KR101533150B1 - Method for Producing γ-aminobutiric acid Using modular, synthetic scaffolds - Google Patents

Abstract

The present invention relates to a method for producing gamma aminobutyric acid, and more particularly, to a method for producing gamma aminobutyric acid by using a modular synthesis scaffold without the precursor of gamma-aminobutyric acid (GABA) such as glutamic acid or MSG In which two synthetic routes are established to effectively produce gamma aminobutyric acid directly from glucose.

Description

Technical Field [0001] The present invention relates to a method for producing gamma-aminobutyric acid using a modular scaffold,

The present invention relates to a method for producing gamma aminobutyric acid, and more particularly, to a method for producing gamma aminobutyric acid by using a modular synthesis scaffold without the precursor of gamma-aminobutyric acid (GABA) such as glutamic acid or MSG In which two synthetic routes are established to effectively produce gamma aminobutyric acid directly from glucose.

Recently, global anxiety about petroleum supply and demand and exhaustion of petroleum resources have led to an awareness of the importance of bio - energy, bio - plastics, biotechnology, biotechnology, bio - Compounds and the like. In the case of bioplastics produced using biomass, polylactic acid commercialized by Natureworks in 2002 was produced at a production capacity of 140,000 tons per year, and the market is rapidly expanding.

4-aminobutyric acid is also known as gamma-aminobutyric acid (GABA). It has been known to have hypotensive and analgesic effects due to the inhibitory effect of neurotransmitters in the body, and is currently being used as a food and pharmaceutical material Erlander et al., Neurochem Res. 16: 215-226, 1991). Such GABA can be prepared by using glutamate decarboxylase as a raw material of glutamate. Various glutamate decarboxylase have been reported to date (Proc. Natl. Acad. Sci. USA, 87: Biotechnol. Biochem. 66 (12): 2600-2605, 2002), the use of glutamate decarboxylase to produce GABA The process has been developed. However, the enzyme reaction may not be suitable for low-cost mass production of GABA due to the use of expensive enzyme.

In order to solve the problem of enzyme reaction, a process of converting GABA into high concentration by using sodium glutamate produced from biomass using lactobacillus was developed and an economical manufacturing process of GABA which can be used as a monomer of nylon 4 Technology has been developed. However, in order to produce GABA from sodium glutamate, the substrate sodium glutamate must be produced from sugar by a fermentation process of microorganisms such as Corynebacterium, and since carbon dioxide is released when sodium glutamate is converted to GABA, There are disadvantages.

Therefore, the inventors of the present invention have found that by using a modular synthetic scaffold having a domain capable of binding with a specific ligand to which iscitrate dehydrogenase (GAD), GltB (glutamate synthase) and GAD (gultamate decarboxylase) It has been found that GABA can be directly produced from glucose without a precursor of gamma-aminobutyric acid (GABA) such as glutamic acid or MSG with high efficiency, thereby completing the present invention.

1. Proc. Natl. Acad. Sci. USA, 87: 8491-8495, 1990; Protein Expression and Purification.

The main object of the present invention is to provide a method for producing gamma-aminobutiric acid (GABA) directly from Glucose by co-locating specific enzymes using a scaffold device.

To provide a recombinant microorganism and a recombinant vector for GABA production which can be used in the above method of the present invention.

It is another object of the present invention to provide a high yield GABA biosynthetic pathway.

In order to solve the above-mentioned problems, the present invention provides a gene encoding the gene Icd, GltB, Gad; And a recombinant strain comprising a scaffold containing a ligand which specifically binds to each of the enzymes expressed by the genes, is cultured in a culture medium containing GABA, and a method for producing gamma aminobutyric acid (GABA).

At this time, it is preferable to establish two GABA synthesis routes by using both GadA and GadB as Gad genes.

The genes expressed by the genes Icd, GltB and Gad include isocitrate dehydrogenase (IDH), glutamate synthase (GOGAT) and glutamate decarboxylase (GAD), respectively. , And the ligands specifically binding to the IDH, GOGAT and GAD enzymes are preferably GBD, SH3 and PDZ, respectively.

In particular, the method of the present invention is characterized in that the enzymes expressed by Icd, GltB, and Gad are co-localized in the scaffold and metabolize independently.

At this time, it is preferable that the ratio of the IDH, GOGAT, and GAD enzymes is about 1: 1: 1. However, the number of the ligands does not greatly affect the GABA production efficiency.

In addition, the recombinant microorganism (strain) usable in the present invention is preferably a strain containing both GadA and GadB. For example, Escherichia coli can be used.

As a substrate, a carbon source can be used. Preferably, glucose is used. In one embodiment, D-glucose was used. The present invention is capable of effectively producing gamma aminobutyric acid directly from glucose without the precursor of gamma-aminobutyric acid (GABA), such as glutamic acid or MSG.

In another aspect, the present invention provides, as another aspect, a method for producing the enzyme IDH, GOGAT, GAD; (GABA) containing the genes Icd, GltB, and Gad encoding them, and ligands GBD, SH3, and PDZ that specifically bind to the enzymes, respectively. The detailed explanation is as described above.

