pentamer of CDPI, N-methylpyrrole-4-carbox-2-amide (MPC) and its dimers, trimers, tetramers and pentamers of DAPI (4-6-diamidino- But is not limited thereto.

The conjugation of the Taqman probe and MGB significantly increases the stability of the hybrid formed between the probe and its target. More specifically, increased stability (i.e., increased hybridization degree) results in increased melting temperature of the hybrid duplex formed by the MGB-conjugated probe as compared to the normal probe. Thus, MGB stabilizes Van der Waals forces to increase the melting temperature of MGB-conjugated probes without increasing the probe length, resulting in shorter probes in Taqman real-time PCR under more stringent conditions Nucleotides. In addition, MGB-conjugated probes remove background fluorescence more efficiently. Specifically, the length of the TaqMan MGB-conjugate probe of the present invention includes, but is not limited to, 15-21 nucleotides.

The target nucleic acid used in the present invention is not particularly limited and includes all of DNA (gDNA or cDNA) or RNA molecules, more specifically cDNA. When the target nucleic acid is an RNA molecule, reverse transcription is used with the cDNA. According to some embodiments of the present invention, the target nucleic acid of the present invention comprises a eukaryotic cell (e. G., A mammal comprising a human) nucleic acid.

Methods for annealing or hybridizing a target nucleic acid to an extension primer and a probe can be carried out by a hybridization method known in the art. In the present invention, suitable hybridization conditions can be determined by a series of procedures by an optimization procedure. This procedure is performed by a person skilled in the art in a series of procedures to establish a protocol for use in the laboratory. Conditions such as, for example, temperature, concentration of components, hybridization and reaction time, buffer components and their pH and ionic strength depend on various factors such as the length and GC amount of the oligonucleotide and the target nucleotide sequence. Detailed conditions for hybridization can be found in Joseph Sambrook, et al. , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc .; NY (1999).

The template-dependent nucleic acid polymerase used in the present invention is an enzyme having 5 ' to 3 ' nuclease activity. Specifically, the template-dependent nucleic acid polymerase used in the present invention is preferably a DNA polymerase. As used herein, the term "template-dependent extension reaction" refers to a reaction that synthesizes a nucleotide sequence complementary to the sequence of a template. According to some embodiments of the present invention, the real-time PCR of the present invention is performed by the TaqMan probe method.

The marker of the present invention is a biomolecule which is highly expressed in joint diseases. High expression of these markers can be measured at the mRNA or protein level. As used herein, the term "high expression" means that the degree of expression of a nucleotide sequence of interest in a sample to be investigated is higher than that of a normal sample. For example, expression analysis methods conventionally used in the art, such as RT-PCR or ELISA methods (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001) In the case of expression analysis, it means that the expression is analyzed to be high. For example, when the marker according to the present invention is highly expressed 5 times or more as compared with normal cells or tissues, it is determined that the marker is 'highly expressed' in the present invention, Is determined to have occurred.

According to another aspect of the present invention, there is provided a gene delivery system comprising a target nucleotide sequence to be delivered into a cell, wherein the target nucleotide sequence is a nucleotide sequence encoding a SirT1 protein. Lt; / RTI > gene delivery system.

Since the method of the present invention includes the contents described in the method for screening substances for preventing or treating joint diseases described above, the description thereof will be omitted in order to avoid the excessive complexity of the present specification by the description of the duplicated contents.

The SirTl-encoding nucleotide sequence can be applied to all gene delivery systems used in conventional gene therapy, and specifically includes plasmids, adenoviruses (Lockett LJ, et al., Clin. Cancer Res. 3: 2075-2080 (1997) ), Adeno-associated viruses (AAV, Lashford LS., Et al., Gene Therapy Technologies, Applications and Regulations Ed. A. Meager, 1999), retroviruses (Gunzburg WH, et al., Retroviral vectors .. Gene Therapy Technologies, Applications and Regulations Ed A. Meager, 1999), lentivirus (Wang G. et al, J. Clin Invest 104 (11...): R55-62 (1999)), herpes simplex virus (Chamber R., et al, Proc Natl Acad Sci USA 92:.... 1411-1415 (1995)), Bash Catania virus (Puhlmann M. et al, Human Gene Therapy 10:. 649-657 (1999)) , Liposomes (Methods in Molecular Biology, Vol. 199, SC Basu and M. Basu (Eds.), Human Press 2002) or niosomes. Most specifically, the gene delivery system of the present invention is prepared by applying a SirTl-encoding nucleotide sequence to an adenovirus.

i. Adenovirus

Adenoviruses are widely used as gene transfer vectors because of their moderate size, ease of manipulation, high titer, broad target cells and excellent infectivity. Both ends of the genome contain an inverted terminal repeat (ITR) of 100-200 bp, which is a sis element essential for DNA replication and packaging. The E1 regions of the genome (E1A and E1B) encode proteins that regulate transcription and transcription of host cell genes. The E2 regions (E2A and E2B) encode proteins involved in viral DNA replication.

Of currently developed adenovirus vectors, non-replicable adenoviruses lacking the E1 region are widely used. On the other hand, the E3 region is removed from the conventional adenoviral vector to provide a site for insertion of a foreign gene (Thimmappaya, B. et al., Cell , 31: 543-551 (1982); and Riordan, JR et al. Science , 245: 1066-1073 (1989)). Therefore, the HIF-2? Gene of the present invention is preferably inserted into the deleted E1 region (E1A region and / or E1B region, preferably E1B region) or E3 region, and more preferably inserted into the deleted E3 region . The term "deletion" as used herein in connection with a viral genome sequence has the meaning not only of a complete deletion of the sequence but also of a partial deletion thereof.

According to some embodiments of the present invention, the adenovirus gene delivery system of the present invention has a structure in which the 'promoter-SrT1 gene-polyA sequence' is linked and the deleted E1 region (E1A region and / or E1B region, Or the E3 region, preferably the deleted E3 region.

In addition, since the adenovirus can pack up to about 105% of the wild type genome, about 2 kb can be additionally packaged (Ghosh-Choudhury et al., EMBO J. , 6: 1733-1739 (1987)). Thus, the SirTl gene inserted into the adenovirus may additionally bind to the genome of the adenovirus.

The adenovirus has 42 different serotypes and subgroups of AF. Of these, adenovirus type 5 belonging to subgroup C is the most preferable starting material for obtaining the adenovirus vector of the present invention. Biochemical and genetic information on adenovirus type 5 is well known. The SirT1 gene carried by the adenovirus is replicated in the same manner as the episomes, and the genotoxicity of the host cell is very low.

ii. Retrovirus

Retroviruses are widely used as gene transfer vectors because they can insert their genes into host genomes, carry large quantities of foreign genetic material, and have a broad spectrum of cells that can be infected.

To construct a retroviral vector, the SirT1 gene is inserted into the retroviral genome in place of the sequence of the retrovirus to produce a non-replicable virus. To produce virion, a packaging cell line is constructed that contains the gag, pol, and env genes, but lacks the LTR (long terminal repeat) and the? Sequences (Mann et al., Cell , 33: 153-159 (1983)). Upon insertion of the recombinant plasmid containing the Nampt gene, LTR and the? Sequence into the cell line, the? Sequence enables the production of the RNA transcript of the recombinant plasmid, which is packaged with the virus and the virus is exported to the medium (Nicolas and Rubinstein "Retroviral vectors" In: Vectors: A survey of molecular cloning vectors and their uses , Rodriguez and Denhardt (eds.), Stoneham: Butterworth, 494-513 (1988)). The medium containing the recombinant retrovirus is harvested and concentrated to use as a gene delivery system.

Genetic transfer using a second generation retroviral vector was announced. Kasahara et al. ( Science , 266: 1373-1376 (1994)) prepared a variant of Molonimurine leukemia virus, in which an EPO (erythropoietin) sequence was inserted into the envelope region to generate a chimeric Protein. The gene delivery system of the present invention can also be produced according to the construction strategy of the second generation retroviral vector.

iii. AAV vector

Adeno-associated virus (AAV) is suitable for the gene delivery system of the present invention because it can infect non-dividing cells and has the ability to infect various kinds of cells. A detailed description of the preparation and use of AAV vectors is disclosed in detail in U.S. Patent Nos. 5,139,941 and 4,797,368.

A study of AAV as a gene delivery system is described in LaFace et al, Viology , 162: 483486 (1988), Zhou et al., Exp. Hematol. (NY), 21: 928-933 (1993), Walsh et al, J. Clin. Invest. , 94: 1440-1448 (1994) and Flotte et al., Gene Therapy , 2: 29-37 (1995).

Typically, the AAV virus is a plasmid (McLaughlin et al., J. Virol. , 62: 1963-1973 (1988)) containing a gene sequence of interest (SirTl gene) in which two AAV end- Samulski et al, J. Virol, 63 :.. 3822-3828 (1989)) and terminal repeat expression plasmid that contains a wild-type AAV coding sequences without (McCarty et al, J. Virol, 65:.. 2936-2945 ( 1991)). ≪ / RTI >

iv. Other viral vectors

Other viral vectors may also be used as the gene delivery system of the present invention. Bash Catania virus (Puhlmann M. et al, Human Gene Therapy 10:.. 649-657 (1999); Ridgeway, "Mammalian expression vectors," In: Vectors: A survey of molecular cloning vectors and their uses Rodriguez and Denhardt, eds "Transgenic and stable expression of transferred genes," In: Kucherlapati R, ed Gene transfer New York: Plenum (1988); (1986) and Coupar et al., Gene , 68: 1-10 (1988)), lentivirus (Wang G. et al., J. Clin. Invest. 104 (11): R55-62 (1999)) or vectors derived from herpes simplex virus (Chamber R., et al., Proc. Natl. Acad. Sci USA 92: 1411-1415 (1995)) can also carry the SirT1 gene into cells It can be used as a portable system.

v. Liposome

Liposomes are formed automatically by phospholipids dispersed in the aqueous phase. Examples of successful delivery of exogenous DNA molecules into liposomes into cells include Nicolau and Sene, Biochim. Biophys. Acta , 721: 185-190 (1982) and Nicolau et al., Methods Enzymol. , 149: 157-176 (1987). On the other hand, lipofectamine is the most widely used reagent for transformation of animal cells using liposomes. Liposomes containing the SirT1 gene interact with cells through mechanisms such as endocytosis, adsorption to the cell surface or fusion with the plasma membrane, and carry the SirT1 gene into the cell.

The method of introducing the above-described gene delivery system of the present invention into cells can be carried out through various methods known in the art. In the present invention, when the gene delivery system is constructed based on a viral vector, it is carried out according to a virus infection method known in the art. Infection of host cells with viral vectors is described in the above cited documents. In the present invention, when the gene delivery system is an innoculated recombinant DNA molecule or a plasmid, a microinjection method (Capecchi, MR, Cell , 22: 479 (1980); and Harland and Weintraub, J. Cell Biol. 101: 1094-1099 (1985)), calcium phosphate precipitation method (Graham, FL et al., Virology , 52: 456 (1973) and Chen and Okayama, Mol. Cell. Biol. 7: 2745-2752 6, 716-718 (1986)), liposome-mediated transfection methods (Neumann, E. et al., EMBO J. 1: 841 (1982), and Tur-Kaspa et al., Mol. Cell Biol. (Wong, TK et al, Gene , 10:87 (1980); Nicolau and Sene, Biochim Biophys Acta, 721: ... 185-190 (1982); and Nicolau et al, Methods Enzymol, 149 :.. 157- 176 (1987)), DEAE-dextran treatment (Gopal, MoI. Cell Biol. , 5: 1188-1190 (1985)), and gene bendard (Yang et al., Proc. Natl. Acad. Sci. 87: 9568-9572 (1990)), the gene can be introduced into cells, and most specifically, microinjection is performed.

According to some embodiments of the present invention, the gene delivery system of the present invention increases the expression of the matrix-degrading enzyme in a cell, and the matrix-degrading enzyme is matrix metalloproteinase (MMP) -3, But are not limited to, Mmp-9 , Mmp-12 , Mmp-13 and Adamts4 (a disintegrin and metalloproteinase with thrombospondin motifs).

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to the regulation of the stability and transcriptional activity of HIF-2, the master regulator of cartilage regression through activation of SirT1, and its use.

(b) According to the present invention, activation of SirTl of the present invention is essential for the onset of HIF-2 or Nampt-induced arthritic disease.

(c) In particular, activation of SirT1 increases the stability and transcriptional activity of the HIF-2 protein and triggers the expression of various matrix-degrading enzymes (e.g., Mmp3, Mmp12, Mmp13, Adamts4, etc.).

(d) Therefore, the SirT1 of the present invention can be used for diagnosis or prognosis of joint diseases, and can be used for the development of therapeutic agents for joint diseases.

