KR101540647B1 - Simultaneous multiple analysis of korean pharmacogenetic genotype for personalized medicine and methods for predicting drug response using diagnostic results - Google Patents

Abstract

The present invention relates to a method for diagnosing a drug genotype and a drug reaction prediction method, and more particularly, to a method for predicting a drug genotype and a drug reaction prediction method by combining drug genes related to drug effects, , And a method for predicting an individual's drug response using the genotypic analysis result.
Even if the same drug is used, the drug reaction may be different depending on the person, so that side effects may occur or the drug may not be effective. However, by using the present invention, it is possible to diagnose an individual drug type before drug administration and to predict a drug reaction, so that it is possible to use a suitable drug type and an appropriate dose. The present invention can realize a personalized drug therapy that minimizes side effects due to the drug and maximizes the drug efficacy.

Description

TECHNICAL FIELD The present invention relates to a method for predicting a drug response using a simultaneous multiple analysis and analysis result of a Korean drug genotype and a method for predicting a drug response using the analysis result.

The present invention relates to a drug genotype diagnosis method and a method for predicting a drug reaction using the diagnosis result, and more particularly, to a method for predicting a drug genotype and a drug reaction prediction method using the diagnosis result, , The analysis of many drug genotypes using the best analytical method capable of analyzing large quantities, and the use of the genotypic analysis results to predict individual drug reactions, And a method for predicting the reaction.

In general, Pharmacogenomics is a field that is recently emerging with the completion of the human genome project, and studies on single nucleotide polymorphism (SNP) have been actively conducted worldwide.

In fact, in the United States, about 100,000 patients have been treated with the same drug every year, and some patients have an adverse drug reaction. Because the same drug has divergent genetic characteristics, it is time to research and develop an effective method for predicting the therapeutic effect of the drug.

The effectiveness of drug therapy in various diseases such as tumors, Alzheimer's disease, and asthma was not as effective in 75% of tumors, and in 50% of patients, such as Alzheimer's 70% and asthma 40% And about 20% of the patients had toxicity.

The different therapeutic effect of the drug is the most important factor due to the genetic difference of the individual involved in the metabolic process of the drug and the bioactive process of the drug after administration to the individual. Therefore, knowing the genetic characteristic of the patient, There is a need to develop therapy.

The relationship between pharmacokinetic properties and the efficacy of drug dosing is well documented in the example of Warfarin. Warfarin is a thrombolytic agent for cardiovascular disease patients. When we consider the factors determining the dosage as 100%, the genotype of CYP1A1, CYP1A2, CYP2C9, and CYP3A4 genes is 55% and other clinical factors account for 25% .

CYP2A6, CYP2C9, CYP2C8, CYP2C9, CYP2C6, CYP2A1, CYP3A4, CYP3A5, DPYD, GSTM1, GSTP1, GSTT1, CYP2A6, ABCG2, CYP1A1, CYP1A2, CYP2A6, CYP2A6, CYP2A6, ABC2, (Absorption, distribution, metabolism, excretion) gene group was recently reported in the present study. In recent years, there has been reported a case of ADME (absorption, distribution, metabolism, excretion) gene group, NAT1, NAT2, SLC15A2, SLC22A1, SLC22A2, SLC22A6, SLCO1B1, SLCO1B3, SLCO2B1, SULT1A1, TPMT, UGT1A1, UGT2B15, UGT2B17, UGT2B7 and VKORC1 And related genome studies are actively under way.

In foreign countries, gene analysis companies such as DecodeMe, 23andMe, etc. have commercialized services such as disease prediction and drug gene testing. However, there are no researches on commercialization in Korea.

Affymetrix DMET Chip and ARRAY CGC, which are commercialized for drug genotyping, are available. However, only a small number of drug genes or genotypes independent of biological activity prediction are analyzed, and SNPs are selected for foreigners. In addition, there are kits for diagnosing drug genotypes such as CYP family enzymes, but only a few genotypes are diagnosed and no information on activity or clinical information is provided. Therefore, it is necessary to develop a new test method composed of SNPs suitable for Korean drug genotype screening.

Drug genetic testing is necessary to apply drug genetic information to individualized drug therapy, but there is no method for diagnosis of drug genotype in Koreans.

In order to activate individualized drugs in Korea, a combination of multiple drug genotypes affecting the drug response of Koreans and developing and distributing high-throughput diagnostic methods that can accurately and promptly diagnose genotypes and have high reliability It is urgent to do.

To develop a diagnostic method for drug genotyping in Koreans, a total of 392 genotypes were analyzed in 155 Koreans (78 males and 77 females) by genetic analysis by repeating 3 times with Glass microbead assay and SNaPshot method Respectively. The overall call rate was 99.99%, indicating a very high level of genotyping success rate, and the accuracy of the repeat test was 100%. Then, we investigated the relationship between the genes and genotypes and the 217 drug components through the literature review.

Accordingly, the present inventors analyzed the 392 genotypes existing in 141 genes at one time in a large capacity using the multiplexing analysis method and the SNaPshot method from the DNA isolated from the Korean test subject, thereby rapidly reacting the test subject with the drug Through the development of a highly reliable high-throughput diagnostic method, the present invention has been completed.

It is an object of the present invention to provide a pharmaceutical composition which comprises a combination of a drug gene and a drug genotype that affect the drug effect, the prediction of an adverse reaction, the pharmacokinetic response, And to provide a method for analyzing drug genotypes in large quantities.

Another problem to be solved by the present invention is to provide a method for diagnosing a drug genotype of an individual analyzed using the method described above, wherein the individual is classified into an extensive metabolizer (EM) metabolizer), and to provide safe drug use method by predicting the response of the drug related to the genotype to the drug before administration.

In order to achieve the above object,

1) constructing a combination of selectable genes and genotypes that can affect the effects of drugs, prediction of adverse events, and pharmacokinetic responses in Korean individuals; And

2) Using genomic DNA isolated from subjects to construct a possible combination of drug effects, predicting adverse events, pharmacokinetic response genes and genotypes (Glass microbead assay and SNaPshot method) ; And

3) Provides a method of predicting drug activity related to drug genotypes by predicting the biological activity of a subject, with the results of the drug genotype diagnosis of the individual obtained using the above analysis method.

In the present invention, 392 major genotypes among 141 drug genes important for drug metabolism and the like are selected, 378 genotypes are analyzed by Glass microbeads assay method and 14 genotypes are analyzed by SNaPshot method to analyze drug genotypes at a large capacity Method.

Through the method according to the present invention, it is possible to diagnose Korean drug genotype accurately and quickly, and to enable high-throughput diagnosis with high reliability. By diagnosing an individual's drug genotype, the drug response can be predicted, and accordingly, a medicine suitable for an individual can be prescribed.

Hereinafter, the present invention will be described in detail.

The present invention

1) constituting a combination capable of selectively analyzing drug genes and genotypes described below in Table 1, which may affect drug effects, prediction of adverse events, and pharmacokinetic responses in Korean individuals;