The present invention also provides, as yet another aspect, a recombinant microorganism (strain) for producing gamma aminobutyric acid (GABA) containing such a scaffold.

Thus, the present invention relates to a method for efficiently producing gamma aminobutyric acid directly from glucose by establishing two synthetic routes by co-locating specific enzymes using a modular synthetic scaffold.

The method of the present invention enables the synthesis of gamma aminobutyric acid directly from glucose by establishing two synthetic routes by co-locating specific enzymes using a modular synthetic scaffold, Since it is not necessary to use a precursor of γ-aminobutyric acid (GABA) such as MSG, it is possible to produce GABA more simply and effectively, and therefore, it is very useful for commercialization technology through GABA mass production.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic diagram of a design of a scaffold device of the present invention with use of pBad30 as an expression plasmid.
Figure 2 shows the time profile of GABA concentration compared to the case of pre-scaffold, where A represents pBIGA and B represents pBIGB.
A: XB (pBIGA_57) (gray) versus the control (white)
B: XB (pBIGB_57) (gray) versus the control (white)
3 shows the consumption of D-glucose in the production of GABA by the strain of the present invention.
Glucose concentration: XB (pBIGA_57) (red dotted line); XB (pBIGB_57) (black dotted line)
Lactic acid concentration: XB (pBIGA_57) (red solid line); XB (pBIGB_57) (black solid line)
Figure 4 shows the effect of various scaffold constructs (pJD757-pID765) on GABA production at 1 mM Arabidopsis and 108 nM aTc concentration.

The terms used in the present invention are defined as follows.

The term " encoded by " or "encoding" refers to a nucleic acid sequence encoding a polypeptide sequence, wherein the polypeptide sequence is a polypeptide encoded by the nucleic acid sequence, more preferably at least 3-5 amino acids, Quot; comprises an amino acid sequence consisting of at least 8 to 10 amino acids, and even more preferably at least 15 to 20 amino acids. Also encompassed is an immunologically identifiable polypeptide sequence using the polypeptide encoded by the sequence. Thus, an antigen "polypeptide "," protein "or" amino acid "sequence refers to a polypeptide having an identity of at least 70%, preferably at least about 80%, more preferably at least about 90-95% And most preferably about 99% similarity.

A "gene" is a nucleotide sequence of a nucleic acid molecule (chromosome, plasmid, etc.) to which a genetic function is involved. A gene is a genetic unit of an organism, including, for example, a polynucleotide sequence (e. G., A mammalian DNA sequence) that occupies a particular physical location ("locus") within the genome of an organism. The gene may encode an expression product, such as a polypeptide or polynucleotide. Generally, the gene comprises a coding sequence such as a polypeptide coding sequence and a non-coding sequence such as a promoter sequence, a polyadenylation sequence, a transcription control sequence (e.g., an enhancer sequence). Many eukaryotic genes have an "exon" (coding sequence) in which an "intron" (noncoding sequence) is interposed.

"Transfection or transfection" refers to the process by which extracellular DNA enters a host cell in the absence and presence of entities. "Transfected cell" refers to a cell in which extracellular DNA is introduced into a cell and contains extracellular DNA. DNA can be introduced into the cell and the nucleic acid can be inserted into the chromosome or replicated as an extrachromosomal material.

A "vector" or "plasmid" is a nucleic acid molecule, preferably a self-replicating nucleic acid molecule, that transfers an inserted nucleic acid molecule into and / or into a host cell. The term refers to a vector that functions primarily for insertion of DNA or RNA into a cell, a copy of a vector that primarily functions for the replication of DNA or RNA, and a transcription and / Expression vectors. Also included is a vector that provides more than one of the above functions. An "expression vector" is a polynucleotide that can be transcribed and translated into the polypeptide (s) when introduced into an appropriate host cell. By "expression system" is meant a suitable host cell comprising an expression vector that is generally capable of producing the desired expression product.

"Enzyme reaction conditions" means such factors as any necessary conditions (i.e., temperature, pH, inhibition of substance degradation) available in an environment permitting the enzyme to function. Enzyme reaction conditions can be in vitro, such as in vitro, or in vivo, such as in a cell.

"Metabolic engineering" involves rational pathway design and assembly of biosynthetic genes, genes associated with operons, and control elements of these polynucleotides, for the production of desired metabolites in microorganisms. "Metabolically engineered" refers to transcription and translation using genetic manipulation and appropriate culture conditions, including reduction of competing metabolic pathways competing with the intermediate product leading to the desired pathway, destruction or hitting, , And optimization of metabolic flux by regulation and optimization of protein stability and protein functionality. The biosynthetic gene may be heterologous to the host microorganism by being foreign to the host or modified by mutagenesis, recombination and / or by association with a heterologous expression control sequence in an endogenous host cell. In one aspect, when the polynucleotide is heterologous to the host organism, the polynucleotide can be codon-optimized.

"Substrate" refers to any substance or compound that is converted or converted to another compound by the action of an enzyme. The term encompasses combinations of compounds such as solvents, mixtures and other materials including at least one substrate and derivatives thereof as well as single compounds. In addition, the term "substrate" is intended to encompass a compound that provides a carbon source suitable for use as a starting material, such as biomass-derived sugars, as well as the intermediates used in the pathways associated with the metabotropic microorganisms described herein, . Suitable carbon substrates commonly used by microorganisms are encompassed.