Figures 1a-1e are results showing that the Nampt gene is a direct target of HIF-2 alpha in mouse articular cartilage cells. FIG. 1A is a microarray analysis ( n = 4) of primary cultures of mouse articular cartilage cells infected with Ad- EPas1 (800 MOI) for 24 hours. Abbreviations: Retn, Resistin; Adipoq, adiponectin; And Lep, leptin. Figure 1b is then the Ad- EPas1 of treatment does not in primary cultures of mouse articular cartilage cells (none) or Ad-C (800 MOI), or infected with a specified concentration for 24 hours, RT-PCR of the instructions of adipic myrtle (Left panel) and its expression level was quantified by qRT-PCR (right panel) ( n = 6). GAPDH was used as a loading control. Figure 1c shows the expression levels of Epas1 and Nampt in the qRT-PCR roll assay ( n = 6) after infecting primary cultured chondrocytes with Ad-C (800 MOI) or Ad- EPas1 of indicated MOI for 24 hours, (Left panel). HIF-2 alpha, iNampt and eNampt were detected by Western blotting (right panel). Figure 1d shows the results of analysis of HIF-2? -Binding positions in the Nampt promoter. (None), treated with IL-1 (1 ng / ml) or infected with cartilage cells with Ad- EPas1 . Three different HIF-2 [alpha] -binding sites in the Nampt promoter were detected by PCR. A primer for the Nampt CDS (coding sequence) was used as a negative control. The left panel of FIG. 1e shows that the expression of Nampt (SEQ ID NO: 1) containing three HIF-2? -Linked positions in chondrocytes transfected with an empty vector (EV; 1.0 μg) or another amount (μg) of Epas1 vector under the presence or absence of ΔEpas1 vector The activity of the reporter gene was measured ( n = 6). As shown in the right panel of FIG. 1 (e), the activity was measured using reporter gene activity of WT and HIF-2α binding site-mutated (CGTG -> AAAG) reporter genes ( n = 6). The measurements are presented as means ± standard error ( ^* P <0.01, ^** P <0.001; NS, not statistically significant).
Figures 2a-2e show that Nampt is required for the expression of HIF-2? -Induced catabolic factors in articular cartilage cells. Figure 2a shows the mRNA and protein levels after qRT-PCR (left panel) and after treatment with Ad-C (800 MOI) or Ad- Nampt (800 MOI) This is the result of Western blotting (right panel) ( n > 6). Figure 2b is a graph (n = 6) of iNampt and eNampt measured by ELISA after infecting chondrocytes with Ad-C (800 MOI) or Ad- Nampt (800 MOI) for 36 h ). FIG. 2C is a graph showing mRNA levels measured by qRT-PCR after infecting cartilage cells with Ad-C (800 MOI) or Ad- Nampt (800 MOI) for 36 hours in the presence or absence of FK866 ( n = 6). Figure 2d shows the results of qRT-PCR ( n = 6) of expression levels of the indicated genes after treatment of cartilage cells alone or recombinant Nampt (rNampt; Nampt full-length sequence) . Figure 2e is then treated with FK866 (100 μM) to the transfected the control siRNA (siRNA-C) of 100 nM or Nampt- specific siRNA in chondrocytes or cartilage cells and infected for 36 hours with Ad- EPas1 , mRNA levels were measured by qRT-PCR ( n > 6). The measurements are presented as means ± standard error ( ^* P <0.01, ^** P <0.001; NS, not statistically significant).
Figures 3A-3C are results showing that NAMPT is overexpressed in human and mouse OA chondrocytes. FIG. 3A shows the result of staining the fourth grade ICRS human OA cartilaginous tissue section with Alcian blue. NAMPT protein was detected via immunostaining (left panel) and its expression level was measured by qRT-PCR (right panel) ( n = 10). Figure 3b shows the results of saprinin-O staining and immunostaining for Nampt in cartilaginous tissue sections obtained from STR / ort OA mice and CBA control mice. Cartilage tissue destruction was scored using the Mankin's method and Nampt expression levels were quantified by qRT-PCR ( n = 10). Figure 3c shows the results of sapranin-O staining and immunostaining for Nampt in cartilaginous tissue sections obtained from sham- and DMM-operated mice. Cartilage tissue destruction was scored using the Mankins method, and Nampt expression levels were quantified by qRT-PCR ( n = 10). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Scale bar: 50 μm.
Figures 4A-4C are results showing that Nampt expression in OA cartilage tissue is regulated by HIF-2 alpha . FIG. 4A shows the results of sapranin-O staining and immuno-detection of HIF-2α and Nampt in the obtained cartilaginous tissue sections after injection of Ad-C or Ad- EPas1 virus (1 × 10 ⁹ PFU) to be. Cartilage tissue destruction was scored using the Mankins method and the expression levels of Nampt and Epas1 were quantified by qRT-PCR ( n > 6). FIG. 4B shows the results of saprinin-O and immunostaining for HIF-2α and Nampt in DMM or post-simulated control ( Epas1 ^{fl / fl} ) and CKO ( Epas1 ^{fl / fl} ; Col2a1-Cre ) mice. FIG. 4c shows the results of scoring cartilage tissue destruction by the Mann-Kins method and quantifying the expression levels of Nampt and Epas1 by qRT-PCR ( n > 10). The measurements are presented as mean ± standard error ( ^* P <0.001). Size bar: 100 μm.
Figures 5a-5h are results showing that overexpression of Nampt in cartilage cells causes OA cartilage tissue destruction. Figure 5a: Mice were injected with Ad-C or Ad- Nampt (1 x 10 ⁹ PFU) and mice were sacrificed on day 21. Nampt expression was confirmed by immunostaining. Cartilage tissue destruction was detected by sapranin-O staining and scored by the Mankins method ( n > 6). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Figure 5b: Mice were injected with either Ad-C or Ad- Nampt (1 x 10 ⁹ PFU; once a week for 3 weeks) and sacrificed on day 21. Nampt expression in the meniscus (M), cartilaginous tissue (C), and synovial membrane (S) was examined by immunostaining. 5c: mice were injected with Ad- Gfp (1 x 10 ⁹ PFU; once a week for 3 weeks) and sacrificed on day 21. GFP expression was detected using immunofluorescence microscopy and nuclei were detected by DAPI staining (left panel). The percentage of GFP-positive articular cartilage cells was calculated from counting over 200 cells from four independent experiments (right panel). The measurements are presented as means ± standard error ( ^* P = 0.001). Figure 5d: Mice were injected with Ad-C or Ad- Nampt (1 x 10 ⁹ PFU) and mice were sacrificed on day 21. Expression of the cognitive factors indicated in Ad-C- and Ad- Nampt -injected cartilage tissues was measured by qRT-PCR ( n = 6). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Figure 5e: Synovitis in Ad-C- or Ad- Nampt -injected mice was detected and quantified by saffranin -O and hematoxylin staining ( n = 10). The measurements are presented as means ± standard error ( ^* P = 0.001). FIG. 5f shows the expression levels of genes indicated in primary cultured chondrocytes derived from Col2a1 - Nampt TG mouse and WT littermates by qRT-PCR ( n > 7). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). FIG. 5g is a result of Nampt expression observed through immunostaining in DMM or simulated Col2a1 - Nampt TG mouse and WT pup-derived cartilage tissue. Cartilage tissue destruction was determined by sapranin-O staining and quantified by the Mankins method ( n > 13). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Figure 5h shows spontaneous cartilage tissue destruction in 12-month old TG mice and WT pups, and cartilage tissue destruction was determined by sapranin-O staining and quantified by the Mann-Kinth method ( n = 10). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Size bar: 100 μm. Abbreviation: C, joint tissue; M, meniscus plate; And S, synovial membrane.
FIGS. 6a-6g show that inhibition of Nampt enzyme activity blocks OA cartilage tissue destruction induced by Ad- Nampt , Ad- EPas1, or DMM surgery, and that FK866 inhibits in vivo expression of synovitis and catabolic factors. 6a: mice were injected with either Ad-C or Ad- Nampt (1 x 10 ⁹ PFU) IA and FK866 (10 mg / kg) IA or IP co-injected. Cartilage tissue destruction was detected by sapranin-O staining and quantified by the Mankins method ( n = 10). 6b: Ad-C or Ad- Nampt (1 x 10 ⁹ PFU) was injected into mice in the presence or absence of FK866 (10 mg / kg). Expression levels of the indicated genes in cartilage tissue were quantified by qRT-PCR ( n = 10). Figure 6c: IP injection of FK866 into the mice after DMM or simulated surgery. Cartilage tissue destruction was detected by sapranin-O staining and quantified by the Mankins method ( n = 10). Figure 6d shows that after DMM or sham surgery, mice were IP injected with FK866 (10 mg / kg) every 3 days for a total of 8 weeks. Expression levels of the indicated genes in cartilage tissue were quantified by qRT-PCR ( n = 10). 6E: mice were injected IA with Ad-C or Ad- EPas1 (1 x 10 ⁹ PFU) and IA or IP co-injected with FK866 (10 mg / kg). Cartilage tissue destruction was detected by sapranin-O staining and quantified by the Mankins method ( n = 10). 6f: mice were injected with either Ad-C or Ad- EPas1 (1 x 10 ⁹ PFU) and FK866 (10 mg / kg) IA or IP co-injected. Expression levels of the indicated genes in cartilage tissue were quantified by qRT-PCR ( n = 6). 6g: Ad-C or Ad- EPas1 (1 x 10 ⁹ PFU) was injected into mice and IA co-injected with FK866 (10 mg / kg). Synovial inflammation was detected by saffranin-O and hematoxylin staining ( n = 10). The measurements are presented as means ± standard error ( ^* P <0.01, ^** P <0.001; NS, not statistically significant). Size bar: 100 μm.
FIGS. 7A-7E are results showing that HIF-2? -Induced Nampt expression increases SIRT1 without increasing NAD ⁺ levels and deacetylating HIF-2 ?. Figures 7a and 7d show the presence or absence of neutralizing antibodies (Ab) FK866 (100 μM), EX527 (100 μM) or nicotinamide (NIC; 15 mM) against eNampt (5 μg / ml) for 36 hours in the absence of cartilage cells were infected with Ad-C (MOI 800) or the indicated MOI Ad- Nampt or Ad- EPas1 of, a NAD ⁺ level (Fig. 7a) and SirT1 activity (Fig. 7d) 6 independent The results are shown in Fig. The measurements are presented as means ± standard error ( ^* P <0.01, ^** P <0.001; NS, not statistically significant). Figures 7b and 7c: Ad-C (800 MOIs) in the presence or absence of untreated (none) or FK866 (100 μM) or neutralizing antibody (Ab; 5 μg / ml) against eNampt in primary cultures of chondrocytes ) Or Ad- Nampt (Figure 7b) or Ad- EPasl (Figure 7c) of the indicated MOI for 36 hours. Total NAD (NAD ⁺ and NADH) levels were measured ( n = 6). Measurements are presented as mean ± standard error ( ^* P <0.001, ^** P <0.0001; NS, not statistically significant). Figure 7e: it does not process the cartilage cells (none), Ad-C ( 800 MOI) or to infection by Ad- EPas1 of the indicated MOI or Ad-Nampt (800 MOI) with co-infected. (100 μM), nicotinamide (NIC; 5 mM), resveratrol (Res; 100 μM) or MG132 (MG; 1 μM) for the final 8 hours of culture. At 36 hours after infection, HIF-2α was immunoprecipitated and HIF-2α and acetylated HIF-2α were detected by Western blotting. The arrow indicates the size of HIF-2α.
Figures 8a-8k show that the Nampt / SirT1 pathway regulates the stability and transcriptional activity of HIF-2 alpha, which is the result of proteasome degradation of HIF-2 alpha in chondrocytes. 8a and 8b: Chondrocytes were infected with Ad-C or Ad- EPas1 in the presence of FK866, EX527, nicotinamide (NIC) or resveratrol (Res). HIF-2 alpha reporter gene activity was measured at 36 hours post-infection ( n = 6) (Fig. 8A). Epas1 expression and HIF-2 alpha protein levels were determined by RT-PCR and Western blotting, respectively ( n = 6) (Fig. 8b). The measurements are presented as mean ± standard error ( ^* P <0.0005, ^** P <0.00005). 8c: MG132 at the indicated concentration in chondrocytes was treated for 8 hours. HIF-1 was detected by Western blotting. HIF-2? Was not detected under these conditions. 8d: Chondrocyte cells were either untreated (none) or infected with Ad-C or Ad- EPas1 (800 MOI) for 36 hours. MG132 was added during the last 8 hours of incubation. HIF-2? Was detected by Western blotting. 8e and 8h: either untreated or chondrocytes were infected with Ad-C or Ad- EPas1 (800 MOI) and then cultured for 48 hours in the presence of FK866 or nicotinamide (NIC). MG132 was added during the last 8 hours of culture (Figure 8e). DMOG was treated for 48 hours to inhibit hydroxylase activity (Figure 8h). Epas1 expression and HIF-2α protein levels were detected by RT-PCR and Western blotting, respectively. Fig. 8f: Chondrocyte cells were either untreated (none) or infected with Ad-C or Ad- EPasl (800 MOI) for 36 hours in the presence of EX527, FK866 or nicotinamide (NIC). MG132 or PS-341 were treated for the last 8 hours of cell culture. Epas1 and HIF-2? Were detected by RT-PCR and Western blotting, respectively. 8g: Infected with Ad-C or Ad- EPas1 (800 MOI) for 16 hours in untreated chondrocytes (none) or in the presence or absence of FK866 or nicotinamide (NIC). The cells were further treated with MG132 for 8 hours. HIF-2α and ubiquitinated HIF-2α (Ub) were detected by Western blotting against HIF-2α immunoprecipitates. The results presented are representative of five independent experiments. Figures 8i-8k show the results of control of HIF-2 alpha degradation by prolyl-4-hydroxylase (PHD). 8i: Chondrocyte cells were infected with Ad-C (800 MOI) or Ad- EPasl (800 MOI) for 48 hours in the absence of (none) or in the presence of EX527 (100 μM). DMOG was added to inhibit hydroxylase activity. Epas1 and HIF-2? Were detected by RT-PCR and Western blotting, respectively. 8j: Chondrocyte cells were either untreated (none) or infected with Ad-C (800 MOI) or Ad- EPas1 at indicated concentrations for 24 hours. Relative expression levels of PHD isoforms were determined by RT-PCR ( n = 8). Measurements are presented as means ± standard error ( ^* P <0.001; NS, not statistically significant). 8k: Chondrocyte cells were either untreated (none) or infected with Ad-C (800 MOI) or Ad- EPas1 (800 MOI) and incubated with FK866 (100 μM), nicotinamide (NIC; 15 mM) or EX527 ) For 24 hours. PHD2 was detected by Western blotting. ERK was used as a loading control.
Figures 9a-9g are results showing that SirT1 activity is required for the OA outbreak process induced by Ad- Nampt or Ad- EPas1 . 9a: Ad-C, Ad- EPas1 or Ad- Nampt (1 x 10 ⁹ PFU) was injected into the mice in the presence or absence of EX527 (1.25 mg / kg). Cartilage tissue destruction was detected by saffranin-O staining and quantified by the Mankins method ( n > 12). The measurements are presented as means ± standard error ( ^** P <0.01, ^** P <0.001). 9b: In the presence of the indicated concentration of EX527, primary cultured chondrocytes were either untreated or infected with Ad-C, Ad- Nampt or Ad- EPas1 (800 MOI). Expression levels of the indicated genes were quantified by qRT-PCR ( n = 6). The measurements are presented as means ± standard error ( ^** P <0.01, ^** P <0.001). Figure 9c shows the results showing that SirTl activity modulates the expression of catabolic factors in OA cartilage tissue. Ad-C, Ad- EPas1 or Ad- Nampt (1 x 10 ⁹ PFU) was injected into the mice in the presence or absence of EX527 (1.25 mg / kg). The indicated proteins were detected by immunostaining of cartilaginous tissue sections ( n > 6). Size bar: 100 μm. Figures 9d-9e are results showing that IA injection of nicotinamide inhibits the OA outbreak process induced by Ad- Nampt or Ad- EPas1 . 9d: mice were injected with IA with Ad-C, Ad- EPas1 or Ad- Nampt (1 x 10 ⁹ PFU) in the presence or absence of nicotinamide (NIC; 300 mg / kg). Cartilage tissue destruction was detected by saffranin-O staining and scored by the Mankins method ( n > 12). 9e: Ad-C (800 MOI), Ad- EPas1 (800 MOI) or Ad- Nampt (800) were administered to the mice in the absence or in the presence or absence of the indicated concentrations of nicotinamide MOI). Expression levels of the indicated genes were quantified by qRT-PCR ( n = 6). The measurements are presented as mean ± standard error ( ^* P <0.01, ^** P <0.001). Size bar: 100 μm. Figure 9f shows that inhibition of SirT1 activity blocks synovitis caused by IA injection of Ad- EPas1 or Ad- Nampt . Ad-C, Ad- EPas1 or Ad- Nampt (1 x 10 ⁹ PFU) was injected in the presence or absence of nicotinamide (NIC; 300 mg / kg) or EX527 (1.25 mg / kg) in mice . Synovial inflammation was detected and quantified by saffranin-O and hematoxylin staining ( n = 10). The measurements are presented as mean ± standard error ( ^* P <0.001). Size bar: 100 μm. Figure 9g is a graphical representation of reciprocal control of OA outbreaks by HIF-2 alpha and Nampt / NAD ⁺ / SirT1 pathways. The measurements are presented as means ± standard error ( ^** P <0.01, ^** P <0.001). Size bar: 100 μm.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Human OA cartilage tissue