Gene SNP ID A common name Major> Minor Mutation type CYP2D6 rs1065852 * 10, * 36, * 49, 100C > T C> T * 10 [T] rs16947 * 2, 2850C > T C> T * 2 [T] rs1135822 * 49, 1611T> A T> A * 49 [A] rs35742686 * 3, 2549delA ins> del * 3 [del] rs3892097 * 4, 1846G > A G> A * 4 [A] rs5030655 * 6, 1707delT ins> del * 6 [del] rs79738337 * 60, 2303C > T C> T * 60 [T] rs1058164 * 2, * 4, * 8, * 10, 1661G > C C> G * 2, * 4, * 8, * 10 [C] rs1135840 * 2A, 4180G > C C> G * 2A [C] rs28371525 * 41, 2988G > A G> A * 41 [A] CYP2D6_2 * 60, 1887 del ins * 60 [ins] rs5030867 * 7, 2935A > C A> C * 7 [C] rs5030865 * 8, 1758G > T C> T * 8 [T] rs5030656 * 9, 2615_2617delAAG ins> del * 9 [del] CYP2C9 rs28371685 * 11, R335W C> T * 11 [T] rs9332239 * 12, 50338C> T C> T * 12 [T] rs72558187 * 13, 3276T > C T > C * 13 [C] rs72558190 * 15, 9100C> A C> A * 15 [A] rs72558193 * 18, 47391A > C A> C * 18 [C] rs1799853 * 2, Arg144Cys C> T * 2 [T] rs72558188 * 25, 353_362delAGAAATGGAA ins> del * 25 [del] rs1057910 * 3, 3531_3540delAGAAATGGAA ins> del * 3 [del] rs9332131 * 6, 818delA ins> del (A> G) * 6 [G] rs9332092 . T > C [C] rs9332096 . C> T [T] rs9332098 . G> A [A] rs4918758 * 1C, C1188T T > C * 1C [T] VKORC1 rs9934438 C6484T, 1173C > T A> G [AG / AA] rs8050894 * 2, 1542G > C, 6853G > C G> C * 2 [G] rs2359612 * 2, 2255C > T, 7566C > T A> G * 2 [A] rs7200749 * 3F, 3462C > T, 8773C > T G> A * 3F [A] rs7294 3730G> A G> A [A] rs17708472 * 4, 6009C > T, 698C > T G> A * 4 [A] CYP2C19 rs12248560 * 17, -806C > T C> T * 17 [T] rs4244285 * 2, G681A G> A * 2 [A] rs4986893 * 3, G636A G> A * 3 [A] rs28399504 * 4, A1G A> G * 4 [G] rs41291556 * 8, 12711T > C, W120R T > C * 8 [C] rs17885098 * 2, * 4, 99C > T T > C * 2, * 4 [T] rs3758580 * 2, 80160C > T C> T * 2 [T] rs11568732 -888T / G T> G [G] rs4986894 -97T / C T > C [C] rs17886522 G417G A> C [C] rs17878649 IVS1-47G / A G> A [A] rs4417205 IVS5-51C / G C> G [G] rs4917623 IVS7-106T / C C> T [T] rs11188072 * 17, -3402C > T C> T * 17 [T] rs56337013 * 5A, 1297C > T, R433W C> T * 5A [T] DPYD rs3918290 * 2A, IVS14 + 1G > A G> A * 2A [A] rs1801268 * 10, 2983G > T, V995F G> T * 10 [T] rs1801159 * 5, I543V, A1627G A> G * 5 [G] rs72549309 * 7, 295delTCAT ins> del * 7 [del, T] rs1801266 * 8, R235W C> T * 8 [T] rs1801265 * 9A, C29R, T85C T > C * 9A [C] rs1801267 * 9B, 2657G > A, R886H G> A * 9B [A] rs2297595 496A > G, Met166Val T > C [C] rs72981743 -243G / A G> A [A] DPYD_2 -268C / A A> C [C] rs1042482 3651G / A G> A [A] rs291593 3858T / C T > C [C] DPYD_1 N151D A> G [G] DPYD_3 S811S C> T [T] DPYD_4 T735A A> G [G] rs56279424 . G> T [T] G6PD rs2230037 1311C> T C> T [T] rs1050828 202G> A G> A [T] rs1050829 376A> G A> G [G] rs34193178 H350D G> C [C] rs2472393 IVS1 + 2955A / G C> T [T] rs743544 IVS1-773C / T C> T [T] HLA-B * 1502 rs3130690 HLA-B * 1502 C> A * 1502 [A] rs3909184 HLA-B * 1502 C> G * 1502 [G] rs2844682 HLA-B * 1502 C> T * 1502 [T] HLA-B * 5701 rs2395029 HLA-B * 5701 T> G * 5701 [G] NAT1 rs4986988 * 11, c.-344C > T C> T * 11 [T] rs4986989 * 11, c.-40A > T A> T * 11 [T] rs4986990 * 11, c.459G > A, p.T153T G> A * 11 [A] rs4986783 * 11, c.640T > G, p.S214A T> G * 11 [G] rs5030839 * 15, c.559C > T, p.R187X C> T * 15 [T] rs56379106 * 17, c.190C> T, p.R64W C> T * 17 [T] rs56318881 * 19, c.97C > T, p.R33X C> T * 19 [T] rs56172717 * 22, c.752A > T, p.D251V A> T * 22 [T} rs55793712 * 5, c.884A> G A> G * 5 [G] rs72554612 * 5, c.976delA ins> del * 5 [G] NAT2 rs1799929 * 11, * 5B C> T * 11A [T] rs1041983 * 13, * 5G, * 6A C> T * 13 [T] rs1805158 * 19, 190C > T, R64W C> T * 19 [T] rs1799930 * 5E, * 6A G> A * 6A [A] rs1799931 * 7, G286E, * 6I G> A * 7A [A] rs4986996 * 12D G> A * 12D [A] rs4646241 . T > C [C] rs4646242 . A> G [G] rs4646243 . T > C [C] rs4646246 . A> G [G] TPMT rs1800460 * 3B G> A * 3B [A] rs1142345 * 3C, C240Y, 18485A> G A> G * 3C [G] rs75543815 * 6, 15327A> T T> A * 6 [A] rs1800462 * 2, 238G > C, A80P G> C * 2 [C] rs12201199 . A> T [T] rs1800584 *4 G> A * 4 [A] UGT1A1 rs4124874 * 60, -3263T> G A> C * 60 [C] rs887829 * 28 G> A * 28 [A] rs28934877 * 38 A> G * 38 [G] rs55750087 * 29, R367G C> G * 29 [G] rs4148323 * 6, Gly71Arg G> A * 6 [A] rs34993780 * 7 T> G * 7 [G] rs10929302 * 93, -3156G > A G> A * 93 [A] rs3755319 . T> G [G] rs2003569 . G> A [A] CYP2E1 rs2031920 * 5, -1053C > T C> T * 5 [T] rs6413432 * 6, 7632T> A T> A * 6 [A] rs3813867 * 5A, * 5B G> C * 5A, * 5B [C] rs2070673 * 7, -333T> A T> A * 7, [A] rs2070875 . T> G [G] rs2515641 . C> T [T] CYP3A4 rs4987161 * 17, F189S, 670T > C T > C * 17 [C] rs28371759 * 18, L293P (T > C) T > C * 18 [C] rs2740574 * 1B, -392A> G A> G * 1B [G] CYP3A5 rs776746 * 3, 6986A> G G> A * 3 [G] rs55965422 * 5, 12952T> C A> G * 5 [G] rs10264272 * 6, 14690G > A C> T * 6 [T] rs41303343 * 7, 27131_27132insT del ins * 7 [ins, T] rs28383479 * 9, 19386G> A G> A * 9 [A] rs41279854 * 10, 29753T> C A> G * 10 [G] CYP4B1 rs4646487 Arg173Trp C> T [T] CYP4F2 rs2108622 V433M C> T [T] CYP19A1 rs4646 . C> A [A] rs6493497 . G> A [A] CYP1A2 rs762551 * 1F, -163C > A A> C * 1F [A] rs2069526 * K, * 1E, -739T> G T> G * 1E [G] rs2470890 * 1B, 5347T > C C> T * 1B [C] rs2069522 . T > C [C] rs3743484 . G> C [C] rs72547513 * 11, F186L, 558C > A C> A * 11 [A] rs72547511 * 15, P42R, 125C> G C> G * 15 [G] rs72547515 * 16, R377Q, 2473G > A C> T * 16 [T] rs55889066 * 5, C406Y, 3497G > A G> A * 5 [A] rs28399424 * 6, R431W, 5090C > T C> T * 6 [T] rs72547517 * 8, R456H, 5166G > A G> A * 8 [A] rs2472304 . G> A [A] rs4646427 . T > C [C] rs2069521 . G> A [A] CYP1B1 rs1056836 * 3, 4326C> G, L432V C> G * 3 [G] CYP2A6 rs28399468 * 10, 6600G > T G> T * 10 [T] rs28399433 * 13, * 15, -48T> G T> G * 13, * 15 [G] rs1809810 * 18, 5668A> T A> T * 18 [T] rs56256500 * 23, R203C, 607C > T G> A * 23 [A] rs28399444 * 20, 2141_2142delAA ins> del * 20 [del] CYP2B6 rs12721655 * 8, 415A > G, K192E A> G * 8 [G] rs1042389 . T > C [C] rs34223104 * 22, -82C > T T > C * 22 [T] rs36079186 * 27, 593T > C, M198T T > C * 27 [C] rs34097093 * 28, 1132C> T, R378X C> T * 28 [T] rs3211371 * 1C, * 5, * 7, 1459C > T, Arg487Cys T > C * 5A [T] rs8192709 * 2, 64C > T C> T * 2 [T] rs28399499 * 18, 983T > C, I328T T > C * 18 [C] rs58425034 c.646-159G> C G> C [C] rs12721646 c.646-17C> T C> T [T] CYP2C8 rs11572103 * 2, I269F, A805T A> T * 2 [T] rs10509681 * 5, 2189delA ins> del * 5 [del] rs11572177 . A> G [G] rs1113129 . G> C [C] rs1341164 . T > C [C] CYP2C18 rs12777823 . G> A [A] ABCB1 rs1045642 3435C> T C> T [T] rs1128503 Gly412Gly T > C [T] rs10280101 . A> C [C] rs7787082 . G> A [A] rs4148739 . A> G [G] rs11983225 . T > C [C] rs12720067 . G> A [A] rs3213619 -129T> C T > C [C] rs2235015 287-25G> T G> T [T] rs10276036 IVS9-44a> G C> T [C] rs35810889 M89T T > C [C] rs35023033 R669C C> T [T] rs28364274 V1251I G> A [A] rs35730308 W1108R T > C [C] rs2032582 . G> T / A [T / A] rs3789243 . C> T [T] ABCC1 rs3784862 . G> A [G] rs246240 . A> G [A] rs2238476 . C> T [C] rs35592 16081823T> C T > C [T] rs35605 1684C> T C> T [T] rs2230671 4002G> A G> A [A] rs212090 5462T> A T> A [A] rs35529209 Ala989Thr G> A [A] rs4148356 Arg723Gln G> A [A] rs45511401 Gly671Val G> T [T] rs119774 . G> A [A] ABCC2 rs717620 -24C> T G> A [A] rs3740066 3972C> T G> A [A] rs8187710 Cys1515Tyr G> A [A] rs2273697 V417I G> A [A] rs17222723 Val1188Glu T> A [A] rs12762549 . G> C [G] ABCC4 rs1751034 3463 A> G T > C [C] rs9561778 c.3366 + 1243G > T G> T [T] ABCC6 rs2238472 Arg1268Gln G> A [A] ABCG2 rs13120400 . T > C [C] rs17731538 . G> A [A] rs2622604 . C> T [T] rs2231142 Q141K C> A [A] ABO rs8176746 . C> A [AA] rs495828 . G> T [GG] ACE rs4341 . C> G [GG] ADM rs11042725 -1923C> A C> A [CC] ADRB2 rs1042713 Arg16Gly A> G [AA] rs1800888 Thr164Ile C> T [T] ADRB3 rs4994 Trp64Arg T > C [C] AGTR1 rs5182 573C> T T > C [C] AKT1 rs2494732 . C> T [TT] ANKK1 rs1800497 . C> T [T] AOX1 rs55754655 Asn1135Ser A> G [GG] APOB rs1367117 711C> T G> A [G] APOC3 rs5128 3238C> G G> C [C] rs2854117 -482C> T G> A [A] ARG1 rs2781659 . A> G [G] ATM rs4585 . G> T [T] ATP7A rs2227291 Val767Leu G> C [G] ATXN1 rs179997 A-241G A> G [G] BAT3 rs750332 . A> G [G] BCHE rs1799807 Asp70Gly A> G [G] rs28933390 Gly390Val G> T [T] rs28933389 Thr243Met C> T [T] BDKRB1 rs12050217 . A> G [AA] BDKRB2 rs1799722 C-58T T > C [T] C6F10 rs3129900 . T> G [G] CACNG2 rs2284017 . C> T [C] rs2284018 . C> T [C] rs5750285 . C> G [C] CAT rs10836235 c.66 + 78C> T C> T [CC] CBR1 rs9024 1096G> A G> A [GG] rs20572 627C> T, A209A C> T [CC] CBR3 rs2835285 Val93Ile G> A [A] rs1056892 Val244Met G> A [A] CCND1 rs17852153 870G> A A> G [G] CDA rs2072671 Lys27Gln, K27Q A> C [A: AA] rs60369023 c.208G > A, Ala70Thr G> A [A: AA] rs532545 -451C> T G> A [AA] CETP rs708272 Taq1B C> T [T] CHST3 rs4148943 c. * 1278C> T C> T [CC] rs4148945 c. * 1361C> T C> T [CC] rs4148950 c. * 3477G> A G> A [AA] rs1871450 c. * 3785G> A G> A [AA] rs730720 c. * 4533C> T G> A [AA] rs12418 c. * 4785G> A G> A [AA] CNTF rs1800169 FS63TER G> A [A] COMT rs9332377 . C> T [T] rs737865 . T > C [C: CG] rs165599 . A> G [G: CG] rs4680 Val158Met G> A [G] CRHR2 rs2267715 . G> A [G] rs2284220 . A> G [G] rs7793837 . A> T [T] CYTSA rs5760410 g.4205975G> A A> G [G] DRD2 rs4436578 . T > C [C] rs1799978 A-241G A> G [G] rs6277 C957T C> T [C] rs1076560 . C> A [A] DRD3 rs167771 . A> G [G] rs6280 Ser9Gly T > C [C] EGFR rs121434568 L858R T> G [G] rs2227983 R497K G> A [A] EPHX1 rs1051740 Y113H, 337T > C T > C [CC] rs2234922 H139R, 416A > G A> G [GG] ERBB2 rs1136201 Ile655Val A> G [A] ERCC1 rs3212986 8092C> A G> T [T] rs11615 19007T > C, Asn118Asn C> T [T] ERCC2 rs13181 2251A > C, Lys751Gln T> G [G] F2 rs1799963 . G> A [A] FDPS rs2297480 . C> A [CC] FKBP5 rs1360780 . C> T [T] rs3800373 . T> G [G] GGCX rs699664 8016G> A G> A [A] GGH rs11545078 452C> T C> T [T] rs3780126 c.109 + 1307G > C C> T [C] rs11545077 Ala31Thr G> A [A] GNB3 rs5443 Ser275Ser C> T [T] GRIK2 rs2518224 . A> C {C} GRIK4 rs1954787 . C> T [T] GSK3B rs334558 -50T> C G> A [A: AAGA] rs13321783 IVS7 + 9227A> G C> T [T: AAGA] rs2319398 IVS7 + 11660G > T T> G [G: AAGA] rs6808874 IVS11 + 4251T > A A> T [A: AAGA] GSTM3 rs1799735 Intron6, 3 bp deletion ins> del [ins, G] GSTP1 rs1138272 C341T, A114V C> T [T] rs1695 * B, Ile105Val A> G [G] HLA-E rs1059510 Asn98Asn G> A [A] HMGCR rs12654264 . T> A [AA] rs3846662 . C> T [TT] HSPA1L rs2227956 . T > C [C] rs2075800 E602K G> A [A] HTR1A rs6295 . C> G [G] rs10042486 . T > C [C] rs1364043 . G> T [T] HTR2A rs9316233 . C> G [GG] rs7997012 Intron 5, 2 variant G> A [A] rs6311 -1438G> A C> T [T] rs6314 C1354T C> T [T} rs6313 102C> T C> T [T] HTR2C rs1414334 . G> C [C] rs518147 -697G / C C> G [G] rs3813928 c.-995G > A G> A [A] rs6318 Cys23Ser G> C [C] rs3813929 -759C> T C> T [C] HTR3B rs2276307 . A> G [G] HTR7 rs1935349 . G> A [A] IL1B rs16944 -511C / T G> A [A] IL28B rs8099917 . T> G [G] rs12980275 . A> G [A] rs8105790 . T > C [C] rs11881222 . A> G [G] rs7248668 . G> A [A] ITGB3 rs5918 Leu33Pro T > C [C] ITPA rs1127354 P32T C> A [A] KCNH2 rs3815459 . A> G [A] rs3807375 . A> G [A] rs12720441 R784W C> T [T] KCNJ11 rs5219 Lys23Glu, E23K C> T [T] KNG1 rs4686799 . C> T [T] rs5030062 . A> C [A] rs698078 . T > C [C] LDLR rs688 16730C> T C> T [T] LEMD2 rs2395402 . T > C [C] LRP2 rs2075252 . A> G [A] LTC4S rs730012 -444C A> C [C] METTL21A rs7569963 . G> A [G] rs4675690 . T > C [T] MICA rs2848716 . C> G [G] MLH1 rs1800734 -93 A> G [G] MTHFR rs1801131 1298A> C A> C [C] rs1801133 Ala222Val C> T [T] NEFM rs1379357 . G> C [C] NOS1AP rs10918594 . G> C [GG] rs10494366 . G> T [GG] NOS3 rs2070744 -786T> C T > C [CC] NPPA rs5065 T2238C A> G [GG] NQO1 rs1800566 * 2, c.558C > T C> T * 2 [T] NR1I2 rs1464603 g.252A> G T > C [C] NTRK1 rs2768759 . A> C [C] OPRM1 rs1799971 A118G A> G [G] P2RY1 rs701265 . A> G [G] rs1065776 893C> T C> T [T] P2RY12 rs2046934 T744C T > C [C] PTGS1 rs3842787 P17L C> T [T] PTGS2 rs20417 -765G> C G> C [C] RGS4 rs951439 . C> T [TT] rs2661319 . A> G [AA] rs2842030 . T> G [GG] SCN5A rs12053903 . C> T [TT] rs1805124 H558R A> G [GG] rs7626962 S1103Y G> T [TT] SLC10A1 rs2296651 800C> T G> A [T] SLC10A2 rs2301159 c. * 755C> T C> T [T] SLC19A1 rs1051266 Arg27His, c. * 746C > T A> G [AA] SLC1A1 rs2228622 . G> A [A: ACG] rs3780413 . C> G [C: ACG] rs3780412 . A> G [G: ACG] SLC22A1 rs34059508 1393G > A, G465R G> A [A] rs12208357 148C > T, R61C C> T [T] SLC22A16 rs714368 146A > G, His49Arg A> G [G] SLC22A2 rs316019 * 4, A270S G> T * 4 [G] rs8177517 K432Q A> C [C] rs8177507 M165I C> T [T] rs8177516 * 7, R400C C> T * 7 [T] SLC28A2 rs2413775 16334845T> A A> T [A] SLC28A3 rs11568388 1099G> A G> A [A] SLCO1B1 rs56199088 * 10, D655G A> G * 10 [G] rs2306283 * 1B, N130D C> T * 1B [C] rs56101265 * 2, F73L T > C * 2 [C] rs72559745 * 3, E156G A> G * 3 [G] rs56061388 * 3, V82A T > C * 3 [C] rs4149056 * 5, c.521T > C T > C * 5 [C] rs59502379 * 9, G488A G> C * 9 [C] rs4149081 intronic A / G G> A [A] rs11045879 intronic C / T T > C [C] SLCO1B3 rs11045585 . A> G [C] SLCO2B1 rs12422149 Arg312Gln G> A [A] ST6GAL1 rs10937275 - G> A [A] SULT1C4 rs1402467 p.Asp5Glu C> G [G] TCF7L2 rs12255372 . G> T [T] TNF rs1800629 -308G> A G> A [A] TP53 rs1042522 Arg72Pro G> C [G] UGT1A7 rs7586110 -57T> G T> G [G] UGT1A8 rs1042597 * 2, c.518C > G, Ala173Gly C> G [C] UGT2B10 rs7657958 Asp67Tyr tagging G> A [A] UGT2B15 rs1902023 * 2, Y85D T> G * 2 [G] UGT2B17 rs6552182 * 2, CNV Loss> Gain * 2 [Gain] ULK3 rs2290573 . C> T [CC] VDR rs1544410 BsmI G> A [A]

2) analyzing the genomic DNA isolated from the subject using an optimal analysis method (Glass microbead assay method and SNaPshot method) capable of analyzing major drug-related genes and genotypes in large quantities; And

3) Provides a method for predicting the drug response related to the drug genotype by classifying the biological activity of the individual, with the result of the drug genotype diagnosis of the individual obtained using the above analysis method.

The term 'single nucleotide polymorphism' (SNP) refers to the most common form of DNA sequence polymorphism (about 1/1 kb) due to differences in single base-pair variation in individual DNA.

The term 'SNP ID' indicates the sequence of each SNP and its position. Those skilled in the art will readily be able to ascertain the location and sequence of the SNP using the registration number. The specific sequence corresponding to the rs number of the SNP registered in NCBI's dbSNP (The Single Nucleotide Polymorphism Database) may change slightly over time. It will be apparent to those skilled in the art that the scope of the present invention also affects the altered sequence.

In the above method, the analysis method of step 2) is preferably performed by Glass microbeads assay method or SNaPshot (Single Base Extension) method, but is not limited thereto.

Also, as a result of the drug genotypes of individuals diagnosed by the method according to the present invention, there is a method of predicting drug responses according to drug genotypes and distinguishing individuals using Table 2 below.

