KR101524923B1 - PHARMACEUTICAL COMPOSITION FOR TREATING ACUTE MYELOID LEUKEMIA COMPRISING VEGFR-3 INHIBITOR, WHEREIN VEGFR-3 INHIBITOR INCREASES IFN-gamma EXPRESSION - Google Patents

Abstract

The present invention provides a pharmaceutical composition comprising an effective amount of a vascular endothelial growth factor receptor (VEGFR) -3 expression inhibitor, wherein the inhibitor inhibits VEGFR-3 and simultaneously increases the expression or activity of IFN (Interferon) a pharmaceutical composition for treating acute myeloid leukemia, a screening method for treating acute myeloid leukemia, and a method for providing information for diagnosis of acute myelogenous leukemia. More specifically, the present invention reduces the expression of VEGFR-3 in the inhibitor of VEGFR-3, which is a lymphocyte formation marker, in NK (natural killer) cells, which are immune cells of acute myelogenous leukemia patients, Expression of the VEGFR-3 inhibitor, the VEGFR-3 inhibitor can be screened for the treatment and diagnosis of acute myelogenous leukemia.

Description

[0001] The present invention relates to a pharmaceutical composition for the treatment of acute myelogenous leukemia comprising, as an active ingredient, a VEGFR-3 inhibitor which increases expression of IFN- [gamma]. [0002] PHARMACEUTICAL COMPOSITION FOR TREATING ACUTE MYELOID LEUKEMIA COMPRISING VEGFR-3 INHIBITOR, WHEREIN VEGFR-3 INHIBITOR INCREASES IFN-GAMMA EXPRESSION }

The present invention relates to a method for the treatment of acute myelogenous leukemia (VEGFR-3), which inhibits VEGFR-3 and simultaneously increases the expression or activity of IFN (Interferon) acute myeloid leukemia), a method for screening for a therapeutic agent for acute myelogenous leukemia, and a method for providing information for diagnosis of acute myelogenous leukemia.

Leukemia (leukemia) is a disease that causes leukocytes to proliferate into tumors. The types of leukemia are classified into myeloid leukemia and lymphoid leukemia according to the leukemia originating from leukemia, and classified as acute leukemia and chronic leukemia according to the progression rate. The clinical manifestations of leukemia vary according to the type of disease and the nature of the affected cells. Lymphocytic leukemia is caused by lymphoid hematopoietic cells, myeloid leukemia by myeloid hematopoietic cells, and chronic myelogenous leukemia by mature cells. In acute myelogenous leukemia, the bone marrow It is caused by disorders of the parent cells.

Acute myeloid leukemia (AML) is a hematologic malignancy in which abnormal cells that interfere with normal leukocyte production are formed and accumulated in red marrow, mainly in adults and elderly people, and account for about 70% of all acute leukemia It is known to occupy. Symptoms of AML include the fact that the number of blood cells (red blood cells, platelets, normal white blood cells) is reduced as normal bone marrow is filled with leukemia cells. The main symptom is fatigue, bad breath, easy bruising or bleeding, frequent infections. There are many things that are presumed to be the cause of AML, but the cause of AML is not clear. Acute myelogenous leukemia was classified as M0 (minimally differentiated acute myelogenous leukemia, minimally differentiated) according to the French-American-British (FAB) classification as revised in 1985 according to the morphological and cytochemical findings on optical microscope acute myeloblastic leukemia), M1 (acute myeloblastic leukemia, without maturation), M2 (acute myeloblastic leukemia with granulocytic maturation), M3 (acute promyelocytic leukemia), M4 (acute myelomonocytic leukemia) or acute monocytic leukemia), ⑦ M6 (acute erythroid leukemias), and ⑧ M7 (acute megakaryoblastic leukemia).

On the other hand, NK cells (natural killer cells) are morphologically large granular lymphocytes (LGL), which account for about 10 to 20% of lymphocytes in the blood. T cell receptor, CD4 , T lymphocytes and B lymphocytes, which do not have a cell surface receptor such as CD5 or immunoglobulin (Trinchieri, G., Adv. Immunol., 47, 187, 1989). These NK cells are found in the spleen, liver, lung, tonsils and lymph nodes in addition to blood, and it is known that the bone marrow tissues are important for NK cell formation and differentiation.

In addition, NK cells are capable of killing tumor cells (Scala, G. et al., J. Immunol., 134, 3049, 1985), showing cytotoxicity against virus- infected cells and killing bacteria and fungi (Walsh, CM et al., Proc. Natl. Acad. Sci. USA., 91, 10854, 1998), which has been reported to have an antitumor immunity and a protective ability against microorganisms. 1994) and is also implicated in the regulation of the immune system by producing lymphocytes and is known to function as an antibody-dependent cell-mediated cytotoxicity (ADCC) through CD16 cell surface receptors (Ortaldo, JR, Pathol. Immunol Res., 5, 2203, 1986). In addition, NK cells are involved in the rejection of bone marrow transplantation and autoimmune diseases in addition to the role of NK cells in antitumor immunity and protection against microorganisms. Thus, the control of killing function of NK cells is recognized as more important (Yu, YYL et al., Annu. Rev. Immunol., 19, 189, 1992). In particular, the control of killing function of NK cells by cytokines and antibodies has been mainly studied. Examples of cytokines include IL-2, IL-12 and IFN-γ. It is known that it enhances the killing ability of NK cells by increasing the expression and secretion of kill inducers. Antibodies to CD16 are typical antibodies that bind to the CD16 receptor of NK cells and then express the Fc part Which increases the killing ability through reverse cytotoxicity (reverse ADCC).

However, the function of VEGFR-3 in NK cells in patients with acute myelogenous leukemia (AML) remains unknown.

Therefore, the inventors of the present invention have completed the present invention by firstly confirming that the expression of IFN-y can be restored in the presence of an inhibitor (antagonist) for VEGFR-3 in NK cells of AML patients whose function has been impaired.

Therefore, an object of the present invention is to provide a pharmaceutical composition for preventing or treating vascular endothelial growth factor receptor (VEGFR-3), which comprises VEGFR-3 expression or activity inhibitor as an active ingredient, And to provide a pharmaceutical composition for the treatment of acute myeloid leukemia.