Human OA cartilage tissue was obtained from individuals who underwent arthroplasty (aged 51 to 72 years) (3, 7, 8). The use of these substances was approved by the Institutional Review Board (IRB) of Wonkwang University Hospital and all individuals provided full written informed consent.

Mouse and experimental OA

Male mice (C57BL / 6, STR / ort, CBA / CaCrl, Col2a1-Nampt TG, Epasl ^+/- or Epasl ^{fl / fl} ; Col2a1-Cre ) were used in the experimental OA studies of the present invention. Chondrocyte-specific Nampt TG (Col2a1-Nampt) mice were produced by using a Col2a1 promoter and enhancer, was prepared by Col2a1-Epas1 TG mice as in the previous bar (3, 40) as described in FIG using a Col2a1 promoter and enhancer . Epas1 ^+/- mice, Epas1 ^{fl / fl} mice and Col2a1-Cre TG mice were obtained from Jackson Laboratories. Chondrocyte-specific CKO mice ( Epas1 ^{fl / fl} ; Col2a1-Cre ) were prepared as previously described (7). Animals were kept under pathogen-free conditions. All experiments were approved by the animal care and use committee of the Gwangju Institute of Ginseng. Spontaneous OA in STR / ort mice (53), Epas1 TG mice (3) and Nampt TG mice were investigated at 28, 45 and 55 weeks, respectively. Experimental OA was induced by DMM surgery and sham operation was performed as a control (3, 53). In addition, mice were injected intraperitoneally (IP) with FK886 (10 mg / kg) once every three days and sacrificed at 8 weeks after DMM surgery for histological and biochemical analysis. Experimental OA was induced by intra-articular injection (IA) for 3 weeks once a week with Ad- Nampt or Ad- EPas1 (1 x 10 ⁹ PFUs in a total volume of 10 l) to male mice 10 to 12 weeks old (3, 7, 8, 40): IA infusion of co-vector adenovirus (Ad-C) was used as a control. Mice were sacrificed 21 days after the first IA injection for histological and biochemical analysis.

Histology and Immunohistochemical Analysis

The lyophilized human OA cartilage tissue was sectioned into 6-μm thickness and fixed to paraformaldehyde. Sulfate proteoglycan was detected by alcian blue staining. Human NAMPT was detected by immunostaining with antibodies purchased from Adipogen. Mouse cartilage tissue destruction was scored with the safranin-O stain and the Mankin's method. Briefly, the knee joint tissue was fixed in 4% paraformaldehyde and calcium was removed with 0.5 M EDTA and then embedded in paraffin. The paraffin block was sectioned to a thickness of 6-μm. Serial sections were obtained from whole joints at 70-μm intervals. The sections were deparaffinized with xylenes, hydrated with graded ethanol and stained with sapranin-O. Cartilage tissue destruction was scored by blinded observers using the Mankins method (3, 40). Synovitis was quantitated according to the previously described method (40) by irradiation with saffranin-O and hematoxylin staining. HIF-2α and Nampt in mouse cartilage tissues were detected by immunostaining using antibodies purchased from Abcam and Adipogen, respectively. According to the previously described method (3, 40), synovitis was examined by sapranin-O and hematoxylin staining.

Primary culture of articular chondrocytes

WT, TG and KO mouse-derived articular cartilage tissues were obtained from the femoral heads, femoral condyles and tibial plateaus of mice 5 days after birth and chondrocytes were isolated (3, 40). Chondrocyte cells were maintained in a monolayer in DMEM (Dulbecco's Modified Eagle's Medium) and were treated at day 3 of cultured cells as indicated in each experiment.

Adenovirus, chondrocyte infections and IA infusion

Adenovirus expressing mouse Epas1 (Ad- EPas1 ) was prepared as previously described (3, 7, 8). Ad- Nampt was constructed by inserting mouse Nampt cDNA into the Not I site of the pShuttle-CMV vector. Ad- Nampt was manufactured in Surin Bioscience using the pAdEasy system (QBiogene). The mouse articular chondrocytes were cultured for 3 days and infected with the indicated vector multiplicity of infection (MOI) of co-vector virus (Ad-C), Ad- Nampt , or Ad- EPas1 for 3 hours and then the presence or absence of the pharmacological agent &Lt; / RTI &gt; Ad- Nampt , Ad- EPas1 , Ad- Gfp or Ad-C (1 x 10 ⁹ PFU) were injected into the mouse knee joint for 3 weeks, once a week, for IA infusion of adenovirus. The mice were IA co-injected with 5 μl (v / v) of FK866 (10 mg / kg body weight), EX527 (1.25 mg / kg body weight) or nicotinamide (300 mg / kg body weight).

Reverse transcription-polymerase chain reaction (RT-PCR), quantitative RT-PCR (qRT-PCR) and siRNA

Total RNA was extracted from primary cultured chondrocytes using TRI reagent (Molecular Research Center Inc.). In the case of cartilage tissue, knee joints of WT, TG or KO mouse were obtained by DMM surgery to remove cartilage tissue or by scraping with a blade after adenovirus injection and then extracted with TRI reagent. The cDNA obtained by reverse transcription of the RNA was amplified by PCR. PCR primers and experimental conditions are summarized in Table 1.

PCR primer sequences and conditions. gene piece Sequences (5 '-> 3') Size (bp) AT (占 폚) origin Acan S
AS GAAGACGACATCACCATCCCAG
CTGTCTTTGTCACCCACACATG 581 55 mouse Adamts4 S
AS CATCCGAAACCCTGTCAACTTG
GCCCATCATCTTCCACAATAGC 281 58 mouse Adamts5 S
AS GCCATTGTAATAACCCTGCACC
TCAGTCCCATCCGTAACCTTTG 292 58 mouse Adipoq S
AS TCTTAATCCTGCCCAGTCATGC
TGCTGCCGTCATAATGATTCTG 420 58 mouse Col2a1 S
AS CACACTGGTAAGTGGGGCAAGA
GGATTGTGTTGTTTCAGGGTTCG 173 55 mouse Epas1 S
AS CGAGAAGAACGACGTGGTGTTC
GTGAAGGCGGGCAGGCTCC 370 62 mouse Gapdh S
AS TCACTGCCACCCAGAAGAC
TGTAGGCCATGAGGTCCAC 450 62 mouse Lep S
AS CCAAAACCCTCATCAAGACC
ATCCAACTGTTGAAGAATGTCC 395 58 mouse Nampt S
AS ACAGATACTGTGGCGGGATTG
TGATATCCACGCCATCTCCTTG 424 58 mouse NAMPT S
AS GAACAGGATCTTTCGTTCCATA
TTCCTGAGGGCTTTGTCATTCC 357 58 human Nampt # 1
(ChIP) S
AS GGTGACGGTCGGCTTTAGGC
CTGCGCGTGCGCAGCGCAGG 120 58 mouse Nampt # 2
(ChIP) S
AS GTGGGTGGCTCCTTGGCCTTAG
CCGCCCCAACCCGGACCTTCCT 100 58 mouse Nampt # 3
(ChIP) S
AS GAGGATCGGAATCCACAAGACG
ACCCACTGTCGTCTCCCTGTTC 100 58 mouse Nampt
Promoter S
AS CGCATAAAACAGCCTAAAATGG
CTCGGCCCGGACCGGAGACGCCG 1,230 55 mouse Nampt
TG S
AS ATAAGAATGCGGCCGCATGAATGCTGCTGCGGCAGAAGCCGAGA
ATAAGAATGCGGCCGCCGCCTAATGAGGTGCCACGTCCTGC 1,476 55 mouse Mmp2 S
AS CCAACTACGATGATGAC
ACCAGTGTCAGTATCAG 233 60 mouse Mmp3 S
AS TCCTGATGTTGGTGGCTTCAG
TGTCTTGGCAAATCCGGTGTA 102 55 mouse Mmp9 S
AS ACCACATCGAACTTCGA
CGACCATACAGATACTG 212 58 mouse Mmp12 S
AS CCCAGAGGTCAAGATGGATG
GGCTCCATAGAGGGACTGAA 482 60 mouse Mmp13 S
AS TGATGGACCTTCTGGTCTTCTGG
CATCCACATGGTTGGGAAGTTCT 473 55 mouse Mmp14 S
AS GTGCCCTAGGCCTACATCCG
TTGGGTATCCATCCATCACT 580 55 mouse Mmp15 S
AS GAGAGATGTTTGTGTTCAAGGG
TGTGTCAATGCGGTCATAGGG 260 62 mouse Retn S
AS TTCTTCCTTGTCCCTGAACTG
TGTCCAGTCTATCCTTGCACAC 276 58 mouse Egln1
(PHD2) S
AS TTGAAGCTGGCTCTGGAGTACATC
ACAGCAGTCTATCAAATTTGGGTTC 523 64 mouse Egln2
(PHD1) S
AS CTGGGCAACTACGTCATCAATGG
TTGGCTGTGATACTGGTACTTGAAC 400 64 mouse Egln3
(PHD3) S
AS GGCTTCTGCTACCTGGACAACTTC
GATGAGGGACAGGAGGAAGTTGATG 216 64 mouse

Abbreviation: AT, annealing temperature; S, sense; And AS, antisense.

Transcript levels were quantified using qRT-PCR. SiRNA sequences that most effectively knock-down HIF-2 alpha or Nampt were used in this study and are shown in Table 2 below.

siRNA sequence. target piece Sequences (5 '-> 3') Control group
siRNA S
AS CCUACGCCACCAAUUUCGU
ACGAAAUUGGUGGCGUAGG Epas1 S
AS CUCAGUUACAGCCACAUCGUCACUG
CAGUGACGAUGUGGCUGUAACUGAG Nampt S
AS UUCUCAAGGAUGUAGUUCCAUCCUC
GAGGAUGGAACUACAUCCUUGAGAA

Abbreviation: S, Sense; And AS, antisense

Non-targeting (scrambled) siRNA was used as a negative control. Chondrocyte cells were transfected with siRNA and lipofectamine 2000 (Invitrogen) for 6 hours according to the manufacturer's instructions or infected with adenovirus as described above.

Immunoprecipitation, Western blotting and immunofluorescence microscopy analysis

Total cell lysates were prepared using lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris, 5 mM NaF) and were used to detect intracellular proteins such as iNampt and PHD2. Secreted proteins (eNampt, Mmp3, Mmp12, and Mmp13) were detected after precipitating TCA (trichloroacetic acid) in a 900 μl serum-free conditioned medium. For western blotting of HIF-2 alpha, nuclear lamin, histone H3 and acetylated-lysine, the cell lysate was eluted using the lysis buffer additionally containing 0.5% sodium deoxycholate . All lysis buffers contained cocktails of protease inhibitors and phosphatase inhibitors (Roche). In the case of Western blotting of acetylated proteins, deacetylase inhibitors (5 [mu] M tricostatin A and 5 mM nicotinamide) were also included in lysis buffers. The information on the antibodies is summarized in Table 3 below.