"Scaffold" means a polypeptide platform for the manipulation of new products, e.g. proteins, with customized functions and features. Such scaffolds are useful for the production of protein libraries. Scaffolds are typically defined by conserved residues that are observed in the alignment of the sequence-related protein family. Fixed residues may be required for folding or structure, particularly if the function of the aligned protein is different. Thus, when designing proteins from scaffolds, amino acid residues important to the advantageous properties of the framework are retained, and other residues may be randomly selected or mutated. A detailed description of the protein scaffold may include the number, location or spacing of cysteines and binding patterns, and the location and type of any fixed residues in the loop.

"Function" and "functional" mean biological or enzymatic functions.

"Increased" or "increase" refers to a greater amount of a given product or molecule (e.g., a generic chemical, biofuel, or intermediate product thereof) relative to a control microorganism, such as a non- Lt; RTI ID = 0.0 > of the < / RTI > recombinant microorganism.

By "derived" or "from" is meant a sample such as, for example, a polynucleotide extract or polypeptide extract isolated from, or derived from, a particular source, such as a particular organism, typically a microorganism. It may also refer to situations in which a polynucleotide or polypeptide sequence is isolated from or derived from a particular organism or microorganism.

A "recombinant" microorganism typically comprises one or more foreign nucleotide sequences, e.g., in a plasmid or vector.

"About" means that the reference quantity, level, value, number, frequency, percentage, dimension, size, quantity, weight or length is 30, 25, 20, 25, 10, 9, 8, 7, , Level, value, number, frequency, percent, dimension, size, quantity, weight, or length that varies from one to three, two, or one percent.

Throughout this specification, the words " comprising "and" comprising ", unless the context requires otherwise, include the stated step or element, or group of steps or elements, but not to any other step or element, And that they are not excluded.

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. Also, preferred methods or samples are described in this specification, but similar or equivalent ones are also included in the scope of the present invention. The contents of all publications referred to herein are incorporated herein by reference.

Hereinafter, the present invention will be described in detail.

The present invention relates to a method for producing gamma aminobutyric acid (GABA) using a recombinant microorganism, and more particularly, to a method for producing gamma aminobutyric acid (GABA) using genes Icd, GltB, Gad; And a method for efficiently producing gamma aminobutyric acid directly from glucose by establishing two synthetic routes using a scaffold containing a ligand that specifically binds to each of the enzymes expressed by the genes.

In particular, gamma aminobutyric acid can be obtained with excellent efficiency without the precursor of gamma-aminobutyric acid (GABA) such as glutamic acid or MSG.

The present invention can be implemented by culturing a recombinant microorganism transformed by inserting a gene encoding a specific enzyme into a basic vector, using standard cloning techniques and conventional methods known to those of ordinary skill in the art. Accordingly, the present invention encompasses methods of converting to generic chemicals such as gamma aminobutyric acid, enzymes, recombinant microorganisms, and microbial systems.

Amino butyric acid, gamma-amino butyric acid, 2-amino butyric acid) is a kind of amino acid having 4 amino acids with amine group and carboxy, 3, 4-aminobutyric acid.

4-aminobutyric acid is also known as gamma-aminobutyric acid (GABA). It has been known to have hypotensive and analgesic effects due to the inhibitory effect of neurotransmitters in the body, and is currently being used as a food and pharmaceutical material Erlander et al., Neurochem Res. 16: 215-226, 1991).

Such GABA can be produced by using glutamate decarboxylase as a raw material of glutamate, and various glutamate decarboxylase have been reported to date (Proc. Natl. Acad. Sci. USA, 87: Protein Expression and Purification 8: 430-438, 1996; Biosci. Biotechnol. Biochem. 66 (12): 2600-2605, 2002).

Thus, conventionally, a method of producing gamma-aminobutyric acid (GABA) using a precursor of gamma -aminobutyric acid (GABA) such as glutamate (glutamic acid) or MSG (monosodium glutamate) This was common.

However, the present invention establishes two synthetic routes by locating certain enzymes together using a modular synthetic scaffold, without the precursor of gamma-aminobutyric acid (GABA), such as glutamic acid or MSG, And is characterized by directly producing gamma aminobutyric acid directly.

The method of the present invention uses a scaffold device to position specific enzymes in the same position and independently metabolize them. For this purpose, genes Icd, GltB, Gad; And a scaffold containing a ligand that specifically binds to the enzymes that the genes express.

At this time, it is most preferable that two metabolic pathways (synthetic pathways) are established by using GadA and GadB simultaneously as the Gad gene encoding the distinct glutamate dicarboxylase.

The term "biological synthesis path", also referred to as "metabolic pathway", refers to a set of anabolic or catabolic biochemical actions for transmuting one species to another. The gene product may act on the same substrate in parallel or in series to produce the same product or produce or produce a metabolic intermediate product (i.e., a metabolite) between the same substrate and the metabolic end product, .

In the present invention, enzymes of isocitrate dehydrogenase (IDH), glutamate synthase (GOGAT) and glutamate decarboxylase (GAD) are used.