It is another object of the present invention to provide a method for screening for a therapeutic agent for acute myeloid leukemia.

It is another object of the present invention to provide a method for providing information for the diagnosis of acute myeloid leukemia.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a VEGFR (vascular endothelial growth factor receptor) -3 expression or activity inhibitor as an active ingredient, wherein the inhibitor inhibits VEGFR- - > expression or activity of acute myelogenous leukemia (acute myeloid leukemia).

In one embodiment of the invention, the inhibitor may be selected from the group consisting of siRNA, shRNA, miRNA, ribozyme, DNAzyme, peptide nucleic acids, antisense nucleotides, peptides, antibodies, have.

The present invention also provides a method of screening for a therapeutic agent for acute myeloid leukemia comprising the steps of:

(a) treating a candidate substance with NK (natural killer) cells;

(b) measuring the degree of IFN (Interferon) -γ expression after the candidate substance treatment; And

(c) selecting the candidate substance whose expression level of the IFN-y is increased compared to the control group not treated with the candidate substance.

In one embodiment of the present invention, the NK cells may be cells derived from peripheral blood mononuclear cells or bone marrow derived mononuclear cells.

In one embodiment of the present invention, the degree of expression in step (b) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical analysis, RealTime- PCR, qRT-PCR, Western blotting, and flow cytometry (FACS).

Further, the present invention provides a method for providing information for the diagnosis of acute myeloid leukemia comprising the steps of:

(a) collecting blood of a subject to be diagnosed and extracting mononuclear cells;

(b) measuring the expression level of LEC (lymphatic endothelial cells) marker in the mononuclear cells; And

(c) determining the acute myelogenous leukemia if the level of expression of the LEC marker is increased relative to the expression level of the normal control subject.

In one embodiment of the present invention, the LEC marker comprises a vascular endothelial growth factor receptor (VEGFR) -3, POD (podoplanin), PROX (prospero homeobox) -1 and LYVE (lymphatic vessel endothelial hyaluronan receptor) Lt; / RTI >

In one embodiment of the present invention, the degree of expression in step (b) may be measured by RealTime-PCR, qRT-PCR, or flow cytometry (FACS).

In the present invention, the expression of VEGFR-3 and the expression of IFN-γ, a cytokine, are increased in NK (natural killer) cells, which are immune cells of acute myeloid leukemia patients, in the treatment of inhibitors of VEGFR- , The VEGFR-3 inhibitory substance can be screened and useful for the treatment and diagnosis of acute myelogenous leukemia.

Figure 1 shows the values of LEC markers in monocytes extracted from patients with AML.
Figure 2 shows the results of flow cytometry analysis of CD antigen levels in NK cells of normal and AML patients.
Figure 3 shows the expression of lymphoid formation markers and lysis-related factors in CD56 ⁺ NK cells of AML patients.
Fig. 4 shows cytotoxicity and IFN-y expression in NK cells.
FIG. 5 shows the results of measuring the expression of IFN-y after incubating NK cells with HUVEC cells that release VEGF-C and HEK293 cells that do not release VEGF-C, respectively.
Figure 6 shows the effect of the VEGFR-3 antagonist MAZ51 on IFN-y expression in NK cells of patients with AML.

The present invention relates to the use of VEGFR (vaginal endothelial growth factor receptor-3) antagonists in the treatment of acute myeloid leukemia (AML) (Interferon) -γ, which is a cytokine, is restored.

Accordingly, the present invention includes a vascular endothelial growth factor receptor (VEGFR) -3 expression inhibitor as an active ingredient, wherein the inhibitor inhibits VEGFR-3 and at the same time increases the expression or activity of IFN (Interferon) Which is characterized by providing a pharmaceutical composition for treating acute myeloid leukemia.

In the present invention, IFN-y is also called type II interferon, and is called immune interferon because it regulates the immune response by being made by CD4 T cell or CD8 T cells. IFN-γ is a cytokine that acts on NK cells, T cells, B cells, neutrophils, and vascular endothelial cells and activates them. It acts as a macrophage activating factor and acts as a Class I, II MHC It also increases expression.

NK cells are capable of destroying cancer cells by releasing important cytokines such as IFN-γ, but NK cells of AML patients are less able to release cytokines (secretory) than normal cells and have low solubility in cancer cells .

Therefore, in the present invention, a VEFGFR-3 antagonist can restore the expression of IFN-y in NK cells, and the expression of lymphatic endothelial cells (LEC) such as VEGFR-3 in monocytes of AML patients with impaired function And the expression level was significantly increased compared to the normal group.

More specifically, in the following embodiments of the present invention, de In order to block VEGFR-3, MAZ51, a VEGFR-3 antagonist, was added to NK cells and FACS analysis was performed. As a result, NK cells of AML patients were treated with blood samples obtained from novo AML patients and normal donors , The level of IFN-γ was restored by treatment with VEGFR-3 antagonist.

In addition, the expression of lymphocyte-forming markers was analyzed by RT-PCR, flow cytometry, and immunohistochemistry. As a result, lymphocyte formation marker expression was significantly increased in monocytes of AML patients compared to normal individuals. From the above, it can be seen that the present invention firstly demonstrated the relationship between the expression of VEGFR-3 and IFN gamma in NK cells and that AML patients can be effectively used for the prevention or treatment of AML by treating inhibitors such as VEGFR-3 antagonists .

Accordingly, the present invention provides a pharmaceutical composition comprising an effective amount of a vascular endothelial growth factor receptor (VEGFR) -3 expression inhibitor, wherein the inhibitor inhibits VEGFR-3 while increasing the expression or activity of IFN (Interferon) A pharmaceutical composition for treating acute myeloid leukemia can be provided.

In the present invention, the inhibitor may be a small interference RNA (siRNA), shRNA (short hairpin RNA (RNA), or the like) complementary to the VEGFR-3 gene, a complementary sequence to the above- ), miRNA (microRNA), ribozyme, DNAzyme, PNA (peptide nucleic acids), or antisense nucleotide, and is preferably a compound, a peptide, or a peptide which is complementary to VEGFR- A peptide mimetic, an antibody, or an extramammary, but is not limited thereto.