Antibodies and sources. Antibody specificity antigen production Usage sauce Acetylated-Lysine Synthetic peptide Rabbit WB Cell Signaling ERK Rat recombination mouse WB BD Transduction Lab HIF-2? Human recombination mouse WB Santa Cruz Biotechnology HIF-2? Mouse peptide rabbit IP Novus Biological HIF-2? Human recombination mouse IH, IF Abcam Lamin B Human peptide Goat WB Santa Cruz Biotechnology Nampt Human recombination mouse WB, IH Adipogen Nampt Mouse recombination rabbit Neutralization Bio Vision Mmp3 Human peptide rabbit WB Epitomics Mmp12 Human peptide rabbit WB Epitomics Mmp13 Human peptide rabbit WB Epitomics PHD2 Human peptide rabbit WB Cell Signaling Ubiquitin Soviaticin mouse WB Cell Signaling

The acetylation status of HIF-2α was detected using immunoprecipitated HIF-2α. Nuclear proteins were extracted using a nuclear protein extraction kit (NE-PER Nuclear and Cytoplasmic Extraction Reagents; Thermo Scientific). The extract was reacted with anti-HIF-2? Antibody (Novus Biologicals) at 4 占 폚 for 12 hours and precipitated with Dynabeads Protein G (Invitrogen). Aliquots were immunoblotted against HIF-2α and acetyl lysine. To detect ubiquitinated HIF-2 alpha, the cells were lysed in lysis buffer supplemented with 0.5% sodium deoxycholate and 10 mM N-ethylmaleimide to inhibit ubiquitin-conjugating enzymes (150 mM NaCl, 1% NP-40, 50 mM Tris, 5 mM NaF). HIF-2α was immunoprecipitated from a total of 200 μg of cell lysate. After electrophoresis, the nitrocellulose membrane onto which the protein was transferred was washed with denaturing buffer (6 M guanidine-HCl, 20 mM Tris-HCl, pH 7.5, 5 mM? -Mercaptoethanol, 1 mM PMSF) After reacting at 4 ° C for 30 minutes, the antibodies were used to detect HIF-2α and ubiquitin.

Cloning, reporter gene assay, promoter binding assay and ChIP assay

Expression vectors for Epas1 and dominant-negative Epas1 (dn Epas1 ) were prepared as previously described (3). The Nampt promoter region was cloned using a primer specific for the genomic DNA of C57BL / 6 mice (Table 1). The amplified products were inserted into the pGL3 vector (Promega), and the reporter gene activity was assayed as previously described (3). The HIF-2 alpha binding site (CGTG) in the Nampt promoter was mutated to 'AAAG' using a locus-designated mutagenic kit (iNtRON Biotech) and the reporter gene activity of the mutant promoter was compared to the activity of the WT reporter gene. The HIF-2alpha reporter gene was constructed into a pGL3 vector by inserting four repeating sequences (tandem repeats: 5'-GATCGCCCTA CGTG CTGTCTCA-3 ') in the upstream region of the SV40 promoter. HIF-2 alpha reporter gene (1 μg) and β-galactosidase expression vector (0.1 μg) were transfected into chondrocytes using lipofectamine 2000 (Invitrogen) for 3 hours. Transfected cells were infected with Ad- EPas1 for 3 hours and treated with indicated concentrations of FK866 (Cayman), EX527 (Sigma), nicotinamide (Sigma) or resveratrol (Sigma). Cells were obtained after 36 hours of treatment and expressed as relative beta -galactosidase activity to measure luciferase activity and normalize transfection efficiency. ChIP assays of mouse articular cartilage cells treated with IL-1β or infected with 800 MOI of Ad- EPas1 were performed using a kit (Millipore) as previously described (7, 8). ChIP-assemble primers were designed to amplify three different HRE-containing regions of the Nampt promoter (Table 1).

NAD production and SirT1 activation assay

Intracellular NAD ⁺ and total NAD (NAD ⁺ and NADH) levels were measured using an NAD / NADH quantitation kit (BioVision Inc). Briefly, chondrocyte cells were extracted through two cycles of freezing / thawing in NAD / NADH extraction buffer, and the total extract was filtered with a 10-kDa cutoff filter. Half of the lysate was used to determine the total NAD concentration and the other half was heated to 60 占 폚 for 30 minutes to measure the NADH concentration. The reactions were performed in 96-well plates and read at 450 nm. The NAD ⁺ concentration was determined by subtracting the NADH concentration from the total NAD concentration.

SirTl activity was measured using a fluorescence assay kit (Sigma CS1040) according to the manufacturer's instructions. Briefly, whole-cell extracts were resuspended in 1 ml of trichostatin A, 10 mM DTT (dithiothreitol), and in lysis buffer (20 mM Tris-HCl, pH 8.0; 100 mM NaCl, 1 mM) supplemented with phosphatase and protease inhibitors mM EDTA, and 0.5% NP-40). The lysate (20 μl) was reacted with an equal amount of acetylated Fluor-de-Lys substrate at 37 ° C for 1 hour and the developing solution (5 μl) was added to stop the reaction. Fluorescence intensity was measured at 450 nm using a fluorescence plate reader (Spectramax Gemini XS, Molecular Devices) after excitation at 355 nm. Each value was normalized according to the amount of protein (μg).

Enzyme-linked immunosorbent assay (ELISA)

The amount of Nampt produced was quantitated using a mouse Nampt ELISA kit (Adipogen). Briefly, mouse articular cartilage cells did not infect or infect with Ad-C or Ad- Nampt . After incubation for 36 hours, the amount of iNampt was measured in whole-cell lysates according to the manufacturer's instructions, and eNampt was measured in the culture supernatant.

Statistical analysis

Quantified data based on an ordinal grade system such as the Mankin score were analyzed using non-parametric statistical methods. QRT-PCR data, represented by relative fold changes, were first identified using a Shapiro-Wilk test, followed by pair-wise comparisons and multi- ANOVA (analysis of variance) including Student's t-test and post hoc test was used for each test. Statistically significant significance was accepted at a 0.05 level of probability (P <0.05).

Experiment result

HIF-2? Targets the Nampt gene directly in mouse articular cartilage cells and up-regulates its expression

Screening of HIF-2? Target genes using microarray in chondrocytes infected with adenovirus (Ad- EPas1 ) containing Epas1 showed different expression control of adipokines : uptake of Nampt (visfatin) - upregulation and down -regulation of Adipoq (adiponectin), Retn (resistin) and Lep (leptin) (FIGS. 1a and 1b). In addition, different modulation of adipocyte expression was also confirmed in primary cultured chondrocytes infected with Ad- EPasl at transcript and / or protein levels (Figures Ia-Ic). Of the adipocytes identified through microarray, the present inventors focused on the possible function of Nampt (positively regulated by HIF-2 alpha) in the regulation of OA pathogenesis.

First, we examined whether the Nampt gene is a direct target of HIF-2α through a chromatin immunoprecipitation (ChIP) assay and a reporter gene assay using the 1,208 bp mouse Nampt promoter construct . The promoter of mouse Nampt contains three HIF-2 alpha binding sites (CGTG; 38) at positions -89, -309 and -361 from the transcription start point. The ChIP assay identified the proximal site (-89 position) -binding HIF-2 alpha (FIG. 1d). Transfection with the Epas1 expression vector stimulated the transcriptional activity of the Nampt promoter, but the effect was inhibited by co-transfection of dominant-recessive (Δ) Epas1 (3, 39; Mutation of the proximal HIF-2 alpha position (-89 position) (mutation to the AAAG sequence of the CGTG sequence) but not other HIF-2 alpha binding sites (positions -309 and -361) resulted in inhibition of reporter gene activity ). Taken together, the above results show that the Nampt gene is a direct target of HIF-2α in chondrocytes.

Nampt is required for HIF-2? -Induced expression of Mmp3, Mmp12 and Mmp13

Next, we examined the possible function of Nampt in the expression of matrix-degrading enzymes in primary cultured articular cartilage cells. Overexpression of Nampt due to Ad- Nampt infection caused significant up-regulation of Mmp3, Mmp12 and Mmp13 expression at both mRNA and protein levels (Fig. 2a). Since Ad- Nampt infection up-regulates both iNampt and eNampt (Figure 1c), we used an enzyme-linked immunosorbent assay (ELISA) to explain the importance of iNampt and eNampt activity on MMP expression Nampt yield was quantified. iNampt production was 5.6-fold higher than eNampt production in untreated chondrocytes and 2-fold higher in Ad- Nampt -infected cells (Fig. 2b). The importance of iNampt in MMP expression was analyzed through the inhibition of iNampt enzyme activity by the non-competitive inhibitor FK866 (18). FK866 markedly blocked Ad- Nampt -induced up-regulation of Mmp3, Mmp12 and Mmp13 (Figure 2c). eNampt activity was investigated by treating recombinant mouse Nampt protein (rNampt) on cartilage cells. rNampt stimulated the expression of Mmp3, Mmp12 and Mmp13 in chondrocytes, albeit less than Ad- Nampt infection (Fig. 2d). Furthermore, HIF-2? -Induced Mmp3, Mmp12 and Mmp13 expression was markedly blocked by knockdown of siRNA-mediated Nampt or inhibition of iNampt enzyme activity by FK866 (FIG. 2e). As a result, our results indicate that Nampt promotes up-regulation of Mmp3, Mmp12 and Mmp13 in chondrocytes as an activity required for HIF-2? -Induced expression of lysing enzymes.

In OA cartilage tissue, Nampt expression is regulated by HIF-2α

The activity of Nampt, which promotes the expression of catabolic factors, implies that Nampt performs a catabolic role in the pathogenesis of OA. Thus, we examined the mRNA and protein levels of Nampt in human OA cartilage tissue and mouse model to first determine whether Nampt functions in OA cartilage tissue destruction in In vivo . Damage to OA-affected human cartilage tissue was confirmed by alcian blue staining (Fig. 3a). NAMPT mRNA and protein were significantly increased in OA-induced human cartilage tissue, but were almost undetectable in uninjured areas of arthritic cartilage tissue (Fig. 3a). In addition, Nampt mRNA and protein levels were also increased in the mouse OA model. For example, the mouse OA model can be used for DMM surgery compared to STR / ort mouse OA cartilage tissue (FIG. 3b) and normal cartilage tissue in sham-operated mice compared to normal cartilage tissue of CBA control mice OA &lt; / RTI &gt; cartilage tissue (FIG. Because OA cartilage tissue in both the human and mouse models exhibits increased expression of HIF-2? (3, 7, 8), the inventors have determined whether the increase in Nampt level in OA cartilage tissue is mediated by HIF-2? Respectively. Overexpression of HIF-2α by IA (intra-articular) injection of Ad-EPas1 in articular cartilage tissue increased Nampt expression along with OA cartilage tissue destruction (FIG. 4A). In addition, DMM-induced Nampt up-regulation and OA cartilage tissue destruction were markedly blocked in chondrocyte-specific Epas1 CKO ( Epasl ^{fl / fl} ; Col2a1-Cre ) mice (Fig. 4b and Fig. 4c). Thus, the above results show that Nampt expression in chondrocytes of OA cartilage tissue is regulated by HIF-2α.

Nampt causes experimental OA in mice

The role of Nampt in OA cartilage tissue destruction was directly investigated by IA injection of Ad- Nampt into the mouse knee joint. Consistent with our previous results (3, 7, 8, 40), Ad- Nampt infusion resulted in overexpression of Nampt in articular cartilage, meniscus and synovium And Figure 5b). Gene delivery by IA injection of adenovirus was confirmed by injecting Ad- Gfp and showed up to about 50% of cartilage cell infection efficiency (FIG. 5c). IA injection of Ad- Nampt triggered cartilage tissue destruction, as confirmed by the saffranin- O stain and Mankins score data (Fig. 5A). The cartilage tissue of Ad- Nampt -injected mice markedly increased the mRNA levels of the Mpt3, Mmp12 and Mmp13 targets of the Nampt targeting agents (Fig. 5d). In addition, Nampt overexpression in synovial membrane resulted in synovitis (Figure 2e).

In the OA outbreak, the in vivo role of Nampt was further confirmed by producing chondrocyte-specific Col2a1-Nampt TG mice using the promoter and enhancer region of mouse Col2a1 (3, 40). The mice exhibited normal skeletal development (no results) without signs of synovitis. In contrast to the chondrocytes of WT mice, Nampt TG mouse-derived chondrocytes exhibit an increased expression level of Nampt and are associated with a significantly increased level of Nampt target genes Mmp3, Mmp12 and Mmp13 as well as the non-target gene Mmp9 Expression levels (Figure 5f). In this context, Col2a1-Nampt TG mice showed a marked increase in OA cartilage tissue destruction following DMM surgery compared to WT littermates (Figure 5g). Moreover, as can be seen from the saffranin- O staining and Mankins score data, 12-month - old Col2a1-Nampt TG mice exhibited spontaneous cartilage tissue destruction compared to WT mice of the same age (Fig. 5h). Thus, our Namct-gain-of-function studies show that Nampt up-regulates matrix-degrading enzymes in chondrocytes, which is an important catabolic regulator of OA pathogenesis.

Nampt is required for the onset of HIF-2α-induced experimental OA

Because iNampt enzyme activity is required for the expression of the transcription factor in cartilage cells, we investigated whether iNampt regulates the onset of OA using the noncompetitive inhibitor FK866. As can be seen from the saffranin-O staining and Mankins score data, both IP (intra-peritoneal) and IA injection of FK866 specifically inhibited cartilage tissue destruction induced by Ad- Nampt infusion (Fig. 6A) MMP3, Mmp12, and Mmp13, which are targets of Nampt genes (Fig. 6B). In addition, administration of FK866 by IP injection inhibited DMM-induced cartilage tissue destruction (Fig. 6c) and inhibited the up-regulation of Nampt target genes (Fig. 6d). Finally, IP and IA infusion of FK866 markedly blocked the expression of Mmp3, Mmp9, Mmp12 and Mmp13 in Ad- EPas1 -induced cartilage tissue destruction and cartilage tissue (FIGS. 6E and 6F). In addition, synovitis caused by Ad- EPas1 or Ad- Nampt infusion was clearly blocked by IA co-injection of FK866 (Fig. 6g). However, knockdown of Epas1 or Epas1 ^{fl / fl in} Epas1 ^+/- heterozygous mice; Cartilage tissue-specific Epas1 CKO in Col2a1-Cre mice did not affect cartilage tissue destruction induced by Ad- Nampt injection (results not shown). The results are consistent with the hypothesis that Nampt is downstream of HIF-2 ?. Taken together, the above results indicate that iNampt enzyme activity is essential for the OA outbreak process induced by DMM surgery or IA injection of Ad- Nampt or Ad- EPas1 .