Representative genes coding for each of these are Icd, GltB, and Gad.

In particular, since the Gad gene can be distinguished into two types of GadA and GadB, and they express different types of glutamate decarboxylase (GAD), they can be used to establish two pathways for GABA synthesis . Preferably, the recombinant microorganism (strain) used contains these genes.

Suitable polynucleotides encoding the enzymes used in the present invention can be derived from any biological source that provides them, and their analogs can be identified by reference to various data bases.

Native DNA sequences encoding biosynthetic enzymes are referred to herein to simply illustrate embodiments of the present invention and the present invention encompasses polypeptides of the enzymes utilized in the methods of the invention and any sequence of amino acids encoding the amino acid sequence of the protein DNA compounds. In a similar manner, polypeptides may typically allow for one or more amino acid substitutions, deletions and insertions in the amino acid sequence, without loss of or loss of the desired activity. The present invention also encompasses modified or mutated polypeptides having amino acid sequences that differ from the reference polypeptides, provided that they have enzymatic assimilation or catabolism activity of the specific proteins described herein. Further, the amino acid sequences encoded by the DNA sequences shown herein are merely illustrative of embodiments of the invention.

Sequences for each gene and polypeptide / enzyme listed in the present specification can be easily confirmed by using a database available on the Internet (http://eecoli.kaist.ac.kr/main.html). In addition, these amino acid sequences and nucleic acid sequences can be easily compared for identity using algorithms commonly used in the art (such as BLAST).

The scaffold used in the present invention may be selected from the group consisting of isocitrate dehydrogenase (IDH), glutamate synthase (GOGAT), and glutamate decarboxylase (GAD) Characterized in that it contains a ligand which specifically binds. This is to allow the three enzymes to coexist in the scaffold. Ligands that specifically bind IDH, GOGAT, and GAD enzymes are representative examples of GBD, SH3, and PDZ, respectively.

That is, the enzymes expressed by Icd, GltB, and Gad (GadA and GadB) are located together in the scaffold and independently metabolize them. As described above, two kinds of genes, GadA and GadB, A synthetic route is established.

At this time, it is most preferable that the ratio of IDH, GOGAT and GAD enzyme is about 1: 1: 1. This is because the number of ligands does not affect the production rate of GABA as can be seen from the examples.

Recombinant vector

A vector in the present invention means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA of the genes in a suitable microorganism.

The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host microorganism, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Plasmids and vectors are sometimes used interchangeably herein because plasmids are the most commonly used form of the current vector.

As is well known in the art, in order to increase the level of expression of a gene introduced in a host cell, the gene must be operably linked to transcriptional and detoxification control sequences that function in a selected expression host. Preferably the expression control sequence and the gene are contained within an expression vector containing a bacterial selection marker and a replication origin. If the expression host is a eukaryotic cell, the expression vector should further include a useful expression marker in the eukaryotic expression host.

"Operably connected" refers to an array of elements in which the referenced components are configured to perform their general function. Thus, a particular promoter operably linked to a coding sequence (e. G., A sequence encoding an antigen of interest) may enable the expression of the coding sequence in the presence of the regulatory protein and the appropriate enzyme. In some cases, certain regulatory elements need not be contiguous to the coding sequence so long as they can function to direct expression of the coding sequence.

Typical plasmid vectors include: (a) a cloning start point that allows replication to be efficiently made to include hundreds of plasmid vectors per host cell; (b) an antibiotic resistance gene that allows the host cell transformed with the plasmid vector to be selected; and c) a restriction enzyme cleavage site into which a foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, the vector and the foreign DNA can be easily ligated using a synthetic oligonucleotide adapter or a linker according to a conventional method.

Typically, the DNA sequence and vector are cut with one or more restriction enzymes, and the fragments are ligated together to bind the DNA sequence to be finally expressed to the vector. Restriction enzyme digestion and ligating are well known to those skilled in the art.

Recombinant microorganism

In another aspect, the invention relates to a metabolically engineered microorganism (recombinant microorganism or recombinant strain) comprising a biochemical pathway for production of gamma aminobutyric acid (GABA).

The metabolically engineered microorganism of the present invention comprises one or more recombinant polynucleotides in the genome of the organism or outside the genome in the organism. Such microorganisms include the reduction, disruption or knockout of genes found in wild-type organisms and / or the introduction of heterologous polynucleotides.

In one embodiment, the present invention relates to a method for producing a recombinant vector comprising the genes Icd, GltB, Gad; And genes specific for the enzymes expressed by the genes, that is, isocitrate dehydrogenase (IDH), glutamate synthase (GOGAT) and glutamate decarboxylase (GAD) To a recombinant microorganism comprising a scaffold containing a linking ligand. Ligands that specifically bind IDH, GOGAT, and GAD enzymes are representative examples of GBD, SH3, and PDZ, respectively.

Suitable microbial hosts include, but are not limited to, Zymomonas, Escherichia, Pseudomonas, Alcaligenes, Salmonella, Shigella, Such as Burkholderia, Oligotropha, Klebsiella, Pichia, Candida, Hansenula, Saccharomyces and Kluyveromyces, ) Can be used as a microorganism belonging to one or more genera. Of these, Escherichia coli, Kluyveromyces marxianus or Sccharomyces cerevisiae are preferred. In one embodiment of the present invention, Escherichia coli (E. coli) was used.