The siRNA preferably consists of a sense sequence of 15 to 30 mers selected in the base sequence of the mRNA encoding the human VEGFR-3 protein and an antisense sequence complementarily binding to the sense sequence, It is not limited.

The antisense nucleotide binds (hybridizes) to a complementary base sequence of DNA, immature-mRNA or mature mRNA to inhibit the flow of genetic information as a protein in DNA, as defined in the Watson-click base pair. Antisense nucleotides Because they are the long chain of monomeric units they can be easily synthesized against the target RNA sequence. Recently, in many studies, the utility of antisense nucleotides as biochemical tools for studying target proteins has been demonstrated (Rothenberg et al., J. Natl. Cancer Inst., 81: 1539-1544, 1999). Many advances have been made in the field of oligonucleotide chemistry and in the field of nucleotide synthesis showing improved cell adsorption, target binding affinity and nuclease resistance, and the use of antisense nucleotides can be considered as a new type of inhibitor.

The peptide mimetics inhibit the binding domain of the VEGFR-3 protein and inhibit the activity of the VEGFR-3 protein. Peptide mimetics may be peptides or non-peptides and may be derived from amino acids linked by non-peptide bonds, such as psi bonds (Benkirane, N., et al. J. Biol. Chem., 271: 33218-33224, Lt; / RTI > Also included within the scope of the present invention are "cyclic mimetics," which include "conformationally constrained" peptides, cyclic mimetics, at least one exocyclic domain, a binding moiety (binding amino acid) It can be mimetic. Peptide mimetics is structurally similar to the secondary structural features of the VEGFR-3 protein and is expressed by an antibody (Park, BW et al. Nat Biotechnol 18, 194-198, 2000) or a water soluble receptor (Takasaki, W. et al. Nat Biotechnol 15, (Wrighton, NC et al., Nat Biotechnol 15, 1261-1265, 1997), which can imitate the inhibitory properties of large molecules such as, for example, 1997).

The antibody is a polyclonal or monoclonal antibody, preferably a monoclonal antibody. Antibodies can be produced using methods commonly practiced in the art, such as the fusion method (Kohler and Milstein, European Journal of Immunology, 6: 511-519 (1976)), the recombinant DNA method (US Patent No. 4,816,56) Or phage antibody library methods (Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 58, 1-597 (1991)). General procedures for antibody preparation are described in Harlow, E. and Lane, D., Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press, New York, 1999; Zola, H., Monoclonal Antibodies: A Manual of Techniques, CRC Press, Inc., Boca Raton, Florida, 1984; And Coligan, CURRENT PROTOCOLS IN IMMUNOLOGY, Wiley / Greene, NY, 1991, the disclosures of which are incorporated herein by reference. For example, the preparation of hybridoma cells producing monoclonal antibodies is accomplished by fusing an immortalized cell line with an antibody-producing lymphocyte, and the techniques necessary for this process are well known to those skilled in the art and can be readily carried out. Polyclonal antibodies can be obtained by injecting a protein antigen into a suitable animal, collecting the antiserum from the animal, and then separating the antibody from the antiserum using a known affinity technique.

The aptamer is a single-chain DNA or RNA molecule, which has high affinity for a specific chemical molecule or biological molecule by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment) (J. Tuerand L. Gold, Science 249, 505-510, 2005; AD Ellington and JW Szostak, Nature 346, 818-822, 1990; M. Famulok, et al. DS Wilson and Szostak, Annu Rev. Biochem., 68, 611-647, 1999). An aptamer can specifically bind to a target and modulate the activity of the target, for example, by blocking the ability of the target to function through binding.

As used herein, " treatment " means, unless otherwise stated, reversing, alleviating, inhibiting, or preventing the progression of one or more symptoms of the disease or disorder to which the term applies. Thus, " treatment " or " treatment regimen " of acute myelogenous leukemia in a mammal of the invention may include one or more of the following:

(1) inhibiting the progression of acute myelogenous leukemia, i.e., arresting its development;

(2) relieving acute myelogenous leukemia;

(3) preventing recurrence of acute myelogenous leukemia; And

(4) palliating symptoms of acute myelogenous leukemia.

A pharmaceutical composition for the treatment of acute myelogenous leukemia according to the present invention may comprise a pharmaceutically effective amount of a VEGFR-3 inhibitor alone or may comprise one or more pharmaceutically acceptable carriers, excipients or diluents. As used herein, the term " pharmaceutically effective amount " refers to an amount sufficient to prevent, ameliorate, and treat symptoms of acute myelogenous leukemia.

The term " pharmaceutically acceptable " as used herein refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as a gastrointestinal disorder, dizziness, or the like when administered to a human. Examples of the carrier, excipient and diluent include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. Further, it may further include a filler, an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent.

In addition, the compositions of the present invention may be formulated using methods known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to an individual, such as a mammal. The formulations may be in the form of powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatine capsules, sterile injectable solutions, sterile powders.

The composition for treating acute myelogenous leukemia according to the present invention may be administered through various routes including oral, transdermal, subcutaneous, intravenous, or muscular, and the dose of the active ingredient may vary depending on the route of administration, the age, sex, And the severity of the patient, and the composition for treating acute myelogenous leukemia according to the present invention may be administered in combination with a known compound having an effect of preventing, ameliorating, or treating acute myelogenous leukemia symptoms have.

In addition, the present invention can provide a screening method of a therapeutic agent for acute myeloid leukemia (acute myeloid leukemia).

Specifically, in the screening method,

(a) treating a candidate substance with NK (natural killer) cells;

(b) measuring the degree of IFN (Interferon) -γ expression after the candidate substance treatment; And

(c) selecting the candidate substance whose expression level of IFN-y is higher than that of the control group not treated with the candidate substance, but it is not limited thereto.