Nampt does not regulate HIF-2? Deacetylation but activates SirT1

Since iNampt enzyme activity induces NAD ⁺ production, which leads to the activation of SirT1 (10, 25), the inventors have found that Nampt and HIF-2α induce SirT1 activation by modulating NAD ⁺ synthesis in articular cartilage cells .

Overexpression of Nampt or HIF-2 alpha in cartilage cells due to adenovirus infection resulted in a significant increase in NAD ⁺ (Fig. 7a) and total NAD levels (Fig. 7b and Fig. 7c). NAD ⁺ levels were markedly reduced through inhibition of iNampt by FK866, whereas neutralization of eNampt with antibodies did not affect NAD ⁺ levels (FIG. 7A). As expected, overexpression of Nampt or HIF-2 alpha in cartilage cells promoted SirTl activity as confirmed using the SirTl fluorescence assay kit, and SirTl -specific deacetylase activity was inhibited by FK866, EX527 and nicotinamide ( 41), using inhibitors of Nampt or SirTl (Fig. 7d). SirT1 is known to deacetylate HIF-2α and stimulate the transcriptional activity of HIF-2α in hypoxic Hep3B and HEK293 cells (36, 37). Based on this, the present inventors investigated whether SirTl activated in chondrocytes regulates deacetylation of HIF-2 ?. However, the present inventors found no evidence for changes in the HIF-2? Acetylation state under the condition of HIF-2? Overexpression in the presence or absence of Nampt or SirT1 inhibitors / activators (FIG. 7e) . Thus, our results suggest that Nampt activates SirT1 in articular cartilage cells by inducing NAD ⁺ production without regulating HIF-2? Acetylation status.

Nampt and SirT1 regulate the stability and transcriptional activity of the HIF-2 alpha protein

Although the acetylation status of HIF-2α is not regulated by SirT1, the HIF-2α reporter gene assay results show that HIF-2α transcriptional activity is markedly reduced by inhibition of Nampt (FK866) or SirT1 (EX527, nicotinamide) While SirTl activation by resveratrol was shown to increase HIF-2 alpha transcriptional activity (Fig. 8A). Regulation of HIF-2α transcriptional activity by Nampt or SirT1 was associated with HIF-2α protein levels: inhibition of Nampt or SirT1 reduced HIF-2α protein levels, whereas activation of SirT1 reduced HIF-2α protein levels (Fig. 8B). To characterize the mechanisms involved in regulating HIF-2 alpha protein levels, the inventors first investigated the proteasomal degradation pathway. Inhibition of the 26S proteasome pathway through MG132 treatment caused accumulation of HIF-1 in chondrocytes but did not result in accumulation of HIF-2 (Fig. 8c). However, HIF-2 alpha overexpressed by Ad- EPas1 infection was regulated by proteasome degradation pathways (Figure 8d). Inhibition of the 26S proteasome pathway by MG132 or PS-341 treatment inhibited the reduction of HIF-2 alpha protein levels caused by the inhibition of Nampt or SirT1 (Fig. 8E and Fig. 8F). In addition, HIF-2 alpha was ubiquitinated and this effect was additionally increased by inhibition of Nampt by FK866 or inhibition of SirT1 by nicotinamide (Fig. 8g). The above results are consistent with the observed HIF-2 alpha protein levels (Figures 8e and 8f).

HIF-2α proteasome degradation is regulated by the prolyl-4-hydroxylase domain (PHD) protein (5), which hydrolyzes HIF-2α and induces ubiquitination. Consistently, inhibition of hydroxylase activity by DMOX (dimethyloxalylglycine) treatment restored HIF-2α protein levels reduced by inhibition of Nampt or SirT1 (FIGS. 8h and 8i). To identify PHD isoforms responsible for hydroxylation of HIF-2 alpha in primary cultured chondrocytes, we investigated the relative expression levels of PHD isoforms through qRT-PCR analysis. In unstimulated chondrocytes, Egln1 encoding PHD2 was the most abundant isoform, while Egln3 encoding PHD3 was the least abundant isoform. HIF-2? Overexpression by Ad- EPas1 infection did not regulate the expression of Egln2 encoding PHD1. However, Egln1 (PHD2) expression was slightly increased by HIF-2α overexpression, and Egln3 (PHD3) expression was significantly increased (FIG. 8j). Increased expression of Egln3 (PHD3) induced by HIF-2α overexpression is consistent with previous reports describing negative feedback regulation of the proteasome degradation process of HIF- (43, 44). It has also been reported that PHD2 is the major isoform that regulates HIF-2α hydroxylation during proteasome degradation (44, 45). Thus, we examined the level of PHD2 protein using Western blotting, where the PHD2 protein level was increased through inhibition of Nampt by FK866 or inhibition of SirT1 by nicotinamide or EX527 (FIG. 8k). Consistent with previous reports (44, 45), PHD2 appears to be the predominant isoform of HIF-2α hydrolysis in articular cartilage cells. Taken together, the above results indicate that Nampt and SirT1 activities are required for HIF-2 alpha protein stabilization by negatively regulating HIF-2 alpha hydroxylase activity.

SirT1 activity is required for OA pathogenesis caused by HIF-2 alpha and Nampt

In OA disease process and the importance of Nampt SirT1 control for HIF-2α protein stability and transcriptional activity is Ad- EPas1 - or Ad- Nampt - was monitored by injection - IA co SirT1 inhibitors during the induction process of OA. Similar to inhibition of cartilage tissue destruction by FK866 (Fig. 6), IA infusion of the SirT1 inhibitor EX527 was induced by Ad- EPas1 or Ad- Nampt , as confirmed by the saffranin- O stain and Manckins score Lt; RTI ID = 0.0 &gt; (FIG. 9A). &Lt; / RTI &gt; With consistent results on the role of SirT1 who is responsible for controlling the OA disease process, the primary process the EX527 to cultured chondrocytes to suppress the SirT1 induced by Ad- EPas1 or Ad- Nampt infection matrix-degrading enzyme (Mmp3, Mmp9, Mmp12, Mmp13 and Adamts4) (Fig. 9b). In addition, the increase in Mmp3 and Mmp13 levels induced by Ad- EPas1 or Ad-Nampt in cartilage tissue was inhibited by IA co-injection of EX527 (Fig. 9c). Similar to the process EX527, the nicotinamide IA co-injection also Ad- EPas1 - and Ad- Nampt-hayeoteul as well as significantly block the induced cartilage destruction, matrix was inhibiting the expression of the lyase (FIG. 9d and 9e ). Finally, synovitis induced by Ad- EPas1 or Ad- Nampt infusion was markedly inhibited via nicotinamide or SIRT1 inhibition by EX527 treatment (Fig. 9f).

Additional discussion

Identifying molecular mechanisms that regulate cartilage tissue homeostasis is the main focus of OA research. Catabolic signals involved in the OA outbreak process can be categorized into two major pathways: (a) up-regulation of tissue-destroying enzymes (i. E., Mmp3, Mmp13 and Adamts5); And (b) down-regulation of cartilage tissue ECM (i.e., type II collagen and aggrecan). HIF-2α is a key regulatory factor in the pathogenesis of OA by up-regulating inflammatory and tissue-destroying genes (3). Our findings, which identified essential functions of mutual regulation by HIF-2? And Nampt / NAD ⁺ / SirT1 axes, provide a new understanding of the molecular mechanisms of OA pathogenesis. HIF-2α promotes Nampt expression and SirT1 activation, thus Nampt and SirT1 stimulate HIF-2α protein stability and transcriptional activity. Nampt contributes to the HIF-2α-mediated OA pathogenesis through dual pathways: (a) expression amplification of matrix-degrading enzymes by eNampt activity; And (b) NAD ⁺ synthesis by iNampt activity and promotion of SirT1 activation. Subsequently, SirT1 promotes the stability and transcriptional activity of HIF-2 alpha, thereby amplifying the expression of cingulate factors and the pathogenesis of OA. In conclusion, our results confirm the key role of mutual regulation by the HIF-2α and Nampt / NAD ⁺ / SirT1 pathways as illustrated in FIG. 9g, and consequently the amplification of HIF-2α signaling during OA development It confirms.

First, the present inventors found that the Nampt gene is a direct target of HIF-2? In chondrocytes. Although it is known that HIF-1 directly targets and regulates the expression of Nampt (non- spontaneous ) in hypoxic adipocytes (46) and MCF7 breast cancer cells (47), the role of HIF- Have not been reported. In particular, the inventors have demonstrated that HIF-2 alpha induces Nampt expression in chondrocytes in normoxic conditions. In addition, the present inventors have confirmed that HIF-2 alpha upregulates Nampt in OA cartilage tissue. Furthermore, our results confirmed Nampt as a cognitive regulator of experimental OA in mice, which was demonstrated by overexpression of Nampt in OA cartilage tissue destruction or Ad- Nampt injected joint tissue in Col2a1-Nampt TG mice do. Nampt performs catabolic functions by up-regulating Mmp3, Mmp12, and Mmp13 (48, 49), which function as key effectors in the OA outbreak process. Ad- Nampt or Ad- EPas1 infection caused an increase in both iNampt and eNampt. Moreover, treatment of rNampt resulted in up-regulation of Mmp3, Mmp12 and Mmp13 , which implies that eNampt contributes to MMP expression. INampt enzyme activity also plays an important role in MMP expression, as confirmed by the inhibition of iNampt by FK866, which blocks Nampt -induced expression of matrix-degrading enzymes. In this context, administration of FK866 inhibited experimental OA induced by DMM surgery or injection of Ad- Nampt or Ad- EPas1 in mice . To date, there is no in vivo contribution of Nampt in the OA outbreak, although there are in-vitro studies (21-24) that suggest possible functions of Nampt in OA outbreaks. Thus, our results are the first evidence for the in vivo function of Nampt in the course of OA outbreaks. Unlike Nampt, other adipokines (ie, resistin, adiponectin and leptin) were down-regulated by HIF-2α in chondrocytes. Treatment of Ad- EPas1 -infected chondrocytes with the above-mentioned adipocines did not affect HIF-2? -Induced up-regulation of MMPs (results not shown), indicating that the adipocine down- Lt; / RTI &gt; is not critical for HIF-2? -Induced up-regulation of MMPs.

HIF-2? -Induced MMP expression is dependent on Nampt enzyme activity. However, Nampt overexpression induced MMP expression without modulating HIF-2α expression or transcriptional activity (no results), indicating the presence of Nampt's HIF-2α-independent function in the regulation of MMP expression. In addition, Nampt induced MMP expression through SirT1, as evidenced by the results of blocking Nampt or HIF-2α-induced MMP expression. However, overexpression of SirT1 alone did not induce MMP expression, nor did it regulate the expression of the upstream elements of SirT1, Nampt and HIF-2? (Results not shown). Although SirT1 activity is required for Nampt- or HIF-2? -Induced MMP expression, the above results indicate that overexpression of SirTl alone in the absence of HIF-2? Overexpression is not sufficient to induce MMP expression. In addition, the above results indicate that the SirT1 function is critical only when HIF-2 alpha is overexpressed. Although further studies are needed to account for the SirT1-independent pathway of Nampt regulation on MMP expression, the present inventors have found that pharmacological inhibition of p38 mitogen-activated protein kinase or JNK (C-Jun N-terminal kinase) Found that inhibition of NF-κB or ERF (extracellular-signal regulated kinase) does not regulate MMP expression, while blocking Nampt-induced MMP expression markedly.

iNampt induces NAD ⁺ production, which activates the NAD ⁺ -dependent diacetylase, SirT1 (25, 26). The present inventors have found that overexpression of Nampt or HIF-2 alpha increases NAD ⁺ levels in chondrocytes and thereby induces SirT1 activation. SirT1 deacetylates histones and a variety of transcription factors to regulate target gene expression (26). Of the echogenic signals that regulate the onset of OA in chondrocytes, SirT1 seems to regulate cartilage tissue ECM gene expression, albeit controversial. For example, SirT1 activation inhibits expression of Col2a1 during dedifferentiation of IL 1β-induced chondrocytes (24). In contrast, SirT1 activity is essential for the expression of EC2 genes in the cartilage including Col2a1 through modulation of the transcription factor Sox-9 (33-35), suggesting that SirT1 functioning downstream of Nampt is involved in cartilage tissue- (27, 28), as shown in Fig. The prediction is somewhat contradictory to the proinflammatory and catabolic functions (9-12) of Nampt, the upstream activator of SirTl. Unlike the regulation of cartilage ECM genes, the role of SirT1 in the expression of tissue-destructive enzymes such as MMPs has not been previously reported. In this study, we found that SirTl activity is important for Nampt- and HIF-2? -Induced MMP expression in chondrocytes, even though SirTl alone overexpression does not induce expression of matrix-degrading enzymes. This proves that the treatment of the SirT1 inhibitor almost completely inhibits Nampt- and HIF-2? -Induced MMP expression. These in vitro (ie, primary cultured chondrocytes) catabolic functions of SirT1 are in good agreement with the in vivo function of SirT1 (ie OA cartilage tissue destruction due to increased expression of matrix-degrading enzymes).