Gene SNP ID Mutation type Predict drug response CYP2D6 rs1065852 * 10 [T] Poor metabolizer rs16947 * 2 [T] Poor metabolizer rs1135822 * 49 [A] Poor metabolizer rs35742686 * 3 [del] Poor metabolizer rs3892097 * 4 [A] Poor metabolizer rs5030655 * 6 [del] Poor metabolizer rs79738337 * 60 [T] . rs1058164 * 2, * 4, * 8, * 10 [C] Poor metabolizer rs1135840 * 2A [C] Normal rs28371525 * 41 [A] Poor metabolizer CYP2D6_2 * 60 [ins] . rs5030867 * 7 [C] Poor metabolizer rs5030865 * 8 [T] Poor metabolizer rs5030656 * 9 [del] Poor metabolizer CYP2C9 rs28371685 * 11 [T] Decreased rs9332239 * 12 [T] Decreased rs72558187 * 13 [C] Decreased rs72558190 * 15 [A] Decreased rs72558193 * 18 [C] Decreased rs1799853 * 2 [T] Decreased rs72558188 * 25 [del] Decreased rs1057910 * 3 [del] Decreased rs9332131 * 6 [G] Decreased rs9332092 [C] . rs9332096 [T] . rs9332098 [A] . rs4918758 * 1C [T] . VKORC1 rs9934438 [AG / AA] Poor metabolizer rs8050894 * 2 [G] Poor metabolizer rs2359612 * 2 [A] Poor metabolizer rs7200749 * 3F [A] Poor metabolizer rs7294 [A] Poor metabolizer rs17708472 * 4 [A] Poor metabolizer CYP2C19 rs12248560 * 17 [T] Ultra rapid metabolizer rs4244285 * 2 [A] Poor metabolizer rs4986893 * 3 [A] Poor metabolizer rs28399504 * 4 [G] Poor metabolizer rs41291556 * 8 [C] Poor metabolizer rs17885098 * 2, * 4 [T] Poor metabolizer rs3758580 * 2 [T] Poor metabolizer rs11568732 [G] . rs4986894 [C] . rs17886522 [C] . rs17878649 [A] . rs4417205 [G] . rs4917623 [T] . rs11188072 * 17 [T] Normal rs56337013 * 5A [T] Poor metabolizer DPYD rs3918290 * 2A [A] Decreased rs1801268 * 10 [T] Decreased rs1801159 * 5 [G] Normal rs72549309 * 7 [del, T] Decreased rs1801266 * 8 [T] Decreased rs1801265 * 9A [C] Normal rs1801267 * 9B [A] Decreased rs2297595 [C] Decreased rs72981743 [A] . DPYD_2 [C] . rs1042482 [A] . rs291593 [C] . DPYD_1 [G] . DPYD_3 [T] . DPYD_4 [G] . rs56279424 [T] . G6PD rs2230037 [T] Decreased rs1050828 [T] Decreased rs1050829 [G] Decreased rs34193178 [C] . rs2472393 [T] . rs743544 [T] . HLA-B * 1502 rs3130690 * 1502 [A] Carbamazepine Side Effects rs3909184 * 1502 [G] Carbamazepine Side Effects rs2844682 * 1502 [T] Carbamazepine Side Effects HLA-B * 5701 rs2395029 * 5701 [G] Abacarvir hypersensitivity reaction NAT1 rs4986988 * 11 [T] . rs4986989 * 11 [T] . rs4986990 * 11 [A] . rs4986783 * 11 [G] . rs5030839 * 15 [T] Slow acetylator rs56379106 * 17 [T] Slow acetylator rs56318881 * 19 [T] Slow acetylator rs56172717 * 22 [T} Slow acetylator rs55793712 * 5 [G] . rs72554612 * 5 [G] . NAT2 rs1799929 * 11A [T] Slow acetylator rs1041983 * 13 [T] Rapid acetylator rs1805158 * 19 [T] Slow acetylator rs1799930 * 6A [A] Slow acetylator rs1799931 * 7A [A] Slow acetylator rs4986996 * 12D [A] Slow acetylator rs4646241 [C] . rs4646242 [G] . rs4646243 [C] . rs4646246 [G] . TPMT rs1800460 * 3B [A] Poor metabolizer rs1142345 * 3C [G] Poor metabolizer rs75543815 * 6 [A] Poor metabolizer rs1800462 * 2 [C] Poor metabolizer rs12201199 [T] The risk of hearing loss due to cisplatin is high rs1800584 * 4 [A] Poor metabolizer UGT1A1 rs4124874 * 60 [C] Potentially toxic to Irinotecan rs887829 * 28 [A] Poor metabolizer rs28934877 * 38 [G] . rs55750087 * 29 [G] Poor metabolizer rs4148323 * 6 [A] Potentially toxic to Irinotecan rs34993780 * 7 [G] Poor metabolizer rs10929302 * 93 [A] Potentially toxic to Irinotecan rs3755319 [G] . rs2003569 [A] . CYP2E1 rs2031920 * 5 [T] . rs6413432 * 6 [A] . rs3813867 * 5A, * 5B [C] . rs2070673 * 7, [A] . rs2070875 [G] . rs2515641 [T] . CYP3A4 rs4987161 * 17 [C] Poor metabolizer rs28371759 * 18 [C] Rapid metabolizer rs2740574 * 1B [G] . CYP3A5 rs776746 * 3 [G] Poor metabolizer rs55965422 * 5 [G] Poor metabolizer rs10264272 * 6 [T] Poor metabolizer rs41303343 * 7 [ins, T] Poor metabolizer rs28383479 * 9 [A] Poor metabolizer rs41279854 * 10 [G] Poor metabolizer CYP4B1 rs4646487 [T] Docetaxel, Possible toxicity to thalidomid CYP4F2 rs2108622 [T] High doses of warfarin as a poor metabolizer CYP19A1 rs4646 [A] . rs6493497 [A] Effects of anastrozole, exemestane, and letrozole in patients with hormone receptor-positive metastatic breast cancer CYP1A2 rs762551 * 1F [A] Poor metabolizer rs2069526 * 1E [G] . rs2470890 * 1B [C] . rs2069522 [C] . rs3743484 [C] . rs72547513 * 11 [A] Poor metabolizer rs72547511 * 15 [G] Poor metabolizer rs72547515 * 16 [T] Poor metabolizer rs55889066 * 5 [A] Poor metabolizer rs28399424 * 6 [T] Poor metabolizer rs72547517 * 8 [A] Poor metabolizer rs2472304 [A] . rs4646427 [C] . rs2069521 [A] Poor metabolizer CYP1B1 rs1056836 * 3 [G] In patients with breast cancer, the probability of progression-free survival for paclitaxel is high CYP2A6 rs28399468 * 10 [T] Poor metabolizer rs28399433 * 13, * 15 [G] Poor metabolizer rs1809810 * 18 [T] Poor metabolizer rs56256500 * 23 [A] Poor metabolizer rs28399444 * 20 [del] Poor metabolizer CYP2B6 rs12721655 * 8 [G] Poor metabolizer rs1042389 [C] Possible maculopapular exanthema or hypersensitivity syndrome by carbamazepine rs34223104 * 22 [T] Rapid metabolizer rs36079186 * 27 [C] Poor metabolizer rs34097093 * 28 [T] Poor metabolizer rs3211371 * 5A [T] Poor metabolizer rs8192709 * 2 [T] Possible hemorrhagic cystitis in patients with hematopoietic stem cell transplantation rs28399499 * 18 [C] Poor metabolizer rs58425034 [C] Possibly high ALT value rs12721646 [T] Possibly high ALT value CYP2C8 rs11572103 * 2 [T] Poor metabolizer rs10509681 * 5 [del] Poor metabolizer rs11572177 [G] . rs1113129 [C] The risk of neurotoxicity by paclitaxel is low rs1341164 [C] Low metabolic activity of Docetaxel CYP2C18 rs12777823 [A] CYP2C19 poor metabolizer ABCB1 rs1045642 [T] Poor metabolizer rs1128503 [T] High dose methadone prescription required rs10280101 [C] Rapid metabolizer rs7787082 [A] Rapid metabolizer rs4148739 [G] Rapid metabolizer rs11983225 [C] Rapid metabolizer rs12720067 [A] Rapid metabolizer rs3213619 [C] Poor metabolizer rs2235015 [T] Rapid metabolizer rs10276036 [C] . rs35810889 [C] Poor metabolizer rs35023033 [T] Poor metabolizer rs28364274 [A] Rapid metabolizer rs35730308 [C] Rapid metabolizer rs2032582 [T / A] Poor metabolizer rs3789243 [T] Poor metabolizer ABCC1 rs3784862 [G] methotrexate low toxicity rs246240 [A] methotrexate low toxicity rs2238476 [C] methotrexate low toxicity rs35592 [T] methotrexate low toxicity rs35605 [T] . rs2230671 [A] Treatment effect of citalopram is high rs212090 [A] Treatment effect of citalopram is high rs35529209 [A] Decreased transport activity rs4148356 [A] Decreased transport activity rs45511401 [T] Possibility of acute cardiotoxicity by Doxorubicin rs119774 [A] Montelukast medication is effective in asthmatic patients ABCC2 rs717620 [A] Poor metabolizer rs3740066 [A] Poor metabolizer rs8187710 [A] Poor metabolizer rs2273697 [A] Possible Side Effects on Carbamazepine Drugs rs17222723 [A] Risk of non-Hodgkin lymphoma rs12762549 [G] Possibility of leukopenia / neutropenia by Docetaxel ABCC4 rs1751034 [C] Poor metabolizer rs9561778 [T] Drug side effects ABCC6 rs2238472 [A] Docetaxel, Possible toxicity to thalidomide ABCG2 rs13120400 [C] Rapid metabolizer rs17731538 [A] Poor metabolizer rs2622604 [T] Possible occurrence of myelosuppression in patients receiving Irinotecan rs2231142 [A] There is a high risk of gout, and patients with gefinitib may have diarrhea. ABO rs8176746 [AA] ACE gene activity is high and blood pressure reduction by ACE inhibitor is high rs495828 [GG] ACE gene activity is high and blood pressure reduction by ACE inhibitor is high ACE rs4341 [GG] Possible risk of diabetes associated with thiazide ADM rs11042725 [CC] Treatment effect of paroxetine is low ADRB2 rs1042713 [AA] Low effect of albuterol and salmeterol in asthmatic patients rs1800888 [T] The risk of coronary artery disease is high and the binding affinity for epineprin is low ADRB3 rs4994 [C] Possible weight gain due to olanzapine AGTR1 rs5182 [C] The risk of myocardial infarction is low in patients receiving ACE inhibitor therapy AKT1 rs2494732 [TT] The treatment effect of risperidone was high in first-episode schizophrenia patients ANKK1 rs1800497 [T] Bupropion is less effective AOX1 rs55754655 [GG] The treatment effect of azathioprine is low in patients with inflammatory growth disease APOB rs1367117 [G] Possibility of hyperlipidemia when ritonavir is administered in HIV patients APOC3 rs5128 [C] Possibility of hyperlipidemia when ritonavir is administered in HIV patients rs2854117 [A] Possibility of hyperlipidemia when ritonavir is administered in HIV patients ARG1 rs2781659 [G] The effect of bronchodilator treatment is low ATM rs4585 [T] Metformin has low therapeutic effect ATP7A rs2227291 [G] Docetaxel, Possible toxicity to thalidomide ATXN1 rs179997 [G] Alcohol dependence is high, and naltrexone is highly effective in treating alcoholism BAT3 rs750332 [G] Possible Stevens-Johnson syndrome and Toxic Epidermal Necrolysis by Carbamazepine BCHE rs1799807 [G] Succinylcholine, mivacurium treatment is ineffective rs28933390 [T] Succinylcholine, mivacurium treatment is ineffective rs28933389 [T] Succinylcholine, mivacurium treatment is ineffective BDKRB1 rs12050217 [AA] Perindopril cardiac event is unlikely BDKRB2 rs1799722 [T] Cough is likely to occur due to ACE inhibitors C6F10 rs3129900 [G] Lumiracoxib Effect High CACNG2 rs2284017 [C] Possible Bipolar Disorder in Lithium rs2284018 [C] Possible Bipolar Disorder in Lithium rs5750285 [C] Possible Bipolar Disorder in Lithium CAT rs10836235 [CC] Possible risk of cardiac damage to anthracyline CBR1 rs9024 [GG] Fast metabolism of Doxorubicin rs20572 [CC] Fast metabolism of Doxorubicin CBR3 rs2835285 [A] Poor metabolizer rs1056892 [A] Poor metabolizer CCND1 rs17852153 [G] Patients with colorectal cancer are more likely to survive treatment with cetuximab CDA rs2072671 [A: AA] Poor metabolizer, possible toxicity rs60369023 [A: AA] Poor metabolizer, possible toxicity rs532545 [AA] Poor prognosis CETP rs708272 [T] Possible high HDL cholesterol CHST3 rs4148943 [CC] Good prognosis rs4148945 [CC] Good prognosis rs4148950 [AA] Good prognosis rs1871450 [AA] Good prognosis rs730720 [AA] Good prognosis rs12418 [AA] Good prognosis CNTF rs1800169 [A] Effect of iloperidone in schizophrenia patients COMT rs9332377 [T] Possibility of hearing loss by cisplatin rs737865 [C: CG] Good bupropion effect on smoking cessation rs165599 [G: CG] Good bupropion effect on smoking cessation rs4680 [G] High-dose prescription for Morphine CRHR2 rs2267715 [G] The acute bronchoconstriction effect of salbutamol in pediatric asthmatics is low rs2284220 [G] The acute bronchoconstriction effect of salbutamol in pediatric asthmatics is low rs7793837 [T] The acute bronchoconstriction effect of salbutamol in pediatric asthmatics is low CYTSA rs5760410 [G] Methotrexate Possible Side Effects DRD2 rs4436578 [C] Possibility of weight gain for clozapine and risperidone in schizophrenia patients rs1799978 [G] When risperidone is prescribed in patients with schizophrenia, the risk of hyperprolactinemia is high due to elevated serum proractin levels rs6277 [C] Possibility of weight gain in clozapine and risperidone in schizophrenia patients. Low methadone effect rs1076560 [A] High Alcoholism Risk DRD3 rs167771 [G] Possibility of extrapyramidal symptom due to risperidone dose in mental patients rs6280 [C] Olanzapine has a high therapeutic effect EGFR rs121434568 [G] In patients with cancer, erlotinib, gefitinib rs2227983 [A] In patients with cancer, erlotinib, gefitinib EPHX1 rs1051740 [CC] Carbamazepine inactive metabolite increase rs2234922 [GG] Carbamazepine inactive metabolite increase ERBB2 rs1136201 [A] Risk of cardiac toxicity by trastuzumab ERCC1 rs3212986 [T] Platinum treatment is effective in NSCLC rs11615 [T] Platinum treatment is effective in NSCLC ERCC2 rs13181 [G] The possibility of early recurrence when cisplatin, fluorouracil, leucovorin is given in patients with colorectal cancer F2 rs1799963 [A] The risk of venous thromboembolism due to oral hormone replacement therapy is high and the risk of placental abruption is high FDPS rs2297480 [CC] Low efficacy of amino-bisphonates in postmenopausal women FKBP5 rs1360780 [T] High therapeutic efficacy of antidepressants rs3800373 [G] High therapeutic efficacy of antidepressants GGCX rs699664 [A] Warfarin does increases GGH rs11545078 [T] Poor metabolizer. Potentially toxic rs3780126 [C] Pemetrexed, bevacizumab Therapeutic Effect Good rs11545077 [A] Pemetrexed, bevacizumab Therapeutic Effect Good GNB3 rs5443 [T] Clozapine has the potential to gain weight, and the effectiveness of triptans GRIK2 rs2518224 {C} Adverse effects on citalopram in patients with depression GRIK4 rs1954787 [T] Low citalopram treatment GSK3B rs334558 [A: AAGA] Citalopram, low fluoxetine effect rs13321783 [T: AAGA] Citalopram, low fluoxetine effect rs2319398 [G: AAGA] Citalopram, low fluoxetine effect rs6808874 [A: AAGA] Citalopram, low fluoxetine effect GSTM3 rs1799735 [ins, G] Cisplatin, cyclophosphamide, thrombocytopenia, anemia, neuropathy, etc. GSTP1 rs1138272 [T] Thiotepa effective rs1695 [G] Good prognosis HLA-E rs1059510 [A] High risk of maculopapular exanthema in Carbamazepine HMGCR rs12654264 [AA] Statin is unlikely to develop colorectal cancer rs3846662 [TT] Low statin effect HSPA1L rs2227956 [C] Low Carbamazepine Sensitivity rs2075800 [A] Higher risk of maculopapular exanthema in Carbamazepine HTR1A rs6295 [G] Antidepressant treatment is effective rs10042486 [C] Antidepressant treatment is effective rs1364043 [T] Antidepressant treatment is effective HTR2A rs9316233 [GG] Escitalopram treatment efficacy is high rs7997012 [A] Treatment efficacy of citalopram is high rs6311 [T] Antidepressant treatment is ineffective rs6314 [T} Paroxetine Therapeutic Effect High rs6313 [T] Low antipsychotic drug effect. Olanzapine is likely to gain weight HTR2C rs1414334 [C] Clozapine, risperidone likely to develop metabolic syndrome rs518147 [G] Olanzapine is likely to gain weight rs3813928 [A] Low Risperidone Effect rs6318 [C] Olanzapine is likely to gain weight rs3813929 [C] Olanzapine is likely to gain weight HTR3B rs2276307 [G] Possible muscle aches in statin HTR7 rs1935349 [A] Possible muscle aches in statin IL1B rs16944 [A] Relatively low PEG-IFNalpha / RBV effect on HCV IL28B rs8099917 [G] Relatively low PEG-IFNalpha / RBV effect on HCV rs12980275 [A] Natural healing potential of hepatitis C virus is high rs8105790 [C] Relatively low PEG-IFNalpha / RBV effect on HCV rs11881222 [G] Relatively low PEG-IFNalpha / RBV effect on HCV rs7248668 [A] Relatively low PEG-IFNalpha / RBV effect on HCV ITGB3 rs5918 [C] Low efficacy of aspirin treatment ITPA rs1127354 [A] The possibility of anemia when administering Ribavirin to HCV, the possibility of neutropenia when ALL patients are receiving mercaptopurine treatment KCNH2 rs3815459 [A] The tendency of long QT in ECG rs3807375 [A] The tendency of long QT in ECG rs12720441 [T] Poor metabolizer KCNJ11 rs5219 [T] Increase in fasting blood glucose, postprandial blood glucose, and glycated hemoglobin in repaglinide KNG1 rs4686799 [T] Increased aldosterone response to diuretics rs5030062 [A] Increased aldosterone response to diuretics rs698078 [C] Increased aldosterone response to diuretics LDLR rs688 [T] Possible blood pressure rise at Atenolol LEMD2 rs2395402 [C] Carbamazepine has potential for hypersensitivity syndrome LRP2 rs2075252 [A] Possible hearing loss in cisplatin LTC4S rs730012 [C] In asthmatic patients, the symptoms may worsen in montelukast. METTL21A rs7569963 [G] Possibility of suicide in citalopram in patients with depression rs4675690 [T] Possibility of suicide in citalopram in patients with depression MICA rs2848716 [G] Possible Stevens-Johnson syndrome and Toxic Epidermal Necrolysis in Carbamazepine MLH1 rs1800734 [G] In patients with Hodgkin lymphoma, the risk of developing cancer is high during methylating treatment MTHFR rs1801131 [C] Folic acid, methotrexate have poor prognosis and possible side effects rs1801133 [T] Low activity of MTHFR, poor prognosis of methotrexate, possible side effects NEFM rs1379357 [C] Early response to risperidone in schizophrenia patients NOS1AP rs10918594 [GG] Associated with Longr QT interval. , Isradipine has no correlation with QT rs10494366 [GG] Associated with Longr QT interval. , Isradipine has no correlation with QT NOS3 rs2070744 [CC] Increased likelihood of recurrence in cyclophosphamide, doxorubicin, fluorouracil, and methotrexate medication in breast tumor patients NPPA rs5065 [GG] People with GG genotype have a good effect on chlorthalidone, and people with AA genotype have a good effect of calcium channel blocker (amlodipine). NQO1 rs1800566 * 2 [T] Poor metabolizer NR1I2 rs1464603 [C] Associated with oral midazolam clearance NTRK1 rs2768759 [C] Poor metabolizer OPRM1 rs1799971 [G] Alcohol dependence is high, and naltrexone is highly effective in treating alcoholism P2RY1 rs701265 [G] Adenosine diphosphate resistance to anti-platelet aggregation rs1065776 [T] Resistant to anti-platelet aggregation by aspirin P2RY12 rs2046934 [C] Low enzyme activity and low metabolism of clopidogrel PTGS1 rs3842787 [T] Risk of bleeding when performing coronary artery bypass without clopidogrel PTGS2 rs20417 [C] Anti-inflammatory after dental treatment in Rofecoxib - low likelihood of anti-analgesia RGS4 rs951439 [TT] Risperidone effect is good rs2661319 [AA] Risperidone effect is good rs2842030 [GG] Risperidone effect is good SCN5A rs12053903 [TT] QT interval reported to be short. Class i, iii antiarrhythmics, antipsychotics, beta blocking agents, qt-prolonging drug rs1805124 [GG] QT interval reported to be short. Class i, iii antiarrhythmics, antipsychotics, beta blocking agents, qt-prolonging drug rs7626962 [TT] QT interval reported to be short. Class i, iii antiarrhythmics, antipsychotics, beta blocking agents, qt-prolonging drug SLC10A1 rs2296651 [T] Decreased enzyme activity SLC10A2 rs2301159 [T] Docetaxel toxicity SLC19A1 rs1051266 [AA] Psoriasis, Rheumatoid Arthritis Patients are more likely to have methotrexate toxicity SLC1A1 rs2228622 [A: ACG] Possibility of OCD due to psychotropic drugs rs3780413 [C: ACG] Possibility of OCD due to psychotropic drugs rs3780412 [G: ACG] Possibility of OCD due to psychotropic drugs SLC22A1 rs34059508 [A] Metformin transport efficiency is low rs12208357 [T] Metformin transport efficiency is low SLC22A16 rs714368 [G] Doxorubicin transport efficiency is low and exposure is high SLC22A2 rs316019 * 4 [G] Metformin transport efficiency is high and nephrotoxicity by cisplatin is unlikely rs8177517 [C] Decreased transport activity rs8177507 [T] . rs8177516 * 7 [T] Decreased transport activity SLC28A2 rs2413775 [A] Increased enzyme activity SLC28A3 rs11568388 [A] Reduced enzyme activity SLCO1B1 rs56199088 * 10 [G] Decreased transport activity rs2306283 * 1B [C] Decreased transport activity rs56101265 * 2 [C] Decreased transport activity rs72559745 * 3 [G] Decreased transport activity rs56061388 * 3 [C] Decreased transport activity rs4149056 * 5 [C] Possible side effects of statin rs59502379 * 9 [C] Decreased transport activity rs4149081 [A] Decreased transport activity rs11045879 [C] Decreased transport activity SLCO1B3 rs11045585 [C] Low enzyme activity and low metabolism of clopidogrel SLCO2B1 rs12422149 [A] Rapid metabolizer. Montelukast treatment is ineffective ST6GAL1 rs10937275 [A] Possible liver damage to Flucloxacillin SULT1C4 rs1402467 [G] The effect of thalidomide treatment in castration-resistant prostate cancer patients TCF7L2 rs12255372 [T] Type 2 diabetes is likely, and sulfonylureas is ineffective TNF rs1800629 [A] Carbamazepine hypersensitivity TP53 rs1042522 [G] Paclitaxel, low efficacy of cisplatin treatment UGT1A7 rs7586110 [G] Possible anemia in Irinotecan UGT1A8 rs1042597 [C] Rapid metabolizer UGT2B10 rs7657958 [A] Rapid metabolizer UGT2B15 rs1902023 * 2 [G] Increased activity UGT2B17 rs6552182 * 2 [Gain] Poor metabolizer ULK3 rs2290573 [CC] Imatinib has poor prognosis VDR rs1544410 [A] Clodronate treatment is ineffective