In this method, the NK cells are preferably cells extracted from peripheral blood-derived mononuclear cells (PB-MNCs) or bone marrow-derived mononuclear cells (BM-MNCs) More preferably, it is a cell extracted from peripheral blood-derived mononuclear cells, but is not limited thereto.

In this method, the degree of expression in step (b) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical analysis, RealTime-PCR, qRT-PCR , Western blotting, or flow cytometry (FACS). However, the present invention is not limited thereto and can be carried out using any method for measuring the amount of a transcript known to a person skilled in the art or a protein encoded therefrom Can be measured.

In addition, the present invention can provide a method for providing information for the diagnosis of acute myeloid leukemia (acute myeloid leukemia). That is, if a biological sample of AML patient is highly expressed in lymphatic endothelial cells (LEC) gene or protein and the signal is larger than in a biological sample of a normal donor, it can be diagnosed as acute myelogenous leukemia.

Specifically, the information providing method for diagnosis includes:

(a) collecting blood of a subject to be diagnosed and extracting mononuclear cells;

(b) measuring the expression level of LEC (lymphatic endothelial cells) marker in the mononuclear cells; And

(c) determining that the expression level of the LEC marker is increased compared with the expression level of the normal control subject, the step of determining the leukemia is acute myelogenous leukemia.

The LEC marker may be one or more genes or proteins of VEGFR (vascular endothelial growth factor receptor) -3, POD (podoplanin), PROX (prospero homeobox) -1 or LYVE (lymphatic vessel endothelial hyaluronan receptor) But is not limited thereto.

In the above method, the degree of expression of step (b) may be measured by any one of RealTime-PCR, qRT-PCR, and FACS, but not limited thereto, Can be measured using any method that measures the amount of coded protein.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

< Preparation Example  1>

Preparation of sample

All experiments were conducted with approval from the Catholic University of Korea Clinical Trials Committee. Blood samples were collected from 34 healthy donors and from the initial acute myelogenous leukemia with cytogenetic potential according to the World Health Organization (WHO) Primary leukemia (AML) due to recurrent cytogenetic translocations was collected from 67 patients. Derived mononuclear cells (BMs) from blood collected by density gradient centrifugation using a Ficoll-Paque ™ PLUS (17-1440-03; GE Healthcare Life Sciences, Piscataway, NJ, USA) -MNCs) and peripheral blood-derived mononuclear cells (PB-MNCs). The clinical characteristics of the AML patients of the present invention are shown in Table 1 below.

Patients FAB
Subtype Age Sex WBC / mm ³
at diagnosis Cytogenetic anomalies One M2 34 M 8370 46, XY, dup (1) (p32p34) [20] 2 M4 57 M 111300 46, XY [20] 3 M4 49 M 74300 46, XY [20] 4 M3 19 M 73350 46, XY [20] 5 M4 56 F 56490 46, XX, add (12) (p13), der (16) inv (16) (p13.1q22) del (16) 6 M6 15 F 13430 46, XX [20] 7 M4 58 M 80000 46, XY [20] 8 M4 56 F 56490 46, XX, add (12) (p13), der (16) inv (16) (p13.1q22) del (16) 9 M4 58 M 40800 46, XY [20] 10 M6 15 F 13430 46, XX [20] 11 M1 58 M 13750 46, XY [20] 12 M7 27 M 207700 47, XY, + 8 [17] / 46, XY [5] 13 M3 51 F 18660 46, XY [20] 14 M4 50 F 194120 46, XX [20] 15 M2 45 M 1840 46, XY [20] 16 M5b 27 M 138790 46, XY [20] 17 M4 41 F 5140 46, XX, inv (3) (q21q26.3) [20] 18 M5b 27 M 138790 46, XY [20] 19 M4 27 M 2150 46, XY, t (9; 11) (p22; q23) [26] / 46, idem, add (1) 20 M2 45 M 1840 46, XY [20] 21 MRC 43 M 1900 46, XY [20] 22 M4 27 M 2150 46, XY, t (9; 11) (p22; q23) [26] / 46, idem, add (1) 23 M4 63 F 35370 46, XX [20] 24 M2 17 M 1240 45, X, -Y, t (8; 21) (q22; q22) [6] / 46, XY [14] 25 M3 58 M 8590 46, XY, t (15; 17) (q22; q12) [30] 26 M3 48 F 40180 46, XX, t (15; 17) (q22, q12) [20] 27 M1 44 F 152940 46, XX [20] 28 M4 28 F 43390 46, XX, inv (16) (p13.1q22) [20] 29 M5 47 M 7030 46, t (10; 11) (p13; q23) [10] / 46, XY [20] 30 M2 65 M 11650 46, XY [20] 31 M4 65 M 59850 46, XY [20] 32 M2 19 M 32240 46, XY [20] 33 M2 19 M 32240 46, XY [20] 34 M3 61 F 21880 46, XY [20] 35  M1 52 F 123140 46, XX, 15 ps + [20] 36  M3 53 M 56000 46, XY, t (15; 17) (q22; q12) [20] 37  M0 36 F 247860 46, XX [20] 38  M2 64 F 127350 46, XX [20] 39  M4 54 M 23140 46, XY [20] 40  M2 31 F 11620 46, XX, t (8; 21) (q22; q22) [27] / 46, XX [3] 41 M5 36 F 240640 46, XX [20] 42 M3 45 M 69890 46, XY, del (11) (p15), t (15; 17) (q22; q12) 43 M2 65 M 84290 46, XY, del (15) (q11.2q15) [4] / 46, XY [16] 44 M2 19 M 32240 46, XY [20] 45 M3 41 F 150000 46, XX, t (6; 11) (q27, q23) [20] 46 M5b 52 F 123140 46, XX, 15 ps + [20] 47 M1 64 F 1610 46, XX, der (15) t (15; 17) (q22; q12) 48 M3 53 M 56000 46, XY, t (15; 17) (q22; q12) [20] 49 M3 54 F 30090 46, XX, t (9; 11) (p22; q23) [20] 50 M0 64 F 127350 46, XX [20] 51 M4orM5 54 M 23140 46, XY [20] 52 M4 23 F 9430 (47; XX, +1, der (1; 14) (q10; q10), +8, t 53 2nd 36 F 240000 46, XX [20] 54 M0 45 M 69890 46, XY, del (11) (p15), t (15; 17) (q22; q12) 55 M3 37 M 144250 46, XX [20] 56 M1 34 F 577000 46, XY [20] 57 M3 44 M 61230 46, XY [20] 58 M3 15 F 13430 46, XX [20] 59 M2 27 M 250130 47, XY, + 8 [20] 60 M2 25 M 11740 46, XY, t (8; 21) (q22; q22) [17] / 46, XY [3] 61 M3 19 F 2230 45, X, -X, t (8; 21) (q22; q22) [9] / 46, 62 M2 31 F 12370 46, XX, t (8; 21) (q22; q22) [27] / 46, XX [3] 63 M1 36 M 108240 46, XY.i (7) (q10) [3] / 46, XY [17] 64 M1 37 M 245000 46, XY [20] 65 M4 40 M 510 14, XY, inv (9) (p12q13), i (17) q10 [6] / 46, 66 MLD 43 F 33610 (12) (p15; q13) [2] / 46, idem, del (11) (p13p15) [18] 67 M3 60 F 2460 46, XX, t (11; 20) (p15; q11.2), t (15; 17) (q22; q21) [13] / 46, Abbreviation: AML, acute myeloid leukemia; FAB, French American British; WBC, white blood cell; MRC, myelodysplastic-related change; P, periperal blood; B, bone marrow