Despite numerous in vitro studies, very few studies have suggested SirT1 function in the in vivo OA outbreak process. Along with the expression of MMPs in chondrocytes following stimulation of SirT1 in HIF-2? Signaling, the present inventors have found that SirT1 performs catabolic functions in the course of OA development. The catabolic function of SirT1 is confirmed by the results of pharmacological inhibition of SirT1 activity or inhibition of Nampt, an upstream activator of SirT1, blocking experimental OA induced by DMM surgery or IA injection of Ad- EPas1 or Ad- Nampt in mice do. However, unlike the results of the present inventors, heterozygous SirTl-KO mice ( Sirt1 ^+/- ) have recently been reported to exhibit increased chondrocyte apoptosis and increased OA severity (31). Similarly, mutant mice with variants with SirT1-deficient enzyme activity have damaged cartilage tissue that exhibit increased cartilage degradation rates as they age (50). Discrepancies between the results of the present inventors and the above results obtained using Sirt1 ^+/- and SirTl mutant mice are somewhat contradictory. In this regard, Sirt1 ^+/- and SirTl mutant mice exhibit defects in cartilage tissue and bone development with small skeletal size; Reduction of cartilage tissue in the knee joints, skulls, thorax and vertebrae; And less bone mineralization (31, 50). The above-described phenotype can contribute to the catabolic effects observed in the mouse. In addition, the discrepancy may reflect the difference in experimental conditions. We induced experimental OA in mice by DMM surgery or IA injection of Ad- EPas1 or Ad- Nampt . Under these conditions, the downstream events of Nampt activation, NAD ⁺ production and SirT1 activation, increase the stability and transcriptional activity of the HIF-2 [alpha] protein essential for OA pathogenesis. However, overexpression of SirT1 alone is not sufficient to induce the expression of catabolic factors. Unlike our experimental conditions, previous studies used Sirt1 ^+/- and SirTl mutant mice to investigate spontaneous cartilage regression following aging (31, 50). Nonetheless, although SirT1 appears to exhibit anabolic effects in cartilage tissue by inhibiting chondrocyte apoptosis and stimulating ECM gene expression, the in vivo effects of Nampt and SirT1 demonstrated in this study The ability of the Nampt / SirT1 pathway to up-regulate tissue-destroying genes (e.g., Mmp3, Mmp12, and Mmp13 ) overwhelms the assimilation effects of SirT1 in cartilage tissue, resulting in OA pathogenesis.

In addition, the present inventors have found that the catabolic functions of the Nampt / SirT1 pathway contribute to the increased stability and transcriptional activity of HIF-2α. SirT1 is known to stimulate the transcriptional activity of HIF-2α by deacetylating HIF-2α in hypoxic Hep3B and HEK293 cells (36, 37). Using anti-acetyl (Ac-Histone 3 or Ac-Lys) antibodies, we detected deacetylated histone H3 (results not shown). However, the inventors could not find any evidence for HIF-2? Deacetylation in chondrocytes under the experimental conditions of our inventors. Above all, the present inventors have found that the Nampt / SirT1 pathway regulates HIF-2 alpha hydroxylation spontaneously, which is a prerequisite for proteasome degradation (5, 6). Moreover, although Sirtl is up-regulated by HIF-2? In Hep3B and HT1080 cells in hypoxic conditions (37), we believe HIF-2? Activates SirT1 in chondrocytes as a result of Nampt activation without altering Sirt1 expression (Results not shown). According to a recent report (51), HIF-1 stability is regulated by SirT1 in hypoxic hepatocellular carcinoma cells because inhibition of SirT1 inhibits HIF-1 accumulation and HIF- 1 &lt; / RTI &gt; protein. The results are similar to the control of HIF-2? Protein stability by SirT1. Despite many similar intracellular activities between HIF-1 and HIF-2α, HIF-1 and HIF-2α not only have unique intracellular activity but also in some cases exhibit counteractivity (5). Similar to HIF-2α, HIF-1 is also deacetylated by SirT1, but in contrast to HIF-2α, it inhibits HIF-1 transcriptional activity (52). Our findings show that the loss of Nampt or SirT1 activity dramatically reduces HIF-2 alpha protein levels in cartilage cells. This effect appears to be due to the hydroxylation of HIF-2 alpha, as demonstrated by the observation that inhibition of hydroxylase blocks the reduction of HIF-2 alpha protein levels caused by the inhibition of Nampt or SirT1 . In addition, the inventors have demonstrated that modulation of HIF-2 alpha protein stability is important in OA pathogenesis in various experimental mouse models. In particular, the inventors have observed that inhibition of iNampt by FK866 or inhibition of SirT1 by EX527 or nicotinamide inhibits OA cartilage tissue destruction induced by DMM surgery or IA injection of Ad- Nampt or Ad- EPas1 .

In addition to the modulation of the matrix-degrading enzymes by the Nampt and SirT1 pathways, the results of the present invention show that IA injection of Ad- Nampt results in synovitis, which inhibits Nampt enzyme activity by treatment with FK866 or SirT1 by EX527 or nicotinamide treatment Lt; / RTI &gt; is blocked by inhibition of the activity. OA is a disease involving all the joint tissues including cartilage, synovial and subchondral bone, and synovitis caused by Ad- EPas1 or Ad- Nampt injection may affect cartilage tissue destruction. Thus, the inhibitory effect of Nampt or SirT1 inhibitors may contribute to the observed effects on cartilage tissue destruction. However, spontaneous cartilage tissue destruction caused by cartilage destruction and aging induced by DMM surgery is significantly increased in cartilage cell-specific Nampt TG mice compared to WT mice. This means that the effect of Ad- EPas1 or Ad- Nampt on cartilage cells plays an important role in OA cartilage tissue destruction.

On the other hand, one of the main discoveries of the present inventors is that mutual regulation by the HIF-2 alpha and Nampt / NAD ⁺ / SirT1 pathways leads to the positive of HIF-2 alpha signaling involved in regulating the expression of matrix- Resulting in feedback amplification (Figure 9c). Mechanical stresses such as pro-inflammatory cytokines such as IL-1β or DMM surgery directly target and regulate the expression of genes encoding up-to-date tissue-destroying enzymes in chondrocytes by up-regulating HIF-2α. The expression of matrix-degrading enzymes ( Mmp3, Mmp12 and Mmp13 ) is amplified by HIF-2α-dependent eNampt activity. More importantly, the transcriptional activity of HIF-2α to genes encoding the above-described cognitive factors is amplified by the stabilization of the HIF-2α protein by the iNampt / NAD ⁺ / SirT1 pathway. The degree of cartilage tissue destruction is most apparent in HIF-2α overexpression, which is similar to that seen in DMM surgery. Cartilage destruction in less Ad- Nampt injection compared with Ad- EPas1 injection. This is consistent with HIF-2α signaling amplified by the Nampt / SirT1 pathway in signaling resulting in OA cartilage tissue destruction.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

references

1. Abramson SB, Attur M. Developments in the scientific understanding of osteoarthritis. Arthritis Res Ther. 2009; 11 (3): 227-235.

2. Bian Q, Wang YJ, Liu SF, Li YP. Osteoarthritis: genetic factors, animal models, mechanisms, and therapies. Front. Biosci. 2012; E4: 74-100.

3. Yang S, et al. Hypoxia-inducible factor-2 is a catabolic regulator of osteoarthritic cartilage destruction. Nat Med. 2010; 16 (6): 687-693.

4. Saito T, et al. Transcriptional regulation of endochondral ossification by HIF-2α during skeletal growth and osteoarthritis development. Nat Med. 2010; 16 (6): 678-686.

5. Patel SA, Simon MC. Biology of hypoxia-inducible factor-2 in development and disease. Biology of hypoxia-inducible factor-2 in development and disease. Cell Death Differ. 2008; 15 (4): 628-634.

6. Lobodae, Jozkowicze, Dulak, J. HIF-1 versus HIF-2α - Is one more important than the other? Vascular Pharmacol. 2012; 56 (5): 245-251.

7. Ryu JH, et al. Hypoxia-inducible factor-2 regulates Fas-mediated chondrocyte apoptosis during osteoarthritic cartilage destruction. Cell Death Differ. 2012; 19 (3): 440-450.

8. Ryu JH, et al. Interleukin-6 plays an essential role in hypoxia-inducible factor 2-induced experimental osteoarthritic cartilage destruction in mice. Arthritis Rheum. 2011; 63 (9): 2732-2743.

9. Zhang LQ, Heruth DP, Ye SQ. Nicotinamide phosphoribosyltransferase in human diseases. J Bioanal Biomed. 2011; 3: 13-25.

10. Imai SI. Nicotinamide phosphoribosyl transferase (NAMPT): a link between NAD biology, metabolism, and diseases. Curr Pharm Design. 2009; 15 (1): 20-28.

11. Gomez R, et al. What's new in our understanding of the role of adipokines in rheumatic diseases? Nat Rev Rhematol. 2011; 7 (9): 528-536.

12. Gomez R, et al. Adipokines in the skeleton: influence on cartilage function and joint degenerative diseases. J Mol Endocrinol. 2009; 43 (1): 11-18.

13. Otero M, et al. Changes in plasma levels of fat-derived hormones such as adiponectin, leptin, resistin and visfatin in patients with rheumatoid arthritis. Ann Rheum Dis. 2006; 65 (9): 1198-1201.

14. Klein-Wieringa IR, et al. Baseline serum adipokine levels predict radiographic progression in early rheumatoid arthritis. Arthritis Rheum. 2011; 63 (9): 2567-2574.

15. Rho YH, et al. Adipocytokines are associated with radiographic joint damage in rheumatoid arthritis. Arthritis Rheum. 2009; 60 (7): 1906-1914.

16. Brentano F, et al. PreB cell colony-enhancing factor / visfatin, a new marker of inflammation in rheumatoid arthritis with proinflammatory and matrix-degrading activities. Arthritis Rheum 2007; 56 (9): 2829-39.

17. Adya R, et al. Visfatin induces human endothelial VEGF and MMP-2/9 production via MAPK and PI3K / Akt signaling pathways: novel insights into visfatin-induced angiogenesis. Cardiovasc Res. 2008; 78 (2): 356-65.

18. Khan JA, Tao X, Tong L. Molecular basis for the inhibition of human NMPRTase, a novel target for anticancer agents. Nat Struct Mol Biol. 2006; 13 (7): 582-588.

19. Evans L, et al. Suppression of leukocyte infiltration and cartilage degradation by selective inhibition of preB cell colony-enhancing factor / visfatin / nicotinamide phosphoribosyltransferase: Apo866-mediated therapy in human fibroblasts and murine collagen-induced arthritis. Arthritis Rheum. 2011; 63 (7): 1866-1877.

20. Busso N, et al. Pharmacological inhibition of nicotinamide phosphoribosyltransferase / visfatin enzymatic activity identifies a new inflammatory pathway linked to NAD. PLoS One. 2008; 3 (5): e2267.

21. Duan Y, et al. Increased synovial fluid visfatin is positively linked to cartilage degradation biomarkers in osteoarthritis. Rheumatol Int. 2012; 32 (4): 985-990.

22. Yammani RR, Loeser RF. Extracellular nicotinamide phosphoribosyltransferase (NAMPT / visfatin) inhibits insulin-like growth factor-1 signaling and proteoglycan synthesis in human articular chondrocytes. Arthritis Res Ther. 2012; 14 (1): R23.

23. Gosset M, et al. Crucial role of visfatin / pre-B cell colony-enhancing factor in matrix degradation and prostaglandin E2 synthesis in chondrocytes: possible influence on osteoarthritis. Arthritis Rheum. 2008; 58 (5): 1399-1409.

24. Hong EH, et al. Nicotinamide phosphoribosyltransferase is essential for interleukin-1betamediated dedifferentiation of articular chondrocytes via SIRT1 and extracellular signal regulated kinase (ERK) complex signaling. J Biol Chem. 2011; 286 (32): 28619-28631.

25. Imai S. Dissecting systemic control of metabolism and aging in the NAD World: the importance of SIRT1 and NAMPT-mediated NAD biosynthesis. FEBS Lett. 2011; 585 (11): 1657-62.

26. Zhang T, Kraus WL. SIRT1-dependent regulation of chromatin and transcription: linking NAD (+) metabolism and signaling to cellular functions. Biochim Biophys Acta. 2010; 1804 (8): 1666-1675.

27. Asahara H. Switching gears to an arthritis gene expression network by SirT1 cleavage. Arthritis Rheum. 2011; 63 (8): 2161-2163.

28. Gabay O, Sanchez C. Epigenetics, sirtuins and osteoarthritis. Joint Bone Spine. 2012; 79 (6): 570-573.

29. Takayama K, et al. SIRT1 regulation of apoptosis of human chondrocytes. Arthritis Rheum. 2009; 60 (9): 2731-2740.

30. Gagarina V, et al. SirT1 enhances survival of human osteoarthritic chondrocytes by repressing protein tyrosine phosphatase 1B and activating the insulin-like growth factor receptor pathway. Arthritis Rheum. 2010; 62 (5): 1383-1392.

31. Gabay O, et al. Increased apoptotic chondrocytes in articular cartilage from adult heterozygous SirT1 mice. Ann Rheum Dis. 2012; 71 (4): 613-616.

32. Oppenheimer H, et al. 75-kD sirtuin 1 blocks tumor necrosis factor -mediated apoptosis in human osteoarthritic chondrocytes. Arthritis Rheum. 2012; 64 (3): 718-728.

33. Dvir-Ginzberg M, Gagarina V, Lee EJ, Hall DJ. Regulation of cartilage-specific gene expression in human chondrocytes by SirT1 and nicotinamide phosphoribosyltransferase. J Biol Chem. 2008; 283 (52): 36300-36310.

34. Fujita N, et al. Potential involvement of SIRT1 in the pathogenesis of osteoarthritis through the modulation of chondrocyte gene expressions. J Orthop Res. 2011; 29 (4): 511-515.

35. Dvir-Ginzberg M, et al. Tumor necrosis factor-mediated cleavage and inactivation of SirT1 in human osteoarthritic chondrocytes. Arthritis Rheum. 2011; 63 (8): 2363-2373.

36. Dioum EM, et al. Regulation of hypoxia-inducible factor 2 signaling by the stress-responsive deacetylase sirtuin 1. Science. 2009; 324 (5932): 1289-1293.

37. Chen R, et al. Hypoxia increases sirtuin 1 expression in a hypoxia-inducible factor-dependent manner. J Biol Chem. 2011; 286 (16): 13869-13878.