In particular, the preferred microorganism of the present invention preferably contains all of the genes for GadA and GadB. Therefore, E. coli is the most preferable microorganism.

Recombinant organisms containing the necessary genes to encode the enzymatic pathway for GABA conversion of the carbon substrate of the invention can be made using techniques well known in the art.

Methods for obtaining desired genes from bacterial genomes are common and well known in the field of molecular biology. For example, where the sequence of the gene of interest is known, the appropriate genomic library may be generated by restriction endonuclease cleavage and screened using a probe complementary to the desired gene sequence. Once the sequence is isolated, the DNA can be amplified using standard primer-induced amplification methods, e. G., Polymerase chain reaction, to obtain an amount of DNA suitable for transformation using appropriate vectors. A codon optimization tool for expression in heterologous hosts is readily available. Some tools for codon optimization are available based on the GC content of the host organism. Once the relevant pathway gene has been identified and isolated, the gene may be transformed into a suitable expression host by means well known in the art. Transduction, transduction, or transfection may be performed by electroporation, microinjection, biolistics (or particle bombardment mediated delivery), or Agrobacterium ≪ RTI ID = 0.0 > mediated < / RTI > transformation, and the like

The terms "recombinant microorganism" and "recombinant strain" are used interchangeably herein and refer to a genetically modified microorganism for expressing or over-expressing a polynucleotide encoding a particular enzyme of the present invention.

[ GABA  Production method]

The present invention provides a method for producing gamma aminobutyric acid (GABA), which comprises culturing the recombinant microorganism from a different viewpoint.

Specifically, there is provided a method for producing GABA, which comprises culturing the recombinant microorganism in a medium containing a carbon source, and then recovering GABA from the cultured microorganism. Herein, the culture of the recombinant microorganism and the step of obtaining GABA can be carried out using a conventional culturing method and a GABA separation purification method which are conventionally known in the fermentation industry.

Fermentation medium

In the present invention, the fermentation medium should contain a suitable carbon substrate. Suitable substrates may be carbon sources selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and C1 substrates or mixtures thereof.

Can include monosaccharides such as glucose and fructose, oligosaccharides such as lactose or sucrose, polysaccharides such as starch or cellulose or mixtures thereof, and unrefined mixtures from renewable feedstock, But is not limited thereto. Preferred carbon substrates are glucose, sucrose, cellulose, glycerol, and the like. Most preferably, glucose can be used.

In addition to a suitable carbon source, the fermentation medium can include suitable minerals, salts, cofactors, buffers and other components known to those skilled in the art, which are suitable for the promotion of the enzyme pathway required for GABA production and for the growth of the culture.

Culture conditions

Typically, the cells are grown in a suitable medium at a temperature ranging from about 25 ° C to about 40 ° C. Suitable growth media for the present invention include, but are not limited to, commercially available media such as Luria Bertani (LB) liquid medium, Sabouraud Dextrose (SD) liquid medium or Yeast Medium (YM) to be. In one embodiment, LB broth (liquid medium) was used.

Suitable pH ranges for fermentation are from pH 5.0 to pH 9.0, wherein pH 6.0 to pH 8.0 is preferred for initial conditions. Fermentation can be carried out under aerobic or anaerobic conditions, where anaerobic or micro-aerobic conditions are preferred.

Industrial placement and continuous fermentation

The present invention utilizes a batch fermentation process. Classic batch fermentation is a closed system in which the composition of the medium is determined at the start of fermentation and does not change artificially during fermentation. Thus, at the start of fermentation, the desired organisms or organisms are inoculated into the medium, allowing fermentation to take place without adding anything to the system. However, typically "batch" fermentation is batchwise with respect to the addition of carbon sources and attempts to control factors such as pH and oxygen concentration are often made. In batch systems, the metabolites and biomaterial compositions of this system are constantly changing until the fermentation is stopped. Within the batch culture, the cells are relaxed to the high growth phase through a static lag phase, and finally to a steady state where the growth rate is reduced or stopped. If it is not treated, the cells of the steady state will eventually die. The cells of the logarithm are generally responsible for the bulk production of the final product or intermediate.

The standard batch system has changed with the Fed-Batch system. In addition, a fed-batch fermentation process is suitable in the present invention, including a typical batch system, except that the fermentation proceeds and the substrate is added incrementally. The fed-batch system is useful when the inhibition of the metabolite is likely to inhibit cellular metabolism and it is desirable to have a limited amount of substrate in the medium. Measurement of the actual substrate concentration in a fed-batch system is difficult and is therefore calculated based on changes in measurable factors such as pH, dissolved oxygen, and the partial pressure of the waste gas, such as CO2.

While the present invention may be practiced batchwise, it is contemplated that the method is applicable to continuous fermentation methods. Continuous fermentation is an open system in which the specified fermentation medium is continuously added to the bioreactor and the same amount of conditioned medium is removed at the same time for processing. In continuous fermentation, cultures are usually maintained at a constant high density, where the cells are in the largely growing stage.