In addition, the present invention can predict the response of a drug using the drug genotypic diagnosis result of the individual using the drug genotyping assay according to the present invention, but the drug is not limited to the following drugs, It can be extended against metabolizing drugs.

Gene Related drugs CYP2D6 aripiprazole, atorvastatin, paroxetine, perhexilline, propafenone, tamoxifen, tolterodine, tramadol, venlafaxine, zuclopenthixol, CYP2C9 acenocoumarol, celecoxib, clopidogrel, flurbiprofen, glibenclamide, glimepiride, glipizide, ibuprofen, lornoxican, losartan, nateglinide, phenprocoumon, phenytoin, phenobarbital, piroxicam, tenoxicam, tolbutamide, torasemide, warfarin VKORC1 acenocoumarol, phenprocoumon, warfarin CYP2C19 amitriptyline, cilostazol, citalopram, clobazam, clomipramine, clopidogrel, diazepam, escitalopram, gliclazide, glipizide, imipramine, lansoprazole, mephenytoin, nelfinavir, omeprazole, pantoprazole, phenobarbital, proguanil, quazepam, tamoxifen, trimipramine, voriconazole DPYD capecitabine, fluorouracil, tegafur G6PD chloroquine, dapsone, primaquine, rasburicase HLA-B * 1502 carbamazepine, phenytoin HLA-B * 5701 abacavir NAT1 isosorbidedinitrate, rifampin NAT2 isoniazid, isosorbidedinitrate, rifampin TPMT azathioprine, cisplatin, mercaptopurine, thioguanine UGT1A1 atazanavir, ezetimibe, irinotecan, raloxifene CYP2E1 acetaminophen, caffeine, chlorzoxazone, disulfiram, tamoxifen CYP3A4 amlodipine, docetaxel, nifedipine, sirolimus, tacrolimus CYP3A5 amlodipine, cilostazol, cyclosporine, nimodipine, paclitaxel, risperidone, sirolimus, tacrolimus, verapamil CYP4B1 docetaxel, thalidomide CYP4F2 acenocoumarol, warfarin CYP19A1 anastrozole, exemestane, letrozole CYP1A2 caffeine, clozapine, leflunomide, olanzapine CYP1B1 docetaxel, paclitaxel CYP2A6 nicotine CYP2B6 bupropion, carbamazepine, cyclophosphamide, efavirenz, mephenytoin, nevirapine, nicotine CYP2C8 amiodarone, amodiaquine, cerivastatin, docetaxel, ibuprofen, paclitaxel, repaglinide, rosiglitazone CYP2C18 clopidogrel ABCB1 epirubicin, etoposide, ezetimibe, fexofenadine, gabapentin, idarubicin, irinotecan, lamotrigine, cyclophosphamide, cyclophosphamide, paclitaxel, paroxetine, phenobarbital, phenytoin, prednisone, rhodamine123, rifampin, risperidone, ritonavir, SN-38, tacrolimus, tipifarnib, topiramate, valinomycin, valproicacid, venlafaxine, verapamil, vigabatrin, vinblastine ABCC1 citalopram, doxorubicin, irinotecan, methotrexate, montelukast, SN-38 ABCC2 carbamazepine, cyclosporine, docetaxel, doxorubicin, ezetimibe, irinotecan, lopinavir, mycophenolatemofetil, mycophenolicacid, SN-38 ABCC4 cyclophosphamide, tenofovir ABCC6 docetaxel, thalidomide ABCG2 atorvastatin, diflomotecan, fluvastatin, gefinitib, imatinib, irinotecan, lamivudine, leflunomide, methotrexate, rosuvastatin, sulfasalazine ABO ACE inhibitor, captopril, nitroprusside, perindopril ACE thiazide ADM paroxetine ADRB2 albuterol, salmeterol ADRB3 olanzapine AGTR1 captopril, enalapril, fosinopril, imidapril, lisinopril AKT1 risperidone ANKK1 bupropion AOX1 azathioprine APOB Irbesartan, ritonavir APOC3 ritonavir ARG1 budesonide, fluticasonepropionate, nedocromil, salbutamol ATM metformin ATP7A docetaxel, thalidomide ATXN1 naltrexone BAT3 carbamazepine BCHE mivacurium, succinylcholine BDKRB1 perindopril BDKRB2 ACE inhibitor, captopril, nitroprusside, perindopril C6F10 lumiracoxib CACNG2 lithium CAT anthracyline CBR1 doxorubicin CBR3 daunorubicin, doxorubicin CCND1 cetuximab CDA azacitidine, capecitabine, cisplatin, cytarabine, fluorouracil, gemcitabine, valproic acid CETP hmg coa reductase inhibitors, atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin CHST3 docetaxel, thalidomide CNTF iloperidone, COMT bupropion, cisplatin, methylphenidate, morphine CRHR2 salbutamol CYTSA 메트 로스 DRD2 clozapine, ethanol, methadone, olanzapine, risperidone DRD3 olanzapine, risperidone EGFR erlotinib, gefitinib EPHX1 carbamazepine phenytoin ERBB2 trastuzumab ERCC1 platinum ERCC2 fluorouracil, leucovorin F2 hormone FDPS alendronate, ibandronate, pamidronate, risedronate, zoledronate FKBP5 desipramine, fluoxetine, mirtazapine, venlafaxine GGCX warfarin GGH bevacizumab, methotrexate, pemetrexed GNB3 clozapine, nortriptyline, olanzapine, sildenafil, tryptans GRIK2 citalopram GRIK4 citalopram GSK3B citalopram, fluoxetine GSTM3 cisplatin, cyclophosphamide GSTP1 cisplatin, cyclophosphamide, doxorubicin, etoposide, fluorouracil, oxaliplatin, pyrimethamine, thiotepa HLA-E Carbamazepine HMGCR pravastatin, simvastatin HSPA1L Carbamazepine HTR1A fluvoxamine, paroxetine HTR2A amitriptyline, aripiprazole, citalopram, citalopram, escitalopram, olanzapine, paroxetine, paroxetine, perphenazine, risperidone, venlafaxine HTR2C clozapine, olanzapine, perphenazine, risperidone HTR3B statin HTR7 statin IL1B clodronate, etidronic acid, risedronate, tiludronate IL28B interferon alpha-2a, PEG-IFNalpha / RBV, recombinant, ribavirin ITGB3 aspirin ITPA mercaptopurine, ribavirin KCNH2 amiodarone KCNJ11 repaglinide KNG1 candesartan, hydrochlorothiazide LDLR atenolol LEMD2 carbamazepine LRP2 cisplatin LTC4S aspirin, montelukast METTL21A citalopram MICA carbamazepine MLH1 dacarbazine, procarbazine MTHFR folic acid, methotrexate NEFM risperidone NOS1AP isradipine, verapamil NOS3 cyclophosphamide, doxorubicin, fluorouracil, methotrexate NPPA amlodipine, chlorthalidone NQO1 epirubicin NR1I2 midazolam NTRK1 aspirin OPRM1 alfentanil, naltrexone, tramadol P2RY1 aspirin P2RY12 clopidogrel PTGS1 aspirin, clopidogrel PTGS2 ibuprofen, rofecoxib RGS4 risperidone SCN5A class i, iii antiarrhythmics, antipsychotics, beta blocking agents, qt-prolonging drugs SLC10A1 rosuvastatin SLC10A2 docetaxel SLC19A1 메트 로스 SLC1A1 clozapine, olanzapine, risperidone SLC22A1 metformin, MPP + SLC22A16 doxorubicin SLC22A2 amantadine, cimetidine, cisplatin, citalopram, imatinib, metformin, oxaliplatin, procainamide, quinidine SLC28A2 gemcitabine SLC28A3 cladribine, fludarabine SLCO1B1 niacinide, pitavastatin, pravastatin, repaglinide, rifampicin, rosuvastatin, simvastatin, sirolimus, SN-38, tacrolimus, torasemide, atorvastatin, caspofungin, ezetimibe, fexofenadine, fluvastatin, irinotecan, lopinavir, methotrexate, mycophenolol SLCO1B3 docetaxel, clopidogrel SLCO2B1 montelukast ST6GAL1 flucloxacillin SULT1C4 thalidomide TCF7L2 sulfonylureas TNF carbamazepine TP53 cisplatin, paclitaxel UGT1A7 irinotecan UGT1A8 cyclosporine, mycophenolatemofetil, mycophenolic acid UGT2B10 nicotine UGT2B15 lorazepam UGT2B17 steroid ULK3 imatinib VDR clodronate, etidronate

The glass microbead assay method and the SNaPshot method for analyzing an individual's drug genotype according to the present invention include primers and probes for single nucleotide polymorphism (SNP) of one or more of the drug metabolizing gene combinations.