38. Coulet F, Nadaud S, Agrapart M, Soubrier F. Identification of the hypoxia-response element in the human endothelial nitric oxide synthase gene promoter. J Biol Chem. 2003; 278 (47): 46230-46240.

39. Maemura K, et al. Generation of a dominant-negative mutant of endothelial PAS domain protein 1 by deletion of a potent C-terminal transactivation domain. J Biol Chem. 1999; 274 (44): 31565-31570.

40. Oh H, Chun CH, Chun JS. Dkk-1 expression in chondrocytes inhibits experimental osteoarthritic cartilage destruction in mice. Arthritis Rheum. 201264 (8): 2568-2578.

41. Lavu S, Boss O, Elliott PJ, Lambert PD. Sirtuins-novel therapeutic targets to treat age-related diseases. Nat Rev Drug Discov. 2008; 7 (10): 841-853.

42. Fujita N, et al. HIF-1 and HIF-2? Degradation is differentially regulated in nucleus pulpous cells of the intervertebral disc. J Bone Miner Res. 2012; 27 (2): 401-412.

43. Minamishima YA, et al. A feedback loop involving the Phd3 prolyl hydroxylase tunes the mammalian hypoxic response in vivo. Mol Cell Biol. 2009; 29 (21): 5729-5741.

44. Fujita N, et al. Expression of prolyl hydroxylases (PHDs) is selectively controlled by HIF-1 and HIF-2α proteins in nucleus pulposus cells of the intervertebral discs: distinct roles of PHD2 and PHD3 proteins in controlling HIF-1 activity in hypoxia. J Biol Chem. 2012; 287 (20): 16975-16986.

45. Minamishima YA, Kaelin WG Jr. Reactivation of hepatic EPO synthesis in mice after PHD loss. Science. 2010; 329 (5990): 407.

46. Segawa K, et al. Visfatin in adipocytes is upregulated by hypoxia through HIF1-dependent mechanism. Biochem Biophys Res Commun. 2006; 349 (3): 875-882.

47. Bae SK, et al. Hypoxic induction of human visfatin gene is directly mediated by hypoxiainducible factor-1. FEBS Lett. 2006; 580 (17): 4105-4113.

48. Blom AB, et al. Crucial role of macrophages in matrix metalloproteinase-mediated cartilage destruction during experimental osteoarthritis: involvement of matrix metalloproteinase 3. Arthritis Rheum. 2007; 56 (1): 147-157.

49. Little CB, et al. Matrix metalloproteinase 13-deficient mice are resistant to osteoarthritic cartilage erosion but not chondrocyte hypertrophy or osteophyte development. Arthritis Rheum. 2009; 60 (12): 3723-3733.

50. Gabay O, et al. Sirt1 enzymatic activity is required for cartilage homeostasis in vivo. Arthritis Rheum. 2013; 65 (1): 159-166.

51. Laemmlee, et al. Inhibition of SIRT1 impairs the accumulation and transcriptional activity of HIF-1 protein under hypoxic conditions. PLoS One. 2012; 7 (3): e33433.

52. Lee YM, et al. Sirtuin 1 modulates cellular responses to hypoxia by deacetylating hypoxiainducible factor 1. Mol Cell. 2010; 38 (6): 864-878.

53. Mason RM, et al. The STR / ort mouse and its use as a model of osteoarthritis. Osteoarthritis Cartilage. 2001; 9 (2): 85-91.