Continuous fermentation allows adjustment of one factor or any number of factors that affect cell growth or final product concentration. For example, one approach would be to keep the levels of the nutrients, such as carbon source or nitrogen, at a fixed rate and make all other parameters adjust. In other systems, many factors that affect growth can be changed continuously while the cell concentration measured by media turbidity remains constant. The continuous system strives to maintain steady-state growth conditions, so that cell loss due to the exported medium must be balanced against cell growth rate in fermentation. Techniques for maximizing the rate of product formation as well as methods for adjusting nutrients and growth factors in a continuous fermentation process are well known in the field of industrial microbiology.

The present invention may be practiced using any of a batch, fed-batch or continuous process.

Gamma aminobutyric acid (GABA) produced using the recombinant microorganism according to the present invention can be obtained at a remarkably high yield by two routes, so that productivity of GABA is greatly improved and industrial mass production is possible do.

<Examples>

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are for further illustrating the present invention, and the scope of the present invention is not limited to these examples.

In particular, in the following examples, only a specific expression vector and Escherichia coli host cell are exemplified for expressing the gene according to the present invention, but it is also obvious to those skilled in the art that other suitable expression vectors and host cells are used something to do.

Bacteria, strains and media

All bacterial strains and plasmids used in the experiments are listed in Table 1.

In all cases, XL1-Blue E. coli strains were used for plasmid production.

The E. coli strain was transformed into Luria-Bertani (LB) broth (10 g / l (100 μg / ml) supplemented with 100 μg / ml ampicillin and / or 30 μg / ml chloramphenicol for screening of transformants in which the recombinant plasmids were latent bacto-tryptone, 5 g / l bacto-yeast extract, and 5 g / l sodium chloride) at 37 ° C and 250 rpm.

Plasmid production

Nine scaffold construct plasmids consisting of the GBD, SH3 and PDZ protein interaction domains (Dueber et al., 2009) were obtained from the authors (Table 1).

Icd gene was amplified from E. coli genome using primers Icd_F_SacI and Icd_R. Next, the GBD ligand sequence was synthesized using GBD_FL and GBD_RL primers, and Icd gene and GBD ligand were ligated to Icd_F_SacI and GBD-BamHI-R primers by overlap PCR (Table 1).

GltB was amplified from the E. coli genome using GltB-BamHI-F and GltB-Xmal-R primers. GadA and GadB genes were amplified from E. coli chromosomes using GadA_XmaI_F, GadA_SbfI_R, GadB_XmaI_F, and GadB_SbfI_R primers in which sequences of SH3 and PZD ligands were attached to reverse primers (Table 1). All genes were cloned and digested at the correct digestion site of the enzyme.

Finally, Icd :: GBD-GltB :: SH3-GadA :: PDZ; And the Icd :: GBD-GltB :: SH3-GadB :: PDZ were obtained and the pBad30 expression plasmid (New England Biolabs, USA) carrying upstream of the Marabinos-inducibility of SacI / SbfI multi- Ipswich, Massachutsetts, USA) (Fig. 1).

The primers used are listed in Table 2 below.

Oligonucleotide primers Primer name The sequence (5'-3 ') Icd- F-SacI GGATTC AAGAAGGAGATATACCATGGAAAGTAAAGTAGTTGT Icd -R CCAGAGCCAGAGCCACGCGGCATGTTTTCGATGATCGCGT GBD -FL ACGCGATCATCGAAAACATGCCGCGTGGCTCTGGCTCTGGCCTGGTGGGCGCGCTGATGCATGTGATGCAGAAACGTTCTGCGATTC GBD -R -L AGGGATTTATCGTACAACATATCTTCATCTTCATCGCCCGCCTGATCTTCGCCTTCATCAGAAGAATGAATCGCAGAACGTTTCTGC GBD- BamHI-R GGATCC TCAATCTTCATCTTCATCGCCCG GltB- BamHI-F GGATCC AAGAAGGAGATATACCATGTTGTACGATAAATCCCTTGAGAGGG GltB- Xmal-R CCCGGG TCAGCCCGGACGACGACGTTTCGGCGGCAGCGCCGGCGGCGGGCCAGAGCCAGAGCCAGAGCCAGAGCCTTCCAGCTGCGCCTGCACGCGCAACT GadA- XmaI-F CCCGGG AAGAAGGAGATATACCATGGACCAGAAGCTGTTAAC GadA- SbfI-R CCTGCAGG TCATCACACCAGAGATTCTTTCACGCCAGAGCCCGGCGCGCCGGTGTGTTTAAAGCTGTTCT GadB- XmaI-F CCCGGG AAGAAGGAGATATACCATGGATAAGAAGCAAGTAAC GadB- SbfI-R CCTGCAGG TCATCACACCAGAGATTCTTTCACGCCAGAGCCCGGCGCGCCGGTATGTTTAAAGCTGTTCT

GABA  transform

All recombinant strains were cultured in LB containing 10 g / l of D-glucose and ampicillin (100 μg / ml) and chloramphenicol (30 μg / ml) at 37 ° C and 250 rpm.