The primers and probes can be easily designed by those skilled in the art.

Hereinafter, the present invention will be described in more detail by way of examples.

It should be noted, however, that the present invention is not limited by the following examples.

Analysis of drug genotypes in Koreans

<1-1> Korean people DNA  Sample collection

DNA samples from 155 Koreans (78 males and 77 females) were obtained from the Center for Disease Control and Prevention of the Breast Cancer Genome Center.

DNA concentration and quality were investigated in advance to increase the likelihood of success of the experiment. In order to receive the DNA samples, the Institutional Review Board (IRB) was reviewed and the bioethical code was observed. To successfully carry out the DNA genotyping experiment, DNA concentration was measured by fluorescence measurement using Picogreen, and 250 ng (5 ul) of DNA was used for each sample. A standard curve was prepared for the measurement of DNA concentration using pico green. The actual concentration was calculated after confirming that the concentration of the standard DNA was accurately plotted according to the dilution ratio. In addition, by confirming the degradation of DNA using electrophoresis, the characteristics of DNA which can not be confirmed by concentration measurement were grasped as a whole and the quality of genotype data was maximized.

<1-2> Drug effects, prediction of adverse events, pharmacokinetic response SNP  Selection and Probe Panel  making

392 SNPs were selected. Specifically, in order to select the SNPs of drug-related effects, adverse reaction predictions, and pharmacokinetic response-related genes, SNPs of drug gene genes selected by the US FDA, functional SNPs identified through literature review, SNPs were selected by examining the validity of target genes and SNPs after selecting non-synonymous, frame-shifted SNPs (available from Pharmacogenetics DB, NCBI SNP DB, and Korea Food & Drug Safety Assessment Database) A total of 392 SNPs were selected by analyzing the probable possibility of the probe and excluding the proximity (60 bp) SNP presence, repeat sequence, Tm limit, and tri-allele SNP from the final production list. Then, two probe panels composed of 392 SNPs were prepared.

Specifically, the possibility of producing probes for each type of genotype was analyzed using an ADT scoring system (Illumina, USA). 378 SNPs in Table 4 were passed through the probe set for glass microbead assay Respectively.

List of genotypes using Glass microbead assay Gene SNP ID A common name CYP2D6 rs1135840 * 2A, 4180G > C rs28371525 * 41, 2988G > A CYP2D6_2 * 60, 1887 rs5030867 * 7, 2935A > C rs5030865 * 8, 1758G > T rs5030656 * 9, 2615_2617delAAG CYP2C9 rs28371685 * 11, R335W rs9332239 * 12, 50338C> T rs72558187 * 13, 3276T > C rs72558190 * 15, 9100C> A rs72558193 * 18, 47391A > C rs1799853 * 2, Arg144Cys rs72558188 * 25, 353_362delAGAAATGGAA rs1057910 * 3, 3531_3540delAGAAATGGAA rs9332131 * 6, 818delA rs9332092 . rs9332096 . rs9332098 . rs4918758 * 1C, C1188T VKORC1 rs9934438 C6484T, 1173C > T rs8050894 * 2, 1542G > C, 6853G > C rs2359612 * 2, 2255C > T, 7566C > T rs7200749 * 3F, 3462C > T, 8773C > T rs7294 3730G> A rs17708472 * 4, 6009C > T, 698C > T CYP2C19 rs12248560 * 17, -806C > T rs4244285 * 2, G681A rs4986893 * 3, G636A rs28399504 * 4, A1G rs41291556 * 8, 12711T > C, W120R rs17885098 * 2, * 4, 99C > T rs11568732 -888T / G rs4986894 -97T / C rs17886522 G417G rs17878649 IVS1-47G / A rs4417205 IVS5-51C / G rs4917623 IVS7-106T / C rs11188072 * 17, -3402C > T rs56337013 * 5A, 1297C > T, R433W DPYD rs3918290 * 2A, IVS14 + 1G > A rs1801268 * 10, 2983G > T, V995F rs1801159 * 5, I543V, A1627G rs72549309 * 7, 295delTCAT rs1801266 * 8, R235W rs1801265 * 9A, C29R, T85C rs1801267 * 9B, 2657G > A, R886H rs2297595 496A > G, Met166Val DPYD_2 -268C / A rs1042482 3651G / A rs291593 3858T / C DPYD_1 N151D DPYD_3 S811S DPYD_4 T735A rs56279424 . G6PD rs2230037 1311C> T rs1050828 202G> A rs1050829 376A> G rs34193178 H350D rs2472393 IVS1 + 2955A / G rs743544 IVS1-773C / T HLA-B * 1502 rs3130690 HLA-B * 1502 rs3909184 HLA-B * 1502 rs2844682 HLA-B * 1502 HLA-B * 5701 rs2395029 HLA-B * 5701 NAT1 rs4986988 * 11, c.-344C > T rs4986989 * 11, c.-40A > T rs4986990 * 11, c.459G > A, p.T153T rs4986783 * 11, c.640T > G, p.S214A rs5030839 * 15, c.559C > T, p.R187X rs56379106 * 17, c.190C> T, p.R64W rs56318881 * 19, c.97C > T, p.R33X rs56172717 * 22, c.752A > T, p.D251V rs55793712 * 5, c.884A> G rs72554612 * 5, c.976delA NAT2 rs1799929 * 11, * 5B rs1041983 * 13, * 5G, * 6A rs1805158 * 19, 190C > T, R64W rs1799930 * 5E, * 6A rs1799931 * 7, G286E, * 6I rs4986996 * 12D rs4646241 . rs4646242 . rs4646243 . rs4646246 . TPMT rs1800460 * 3B rs1142345 * 3C, C240Y, 18485A> G rs75543815 * 6, 15327A> T rs1800462 * 2, 238G > C, A80P rs12201199 . rs1800584 *4 UGT1A1 rs4124874 * 60, -3263T> G rs887829 * 28 rs28934877 * 38 rs55750087 * 29, R367G rs4148323 * 6, Gly71Arg rs34993780 * 7 rs10929302 * 93, -3156G > A rs3755319 . rs2003569 . CYP2E1 rs2031920 * 5, -1053C > T rs6413432 * 6, 7632T> A rs3813867 * 5A, * 5B rs2070673 * 7, -333T> A rs2070875 . rs2515641 . CYP3A4 rs4987161 * 17, F189S, 670T > C rs28371759 * 18, L293P (T > C) rs2740574 * 1B, -392A> G CYP3A5 rs776746 * 3, 6986A> G rs55965422 * 5, 12952T> C rs10264272 * 6, 14690G > A rs41303343 * 7, 27131_27132insT rs28383479 * 9, 19386G> A rs41279854 * 10, 29753T> C CYP4B1 rs4646487 Arg173Trp CYP4F2 rs2108622 V433M CYP19A1 rs4646 . rs6493497 . CYP1A2 rs762551 * 1F, -163C > A rs2069526 * K, * 1E, -739T> G rs2470890 * 1B, 5347T > C rs2069522 . rs3743484 . rs72547513 * 11, F186L, 558C > A rs72547511 * 15, P42R, 125C> G rs72547515 * 16, R377Q, 2473G > A rs55889066 * 5, C406Y, 3497G > A rs28399424 * 6, R431W, 5090C > T rs72547517 * 8, R456H, 5166G > A rs2472304 . rs4646427 . rs2069521 . CYP1B1 rs1056836 * 3, 4326C> G, L432V CYP2A6 rs28399468 * 10, 6600G > T rs28399433 * 13, * 15, -48T> G rs28399444 * 20, 2141_2142delAA CYP2B6 rs12721655 * 8, 415A > G, K192E rs1042389 . rs34223104 * 22, -82C > T rs36079186 * 27, 593T > C, M198T rs34097093 * 28, 1132C> T, R378X rs3211371 * 1C, * 5, * 7, 1459C > T, Arg487Cys rs8192709 * 2, 64C > T rs28399499 * 18, 983T > C, I328T rs58425034 c.646-159G> C rs12721646 c.646-17C> T CYP2C8 rs11572103 * 2, I269F, A805T rs10509681 * 5, 2189delA rs11572177 . rs1113129 . rs1341164 . CYP2C18 rs12777823 . ABCB1 rs1045642 3435C> T rs1128503 Gly412Gly rs10280101 . rs7787082 . rs4148739 . rs11983225 . rs12720067 . rs3213619 -129T> C rs2235015 287-25G> T rs10276036 IVS9-44a> G rs35810889 M89T rs35023033 R669C rs28364274 V1251I rs35730308 W1108R rs3789243 . ABCC1 rs3784862 . rs246240 . rs2238476 . rs35592 16081823T> C rs35605 1684C> T rs2230671 4002G> A rs212090 5462T> A rs35529209 Ala989Thr rs4148356 Arg723Gln rs45511401 Gly671Val rs119774 . ABCC2 rs717620 -24C> T rs3740066 3972C> T rs8187710 Cys1515Tyr rs2273697 V417I rs17222723 Val1188Glu rs12762549 . ABCC4 rs1751034 3463 A> G rs9561778 c.3366 + 1243G > T ABCC6 rs2238472 Arg1268Gln ABCG2 rs13120400 . rs17731538 . rs2622604 . rs2231142 Q141K ABO rs8176746 . rs495828 . ACE rs4341 . ADM rs11042725 -1923C> A ADRB2 rs1042713 Arg16Gly rs1800888 Thr164Ile ADRB3 rs4994 Trp64Arg AGTR1 rs5182 573C> T AKT1 rs2494732 . ANKK1 rs1800497 . AOX1 rs55754655 Asn1135Ser APOB rs1367117 711C> T APOC3 rs5128 3238C> G rs2854117 -482C> T ARG1 rs2781659 . ATM rs4585 . ATP7A rs2227291 Val767Leu ATXN1 rs179997 A-241G BAT3 rs750332 . BCHE rs1799807 Asp70Gly rs28933390 Gly390Val rs28933389 Thr243Met BDKRB1 rs12050217 . BDKRB2 rs1799722 C-58T C6F10 rs3129900 . CACNG2 rs2284017 . rs2284018 . rs5750285 . CAT rs10836235 c.66 + 78C> T CBR1 rs9024 1096G> A rs20572 627C> T, A209A CBR3 rs2835285 Val93Ile rs1056892 Val244Met CCND1 rs17852153 870G> A CDA rs2072671 Lys27Gln, K27Q rs60369023 c.208G > A, Ala70Thr rs532545 -451C> T CETP rs708272 Taq1B CHST3 rs4148943 c. * 1278C> T rs4148945 c. * 1361C> T rs4148950 c. * 3477G> A rs1871450 c. * 3785G> A rs730720 c. * 4533C> T rs12418 c. * 4785G> A CNTF rs1800169 FS63TER COMT rs9332377 . rs737865 . rs165599 . rs4680 Val158Met CRHR2 rs2267715 . rs2284220 . rs7793837 . CYTSA rs5760410 g.4205975G> A DRD2 rs4436578 . rs1799978 A-241G rs6277 C957T rs1076560 . DRD3 rs167771 . rs6280 Ser9Gly EGFR rs121434568 L858R rs2227983 R497K EPHX1 rs1051740 Y113H, 337T > C rs2234922 H139R, 416A > G ERBB2 rs1136201 Ile655Val ERCC1 rs3212986 8092C> A rs11615 19007T > C, Asn118Asn ERCC2 rs13181 2251A > C, Lys751Gln F2 rs1799963 . FDPS rs2297480 . FKBP5 rs1360780 . rs3800373 . GGCX rs699664 8016G> A GGH rs11545078 452C> T rs3780126 c.109 + 1307G > C rs11545077 Ala31Thr GNB3 rs5443 Ser275Ser GRIK2 rs2518224 . GRIK4 rs1954787 . GSK3B rs334558 -50T> C rs13321783 IVS7 + 9227A> G rs2319398 IVS7 + 11660G > T rs6808874 IVS11 + 4251T > A GSTM3 rs1799735 Intron6, 3 bp deletion GSTP1 rs1138272 C341T, A114V rs1695 * B, Ile105Val HLA-E rs1059510 Asn98Asn HMGCR rs12654264 . rs3846662 . HSPA1L rs2227956 . rs2075800 E602K HTR1A rs6295 . rs10042486 . rs1364043 . HTR2A rs9316233 . rs7997012 Intron 5, 2 variant rs6311 -1438G> A rs6314 C1354T rs6313 102C> T HTR2C rs1414334 . rs518147 -697G / C rs3813928 c.-995G > A rs6318 Cys23Ser rs3813929 -759C> T HTR3B rs2276307 . HTR7 rs1935349 . IL1B rs16944 -511C / T IL28B rs8099917 . rs12980275 . rs8105790 . rs11881222 . rs7248668 . ITGB3 rs5918 Leu33Pro ITPA rs1127354 P32T KCNH2 rs3815459 . rs3807375 . rs12720441 R784W KCNJ11 rs5219 Lys23Glu, E23K KNG1 rs4686799 . rs5030062 . rs698078 . LDLR rs688 16730C> T LEMD2 rs2395402 . LRP2 rs2075252 . LTC4S rs730012 -444C METTL21A rs7569963 . rs4675690 . MICA rs2848716 . MLH1 rs1800734 -93 MTHFR rs1801131 1298A> C rs1801133 Ala222Val NEFM rs1379357 . NOS1AP rs10918594 . rs10494366 . NOS3 rs2070744 -786T> C NPPA rs5065 T2238C NQO1 rs1800566 * 2, c.558C > T NTRK1 rs2768759 . OPRM1 rs1799971 A118G P2RY1 rs701265 . rs1065776 893C> T P2RY12 rs2046934 T744C PTGS1 rs3842787 P17L PTGS2 rs20417 -765G> C RGS4 rs951439 . rs2661319 . rs2842030 . SCN5A rs12053903 . rs1805124 H558R rs7626962 S1103Y SLC10A1 rs2296651 800C> T SLC10A2 rs2301159 c. * 755C> T SLC19A1 rs1051266 Arg27His, c. * 746C > T SLC1A1 rs2228622 . rs3780413 . rs3780412 . SLC22A1 rs34059508 1393G > A, G465R rs12208357 148C > T, R61C SLC22A16 rs714368 146A > G, His49Arg SLC22A2 rs316019 * 4, A270S rs8177517 K432Q rs8177507 M165I rs8177516 * 7, R400C SLC28A2 rs2413775 16334845T> A SLC28A3 rs11568388 1099G> A SLCO1B1 rs56199088 * 10, D655G rs2306283 * 1B, N130D rs56101265 * 2, F73L rs72559745 * 3, E156G rs56061388 * 3, V82A rs4149056 * 5, c.521T > C rs59502379 * 9, G488A rs4149081 intronic A / G rs11045879 intronic C / T SLCO1B3 rs11045585 . SLCO2B1 rs12422149 Arg312Gln ST6GAL1 rs10937275 - SULT1C4 rs1402467 p.Asp5Glu TCF7L2 rs12255372 . TNF rs1800629 -308G> A TP53 rs1042522 Arg72Pro UGT1A7 rs7586110 -57T> G UGT1A8 rs1042597 * 2, c.518C > G, Ala173Gly UGT2B10 rs7657958 Asp67Tyr tagging UGT2B15 rs1902023 * 2, Y85D UGT2B17 rs6552182 * 2, CNV ULK3 rs2290573 . VDR rs1544410 BsmI

In addition, the 14 SNPs shown in Table 5, which are difficult to apply the large-scale analysis method in the ADT scoring, produced a probe set for SNaPshot (single base extension) analysis.