<110> Gwangju Institute of Science and Technology (GIST) <120> Screening Methods of a Substance for Preventing or Treating a          Joint Disease Using Nampt <130> PN130296 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 2622 <212> DNA <213> Mus musculus <400> 1 atgacagctg acaaggagaa aaaaaggagc agctcagagc tgaggaagga gaaatcccgt 60 gatgccgcga ggtgccggcg cagcaaggag acggaggtct tctatgagtt ggctcatgag 120 ttgcccctgc ctcacagtgt gagctcccac ctggacaaag cctccatcat gcgcctggcc 180 atcagcttcc ttcggacaca taagctcctg tcctcagtct gctctgaaaa tgaatctgaa 240 gctgaggccg accagcaaat ggataacttg tacctgaaag ccttggaggg tttcattgct 300 gtggtgaccc aagacggtga catgatcttt ctgtcggaaa acatcagcaa gttcatggga 360 cttactcagg tagaactaac aggacacagc atctttgact tcactcatcc ttgcgaccat 420 gaggagatcc gtgagaacct gactctcaaa aacggctctg gttttgggaa gaagagcaaa 480 gacgtgtcca ccgagcgtga cttcttcatg aggatgaagt gcacggtcac caacagaggc 540 cggactgtca acctcaagtc ggccacctgg aaggtcctgc actgcaccgg gcaagtgaga 600 gtctacaaca actgcccccc tcacagtagc ctctgtggct ccaaggagcc cctgctgtcc 660 tgccttatca tcatgtgtga gccaatccag cacccatccc acatggacat ccccctggac 720 agcaagactt tcctgagccg ccacagcatg gacatgaagt tcacctactg tgacgacaga 780 atcttggaac tgattggtta ccaccccgag gagctacttg gacgctctgc ctatgagttc 840 taccatgccc tggattcgga gaacatgacc aaaagtcacc agaacttgtg caccaagggg 900 caggtggtat ctggccagta ccggatgcta gccaaacacg gaggatatgt gtggctggag 960 acccagggga cggtcatcta caacccccgc aacctgcagc ctcagtgtat catgtgtgtc 1020 aactatgtgc tgagtgagat cgagaagaac gacgtggtgt tctccatgga ccagaccgaa 1080 tccctgttca agccacacct gatggccatg aacagcatct ttgacagcag tgacgatgtg 1140 gctgtaactg agaagagcaa ctacctgttc accaaactga aggaggagcc cgaggaactg 1200 gcccagttgg cccccacccc aggagatgcc attatttctc tcgatttcgg aagccagaac 1260 ttcgatgaac cctcagccta tggcaaggcc atccttcccc cgggccagcc atgggtctcg 1320 gggctgagga gccacagtgc ccagagcgag tccgggagcc tgccagcctt cactgtgccc 1380 caggcagaca ccccagggaa cactacaccc agtgcttcaa gcagcagtag ctgctccacg 1440 cccagcagcc ctgaggacta ctattcatcc ttggagaatc ccttgaagat cgaagtgatt 1500 gagaagcttt tcgccatgga cacggagccg agggacccgg gcagtaccca gacggacttc 1560 agtgaactgg atttggagac cttggcaccc tacatcccta tggacggcga ggacttccag 1620 ctgagcccca tctgcccaga ggagccgctc atgccagaga gcccccagcc caccccccag 1680 cactgcttca gtaccatgac cagcatcttc cagccgctca ccccgggggc cacccacggc 1740 cccttcttcc tcgataagta cccgcagcag ttggaaagca ggaagacaga gtctgagcac 1800 tggcccatgt cttccatctt ctttgatgct gggagcaaag ggtccctgtc tccatgctgt 1860 ggccaggcca gcacccctct ctcttctatg ggaggcagat ccaacacgca gtggcccccg 1920 gatccaccat tacatttcgg ccctactaag tggcctgtgg gtgatcagag tgctgaatcc 1980 ctgggagccc tgccggtggg gtcatcgcag ttggaacctc cgagcgcccc gcctcatgtc 2040 tccatgttc agatgaggtc tgcaaaggac ttcggggccc gaggtccata catgatgagc 2100 ccagccatga tcgccctgtc caacaagctg aagctaaagc ggcagctgga gtatgaggag 2160 caagccttcc aagacacaag cgggggggac cctccaggca ccagcagttc acacttgatg 2220 tggaaacgta tgaagagcct catgggcggg acctgtcctt tgatgcctga caagaccatc 2280 agtgcgaaca tggcccccga tgaattcacc caaaaatcta tgagaggcct gggccagcca 2340 ctgagacacc tgccacctcc ccagccacca tctaccagga gctcagggga gaacgccaag 2400 actgggttcc cgccacagtg ctatgcctcc cagttccagg actacggtcc tccaggagct 2460 caaaaggtgt caggcgtggc cagtcgactg ctggggccat cgttcgagcc ttacctgttg 2520 ccggaactga ccagatatga ctgtgaggtg aacgtgcccg tgcctggaag ctccacactc 2580 ctgcagggga gagaccttct cagagctctg gaccaggcca cc 2622 <210> 2 <211> 874 <212> PRT <213> Mus musculus <400> 2 Met Thr Ala Asp Lys Glu Lys Lys Arg Ser Ser Ser Glu Leu Arg Lys   1 5 10 15 Glu Lys Ser Arg Asp Ala Ala Arg Cys Arg Arg Ser Lys Glu Thr Glu              20 25 30 Val Phe Tyr Glu Leu Ala His Glu Leu Pro Leu Pro His Ser Val Ser          35 40 45 Ser His Leu Asp Lys Ala Ser Ile Met Arg Leu Ala Ile Ser Phe Leu      50 55 60 Arg Thr His Lys Leu Leu Ser Ser Val Cys Ser Glu Asn Glu Ser Glu  65 70 75 80 Ala Glu Ala Asp Gln Gln Met Asp Asn Leu Tyr Leu Lys Ala Leu Glu                  85 90 95 Gly Phe Ile Ala Val Val Thr Gln Asp Gly Asp Met Ile Phe Leu Ser             100 105 110 Glu Asn Ile Ser Lys Phe Met Gly Leu Thr Gln Val Glu Leu Thr Gly         115 120 125 His Ser Ile Phe Asp Phe Thr His Pro Cys Asp His Glu Glu Ile Arg     130 135 140 Glu Asn Leu Thr Leu Lys Asn Gly Ser Gly Phe Gly Lys Lys Ser Lys 145 150 155 160 Asp Val Ser Thr Glu Arg Asp Phe Phe Met Arg Met Lys Cys Thr Val                 165 170 175 Thr Asn Arg Gly Arg Thr Val Asn Leu Lys Ser Ala Thr Trp Lys Val             180 185 190 Leu His Cys Thr Gly Gln Val Arg Val Tyr Asn Asn Cys Pro Pro His         195 200 205 Ser Ser Leu Cys Gly Ser Lys Glu Pro Leu Leu Ser Cys Leu Ile Ile     210 215 220 Met Cys Glu Pro Ile Gln His Pro Ser His Met Asp Ile Pro Leu Asp 225 230 235 240 Ser Lys Thr Phe Leu Ser Arg His Ser Met Asp Met Lys Phe Thr Tyr                 245 250 255 Cys Asp Asp Arg Ile Leu Glu Leu Ile Gly Tyr His Pro Glu Glu Leu             260 265 270 Leu Gly Arg Ser Ala Tyr Glu Phe Tyr His Ala Leu Asp Ser Glu Asn         275 280 285 Met Thr Lys Ser His Gln Asn Leu Cys Thr Lys Gly Gln Val Ser Ser     290 295 300 Gly Gln Tyr Arg Met Leu Ala Lys His Gly Gly Tyr Val Trp Leu Glu 305 310 315 320 Thr Gln Gly Thr Val Ile Tyr Asn Pro Arg Asn Leu Gln Pro Gln Cys                 325 330 335 Ile Met Cys Val Asn Tyr Val Leu Ser Glu Ile Glu Lys Asn Asp Val             340 345 350 Val Phe Ser Met Asp Gln Thr Glu Ser Leu Phe Lys Pro His Leu Met         355 360 365 Ala Met Asn Ser Ile Phe Asp Ser Ser Asp Asp Val Ala Val Thr Glu     370 375 380 Lys Ser Asn Tyr Leu Phe Thr Lys Leu Lys Glu Glu Pro Glu Glu Leu 385 390 395 400 Ala Gln Leu Ala Pro Thr Pro Gly Asp Ala Ile Ser Leu Asp Phe                 405 410 415 Gly Ser Gln Asn Phe Asp Glu Pro Ser Ala Tyr Gly Lys Ala Ile Leu             420 425 430 Pro Pro Gly Gln Pro Trp Val Ser Gly Leu Arg Ser His Ser Ala Gln         435 440 445 Ser Glu Ser Glu Ser Leu Pro Ala Phe Thr Val Gln Ala Asp Thr     450 455 460 Pro Gly Asn Thr Thr Ser Ser Ser Ser Ser Ser Ser Cys Ser Thr 465 470 475 480 Pro Ser Ser Pro Glu Asp Tyr Tyr Ser Ser Leu Glu Asn Pro Leu Lys                 485 490 495 Ile Glu Val Ile Glu Lys Leu Phe Ala Met Asp Thr Glu Pro Arg Asp             500 505 510 Pro Gly Ser Thr Gln Thr Asp Phe Ser Glu Leu Asp Leu Glu Thr Leu         515 520 525 Ala Pro Tyr Ile Pro Met Asp Gly Glu Asp Phe Gln Leu Ser Pro Ile     530 535 540 Cys Pro Glu Glu Pro Leu Met Pro Glu Ser Pro Gln Pro Thr Pro Gln 545 550 555 560 His Cys Phe Ser Thr Met Thr Ser Ile Phe Gln Pro Leu Thr Pro Gly                 565 570 575 Ala Thr His Gly Pro Phe Phe Leu Asp Lys Tyr Pro Gln Gln Leu Glu             580 585 590 Ser Arg Lys Thr Glu Ser Glu His Trp Pro Met Ser Ser Ile Phe Phe         595 600 605 Asp Ala Gly Ser Lys Gly Ser Leu Ser Pro Cys Cys Gly Gln Ala Ser     610 615 620 Thr Pro Leu Ser Ser Met Gly Gly Arg Ser Asn Thr Gln Trp Pro Pro 625 630 635 640 Asp Pro Pro Leu His Phe Gly Pro Thr Lys Trp Pro Val Gly Asp Gln                 645 650 655 Ser Ala Glu Ser Leu Gly Ala Leu Pro Val Gly Ser Ser Gln Leu Glu             660 665 670 Pro Pro Ser Ala Pro Pro His Val Val Ser Phe Lys Met Arg Ser Ala         675 680 685 Lys Asp Phe Gly Ala Arg Gly Pro Tyr Met Met Ser Pro Ala Met Ile     690 695 700 Ala Leu Ser Asn Lys Leu Lys Leu Lys Arg Gln Leu Glu Tyr Glu Glu 705 710 715 720 Gln Ala Phe Gln Asp Thr Ser Gly Gly Asp Pro Pro Gly Thr Ser Ser                 725 730 735 Ser His Leu Met Trp Lys Arg Met Lys Ser Leu Met Gly Gly Thr Cys             740 745 750 Pro Leu Met Pro Asp Lys Thr Ile Ser Ala Asn Met Ala Pro Asp Glu         755 760 765 Phe Thr Gln Lys Ser Met Arg Gly Leu Gly Gln Pro Leu Arg His Leu     770 775 780 Pro Pro Pro Gln Pro Pro Ser Thr Arg Ser Ser Gly Glu Asn Ala Lys 785 790 795 800 Thr Gly Phe Pro Pro Gln Cys Tyr Ala Ser Gln Phe Gln Asp Tyr Gly                 805 810 815 Pro Pro Gly Ala Gln Lys Val Ser Gly Val Ala Ser Arg Leu Leu Gly             820 825 830 Pro Ser Phe Glu Pro Tyr Leu Leu Pro Glu Leu Thr Arg Tyr Asp Cys         835 840 845 Glu Val Asn Val Pro Val Gly Ser Ser Thr Leu Leu Gln Gly Arg     850 855 860 Asp Leu Leu Arg Ala Leu Asp Gln Ala Thr 865 870 <210> 3 <211> 2094 <212> DNA <213> Mus musculus <400> 3 atggcggacg aggtggcgct cgcccttcag gccgccggct ccccttccgc ggcggccgcc 60 atggaggccg cgtcgcagcc ggcggacgag ccgctccgca agaggccccg ccgagacggg 120 cctggcctcg ggcgcagccc gggcgagccg agcgcagcag tggcgccggc ggccgcgggg 180 tgtgaggcgg cgagcgccgc ggccccggcg gcgctgtggc gggaggcggc aggggcggcg 240 gcgagcgcgg agcgggaggc cccggcgacg gccgtggccg gggacggaga caatgggtcc 300 ggcctgcggc gggagccgag ggcggctgac gacttcgacg acgacgaggg cgaggaggag 360 gcgaggcgg cggcggcagc ggcggcggca gcgatcggct accgaggtcc atatactttt 420 gttcagcaac atctcatgat tggcaccgat cctcgaacaa ttcttaaaga tttattacca 480 gaaacaattc ctccacctga gctggatgat atgacgctgt ggcagattgt tattaatatc 540 ctttcagaac caccaaagcg gaaaaaaaga aaagatatca atacaattga agatgctgtg 600 aagttactgc aggagtgtaa aaagataata gttctgactg gagctggggt ttctgtctcc 660 tgtgggattc ctgacttcag atcaagagac ggtatctatg ctcgccttgc ggtggacttc 720 ccagacctcc cagaccctca agccatgttt gatattgagt attttagaaa agacccaaga 780 ccattcttca agtttgcaaa ggaaatatat cccggacagt tccagccgtc tctgtgtcac 840 aaattcatag ctttgtcaga taaggaagga aaactacttc gaaattatac tcaaaatata 900 gataccttgg agcaggttgc aggaatccaa aggatccttc agtgtcatgg ttcctttgca 960 acagcatctt gcctgatttg taaatacaaa gttgattgtg aagctgttcg tggagacatt 1020 tttaatcagg tagttcctcg gtgccctagg tgcccagctg atgagccact tgccatcatg 1080 aagccagaga ttgtcttctt tggtgaaaac ttaccagaac agtttcatag agccatgaag 1140 tatgacaaag atgaagttga cctcctcatt gttattggat cttctctgaa agtgagacca 1200 gtagcactaa ttccaagttc tataccccat gaagtgcctc aaatattaat aaatagggaa 1260 cctttgcctc atctacattt tgatgtagag ctccttggag actgcgatgt tataattaat 1320 gagttgtgtc ataggctagg tggtgaatat gccaaacttt gttgtaaccc tgtaaagctt 1380 tcagaaatta ctgaaaaacc tccacgccca caaaaggaat tggttcattt atcagagttg 1440 ccaccaacac ctcttcatat ttcggaagac tcaagttcac ctgaaagaac tgtaccacaa 1500 gactcttctg tgattgctac acttgtagac caagcaacaa acaacaatgt taatgattta 1560 gaagtatctg aatcaagttg tgtggaagaa aaaccacaag aagtacagac tagtaggaat 1620 gttgagaaca ttaatgtgga aaatccagat tttaaggctg ttggttccag tactgcagac 1680 aaaaatgaaa gaacttcagt tgcagaaaca gtgagaaaat gctggcctaa tagacttgca 1740 aaggagcaga ttagtaagcg gcttgagggt aatcaatacc tgtttgtacc accaaatcgt 1800 tacatattcc acggtgctga ggtatactca gactctgaag atgacgtctt gtcctctagt 1860 tcctgtggca gtaacagtga cagtggcaca tgccagagtc caagtttaga agaacccttg 1920 gaagatgaaa gtgaaattga agaattctac aatggcttgg aagatgatac ggagaggccc 1980 gaatgtgctg gaggatctgg atttggagct gatggagggg atcaagaggt tgttaatgaa 2040 gctatagcta caagacagga attgacagat gtaaactatc catcagacaa atca 2094 <210> 4 <211> 698 <212> PRT <213> Mus musculus <400> 4 Met Ala Asp Glu Val Ala Leu Ala Leu Gln Ala Ala Gly Ser Ser Ser   1 5 10 15 Ala Ala Ala Ala Met Glu Ala Ala Ser Gln Pro Ala Asp Glu Pro Leu              20 25 30 Arg Lys Arg Pro Arg Arg Asp Gly Pro Gly Leu Gly Arg Ser Ser Gly          35 40 45 Glu Pro Ser Ala Ala Val Ala Pro Ala Ala Ala Gly Cys Glu Ala Ala      50 55 60 Ser Ala Ala Ala Ala Ala Lea Trp Arg Glu Ala Ala Gly Ala Ala  65 70 75 80 Ala Ser Ala Glu Arg Glu Ala Pro Ala Thr Ala Val Ala Gly Asp Gly                  85 90 95 Asp Asn Gly Ser Gly Leu Arg Arg Glu Pro Arg Ala Ala Asp Asp Phe             100 105 110 Asp Asp Glu Glu Glu Glu Glu Glu Asp Glu Ala Ala Ala Ala Ala         115 120 125 Ala Ala Ala Ile Gly Tyr Arg Gly Pro Tyr Thr Phe Val Gln Gln His     130 135 140 Leu Met Ile Gly Thr Asp Pro Arg Thr Ile Leu Lys Asp Leu Leu Pro 145 150 155 160 Glu Thr Ile Pro Pro Glu Leu Asp Asp Met Thr Leu Trp Gln Ile                 165 170 175 Val Ile Asn Ile Leu Ser Glu Pro Pro Lys Arg Lys Lys Arg Lys Asp             180 185 190 Ile Asn Thr Ile Glu Asp Ala Val Lys Leu Leu Gln Glu Cys Lys Lys         195 200 205 Ile Ile Val Leu Thr Gly Ala Gly Val Ser Ser Ser Cys Gly Ile Pro     210 215 220 Asp Phe Arg Ser Ser Asp Gly Ile Tyr Ala Arg Leu Ala Val Asp Phe 225 230 235 240 Pro Asp Leu Pro Asp Pro Gln Ala Met Phe Asp Ile Glu Tyr Phe Arg                 245 250 255 Lys Asp Pro Arg Pro Phe Phe Lys Phe Ala Lys Glu Ile Tyr Pro Gly             260 265 270 Gln Phe Gln Pro Ser Leu Cys His Lys Phe Ile Ala Leu Ser Asp Lys         275 280 285 Glu Gly Lys Leu Leu Arg Asn Tyr Thr Gln Asn Ile Asp Thr Leu Glu     290 295 300 Gln Val Ala Gly Ile Gln Arg Ile Leu Gln Cys His Gly Ser Phe Ala 305 310 315 320 Thr Ala Ser Cys Leu Ile Cys Lys Tyr Lys Val Asp Cys Glu Ala Val                 325 330 335 Arg Gly Asp Ile Phe Asn Gln Val Val Pro Arg Cys Pro Arg Cys Pro             340 345 350 Ala Asp Glu Pro Leu Ala Ile Met Lys Pro Glu Ile Val Phe Phe Gly         355 360 365 Glu Asn Leu Pro Glu Gln Phe His Arg Ala Met Lys Tyr Asp Lys Asp     370 375 380 Glu Val Asp Leu Leu Ile Val Ile Gly Ser Ser Leu Lys Val Arg Pro 385 390 395 400 Val Ala Leu Ile Pro Ser Ser Ile Pro His Glu Val Pro Gln Ile Leu                 405 410 415 Ile Asn Arg Glu Pro Leu Pro His Leu His Phe Asp Val Glu Leu Leu             420 425 430 Gly Asp Cys Asp Val Ile Ile Asn Glu Leu Cys His Arg Leu Gly Gly         435 440 445 Glu Tyr Ala Lys Leu Cys Cys Asn Pro Val Lys Leu Ser Glu Ile Thr     450 455 460 Glu Lys Pro Pro Arg Pro Gln Lys Glu Leu Val His Leu Ser Glu Leu 465 470 475 480 Pro Pro Thr Pro Leu His Ile Ser Glu Asp Ser Ser Ser Pro Glu Arg                 485 490 495 Thr Val Pro Gln Asp Ser Ser Val Ile Ala Thr Leu Val Asp Gln Ala             500 505 510 Thr Asn Asn Val Asn Asp Leu Glu Val Ser Glu Ser Ser Cys Val         515 520 525 Glu Glu Lys Pro Gln Glu Val Gln Thr Ser Arg Asn Val Glu Asn Ile     530 535 540 Asn Val Glu Asn Pro Asp Phe Lys Ala Val Gly Ser Ser Thr Ala Asp 545 550 555 560 Lys Asn Glu Arg Thr Ser Val Ala Glu Thr Val Arg Lys Cys Trp Pro                 565 570 575 Asn Arg Leu Ala Lys Glu Gln Ile Ser Lys Arg Leu Glu Gly Asn Gln             580 585 590 Tyr Leu Phe Val Pro Pro Asn Arg Tyr Ile Phe His Gly Ala Glu Val         595 600 605 Tyr Ser Asp Ser Glu Asp Asp Val Leu Ser Ser Ser Ser Cys Gly Ser     610 615 620 Asn Ser Asp Ser Gly Thr Cys Gln Ser Pro Ser Leu Glu Glu Pro Leu 625 630 635 640 Glu Asp Glu Ser Glu Ile Glu Glu Phe Tyr Asn Gly Leu Glu Asp Asp                 645 650 655 Thr Glu Arg Pro Glu Cys Ala Gly Gly Ser Gly Phe Gly Ala Asp Gly             660 665 670 Gly Asp Gln Glu Val Val Asn Glu Ala Ile Ala Thr Arg Gln Glu Leu         675 680 685 Thr Asp Val Asn Tyr Pro Ser Asp Lys Ser     690 695

Claims (16)

A method for screening a substance for the prevention or treatment of joint diseases comprising the steps of:
(a) treating a test substance to be analyzed in a cell or tissue comprising a hypoxia-inducible factor-2 alpha (HIF-2 alpha) -encoding nucleotide sequence and a silent information regulator 1 (SirT1) -encoding nucleotide sequence; And
(b) analyzing the SirT1 protein in the cell or tissue,
Wherein the test substance is judged to be a substance for preventing or treating joint disease by inhibiting the stability and transcriptional activity of the HIF-2α protein through inhibition of activation of the SirT1 protein.
2. The screening method according to claim 1, wherein the activation of the SirT1 protein increases the expression of the matrix-degrading enzyme at an mRNA or protein level.
The method according to claim 2, wherein the matrix-degrading enzyme is matrix metalloproteinase (MMP) -3, Mmp-9, Mmp-12, Mmp-13 or Adamts4 (a disintegrin and metalloproteinase with thrombospondin motifs) .
The method according to claim 1, wherein activation of the SirT1 protein promotes hydroxylase activity to induce hydroxylation of HIF-2 alpha, thereby promoting proteasomal degradation of HIF-2 alpha Wherein the screening method comprises the steps of:
The screening method according to claim 4, wherein the protein having the hydroxylase activity is prolyl-4-hydroxylase domain (PHD) 2 or PHD3 protein.
The screening method according to claim 1, wherein the cell or tissue is a joint-derived cell or a joint tissue.
The screening method according to claim 6, wherein the joint tissue is articulating joints.
The screening method according to claim 7, wherein the movable joint is a wrist, an elbow, a shoulder, an ankle, a knee, a hip, a vertebra, a temporomandibular joint or a carpometacarpal joint.
The method of claim 1, wherein the test substance is selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, DNAzyme, peptide nucleic acids, antisense oligonucleotide, peptide, antibody, aptamer, .
The method according to claim 1, wherein the arthritic disease is selected from the group consisting of degenerative arthritis, peelable osteochondritis, postmenopausal osteoarthritic arthritis or arthritis, malunion of joints, avascular necrosis, arthroses, ), Chondromalacia patellae, synovitis, bursitis, traumatic effusion, ligamentous deficiency arthroses, osteochondritis dissecans (OCD), patellar instability, rheumatoid arthritis Inflammatory arthritis, septic arthritis, lupus, scleroderma, tendonitis, fibromyalgia, fibromyalgia, or multiple myositis, including, but not limited to, inflammatory bowel disease, juvenile idiopathic arthritis, juvenile arthritis, .
11. The screening method according to claim 10, wherein the joint disease is degenerative arthritis.
delete delete delete delete delete

Images