When the OD ₆₀₀ value reached 1.2, gene expression was induced with 1 mM of arabinose and 108 nM aTc, and the cultures were adjusted to pH 4.5 and cultured at 30 ° C and 250 rpm for 48 hours. During fermentation, the samples were removed and stored at -20 ° C for subsequent analysis.

Glucose monitoring

Glucose was analyzed by HPLC using an Aminex HPX-87H column (300 x 7.8 mm, Bio-rad). Samples were placed in Eppendorf tubes and centrifuged at 12,000 rpm for 5 minutes.

Next, 1 ml of supernatant was filtered through a 0.2 μm Millipore filter and analyzed on an Agilent system using a RI detector. The separation of the samples derived using H ₂ SO ₄ 0.008 N was made into a mobile phase. The column temperature was set at 50 캜. The mobile phase flow rate was 0.6 ml / min and samples were detected at 286 nm RI. Standard curves for glucose were determined using the same procedure for 5 standards: 1, 2, 3, 5, and 10 g / l glucose (Sigma, Missouri, USA).

GABA  analysis

GABA bioconversions were quantitatively analyzed by HPLC using an OptimaPak C18 column (4.6 x 150 mm) (RS tech Corporation, Daejeon, Korea). Samples were centrifuged at 12,000 rpm for 5 minutes, and 100 [mu] l supernatant was placed in an Eppendorf tube.

Then, a 1-ml reaction mixture was prepared by adding 200 μl of 1 M sodium bicarbonate buffer pH 9.8, 100 μl of 80 g / l dansyl chloride and 600 μl of double-distilled water in acetonitrile.

The mixture was incubated at 80 DEG C for 40 minutes. Then, 100 μl of 20 μl / ml acetic acid was added to stop the reaction. The mixture was centrifuged at 12,000 rpm for 5 minutes. The supernatant was filtered through a 0.2 μm Millipore filter and analyzed by HPLC on an Agilent system using a UV detector.

A binary nonlinear gradient of the binary method with eluent A [tetrahydrofuran / methanol / 50 mM sodium acetate pH 6.2 (5: 75: 420, by vol.)] And eluent B (methanol) To perform separation of the derivatized sample. The column temperature was set at 30 占 폚. The elution conditions are as follows: equilibrium (6 min, 20% B), gradient (20 min, 20-80% B) and cleaning (3 min, 100% B).

The flow rate of the mobile phase was 1 ml / min and the sample was detected at UV 286 nm. The standard curve for GABA was determined using the same procedure for 8 standard solutions: 0.1, 0.2, 0.3, 1, 2, 3, 5, and 10 g / l GABA (Sigma, Missouri, USA).

Example  1: Production of recombinant strain

Two GABA synthesis pathways and scaffolds were used for orthogonal Arabinose-inducible and tetracycline-inducible promoters, resulting in independent expression.

Three enzymes IDH, GOGAT, and GAD were ligated with the ligands GBD, SH3, and PDZ, respectively, and cloned into the p15A-based medium-copy plasmid to produce pBIGA and pBIGB (Table 1).

Because E. coli chromosomes contain distinct genes encoding two biochemically identical isoforms of glutamate dicarboxylase, GadA and GadB, two isoenzymes encoding each, isoenzyme ) Two systems are established differently by exchanging the role of glutamate dicarboxylase. The scaffold moiety was cloned into a ColE1-based high-copy plasmid containing the GTPase binding the GBD, SH3, and PDZ domains (Table 1).

Each of these domains was used to target IDH, GOGAT, and GAD, respectively. Then, each IDH-GOGAT-GAD-expression plasmid was introduced into XL1-Blue E. coli to obtain XB (pBIGA) and XB (pBIGB) strains

Next, each of XB (pBIGA) and XB (pBIGB) was made into competent cells as a standard protocol and a 9 scaffold structure plasmid (pJD575-pJD765), respectively.

Overall, 20 different strains for the GABA synthesis pathway were named as follows: XB (pBIGA), XB (pBIGA_57), XB (pBIGA_58), XB (pBIGA_59), XB (pBIGA_60) pBIGA_62, XB pBIGA_63, XB pBIGA_65, XB pBIGB, XB pBIGB_57, XB pBIGB_59, XB pBIGB_60, XB pBIGB_61, pBIGB_62), XB (pBIGB_63), XB (pBIGB_64), XB (pBIGB_65).

Example  2 : GABA  Conversion and detection

The results of the GABA conversion to the 20 recombinant strains are summarized in Table 3. GABA was not detected if the three enzymes IDH, GOGAT and GAD were not overexpressed.

First, GABA production was tested using two pre-scaffold device strains as a control.

PBIGA and pBIGB were not observed after about 0.38 g / l GABA was produced with XB (pBIGA) and XB (pBIGB), as can be seen from the two systems (Table 3).

Next, strains XB (pBIGA_57) and XB (pBIGB_57) having a matrix of GBD1SH31PDZ1 scaffolds IDH, GOGAT, and GAD co-localized at a 1: 1: 1 ratio showed a higher GABA concentration 2).