< Preparation Example  2>

Cell lines, cell culture media and MAZ51 Processing

Human HEK293 cells (CRL-1573; ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS; GIBCO) and antibiotics (Invitrogen, Carlsbad, CA, USA) medium (DMEM; GIBCO, Grand Island, NY, USA). Human umbilical vein endothelial cells (HUVECs, c-12200; PromoCell, Heidelberg, Germany) were cultured in EGM-2MV medium (cc-3202; Lonza, Allendale, NJ, USA) And cultured.

To determine the expression levels of IFN-γ (interferon gamma) and VEGFR-3 (vascular endothelial growth factor-3) in NK cell lines from normal healthy donors, cultured HUVECs were inoculated into 6-well culture dishes 10 ⁶ cells / well) and the medium was changed to endothelial basal medium containing 1% FBS 1 hour before incubation with peripheral blood-derived mononuclear cells (PB-MNCs).

After approximately 24 hours, mononuclear cells exposed to HEK293 or exposed to HUVEC were collected and analyzed by flow cytometry.

In addition, to treat MAZ51 (EMD-Calbiochem, San Diego, Calif., USA), cells were cultured in DMEM containing 1% FBS and 0.1% DMSO; Or DMEM containing MAZ51 at a concentration of 5 [mu] M in 1% FBS and DMSO for 24 hours.

< Preparation Example  3>

Statistical analysis

In the present invention, all results are expressed as mean ± standard error (SE), and normal healthy donor and AML patient data were compared using the Mann-Whitney U test method. Also, GraphPad Prism ver. 4 software (GraphPad Software, La Jolla, Calif., USA) and were considered statistically significant at the P <0.05 level.

&Lt; Example 1 >

AML  Patient Bone marrow origin - Mononuclear cell  And Derived from peripheral blood - In mononuclear cells  Lymphatic formation Marker  Increased expression

In general, VEGFR-3, POD (podoplanin), PROX (prospero homeobox) -1 and LYVE (lymphatic vessel endothelial hyaluronan receptor) -1 are representative LEC (lymphatic endothelial cells) Were included in the cells expressed as lymphocyte formation markers.

<1-1> qRT - PCR Using LEC Marker  Identification of gene expression

Expression of the LEC marker gene was confirmed in mononuclear cells extracted directly from normal healthy donors and AML patients using qRT-PCR. Total RNA isolation and cDNA synthesis were performed using methods known in the art, and information on the TaqMan primer / probe set used (Biosearch Technologies, Novato, CA, USA) is shown in Table 2 below. Relative mRNA expression of the target gene was calculated by comparative CT method, and three independent reactions were performed. All target gene expression was normalized based on GAPDH expression. Differences in CT values for each target mRNA was calculated by subtracting the average value of the GAPDH expression (relative expression = 2 ^{- △ CT).}

Genes Primers and probes (5'-3 ') SEQ ID NO: human GAPDH Forward GGTGGTCTCCTCTGACTTCAACA One Reverse GTGGTCGTTGAGGGCAATG 2 Probe CCACTCCTCCACCTTTGACGCTGG 3 human VEGFR3 Forward CCTTGCCCGGGACATCTA 4 Reverse TTGTCGAAGATGCTTTCAGGG 5 Probe AGACCCCGACTACGTCCGCAAGG 6 human LYVE-1 Forward CTGGGTTGGAGATGGATTCG 7 Reverse TCAGGACACCCACCCCATTT 8 Probe TAGCCCAAACCCCAAGTG 9 human Podoplanin Forward CAGGTGCCGAAGATGATGTG 10 Reverse TGTTGCCACCAGAGTTGTCA 11 Probe TGACTCCAGGAACCAG 12 human PROX1 Forward GCCAGATTTGCAGTCAATGG 13 Reverse ATGATGACGTCGCCAAAGC 14 Probe TTTCCACACCGCCAAC 15 human IFN-gamma Forward ACTCATCCAAGTGATGGCTGAA 16 Reverse TCCTTTTTCGCTTCCCTGTTT 17 Probe TGTCGCCAGCAGCT 18 human Granzyme B Forward GGCCCCCCTGGGAAA 19 Reverse TCTTCCTGCACTGTCATCTTCAC 20 Probe CACTCACACACACTACAA 21 human Perforin Forward TGTCGAGGCCCAGGTCAA 22 Reverse CCTTGGCTTCGGCAGAGAT 23 Probe ATAGGCATCCACGGCAG 24 human TNF-alpha Forward GGAGAAGGGTGACCGACTCA 25 Reverse CAGACTCGGCAAAGTCGAGATA 26 Probe CTGAGATCAATCGGC 27

As a result, the expression levels of PROX-1, LYVE-1, VEGFR-3 and POD in monocytes of AML patients were 149.9, 6.7 and 18.2 , And 2.7 times, respectively. In addition, the expression levels of TNF-a and IFN-γ, the proinflammatory cytokines, were lower in the AML group than in the normal healthy donors. The gene expression of LEC markers tended to be higher in the PB-MNC group than in the BM-MNC group, and the expression level of all the lymph-forming markers was further increased in AML-patient monocytes regardless of the cell source. Increased expression of lymphocyte formation markers in monocytes of AML patients is similar to that seen in solid tumors, meaning that monocyte cells are involved in lymphangiogenesis in AML.