List of genotypes applying SNaPshot method gene SNP ID A common name CYP2D rs1065852 * 10, * 36, * 49, 100C > T rs16947 * 2, 2850C > T rs1135822 * 49, 1611T> A rs35742686 * 3, 2549delA rs3892097 * 4, 1846G > A rs5030655 * 6, 1707delT rs79738337 * 60, 2303C > T rs1058164 , * 4, * 8, * 10, 1661G > C CYP2A6 rs56256500 * 23, R203C, 607C > T rs1809810 * 18, 5668A> T CYP2C19 rs3758580 * 2, 80160C > T DPYD rs72981743 -243G / A NR1I2 rs1464603 g.252A> G ABCB1 rs2032582 .

<1-3> Selected SNP of Zino typing ( genotyping ) analysis

378 SNPs were genotyped by the Glass microbead assay method using the prepared probe set. The Zino typing analysis was performed as follows.

The above-mentioned Glass microbead assay was carried out by verifying the genotype information of 378 SNP markers using Veracode bead, which is a cylindrical glass microbead having a length of 240 microns and a diameter of 28 microns, The microbead code and fluorescent signal are scanned through a BeadXpress reader, which is an analyzer, and then the genotype is automatically determined by comparing the code recorded in the veracode bead with the ID of the sample.

Specifically, streptavidin and biotin were added using a probe panel to activate DNA, and allele specific oligos, locus specific oligos, and oligonucleotides were added to the activated DNA, A universal PCR primer oligo pool was added to hybridize. Then, oligonucleotides and primers specifically bound to each SNP were subjected to extension and ligation to perform PCR, and fluorescence probes specifically generated for each DNA and SNP were amplified by veracode After that, fluorescence image was implemented for each sample using BeadXpress. Genotypes of each SNP were determined automatically, and drug metabolism related genotype distributions were generated using these genotype results.

Then, in order to analyze the genotyping data, a cluster image of each SNP was examined to confirm whether or not the genotype clustering was correctly configured, and then the genotype clustering was performed using GenomeStudio software, , HWE, chromosome, and location.

In addition, 14 SNPs were genotyped by SNaPshot (single base extension) analysis using the prepared probe set.

Specifically, in the SNaPshot analysis method, first, genomic DNA was amplified by performing PCR using a primer, followed by removal of dNTP and primer, and then a purified template was obtained. It was then expanded by thermal cycling, and then unincorporated ddNTPs were removed. Then, electrophoresis was performed using a DNA analyzer, and data were analyzed with GeneScan and Genotyper software.

SNaPshot primer and probe information of CYP2D6 gene division primer  & Probe  order Length
(size) PCR CYP2D6_P3_F GTTATCCCAGAAGGCTTTGCAGGCTTCA (SEQ ID NO: 1) (5,101) CYP2D6_P3_R GCCGACTGAGCCCTGGGAGGTAGGTA (SEQ ID NO: 2) SNaPshot rs1065852 AACGCTGGGCTGCACGCTAC (SEQ ID NO: 3) 0 rs16947 tCAGAGAACAGGTACCACCACTATGC (SEQ ID NO: 4) 6 rs1135822 TTTTTTTTTTTCGGGCCCATAGCGCGCCAGGA (SEQ ID NO: 5) 2 rs35742686 (T) 10CCAGCTGGATGAGCTGCTAACTGAGCAC (SEQ ID NO: 6) 8 rs3892097 (T) 20CCTTACCCGCATCTCCCACCCCCA (SEQ ID NO: 7) 4 rs5030655 (T) 24GCCTGGGCAAGAAGTCGCTGGAGCAG (SEQ ID NO: 8) 0 rs79738337 (T) 31GGCAAGGAGAGAGGGTGGAGGCTGG (SEQ ID NO: 9) 6 rs1058164 (T) 41CGAGCAGAGGCGCTTCTCCGT (SEQ ID NO: 10) 2

SNaPshot primer and probe information of DPYD (-243G / A), CYP2A6 (R203C, 5668A> T), NR1I2 (g.252A> G), CYP2C19 (80160C> T), ABCB1 (rs2032582) gene SNP ID A common name designation primer / Probe  order Length DPYD rs72981743 -243G / A PCR Primer (F) CGAAAACAGGCAGACTAGGG 200 PCR Primer (R) AGAGCGGGTGCTCTACTCC SNaPshot Probe TCTGCTTGCAGGCTGGGGCGC 21 CYP2A6 rs56256500 * 23, R203C,
607C > T PCR Primer (F) AGTTGGCAGGTTGTGGTAGG 175 PCR Primer (R) CTCCAATGTCATCAGCTCCA SNaPshot Probe GAACTGGAAGATTCCTAGCATCATGC 26 NR1I2 rs1464603 g.252A> G PCR Primer (F) GACCAGCCCACACTCTGAAC 191 PCR Primer (R) CAAATCTGCCGTGTATGTGG SNaPshot Probe CTGGGGGACAGGTCAAGCTGAGGCCCTGAGA 31 CYP2A6 rs1809810 * 18, 5668A> T PCR Primer (F) TCCAGCCCCTGTGTACTTTC 180 PCR Primer (R) AAACTGCCCCTTCTCATTCA SNaPshot Probe t (7) CAACTTCCTCCTCCCTACCAGGGCACCGAAGTGT 38 ABCB1 rs2032582 . PCR Primer (F) TTGAAATGAAAATGTTGTCTGGA 198 PCR Primer (R) AAAAGATTGCTTTGAGGAATGG SNaPshot Probe t (13) CAAGCACTGAAAGATAAGAAAGAACTAGAAGGT 38 CYP2C19 rs375880 * 2, 8160C > T PCR Primer (F) TTCATGTACCCCTGAATTGCT 166 PCR Primer (R) CATCTGTGTAGGGCATGTGG SNaPshot Probe t (24) GCATGCAGGGGCTCCGGTTTCTGCCAAC 33

A total of 392 genotypes of 141 genes were successfully genotyped. The genotype call rate of the glass microbead assay was 99.99% (58,739 genotypes / 378 SNPs x 155 samples), indicating a very high success rate of genotype typing. In addition, the genotype call rate of the SNaPshot method was 100%. A total of 392 SNP genotype clusters and SNaPshot images were confirmed, and genotypes were confirmed to be correctly separated, and statistical analysis of SNP genotypes was performed.

CYP2D6  Drug genotype analysis of genes

In 155 Koreans, 14 SNPs of the CYP2D6 gene were genotyped and typed as 2A, * 3, * 4, * 5, * 6, * 7, * 8, * 9, * 10A, * 14A, * 34, * 41, * 49, * 60 were examined for 15 types of drug genotypes. CYP2D6 is known to be associated with the metabolism of various drugs (atomoxetine, clomipramine, codeine, desipramine, fluoxetine, imipramine, metoprolol, nortriptyline, tamoxifen, and venlafaxine).

Drug type and SNP list of CYP2D6 Drug Genotype A common name rs # Predict drug response * 2A 2850C> T rs16947 Normal 4180G > C rs1135840 * 3 2549delA rs35742686 Poor metabolizer (PM) *4 1846G> A rs3892097 Poor metabolizer (PM) * 5 CYP2D6 deleted . Poor metabolizer (PM) * 6 1707delT rs5030655 Poor metabolizer (PM) * 7 2935A> C rs5030867 Poor metabolizer (PM) *8 1758G> T rs5030865 Poor metabolizer (PM) * 9 2615_2617delAAG rs5030656 Poor metabolizer (PM) * 10A 100C > T rs1065852 Poor metabolizer (PM) 4180G > C rs1135840 * 14A 1758G> T rs5030865 Poor metabolizer (PM) 100C > T rs1065852 1611T> A rs1135822 4180G > C rs1135840 * 34 2850C> T rs16947 - * 39 1661G > C rs1058164 Normal 4180G > C rs1135840 * 41 2988G> A rs28371525 Poor metabolizer (PM) * 49 100C > T rs1065852 Poor metabolizer (PM) 1611T> A rs1135822 4180G > C rs1135840 * 60 2303C> T rs79738337 - 1887insTA CYP2D6_2

SNP genotype typing results of CYP2D6 SNP A common name Risk allele Major  > Minor Genotype (# samples) Total (n) MAF HWE rs1065852 * 10, * 36, * 49, 100C > T * 10 [T] C> T CC 53,  The CT (60) TT (42) 155 0.465 0.006 rs16947 * 2, 2850C > T * 2 [T] C> T CC 124, CT (27) TT (4) 155 0.113 0.105 rs1135822 * 49, 1611T> A * 49 [A] T> A TT 153  TA (2) AA (O) 155 0.006 0.936 rs35742686 * 3, 2549delA * 3 [del] ins> del ins (155) insdel (0) del (0) 155 0.000 1,000 rs3892097 * 4, 1846G > A * 4 [A] G> A GG (154)  GA (1) AA (O) 155 0.003 0.968 rs5030655 * 6, 1707delT * 6 [del] ins> del ins (155) insdel (0) del (0) 155 0.000 1,000 rs79738337 * 60, 2303C > T * 60 [T] C> T CC 149 CT (6) TT (0) 155 0.019 0.806 rs1058164 * 2, * 4, * 8, * 10, 1661G > C * 2, * 4, * 8, * 10 [C] C> G CC (69) CG 52, GG (34) 155 0.387 0.000 rs1135840 * 2A, 4180G > C * 2A [G] C> G CC (76)  CG (53) GG (26) 155 0.339 0.003 rs28371525 * 41, 2988G > A * 41 [A] G> A GG (155) GA (0) AA (O) 155 0.000 1,000 CYP2D6_2 * 60, 1887 * 60 [ins] del ins del (155) delins (0) ins (0) 155 0.000 1,000 rs5030867 * 7, 2935A > C * 7 [C] A> C AA (155) AC (O) CC (0) 155 0.000 1,000 rs5030865 * 8, 1758G > T * 8 [T] C> T CC 151, CT (4) TT (0) 155 0.013 0.871 rs5030656 * 9, 2615_2617delAAG * 9 [del] ins> del ins (155) insdel (0) del (0) 155 0.000 1,000

Drug genotyping of the CYP2D6 gene results in extensive metabolism such as * 1 / * 1, * 1 / * 34, * 1 / * 39, * 2A / * 34 / * 39, * 34 / * 34, * 39 / * 39 The extensive metabolizer was found in 56 patients (36.1%) and the intermediate metabolizer was * 1 / * 10A, * 4 / * 10A, * 8 / * 34, * 8 * 34 / * 34, (63.9%) with * 10A / * 34, * 10A / * 34 / * 49, * 10A / * 39, * 8 / * 10A / * 34, Weak metabolizers such as * 5, * 6, * 7, * 9, * 14A, * 41 and * 49 were not found in 155 Korean patients (Table 9).

Drug genotype frequency of CYP2D6 CYP2D6  Allele Sample ratio Predict drug response * 1 / * 1 12 7.7% Extensive Metabolizer (EM) * 1 / * 34 8 5.2% Extensive Metabolizer (EM) * 1 / * 39 13 8.4% Extensive Metabolizer (EM) * 1 / * 10A 41 26.5% Intermediate Metabolizer (IM) * 2A / * 34 / * 39 One 0.6% Extensive Metabolizer (EM) * 4 / * 10A One 0.6% Intermediate Metabolizer (IM) * 8 / * 34 One 0.6% Intermediate Metabolizer (IM) * 8 * 34 / * 34 One 0.6% Intermediate Metabolizer (IM) * 10A / * 34 14 9.0% Intermediate Metabolizer (IM) * 10A / * 34 / * 49 One 0.6% Intermediate Metabolizer (IM) * 10A / * 39 2 1.3% Intermediate Metabolizer (IM) * 8 / * 10A / * 34 2 1.3% Intermediate Metabolizer (IM) * 10A / * 10A 36 23.2% Intermediate Metabolizer (IM) * 34 / * 34 3 1.9% Extensive Metabolizer (EM) * 39 / * 39 19 12.3% Extensive Metabolizer (EM) * 3, * 5, * 6, * 7, * 9, * 14A, * 41, * 49 0 0.0% Poor Metabolizer (PM) * 60 0 0.0% -

CYP2C9  And VKORC1  Drug genotype analysis of genes

In 155 Koreans, 13 SNPs of CYP2C9 and 6 SNPs of VKORC1 were genotyped. CYP2C9 and VKORC1 are known to be related to the dose of warfarin (blood coagulant).

Analysis of genetic polymorphisms of CYP2C9 * 2, * 3 and rs8050894 of VKORC1 revealed that 1 (0.7%) of the individuals with CC: * 1 / * 1 and CG: * 1 / * 1 were individuals with VKORC1-CYP2C9 genotype GG: * 1 / * 3: 9 (5.8%), CG: * 1 / * 3 was one (0.6% Respectively. CC or CG: * 1 / * 1 is recommended for warfarin doses of 5-7 mg / day and GG: * 1 / * 1 and CG: * 1 / * 3 is recommended for 3- 4 mg / day, and GG: * 1 / * 3 was appropriate for warfarin doses of 0.5 to 2 mg / day (Table 11).