After 48 hours, GABA concentrations were obtained at 1 g / l and 1.2 g / l, 2.5 times higher than XB (pBIGA_57) and 3 times higher than XB (pBIGB_57). Even when the enzymes were located in the domain by the ligand, no significant difference in GABA production was observed between the two systems (Fig. 3).

And the time profile of the GABA concentration showed that the activity of the recombinant strain was maintained even after 48 hours and the GABA concentration continued to increase (FIG. 3).

Previously, most studies focused on the synthesis of GABA through overexpression of the GadA and GadB genes from the GABA high producing strain, where the bacteria directly metabolize glutamic acid or monosodium glutamic acid (MSG) to form GABA.

These mechanisms include the overexpression of GadBC in 27.4 g / l GABA or E. coli mutants obtained from 70 g / l MSG by overexpression of glutamate dicarboxylase in Lactobacillus sakei B2-16 Lactobacillus plantarum ATCC 14917 Showed a high concentration of GABA that could be obtained during fermentation, such as 5.46 g / l GABA obtained from 10 g / l MSG.

In this experiment, the concentration of extracellular matrix GABA produced by XB (pBIGA_57) and XB (pBIGB_57) simultaneously increased, and the glucose concentration in the medium was constantly decreased from the start of fermentation.

In particular, the GABA produced by the two strains XB (pBIGA_57) and XB (pBIGB_57) reached a maximum of 1 g / L and 1.2 g / L after 48 hours, whereas the glucose consumption after 48 hours was 6.01 0.18 g / l and 5.74 + 0.33 g / l (Fig. 3).

These results show that scaffold device strains can be used to successfully produce GABA from glucose without the addition of glutamic acid or MSG as a GABA precursor.

Example 3: Production of GABA

Next, GABA production was tested using various strains containing differences in the number of domains using a matrix of scaffold constructs (XB (pBIGA_58) -XB (pBIGA_65) and XB (pBIGB_58) -XB .

In all scaffold structures GBDaSH3bPDZc, the GBD domain remained stable at ratio a = 1. SH3 and PDZ domains 1, 2, and 4, respectively (Table 1). All strains including scaffold devices showed higher GABA synthesis compared to the control strain, but GABA produced between the obtained scaffold devices showed no significant difference (FIG. 4).

These results show that the enzyme concentration does not affect GABA synthesis. That is, the GABA titer does not depend on the number of SH3 domains nor on the number of PDZ domains.

We have produced expensive GABA using synthetic biotic strategies that produce modular parts of IDH, GOGAT and GAD that can be combined.

Thus, the present invention provides a method of producing GABA by using the metastatic protein interaction domain of a synthetic scaffold and using D-glucose as a substrate. In particular, by changing the relative product titer, which is dependent on the number of enzymes in each complex, the maximum activity of 1.2 g / l GABA, which shows a 3-fold improvement from the pre-scaffold enzyme expressed from the same vector, was observed. In addition, the enzyme concentration did not significantly affect GABA formation.

The present invention may be usefully used as a GABA production method having greatly improved production ability.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

Claims (16)

Gene Icd, GltB, Gad; And culturing a recombinant microorganism comprising a scaffold containing a ligand that specifically binds to each of the enzymes expressed by the genes. &Lt; RTI ID = 0.0 &gt; (GABA) &lt; / RTI &gt; The method according to claim 1,
Wherein the Gad gene is GadA or GadB. 3. The method of claim 2,
Wherein two synthetic routes are established by using GadA and GadB together as the Gad gene. The method according to claim 1,
The genes expressed by the genes Icd, GltB, and Gad include isocitrate dehydrogenase (IDH), glutamate synthase (GOGAT), and glutamate decarboxylase (GAD) (GABA). &Lt; / RTI &gt; 5. The method of claim 4,
Wherein the ligands that specifically bind IDH, GOGAT and GAD enzymes are GBD, SH3 and PDZ, respectively. The method according to claim 1,
Wherein the enzymes expressed by Icd, GltB, and Gad are located together in the scaffold and independently metabolize The method according to claim 6,
Wherein the ratio of IDH, GOGAT and GAD enzymes which are Icd, GltB, and Gad-expressing enzymes is 1: 1: 1. The method according to claim 1,
Wherein the culture comprises a substrate of at least one carbon source selected from the group consisting of glucose, sucrose, cellulose and glycerol. 9. The method of claim 8,
Wherein the substrate is glucose. The method according to claim 1,
Wherein the recombinant microorganism is a strain containing both GadA and GadB. 11. The method of claim 10,
Wherein the recombinant microorganism is E. coli. Enzymes IDH, GOGAT, GAD; Or a scaffold for producing gamma aminobutyric acid (GABA) containing the genes Icd, GltB, Gad encoding them and ligands GBD, SH3 and PDZ each of which specifically binds to the enzymes. 13. The method of claim 12,
Wherein the Gad gene is at least one of GadA and GadB. 13. The method of claim 12,
Wherein the enzymes IDH, GOGAT, and GAD that are expressed by Icd, GltB, and Gad are co-localized in the scaffold. A recombinant microorganism for producing gamma aminobutyric acid (GABA) containing the scaffold of any one of claims 12 to 14. 16. The method of claim 15,
Wherein the recombinant microorganism is E. coli.

Images