<1-2> Flow cell  Analytical LEC Marker  Identification of gene expression

The results of the above Example <1-1> were confirmed using the flow cytometric analysis method. Flow cytometry was performed according to methods known in the art. Briefly, cells were suspended in 100 μL of rinsing buffer, incubated with antibody, washed, and analyzed by Cell Quest software (BD Biosciences, San Diego, ) Using a FACSCalibur flow cytometer. The primary antibodies were FITC-conjugated mouse anti-human CD56 (557699; BD Biosciences), PerCP-conjugated mouse antihuman CD3 (347344; BD Biosciences), mouse anti- human VEGFR-3 (MAB3757; Millipore, Billerica, (POD, FAB3670A; R & D Systems, Minneapolis, Minn., USA) were used for biotinylated anti-human LYVE-1 (102-PABi50; Relates, Wolfenbuttel, Germany) and biotinylated rabbit anti- APC-conjugated anti-mouse IgG (550826; BD Biosciences) and APC-conjugated streptavidin (17-4317-82; eBioscience, San Diego, CA, USA) were used for signal detection. Flow cytometry data were analyzed using a control with the appropriate isotype matched IgG and a non-stained control.

As a result, the number of POD ⁺ and VEGFR-3 ⁺ cells having a similar number of LYVE-1 ⁺ cells was significantly increased in monocytes of AML patients as compared to that of healthy donors, as shown in FIG.

<1-3> AML  Identification of leukocyte common antigen in patient's cells

Among lymphocytes, CD56 ⁺ CD3 ^- cells are considered to be NK cells, and so far the characteristics of AML have been based on multiple parameter analysis including cell morphology, clinical features, and immunophenotype. For example, there is CD45, a common white blood cell antigen, and CD45 has been used to identify AML cells from normal blood cells in the immunological diagnosis of AML. In other words, AML cells do not express CD45 or express less (CD45 ^{low / -} ) whereas normal lymphocytes and monocytes strongly express CD45. About 20% of AML patients have CD56 ⁺ immunophenotypic leukemic cells. In the present invention, CD56-positive cells were found in 17 (25.3%) of 67 AML patients, thus preventing the contamination of AML cells CD45 ^{low / -} AML cells were identified in the blood of 17 patients with the above-described CD56-positive cells.

As a result, also, a normal of NK cells are blood cells is due to pan hematopoiesis marker of CD45 is certainly positive and CD3, as shown in ^{two-fibroblasts} whereas CD56 ⁺ certainly diverge in, AML patients (M3, M4 type of patients) , CD45 is strong only when monocyte cells are designated (upper graph of M3 and M4 results), and CD45 is negative when a large abnormal cell group is designated (lower image of M3 and M4 results) CD45 ^{&lt; / RTI &gt; low / -} AML cells can not participate in functional killing by NK cells because CD45 is not expressed in these cells.

From the above results, it can be seen that remarkable expression of lymph-forming markers appears in AML monocyte.

&Lt; Example 2 >

AML  Patients CD56 + CD3 - NK  Lymphatic formation in cells Marker  Expression

In order to investigate whether the AML NK cells are rich in lymphoid tube-forming markers, we focused on POD and VEGFR-3, which showed a remarkable expression level in Example 1 above. NK cells kill target cells by releasing IFN-γ, cytoplasmic granule toxins, membrane-disrupting small proteins known as perforins, and serine proteases such as granzyme B, and the release of cytokines is caused by the metabolic activation process of exocytosis . Accordingly, the present inventors examined the expression levels of perforin, granzyme B, and IFN-y in NK cells of AML patients. For this purpose, CD56 ⁺ cells were extracted from monocytes using MACS (magnetic microbeads activated cell sorting). That is, monocytes were washed with AutoMACS washing buffer to extract CD56 ⁺ cells with MACS, and the reagents of a human NK cell extraction kit (Miltenyi Biotec) Lt; / RTI &gt; After incubation with a biotinylated antibody cocktail, the cells were mixed with NK cell microbeads and extracted. The purity of the extracted CD56 ⁺ NK cells was about 90%, which was used for qRT-PCR, immunocytochemistry, and cytotoxicity analysis.

Expression of LEC markers and cytotoxicity-related factors was analyzed by qRT-PCR. The qRT-PCR method was the same as in Example 1 above. In addition, the protein levels of the lymph-forming markers were measured by flow cytometry. The method was the same as that in Example 1, except that GolgiStop ™ (2 μM; Monocytes were stimulated with phorbol myristate acetate (PMA, 50 ng / mL; Sigma Chemical Co., St. Louis, Mo., USA) and calcium ionophore (A23187, 500 ng / mouse anti-human IFN-y (569326; BD Biosciences) was used as the primary antibody. Immunostaining was performed according to methods known in the art for immunocytochemical analysis. More specifically, cells were plated on a slide with cytospin and fixed with 2% paraformaldehyde at room temperature for 10 minutes. The cells were washed with phosphate buffered saline (PBS), blocked with 5% horse serum, incubated with primary antibody, and incubated with secondary antibody. The antibodies used were: rabbit anti-human VEGFR-3 (sc-637; Santa Cruz Biotechnology, Santa Cruz, Calif., USA), FITC-conjugated mouse anti-human CD56 (557699; BD Biosciences) Affinipure goat anti-rabbit IgG (NC9771594; Jackson ImmunoResearch Laboratories, West Grove, PA, USA). DAPI was used for nuclear staining and images were taken using a fluorescence microscope (Axiovert 200; Carl Zeiss, Göttingen, Germany).