Assessment of warfarin dosage according to drug genotype frequency and genotype of CYP2C9, VKORC1 CYP2C9 * 1 / * 1 CYP2C9 * 1 / * 2 CYP2C9 * 1 / * 3 CYP2C9 * 2 / * 2 CYP2C9 * 2 / * 3 CYP2C9 * 3 / * 3 VKORC1
(rs8050894) Freq. Dose Freq. Dose Freq. Dose Freq. Dose Freq. Dose Freq. Dose CC One
(0.6%) 5 ~ 7 0 5 ~ 7 0 3 to 4 0 3 to 4 0 3 to 4 0 0.5 to 2 CG 26
(16.8%) 5 ~ 7 0 3 to 4 One
(0.6%) 3 to 4 0 3 to 4 0 0.5 to 2 0 0.5 to 2 GG 118
(76.1%) 3 to 4 0 3 to 4 9
(5.8%) 0.5 to 2 0 0.5 to 2 0 0.5 to 2 0 0.5 to 2

Genotype typing result of SNP of CYP2C9, VKORC1 gene SNP ID A common name Major >
Minor Major Hetero Minor MAF HWE VKORC1 rs9934438 C6484T, 1173C > T A> G 126 22 2 0.090 0.368 rs8050894 * 2, 1542G > C, 6853G > C G> C 126 23 One 0.093 0.964 rs2359612 * 2, 2255C > T, 7566C > T A> G 126 23 One 0.090 0.964 rs7200749 3F, 3462C > T, 8773C > T G> A 150 0 0 0.000 1,000 rs7294 3730G> A G> A 127 22 One 0.090 0.965 rs17708472 * 4, 6009C > T, 698C > T G> A 149 One 0 0.000 0.967 CYP2C9 rs28371685 * 11, R335W C> T 150 0 0 0.000 1,000 rs9332239 * 12, 50338C> T C> T 150 0 0 0.000 1,000 rs72558187 * 13, 3276T > C T > C 150 0 0 0.007 1,000 rs72558190 * 15, 9100C> A C> A 150 0 0 0.000 1,000 rs72558193 * 18, 47391A > C A> C 150 0 0 0.000 1,000 rs1799853 * 2, Arg144Cys C> T 150 0 0 0.000 1,000 rs72558188 * 25, 353_362delAGAAATGGAA ins> del 150 0 0 0.000 1,000 rs1057910 * 3, 42614A> C A> C 137 13 0 0.032 0.579 rs9332131 * 6, 818delA ins> del (A> G) 150 0 0 0.000 1,000 rs9332092 . T > C 137 13 0 0.032 0.579 rs9332096 . C> T 129 20 One 0.081 0.816 rs9332098 . G> A 137 13 0 0.032 0.579 rs4918758 * 1C, C1188T T > C 45 77 28 0.395 0.624

CYP2C19  Drug genotype analysis of genes

In 155 Koreans, Zino was typed in * 2, * 3, * 4, * 5A, * 8, and * 17 SNP of the CYP2C19 gene. CYP2C19 is known to be associated with the effect of clopidogrel.

As a result, wild type (67.2%) was found to be the most common, and 51, 17 and 9 persons were found to be * 1 / * 2, * 1 / * 3, * 2 / * 3 respectively These people were predicted to have low clopidogrel efficacy and 11 (7.1%) genotype * 2 / * 2 predicted to have very low clopidogrel effects (Table 13).

Clopidogrel efficacy according to drug genotype frequency and genotype of CYP2C19 CYP2C19  Genotype combination Freq . (%) Drug efficacy CYP2C19 * 1 / * 1 67 (43.2%) Typical Chloropedogrel efficacy CYP2C19 * 1 / * 2 51 (32.9%) Reduced Chloropedogrel efficacy CYP2C19 * 1 / * 3 17 (11.0%) CYP2C19 * 2 / * 3 9 (5.8%) CYP2C9 * 2 / * 2 11 (7.1%) Very Reduced Chloropedogrel Efficiency

SNP genotype typing results of CYP2C19 SNP ID A common name Major >
Minor Major Hetero Minor MAF HWE rs12248560 * 17, -806C > T C> T 131 18 One 0.026 0.662 rs4244285 * 2, G681A G> A 64 78 8 0.265 0.011 rs4986893 * 3, G636A G> A 128 21 One 0.085 0.891 rs28399504 * 4, A1G A> G 149 One 0 0.000 0.967 rs41291556 * 8, 12711T > C, W120R T > C 150 0 0 0.000 1,000 rs17885098 * 2, * 4, * 99C > T C> T 139 11 0 0.127 0.641 rs3758580 2, 80160C> T C> T 87 54 9 0.240 0.872 rs11568732 -888T / G T> G 113 34 3 0.127 0.814 rs4986894 -97T / C T > C 64 78 8 0.265 0.011 rs17886522 G417G A> C 128 21 One 0.085 0.891 rs17878649 IVS1-47G / A G> A 128 21 One 0.085 0.891 rs4417205 IVS5-51C / G C> G 64 78 8 0.265 0.011 rs4917623 IVS7-106T / C C> T 42 78 30 0.420 0.567 rs11188072 * 17, -3402C > T C> T 146 4 0 0.026 0.869 rs56337013 * 5A, 1297C > T, R433W C> T 150 0 0 0.000 1,000

HLA -B * 1502 gene analysis of drug genotypes

In 155 Koreans, rs3909184 and rs2844682 SNPs of the HLA-B * 1502 gene were genotyped. HLA-B * 1502 is known to be associated with Stevens-Johnson syndrome and Toxic Epidermal Necrolysis, which are side effects of Carbamazepine (an antiepileptic drug).

The risk of adverse effects of carbamazepine on drug genotype frequency and genotype of HLA-B * 1502 rs2844682 rs3909184 HLA -B * Type 1502 Freq . (%) result CC CC none 94 (60.6%) Low risk CC CG none 32 (20.6%) Low risk CC GG none 4 (2.6%) Low risk CT CC none 38 (24.5%) Low risk CT CG Decision impossible 4 (2.6%) . CT GG * 1502 (1 copy) 0 High risk TT CC none 2 (1.3%) Low risk TT CG * 1502 (1 copy) 1 (0.6%) High risk TT GG * 1502 (2 copies) 0 High risk

TPMT  Drug genotype analysis of genes

In 155 Koreans, Zinot typed * 2, * 3B, * 3C, * 4, and * 6 SNP of TPMT gene. TPMT is known to be associated with side effects of the immunosuppressants azathioprine, mercaptopurine, thioguanine and fluorouracil.

As a result, * 1 / * 3C, * 1 / * 6 genotypes were found in 9 people, and they were expected to have drug toxicity (Table 16).

Risk Analysis of Fluorouracil Adverse Effect According to Genotype TPMT  Genotype combination Freq . (%) Enzyme activity result * 1 / * 1 146 (94.2%) normal Typical drug efficacy * 1 / * 3B or * 1 / * 3C 7 (4.5%) decrease Increased drug toxicity * 1 / * 6 2 (1.3%)

Sequence analysis ( Sequencing ) Genotype accuracy verification

The genotype results obtained using the Glass microbead assay method were re-analyzed by direct sequencing method in the same sample to verify the genotype accuracy.

20 SNPs (rs2740574A> C of CYP3A4> rs10509681A> G (K329R) of CYP2C8, rs28399499T> C (I328T) of CYP2B6, rs1902023 G> T (D85Y) of UGT2B15, rs10264272C> T and rs28383479G> A (A337T) of CYP3A5, , Rs1801159A> G (I543V) and rs1801159A (I543V) of DPYD, rs1799931G> A (G286E) of NAT2, rs1800460G> A (A154T) and rs1142345T> C (Y240C) of TMPT, and rs4148323G> A (R71G) of UGT1A1. ] Were directly sequenced and compared with those of Glass microbead assay.

As a result, a total of 3100 genotypes (20 SNPs x 155 samples) were matched and 100% accuracy was obtained.

Claims (8)