As a result of qRT-PCR, mRNA expression levels of PROX-1, VEGFR-3 and POD were found to be 47.9, 22.0 and 28.2 times higher in AML CD56 ⁺ cells than in the normal donor CD56 ⁺ cell fraction. Specifically, other genes, while POD and the like PROX-1 appeared to VEGFR-3 expression is very rich in blood CD56 ⁺ cells from AML patients with CD56 ^- appeared to be somewhat expressed only in cell growth, VEGFR-3 than other factors NK cells. &Lt; / RTI &gt;

The flow cytometry results also showed that the protein levels of the lymphocyte formation markers were clearly higher in NK cells of AML patients than in healthy donors NK cells. As shown in FIG. 3B, the levels of LYVE-1, VEGFR-3, and POD protein in peripheral blood-derived NK cells of AML patients were 1.9 to 23.3 times that of healthy donors, and bone marrow-derived NK cells Showed a 5.9- to 28.2-fold increase in the number of healthy donors, of which VEGFR-3 levels were significantly increased in both peripheral blood-derived and bone marrow-derived.

As a result of immunocytochemistry analysis, as shown in FIG. 3C, the amount of protein expression of VEGFR-3 and POD was high in CD56 ⁺ cells of the AML group. On the other hand, IFN-y, granzyme B, and perforin were significantly lower in CD56 ⁺ cells in AML patients. This indicates that there is a correlation between the amount of lymphocyte formation marker gene expression and the weak lytic activity of AML NK cells.

From the above, it can be seen that the expression of the lymph-tube formation marker is high in CD56 ⁺ NK cells having a low expression level of cytotoxicity-related factors as in AML NK cells, and in particular, VEGFR-3 is remarkably high in both protein and mRNA levels in AML patients There is a close correlation between lymphatic characteristics and loss of natural kill potential.

&Lt; Example 3 >

AML PB - MNC  origin CD56 + Cell K562 Possibility of cytotoxicity to cells

To investigate the cytotoxicity potential of CD56 ⁺ cells with high expression of VEGFR-3 in the AML group, CD56 ⁺ cells were extracted with microbeads in each group and used for cytotoxicity analysis. NK cells can kill cancer cells without sensitization and can be activated by direct contact with human leukemia cell line K562 deficient in HLA class 1 antigen expression. Accordingly, the present inventors used K562 cells as target cells and normal healthy donors and effector cells as NK cells of AML patients for cytotoxicity analysis.

As a result, as shown in FIG. 4A, the dissolution capacity of AML patient NK cells to K562 cells was dramatically decreased as compared with the normal healthy donor NK cells, which means that the function of NK cells was impaired.

In addition, IFN-y is a major cytokine produced by immune cells, including T-cells and NK cells, and is known to play an anti-lymphogenic role in tumor immunotherapy (Kataru RP et al., Immunity, J Interferon Cytokine Res, 2006, 26 (8), J &lt; RTI ID = 0.0 &gt; et al., J Exp Med, 2001,194 (11), 1549-59; 568-74). Thus, expression of VEGFR-3 and IFN-y was examined by FACS analysis.

As a result, the total expression of IFN-y was 2.4 times higher in normal NK cells than in AML NK cells, and the expression of IFN-γ in normal NK cells was 97.2% in VEGFR-3 cells Respectively. In contrast, as shown in FIG. 4C, VEGFR-3 ^- of AML NK cells showed IFN-γ expression as compared to VEGFR-3 ⁺ cells (VEGFR-3 ^- , 31.3%; VEGFR-3 ⁺ , 68.7% Fold lower, indicating that VEGFR-3 is associated with weak cytolytic activity of AML NK cells.

<Example 4>

HUVEC Using VEGF In the -C-secreted state NK  Cell VEGFR -3 expression and IFN -gamma's Association analysis

The tyrosine kinase receptor, VEGFR-3, binds to VEGF-C and VEGF-D ligands, and AML cells and VEGF-C accumulated in tumor cells can induce receptor stimulation under lymphogenic conditions. Therefore, it is important to determine whether the lymphogenic conditions produced by VEGF-C or VEGF-D are related to the degradation of immune cell lysis function. To this end, the effect of HUVEC releasing VEGF-C on normal NK cells . HEK293 cells, which do not produce VEGF-3 and VEGF-3 ligands such as VEGF-C and VEGF-A, were used as feeder cells for control, and monocytes of healthy donors were incubated for 24 hours, (no-feeder-cell) group as another control group. After exposure to HUVEC or HEK293 cells, CD56 ⁺ CD3 ^- in normal monocytes was analyzed by flow cytometry.

As a result, as shown in Fig. 5, IFN-y expression was significantly higher in the HK293 cells exposed to the control group and in the control group than the NK cell group exposed to the HUVEC. In contrast, expression of VEGFR-3 was significantly increased in cells exposed to HUVEC, but not in NK cells cultured with or without HEK293 cells. In addition, the percentage of VEGFR-3 ⁺ cells in the cells expressing IFN-y was calculated and it was found that VEGFR-3 expression was rare in NK cells expressing IFN-y cultured with no-nutrient cells or HEK293 cells was (VEGFR-3 ^{- cells, 97.1%; -;, 2.6} HEK293 a VEGFR-3 ⁺ cells cultured with feeder cells; no feeder cells, the VEGFR-3 ⁺ cells incubated with 2.9% of the cells, 97.4% VEGFR-3 %), VEGFR-3 in NK cells expressing cultured IFN-γ with HUVEC ^- to VEGFR-3 ⁺ ratio of the overall population as compared groups showed significantly greater (VEGFR-3 ^- cells, 23.5%; with the HUVEC culture One VEGFR-3 ⁺ cell, 76.5%).

From the above results, it can be seen that HUVEC that produces VEGF-C in normal NK cells affects VEGFR-3 expression and IFN-y expression.