i) analyzing the genotype of the gene listed in [Table 21] from the genomic DNA isolated from the subject; Gene SNP ID A common name Major> Minor Mutation type CYP2D6 rs1065852 * 10, * 36, * 49, 100C > T C> T * 10 [T] rs16947 * 2, 2850C > T C> T * 2 [T] rs1135822 * 49, 1611T> A T> A * 49 [A] rs35742686 * 3, 2549delA ins> del * 3 [del] rs3892097 * 4, 1846G > A G> A * 4 [A] rs5030655 * 6, 1707delT ins> del * 6 [del] rs79738337 * 60, 2303C > T C> T * 60 [T] rs1058164 * 2, * 4, * 8, * 10, 1661G > C C> G * 2, * 4, * 8, * 10 [C] rs1135840 * 2A, 4180G > C C> G * 2A [C] rs28371525 * 41, 2988G > A G> A * 41 [A] CYP2D6_2 * 60, 1887 del ins * 60 [ins] rs5030867 * 7, 2935A > C A> C * 7 [C] rs5030865 * 8, 1758G > T C> T * 8 [T] rs5030656 * 9, 2615_2617delAAG ins> del * 9 [del] CYP2C9 rs28371685 * 11, R335W C> T * 11 [T] rs9332239 * 12, 50338C> T C> T * 12 [T] rs72558187 * 13, 3276T > C T > C * 13 [C] rs72558190 * 15, 9100C> A C> A * 15 [A] rs72558193 * 18, 47391A > C A> C * 18 [C] rs1799853 * 2, Arg144Cys C> T * 2 [T] rs72558188 * 25, 353_362delAGAAATGGAA ins> del * 25 [del] rs1057910 * 3, 3531_3540delAGAAATGGAA ins> del * 3 [del] rs9332131 * 6, 818delA ins> del (A> G) * 6 [G] rs9332092 . T > C [C] rs9332096 . C> T [T] rs9332098 . G> A [A] rs4918758 * 1C, C1188T T > C * 1C [T] VKORC1 rs9934438 C6484T, 1173C > T A> G [AG / AA] rs8050894 * 2, 1542G > C, 6853G > C G> C * 2 [G] rs2359612 * 2, 2255C > T, 7566C > T A> G * 2 [A] rs7200749 * 3F, 3462C > T, 8773C > T G> A * 3F [A] rs7294 3730G> A G> A [A] rs17708472 * 4, 6009C > T, 698C > T G> A * 4 [A] CYP2C19 rs12248560 * 17, -806C > T C> T * 17 [T] rs4244285 * 2, G681A G> A * 2 [A] rs4986893 * 3, G636A G> A * 3 [A] rs28399504 * 4, A1G A> G * 4 [G] rs41291556 * 8, 12711T > C, W120R T > C * 8 [C] rs17885098 * 2, * 4, 99C > T T > C * 2, * 4 [T] rs3758580 * 2, 80160C > T C> T * 2 [T] rs11568732 -888T / G T> G [G] rs4986894 -97T / C T > C [C] rs17886522 G417G A> C [C] rs17878649 IVS1-47G / A G> A [A] rs4417205 IVS5-51C / G C> G [G] rs4917623 IVS7-106T / C C> T [T] rs11188072 * 17, -3402C > T C> T * 17 [T] rs56337013 * 5A, 1297C > T, R433W C> T * 5A [T] DPYD rs3918290 * 2A, IVS14 + 1G > A G> A * 2A [A] rs1801268 * 10, 2983G > T, V995F G> T * 10 [T] rs1801159 * 5, I543V, A1627G A> G * 5 [G] rs72549309 * 7, 295delTCAT ins> del * 7 [del, T] rs1801266 * 8, R235W C> T * 8 [T] rs1801265 * 9A, C29R, T85C T > C * 9A [C] rs1801267 * 9B, 2657G > A, R886H G> A * 9B [A] rs2297595 496A > G, Met166Val T > C [C] rs72981743 -243G / A G> A [A] DPYD_2 -268C / A A> C [C] rs1042482 3651G / A G> A [A] rs291593 3858T / C T > C [C] DPYD_1 N151D A> G [G] DPYD_3 S811S C> T [T] DPYD_4 T735A A> G [G] rs56279424 . G> T [T] G6PD rs2230037 1311C> T C> T [T] rs1050828 202G> A G> A [T] rs1050829 376A> G A> G [G] rs34193178 H350D G> C [C] rs2472393 IVS1 + 2955A / G C> T [T] rs743544 IVS1-773C / T C> T [T] HLA-B * 1502 rs3130690 HLA-B * 1502 C> A * 1502 [A] rs3909184 HLA-B * 1502 C> G * 1502 [G] rs2844682 HLA-B * 1502 C> T * 1502 [T] HLA-B * 5701 rs2395029 HLA-B * 5701 T> G * 5701 [G] NAT1 rs4986988 * 11, c.-344C > T C> T * 11 [T] rs4986989 * 11, c.-40A > T A> T * 11 [T] rs4986990 * 11, c.459G > A, p.T153T G> A * 11 [A] rs4986783 * 11, c.640T > G, p.S214A T> G * 11 [G] rs5030839 * 15, c.559C > T, p.R187X C> T * 15 [T] rs56379106 * 17, c.190C> T, p.R64W C> T * 17 [T] rs56318881 * 19, c.97C > T, p.R33X C> T * 19 [T] rs56172717 * 22, c.752A > T, p.D251V A> T * 22 [T} rs55793712 * 5, c.884A> G A> G * 5 [G] rs72554612 * 5, c.976delA ins> del * 5 [G] NAT2 rs1799929 * 11, * 5B C> T * 11A [T] rs1041983 * 13, * 5G, * 6A C> T * 13 [T] rs1805158 * 19, 190C > T, R64W C> T * 19 [T] rs1799930 * 5E, * 6A G> A * 6A [A] rs1799931 * 7, G286E, * 6I G> A * 7A [A] rs4986996 * 12D G> A * 12D [A] rs4646241 . T > C [C] rs4646242 . A> G [G] rs4646243 . T > C [C] rs4646246 . A> G [G] TPMT rs1800460 * 3B G> A * 3B [A] rs1142345 * 3C, C240Y, 18485A> G A> G * 3C [G] rs75543815 * 6, 15327A> T T> A * 6 [A] rs1800462 * 2, 238G > C, A80P G> C * 2 [C] rs12201199 . A> T [T] rs1800584 *4 G> A * 4 [A] UGT1A1 rs4124874 * 60, -3263T> G A> C * 60 [C] rs887829 * 28 G> A * 28 [A] rs28934877 * 38 A> G * 38 [G] rs55750087 * 29, R367G C> G * 29 [G] rs4148323 * 6, Gly71Arg G> A * 6 [A] rs34993780 * 7 T> G * 7 [G] rs10929302 * 93, -3156G > A G> A * 93 [A] rs3755319 . T> G [G] rs2003569 . G> A [A] CYP2E1 rs2031920 * 5, -1053C > T C> T * 5 [T] rs6413432 * 6, 7632T> A T> A * 6 [A] rs3813867 * 5A, * 5B G> C * 5A, * 5B [C] rs2070673 * 7, -333T> A T> A * 7, [A] rs2070875 . T> G [G] rs2515641 . C> T [T] CYP3A4 rs4987161 * 17, F189S, 670T > C T > C * 17 [C] rs28371759 * 18, L293P (T > C) T > C * 18 [C] rs2740574 * 1B, -392A> G A> G * 1B [G] CYP3A5 rs776746 * 3, 6986A> G G> A * 3 [G] rs55965422 * 5, 12952T> C A> G * 5 [G] rs10264272 * 6, 14690G > A C> T * 6 [T] rs41303343 * 7, 27131_27132insT del ins * 7 [ins, T] rs28383479 * 9, 19386G> A G> A * 9 [A] rs41279854 * 10, 29753T> C A> G * 10 [G] CYP4B1 rs4646487 Arg173Trp C> T [T] CYP4F2 rs2108622 V433M C> T [T] CYP19A1 rs4646 . C> A [A] rs6493497 . G> A [A] CYP1A2 rs762551 * 1F, -163C > A A> C * 1F [A] rs2069526 * K, * 1E, -739T> G T> G * 1E [G] rs2470890 * 1B, 5347T > C C> T * 1B [C] rs2069522 . T > C [C] rs3743484 . G> C [C] rs72547513 * 11, F186L, 558C > A C> A * 11 [A] rs72547511 * 15, P42R, 125C> G C> G * 15 [G] rs72547515 * 16, R377Q, 2473G > A C> T * 16 [T] rs55889066 * 5, C406Y, 3497G > A G> A * 5 [A] rs28399424 * 6, R431W, 5090C > T C> T * 6 [T] rs72547517 * 8, R456H, 5166G > A G> A * 8 [A] rs2472304 . G> A [A] rs4646427 . T > C [C] rs2069521 . G> A [A] CYP1B1 rs1056836 * 3, 4326C> G, L432V C> G * 3 [G] CYP2A6 rs28399468 * 10, 6600G > T G> T * 10 [T] rs28399433 * 13, * 15, -48T> G T> G * 13, * 15 [G] rs1809810 * 18, 5668A> T A> T * 18 [T] rs56256500 * 23, R203C, 607C > T G> A * 23 [A] rs28399444 * 20, 2141_2142delAA ins> del * 20 [del] CYP2B6 rs12721655 * 8, 415A > G, K192E A> G * 8 [G] rs1042389 . T > C [C] rs34223104 * 22, -82C > T T > C * 22 [T] rs36079186 * 27, 593T > C, M198T T > C * 27 [C] rs34097093 * 28, 1132C> T, R378X C> T * 28 [T] rs3211371 * 1C, * 5, * 7, 1459C > T, Arg487Cys T > C * 5A [T] rs8192709 * 2, 64C > T C> T * 2 [T] rs28399499 * 18, 983T > C, I328T T > C * 18 [C] rs58425034 c.646-159G> C G> C [C] rs12721646 c.646-17C> T C> T [T] CYP2C8 rs11572103 * 2, I269F, A805T A> T * 2 [T] rs10509681 * 5, 2189delA ins> del * 5 [del] rs11572177 . A> G [G] rs1113129 . G> C [C] rs1341164 . T > C [C] CYP2C18 rs12777823 . G> A [A] ABCB1 rs1045642 3435C> T C> T [T] rs1128503 Gly412Gly T > C [T] rs10280101 . A> C [C] rs7787082 . G> A [A] rs4148739 . A> G [G] rs11983225 . T > C [C] rs12720067 . G> A [A] rs3213619 -129T> C T > C [C] rs2235015 287-25G> T G> T [T] rs10276036 IVS9-44a> G C> T [C] rs35810889 M89T T > C [C] rs35023033 R669C C> T [T] rs28364274 V1251I G> A [A] rs35730308 W1108R T > C [C] rs2032582 . G> T / A [T / A] rs3789243 . C> T [T] ABCC1 rs3784862 . G> A [G] rs246240 . A> G [A] rs2238476 . C> T [C] rs35592 16081823T> C T > C [T] rs35605 1684C> T C> T [T] rs2230671 4002G> A G> A [A] rs212090 5462T> A T> A [A] rs35529209 Ala989Thr G> A [A] rs4148356 Arg723Gln G> A [A] rs45511401 Gly671Val G> T [T] rs119774 . G> A [A] ABCC2 rs717620 -24C> T G> A [A] rs3740066 3972C> T G> A [A] rs8187710 Cys1515Tyr G> A [A] rs2273697 V417I G> A [A] rs17222723 Val1188Glu T> A [A] rs12762549 . G> C [G] ABCC4 rs1751034 3463 A> G T > C [C] rs9561778 c.3366 + 1243G > T G> T [T] ABCC6 rs2238472 Arg1268Gln G> A [A] ABCG2 rs13120400 . T > C [C] rs17731538 . G> A [A] rs2622604 . C> T [T] rs2231142 Q141K C> A [A] ABO rs8176746 . C> A [AA] rs495828 . G> T [GG] ACE rs4341 . C> G [GG] ADM rs11042725 -1923C> A C> A [CC] ADRB2 rs1042713 Arg16Gly A> G [AA] rs1800888 Thr164Ile C> T [T] ADRB3 rs4994 Trp64Arg T > C [C] AGTR1 rs5182 573C> T T > C [C] AKT1 rs2494732 . C> T [TT] ANKK1 rs1800497 . C> T [T] AOX1 rs55754655 Asn1135Ser A> G [GG] APOB rs1367117 711C> T G> A [G] APOC3 rs5128 3238C> G G> C [C] rs2854117 -482C> T G> A [A] ARG1 rs2781659 . A> G [G] ATM rs4585 . G> T [T] ATP7A rs2227291 Val767Leu G> C [G] ATXN1 rs179997 A-241G A> G [G] BAT3 rs750332 . A> G [G] BCHE rs1799807 Asp70Gly A> G [G] rs28933390 Gly390Val G> T [T] rs28933389 Thr243Met C> T [T] BDKRB1 rs12050217 . A> G [AA] BDKRB2 rs1799722 C-58T T > C [T] C6F10 rs3129900 . T> G [G] CACNG2 rs2284017 . C> T [C] rs2284018 . C> T [C] rs5750285 . C> G [C] CAT rs10836235 c.66 + 78C> T C> T [CC] CBR1 rs9024 1096G> A G> A [GG] rs20572 627C> T, A209A C> T [CC] CBR3 rs2835285 Val93Ile G> A [A] rs1056892 Val244Met G> A [A] CCND1 rs17852153 870G> A A> G [G] CDA rs2072671 Lys27Gln, K27Q A> C [A: AA] rs60369023 c.208G > A, Ala70Thr G> A [A: AA] rs532545 -451C> T G> A [AA] CETP rs708272 Taq1B C> T [T] CHST3 rs4148943 c. * 1278C> T C> T [CC] rs4148945 c. * 1361C> T C> T [CC] rs4148950 c. * 3477G> A G> A [AA] rs1871450 c. * 3785G> A G> A [AA] rs730720 c. * 4533C> T G> A [AA] rs12418 c. * 4785G> A G> A [AA] CNTF rs1800169 FS63TER G> A [A] COMT rs9332377 . C> T [T] rs737865 . T > C [C: CG] rs165599 . A> G [G: CG] rs4680 Val158Met G> A [G] CRHR2 rs2267715 . G> A [G] rs2284220 . A> G [G] rs7793837 . A> T [T] CYTSA rs5760410 g.4205975G> A A> G [G] DRD2 rs4436578 . T > C [C] rs1799978 A-241G A> G [G] rs6277 C957T C> T [C] rs1076560 . C> A [A] DRD3 rs167771 . A> G [G] rs6280 Ser9Gly T > C [C] EGFR rs121434568 L858R T> G [G] rs2227983 R497K G> A [A] EPHX1 rs1051740 Y113H, 337T > C T > C [CC] rs2234922 H139R, 416A > G A> G [GG] ERBB2 rs1136201 Ile655Val A> G [A] ERCC1 rs3212986 8092C> A G> T [T] rs11615 19007T > C, Asn118Asn C> T [T] ERCC2 rs13181 2251A > C, Lys751Gln T> G [G] F2 rs1799963 . G> A [A] FDPS rs2297480 . C> A [CC] FKBP5 rs1360780 . C> T [T] rs3800373 . T> G [G] GGCX rs699664 8016G> A G> A [A] GGH rs11545078 452C> T C> T [T] rs3780126 c.109 + 1307G > C C> T [C] rs11545077 Ala31Thr G> A [A] GNB3 rs5443 Ser275Ser C> T [T] GRIK2 rs2518224 . A> C {C} GRIK4 rs1954787 . C> T [T] GSK3B rs334558 -50T> C G> A [A: AAGA] rs13321783 IVS7 + 9227A> G C> T [T: AAGA] rs2319398 IVS7 + 11660G > T T> G [G: AAGA] rs6808874 IVS11 + 4251T > A A> T [A: AAGA] GSTM3 rs1799735 Intron6, 3 bp deletion ins> del [ins, G] GSTP1 rs1138272 C341T, A114V C> T [T] rs1695 * B, Ile105Val A> G [G] HLA-E rs1059510 Asn98Asn G> A [A] HMGCR rs12654264 . T> A [AA] rs3846662 . C> T [TT] HSPA1L rs2227956 . T > C [C] rs2075800 E602K G> A [A] HTR1A rs6295 . C> G [G] rs10042486 . T > C [C] rs1364043 . G> T [T] HTR2A rs9316233 . C> G [GG] rs7997012 Intron 5, 2 variant G> A [A] rs6311 -1438G> A C> T [T] rs6314 C1354T C> T [T} rs6313 102C> T C> T [T] HTR2C rs1414334 . G> C [C] rs518147 -697G / C C> G [G] rs3813928 c.-995G > A G> A [A] rs6318 Cys23Ser G> C [C] rs3813929 -759C> T C> T [C] HTR3B rs2276307 . A> G [G] HTR7 rs1935349 . G> A [A] IL1B rs16944 -511C / T G> A [A] IL28B rs8099917 . T> G [G] rs12980275 . A> G [A] rs8105790 . T > C [C] rs11881222 . A> G [G] rs7248668 . G> A [A] ITGB3 rs5918 Leu33Pro T > C [C] ITPA rs1127354 P32T C> A [A] KCNH2 rs3815459 . A> G [A] rs3807375 . A> G [A] rs12720441 R784W C> T [T] KCNJ11 rs5219 Lys23Glu, E23K C> T [T] KNG1 rs4686799 . C> T [T] rs5030062 . A> C [A] rs698078 . T > C [C] LDLR rs688 16730C> T C> T [T] LEMD2 rs2395402 . T > C [C] LRP2 rs2075252 . A> G [A] LTC4S rs730012 -444C A> C [C] METTL21A rs7569963 . G> A [G] rs4675690 . T > C [T] MICA rs2848716 . C> G [G] MLH1 rs1800734 -93 A> G [G] MTHFR rs1801131 1298A> C A> C [C] rs1801133 Ala222Val C> T [T] NEFM rs1379357 . G> C [C] NOS1AP rs10918594 . G> C [GG] rs10494366 . G> T [GG] NOS3 rs2070744 -786T> C T > C [CC] NPPA rs5065 T2238C A> G [GG] NQO1 rs1800566 * 2, c.558C > T C> T * 2 [T] NR1I2 rs1464603 g.252A> G T > C [C] NTRK1 rs2768759 . A> C [C] OPRM1 rs1799971 A118G A> G [G] P2RY1 rs701265 . A> G [G] rs1065776 893C> T C> T [T] P2RY12 rs2046934 T744C T > C [C] PTGS1 rs3842787 P17L C> T [T] PTGS2 rs20417 -765G> C G> C [C] RGS4 rs951439 . C> T [TT] rs2661319 . A> G [AA] rs2842030 . T> G [GG] SCN5A rs12053903 . C> T [TT] rs1805124 H558R A> G [GG] rs7626962 S1103Y G> T [TT] SLC10A1 rs2296651 800C> T G> A [T] SLC10A2 rs2301159 c. * 755C> T C> T [T] SLC19A1 rs1051266 Arg27His, c. * 746C > T A> G [AA] SLC1A1 rs2228622 . G> A [A: ACG] rs3780413 . C> G [C: ACG] rs3780412 . A> G [G: ACG] SLC22A1 rs34059508 1393G > A, G465R G> A [A] rs12208357 148C > T, R61C C> T [T] SLC22A16 rs714368 146A > G, His49Arg A> G [G] SLC22A2 rs316019 * 4, A270S G> T * 4 [G] rs8177517 K432Q A> C [C] rs8177507 M165I C> T [T] rs8177516 * 7, R400C C> T * 7 [T] SLC28A2 rs2413775 16334845T> A A> T [A] SLC28A3 rs11568388 1099G> A G> A [A] SLCO1B1 rs56199088 * 10, D655G A> G * 10 [G] rs2306283 * 1B, N130D C> T * 1B [C] rs56101265 * 2, F73L T > C * 2 [C] rs72559745 * 3, E156G A> G * 3 [G] rs56061388 * 3, V82A T > C * 3 [C] rs4149056 * 5, c.521T > C T > C * 5 [C] rs59502379 * 9, G488A G> C * 9 [C] rs4149081 intronic A / G G> A [A] rs11045879 intronic C / T T > C [C] SLCO1B3 rs11045585 . A> G [C] SLCO2B1 rs12422149 Arg312Gln G> A [A] ST6GAL1 rs10937275 - G> A [A] SULT1C4 rs1402467 p.Asp5Glu C> G [G] TCF7L2 rs12255372 . G> T [T] TNF rs1800629 -308G> A G> A [A] TP53 rs1042522 Arg72Pro G> C [G] UGT1A7 rs7586110 -57T> G T> G [G] UGT1A8 rs1042597 * 2, c.518C > G, Ala173Gly C> G [C] UGT2B10 rs7657958 Asp67Tyr tagging G> A [A] UGT2B15 rs1902023 * 2, Y85D T> G * 2 [G] UGT2B17 rs6552182 * 2, CNV Loss> Gain * 2 [Gain] ULK3 rs2290573 . C> T [CC] VDR rs1544410 BsmI G> A [A]
, And
ii) predicting the drug response according to the genotype of step i) using the following Table 17;
[Table 17]

/ RTI >
A genotyping method to provide information on drug reactions using drug genotypes in vitro (Ex Vivo).
delete The method according to claim 1,
The analysis of the genotype
Characterized in that it is analyzed using a glass microbead assay method or an SNaPshot method.
A genotypic analysis method for providing information on drug reactions using drug genotypes in vitro.
delete The method according to claim 1,
The analysis of the genotype
Characterized in that a combination of Glass microbead assay method and SNaPshot method is analyzed,
A genotypic analysis method for providing information on drug reactions using drug genotypes in vitro.
6. The method of claim 5,
The genotype of the following [Table 18] is analyzed using the Glass microbead assay method.
A genotypic analysis method for providing information on drug reactions using drug genotypes in vitro.
[Table 18]

6. The method of claim 5,
Characterized in that the genotype of the following [Table 19] is analyzed using the SNaPshot method:
A genotypic analysis method for providing information on drug reactions using drug genotypes in vitro.
[Table 19]

The method according to claim 1,
Wherein the drug is applied to a drug as shown in Table 20 below.
A genotypic analysis method for providing information on drug reactions using drug genotypes in vitro.
[Table 20]