&Lt; Example 5 >

VEGFR -3 antagonist AML NK  In a cell IFN -γ expression

To investigate whether these results are due to the VEGF-C / VEGFR-3 axis, we treated MAZ51, a VEGFR-3 antagonist that inhibits VEGFR-3 tyrosine kinase activity but does not affect other VEGFRs in AML NK cells Respectively. That is, AML monocyte was treated with 5 μM of MAZ51 for 24 hours, followed by FACS analysis, and monocyte not treated with MAZ51 was used as a control.

As a result, as shown in FIG. 6, MAZ51 in AML NK cells increased IFN-y expression 2.5-fold and strongly suppressed VEGFR-3 expression 15.1-fold. In particular, IFN-γ expression in the group treated MAZ51 VEGFR-3 ^- set off from the cells increased (93.2%), while in a control group were higher in the VEGFR-3 ⁺ cells (74.3%). In addition, MAZ51 decreased the total number of AML cells and increased the expression of IFN-? In the immune NK cells, and the expression of IFN-? Was significantly reduced in CD4 and CD8 cells with loss of VEGFR-3 ⁺ Cell subset, including the cells of the CD3 ⁺ T-cell subset. This means that immune cells such as T cells and NK cells as well as AML cells are affected by MAZ51. In addition, qRT-PCR was performed to investigate changes in the levels of other soluble factors in MAZ51-treated cells. As a result, unlike mRNA levels of VEGFR-3 in MAZ51-treated AML NK cells, perforin, granzyme B and IFN- mRNA levels were markedly increased, indicating that MAZ51 restored the killing ability of NK cells.

From the above, the present inventors confirmed that an antagonist of VEGFR-3 can be useful for the treatment of acute myelogenous leukemia (AML) by promoting the recovery of NK cell function.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> CATHOLIC UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> PHARMACEUTICAL COMPOSITION FOR TREATING ACUTE MYELOID LEUKEMIA          COMPRISING VEGFR-3 INHIBITOR, WHEREIN VEGFR-3 INHIBITOR INCREASES          IFN-gamma EXPRESSION <130> PB13-11525 <160> 27 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH Primer (Forward) <400> 1 ggtggtctcc tctgacttca aca 23 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH Primer (Reverse) <400> 2 gtggtcgttg agggcaatg 19 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH Probe <400> 3 ccactcctcc acctttgacg ctgg 24 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> human VEGFR3 Primer Forward <400> 4 ccttgcccgg gacatcta 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human VEGFR3 Primer Reverse <400> 5 ttgtcgaaga tgctttcagg g 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human VEGFR3 Probe <400> 6 agaccccgac tacgtccgca agg 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human LYVE-1 Primer Forward <400> 7 ctgggttgga gatggattcg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human LYVE-1 Primer Reverse <400> 8 tcaggacacc caccccattt 20 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> human LYVE-1 Probe <400> 9 tagcccaaac cccaagtg 18 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human Podoplanin Primer Forward <400> 10 caggtgccga agatgatgtg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human Podoplanin Primer Reverse <400> 11 tgttgccacc agagttgtca 20 <210> 12 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> human Podoplanin Probe <400> 12 tgactccagg aaccag 16 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human PROX1 Primer Forward <400> 13 gccagatttg cagtcaatgg 20 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> human PROX1 Primer Reverse <400> 14 atgatgacgt cgccaaagc 19 <210> 15 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> human PROX1 Probe <400> 15 tttccacacc gccaac 16 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> human IFN-gamma Primer Forward <400> 16 actcatccaa gtgatggctg aa 22 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> human IFN-gamma Primer Reverse <400> 17 tcctttttcg cttccctgtt t 21 <210> 18 <211> 14 <212> DNA <213> Artificial Sequence <220> Human IFN-gamma probe <400> 18 tgtcgccagc agct 14 <210> 19 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> human Granzyme B Primer Forward <400> 19 ggcccccctg ggaaa 15 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> human Granzyme B Primer Reverse <400> 20 tcttcctgca ctgtcatctt cac 23 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> human Granzyme B Probe <400> 21 cactacacaca cactacaa 18 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> human Perforin Primer Forward <400> 22 tgtcgaggcc caggtcaa 18 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> human Perforin Primer Reverse <400> 23 ccttggcttc ggcagagat 19 <210> 24 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> human Perforin Probe <400> 24 ataggcatcc acggcag 17 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> human TNF-alpha Primer Forward <400> 25 ggagaagggt gaccgactca 20 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> human TNF-alpha Primer Reverse <400> 26 cagactcggc aaagtcgaga ta 22 <210> 27 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> human TNF-alpha Probe <400> 27 ctgagatcaa tcggc 15

Claims (8)

delete delete A method for screening for a therapeutic agent for acute myeloid leukemia comprising the steps of:
(a) treating a candidate substance with NK (natural killer) cells;
(b) measuring the degree of IFN (Interferon) -γ expression after the candidate substance treatment; And
(c) selecting the candidate substance whose expression level of the IFN-y is increased compared to the control group not treated with the candidate substance. The method of claim 3,
Wherein said NK cells are cells derived from peripheral blood mononuclear cells or bone marrow-derived mononuclear cells. The method of claim 3,
The degree of expression in step (b) may be determined by immunoprecipitation, radioimmunoassay (RIA), enzyme immunoassay (ELISA), immunohistochemical analysis, RealTime-PCR, qRT-PCR, Western blot Western blotting, and flow cytometry (FACS). &Lt; Desc / Clms Page number 13 &gt; (a) collecting blood of a subject to be diagnosed and extracting mononuclear cells;
(b) measuring the expression level of LEC (lymphatic endothelial cells) marker in the mononuclear cells; And
(c) determining acute myelogenous leukemia if the level of expression of the LEC marker is increased relative to the level of expression of a normal control subject,
Wherein said LEC marker is selected from the group consisting of VEGFR (vascular endothelial growth factor receptor) -3, POD (podoplanin), PROX (prospero homeobox) -1 and LYVE (lymphatic vessel endothelial hyaluronan receptor) Way. delete The method according to claim 6,
Wherein the degree of expression in step (b) is measured by RealTime-PCR, qRT-PCR, or flow cytometry (FACS).

Images